version

Summary of OsREG480 (All List)

OrganismOryza sativa  
IDOsREG480  
SequenceATATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1491  

Entry Sequences (1491 entries)

LocusGene modelSequenceDescription
Os01g0101200006-040-D03GTCGCGCGCCCATATNONE 
006-068-A02GTCGCGCGCCCATATNONE 
AK104517GTCGCGCGCCCATATNONE 
AK104625GTCGCGCGCCCATATNONE 
AK104752GTCGCGCGCCCATATNONE 
AK119457GTCGCGCGCCCATAT2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. 
J013089L16GTCGCGCGCCCATATNONE 
J023103K24GTCGCGCGCCCATATNONE 
J075050A15GTCGCGCGCCCATATNONE 
Os01g0155600006-048-F03AAAGCCCATATNONE 
AK060171AAAGCCCATATNONE 
AK071635AAAGCCCATATSimilar to Splicing factor RSZ33. 
J023080A03AAAGCCCATATNONE 
J023100L15AAAGCCCATATNONE 
J033075I17AAAGCCCATATNONE 
J033085O09AAAGCCCATATNONE 
J033105E15AAAGCCCATATNONE 
J033132N10AAAGCCCATATNONE 
J033132P12AAAGCCCATATNONE 
J033149H12AAAGCCCATATNONE 
J043026M03AAAGCCCATATNONE 
J080305J10AAAGCCCATATNONE 
J080308K03AAAGCCCATATNONE 
J090023M04AAAGCCCATATNONE 
J090078F24AAAGCCCATATNONE 
J100066P05AAAGCCCATATNONE 
Os01g0166800AK073783ATATGGGCCGGAConserved hypothetical protein. 
AK099378ATATGGGCCGGANONE 
J033026H10ATATGGGCCGGANONE 
J033067O18ATATGGGCCGGANONE 
J033108A17ATATGGGCCGGANONE 
J065015J11ATATGGGCCGGANONE 
J065204P09ATATGGGCCGGANONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0270100006-096-H09ATATGGGCCACNONE 
009-009-C10ATATGGGCCACNONE 
009-054-E06ATATGGGCCACNONE 
014-085-F09ATATGGGCCACNONE 
AK073275ATATGGGCCACNONE 
AK104155ATATGGGCCACNONE 
AK119511ATATGGGCCACSimilar to Cysteine protease inhibitor. 
J033025K21ATATGGGCCACNONE 
J075065H10ATATGGGCCACNONE 
J075143G10ATATGGGCCACNONE 
J100059J02ATATGGGCCACNONE 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0331900013-026-D04ATATGGGCCTANONE 
AK064784ATATGGGCCTANONE 
AK121761ATATGGGCCTAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15ATATGGGCCTANONE 
J033090D07ATATGGGCCTANONE 
J090006L21ATATGGGCCTANONE 
Os01g0366300015-055-G07ATATGGGCNONE 
016-018-A10ATATGGGCNONE 
AK064115ATATGGGCSimilar to Receptor protein kinase. 
Os01g0514300AK121086ATATGGGCCGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530366J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0559000006-032-B11ATATGGGCNONE 
AK061456ATATGGGCProtein of unknown function DUF1000 family protein. 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0626300016-070-G04ATATGGGCTGGNONE 
AK122071ATATGGGCTGGSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04ATATGGGCTGGNONE 
J033117J08ATATGGGCTGGNONE 
J065007O12ATATGGGCTGGNONE 
J065020K12ATATGGGCTGGNONE 
J065142D24ATATGGGCTGGNONE 
J065157K19ATATGGGCTGGNONE 
J080307H19ATATGGGCTGGNONE 
J080311D16ATATGGGCTGGNONE 
J080316C12ATATGGGCTGGNONE 
J080316E03ATATGGGCTGGNONE 
J100033K16ATATGGGCTGGNONE 
J100042J21ATATGGGCTGGNONE 
J100051E06ATATGGGCTGGNONE 
J100071E22ATATGGGCTGGNONE 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0680500AK069325ATATGGGCTCGTTGGATConserved hypothetical protein. 
J090003P06ATATGGGCTCGTTGGATNONE 
Os01g0698300AK058744GCCCATATNONE 
J090068O06GCCCATATNONE 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0711100AK068087ATATGGGCPeptidase M16, C-terminal domain containing protein. 
Os01g0727400AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
AK121755CCAGCCCATATSimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013049F10CCAGCCCATATNONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J013088L10CCAGCCCATATNONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023020B21CCAGCCCATATNONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J023038M01CCAGCCCATATNONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033058H15CCAGCCCATATNONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033088C04CCAGCCCATATNONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033115N19CCAGCCCATATNONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J033131H04CCAGCCCATATNONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065067E05CCAGCCCATATNONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065085C07CCAGCCCATATNONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065095D12CCAGCCCATATNONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065124B19CCAGCCCATATNONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065181H07CCAGCCCATATNONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J065197B09CCAGCCCATATNONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075090K22CCAGCCCATATNONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075101P17CCAGCCCATATNONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075181F13CCAGCCCATATNONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J075190H19CCAGCCCATATNONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090004P17CCAGCCCATATNONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
J090066I03CCAGCCCATATNONE 
Os01g0784600AK067527TCGGCCCATATConserved hypothetical protein. 
Os01g0796001J080009E05ATATGGGCNONE 
J080020O16ATATGGGCNONE 
J080021P05ATATGGGCConserved hypothetical protein. 
J080022D16ATATGGGCNONE 
J080026A11ATATGGGCNONE 
J080040F20ATATGGGCNONE 
J080041F13ATATGGGCNONE 
J080050C15ATATGGGCNONE 
J080058J01ATATGGGCNONE 
J080062G22ATATGGGCNONE 
J080079L02ATATGGGCNONE 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0825800AK102220ATATGGGCAmino acid/polyamine transporter II family protein. 
Os01g0851000AK065338TTGGCCCATATPfkB domain containing protein. 
Os01g0861000AK058707CAAGCCCATATConserved hypothetical protein. 
Os01g0889800003-107-A06CAAGGCCCATATNONE 
005-016-H12CAAGGCCCATATNONE 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK104708CAAGGCCCATATNONE 
J013035D13CAAGGCCCATATNONE 
J013068K01CAAGGCCCATATNONE 
J023042J18CAAGGCCCATATNONE 
J053023F13CAAGGCCCATATNONE 
J053026M13CAAGGCCCATATNONE 
J053033N15CAAGGCCCATATNONE 
J053035I16CAAGGCCCATATNONE 
J053039A11CAAGGCCCATATNONE 
J053039K22CAAGGCCCATATNONE 
J053043B08CAAGGCCCATATNONE 
J053068K09CAAGGCCCATATNONE 
J053082D11CAAGGCCCATATNONE 
J053092N12CAAGGCCCATATNONE 
J053099A19CAAGGCCCATATNONE 
J065027F17CAAGGCCCATATNONE 
J065039B13CAAGGCCCATATNONE 
J065139N16CAAGGCCCATATNONE 
J065205B22CAAGGCCCATATNONE 
Os01g0895100AK058611ATATGGGCCTASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698ATATGGGCCTANONE 
AK099166ATATGGGCCTANONE 
J023065I03ATATGGGCCTANONE 
J023081J06ATATGGGCCTANONE 
J023126H17ATATGGGCCTANONE 
J023126O09ATATGGGCCTANONE 
J033035I06ATATGGGCCTANONE 
J090065C10ATATGGGCCTANONE 
J090095O16ATATGGGCCTANONE 
Os01g0910500003-113-F02GCCCATATNONE 
011-011-A03GCCCATATNONE 
013-058-C03GCCCATATNONE 
013-073-G01GCCCATATNONE 
014-010-E07GCCCATATNONE 
AK072044GCCCATATNONE 
AK099048GCCCATATConserved hypothetical protein. 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
AK066497ATATGGGCCTTNONE 
Os01g0960300AK100099TTGGCCCATATSimilar to Glucose inhibited division protein A. 
Os02g0119400AK060055GACGGCCCATATNONE 
AK102774GACGGCCCATATSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GACGGCCCATATNONE 
J075175F09GACGGCCCATATNONE 
J090011H05GACGGCCCATATNONE 
J090091O05GACGGCCCATATNONE 
Os02g0162500009-181-F03GCCCATATNONE 
AK058907GCCCATATNONE 
AK121223GCCCATATSimilar to 40S ribosomal protein S14. 
J023090I10GCCCATATNONE 
J023136J11GCCCATATNONE 
J053097J20GCCCATATNONE 
J053098F01GCCCATATNONE 
J065065B09GCCCATATNONE 
J065082M04GCCCATATNONE 
J065188O05GCCCATATNONE 
J075057P15GCCCATATNONE 
J075061J08GCCCATATNONE 
J075061N15GCCCATATNONE 
J075131I08GCCCATATNONE 
J075141H13GCCCATATNONE 
J080062E14GCCCATATNONE 
J080062P15GCCCATATNONE 
J080318G17GCCCATATNONE 
J080319G19GCCCATATNONE 
J090001L10GCCCATATNONE 
J090024I18GCCCATATNONE 
J090033F24GCCCATATNONE 
J090036M16GCCCATATNONE 
J090040I24GCCCATATNONE 
J090048P06GCCCATATNONE 
J090049B12GCCCATATNONE 
J090068C02GCCCATATNONE 
J090069O04GCCCATATNONE 
J090084H22GCCCATATNONE 
J100022L03GCCCATATNONE 
J100028O14GCCCATATNONE 
J100028O18GCCCATATNONE 
J100032A15GCCCATATNONE 
J100033D21GCCCATATNONE 
J100034J23GCCCATATNONE 
J100043K22GCCCATATNONE 
J100052M22GCCCATATNONE 
J100053N03GCCCATATNONE 
J100074N24GCCCATATNONE 
J100082J10GCCCATATNONE 
Os02g0188500AK102004TCAGGCCCATATNONE 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
J090039N13TCAGGCCCATATNONE 
Os02g0189100AK111066GAGGCCCATATConserved hypothetical protein. 
J053061N01GAGGCCCATATNONE 
J053088H13GAGGCCCATATNONE 
J065038F12GAGGCCCATATNONE 
J065083I18GAGGCCCATATNONE 
J065085A17GAGGCCCATATNONE 
J065110G06GAGGCCCATATNONE 
J065117J19GAGGCCCATATNONE 
J065120D21GAGGCCCATATNONE 
J065121C23GAGGCCCATATNONE 
J065174E03GAGGCCCATATNONE 
J075182G01GAGGCCCATATNONE 
J080302D10GAGGCCCATATNONE 
J080309F08GAGGCCCATATNONE 
J080310H15GAGGCCCATATNONE 
Os02g0439700AK067803CCAGCCCATATPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0496900AK059542ATATGGGCTGTConserved hypothetical protein. 
J053031E06ATATGGGCTGTNONE 
J065195E11ATATGGGCTGTNONE 
J090008P16ATATGGGCTGTNONE 
Os02g0549600009-119-C10ATATGGGCCCATCANONE 
AK066564ATATGGGCCCATCASimilar to 40S ribosomal protein S10-1. 
J013073I17ATATGGGCCCATCANONE 
J013104F19ATATGGGCCCATCANONE 
J013104K21ATATGGGCCCATCANONE 
J013110E05ATATGGGCCCATCANONE 
J023020L11ATATGGGCCCATCANONE 
J023130D08ATATGGGCCCATCANONE 
J033041D03ATATGGGCCCATCANONE 
J033105K14ATATGGGCCCATCANONE 
J065040N14ATATGGGCCCATCANONE 
J065157A09ATATGGGCCCATCANONE 
J075123A20ATATGGGCCCATCANONE 
J075129F06ATATGGGCCCATCANONE 
J075135E04ATATGGGCCCATCANONE 
J075173A10ATATGGGCCCATCANONE 
J080301E09ATATGGGCCCATCANONE 
J080306D10ATATGGGCCCATCANONE 
J080310M21ATATGGGCCCATCANONE 
J080312M09ATATGGGCCCATCANONE 
J080319J08ATATGGGCCCATCANONE 
J090036L14ATATGGGCCCATCANONE 
J090051D01ATATGGGCCCATCANONE 
J090066K07ATATGGGCCCATCANONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0595400AK069935CTGGCCCATATConserved hypothetical protein. 
AK099175CTGGCCCATATNONE 
AK103993CTGGCCCATATNONE 
J065021M23CTGGCCCATATNONE 
J065021M24CTGGCCCATATNONE 
J065205M09CTGGCCCATATNONE 
J100082C06CTGGCCCATATNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0682600AK108470ATATGGGCTZinc finger, Tim10/DDP-type family protein. 
J065019B06ATATGGGCTNONE 
J065065L01ATATGGGCTNONE 
Os02g0690600AK110831CCAGCCCATATU box domain containing protein. 
Os02g0700100AK102954TAGGCCCATATSimilar to WD-repeat protein. 
Os02g0740300AK067833TTCGGCCCATATAAA ATPase domain containing protein. 
Os02g0744100006-070-H12ATATGGGCTTTNONE 
006-115-C05ATATGGGCTTTNONE 
AK061274ATATGGGCTTTSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0753200AK067176TTGGCCCATATConserved hypothetical protein. 
AK067176TTGGCCCATATConserved hypothetical protein. 
J013097D23TTGGCCCATATNONE 
J013097D23TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J100032C19ATATGGGCCAACGGCCNONE 
Os02g0767900009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0780800J090080O19AAAGCCCATATNONE 
J090091I06AAAGCCCATATNONE 
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein. 
J075055J16ACCGGCCCATATNONE 
Os03g0117100005-014-F09TCAGGCCCATATNONE 
006-027-C07TCAGGCCCATATNONE 
006-036-G11TCAGGCCCATATNONE 
006-038-H10TCAGGCCCATATNONE 
006-044-D08TCAGGCCCATATNONE 
006-105-H12TCAGGCCCATATNONE 
009-190-G08TCAGGCCCATATNONE 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK104570TCAGGCCCATATNONE 
AK104706TCAGGCCCATATNONE 
J013055H24TCAGGCCCATATNONE 
J023044I05TCAGGCCCATATNONE 
J075111G05TCAGGCCCATATNONE 
J080002K23TCAGGCCCATATNONE 
J080002N12TCAGGCCCATATNONE 
J080004B01TCAGGCCCATATNONE 
J080007H19TCAGGCCCATATNONE 
J080008M18TCAGGCCCATATNONE 
J080011D18TCAGGCCCATATNONE 
J080012J01TCAGGCCCATATNONE 
J080018C19TCAGGCCCATATNONE 
J080022C20TCAGGCCCATATNONE 
J080022I05TCAGGCCCATATNONE 
J080022M12TCAGGCCCATATNONE 
J080023P03TCAGGCCCATATNONE 
J080025A05TCAGGCCCATATNONE 
J080029C02TCAGGCCCATATNONE 
J080036H08TCAGGCCCATATNONE 
J080039P12TCAGGCCCATATNONE 
J080040H05TCAGGCCCATATNONE 
J080045I23TCAGGCCCATATNONE 
J080057O04TCAGGCCCATATNONE 
J080059K18TCAGGCCCATATNONE 
J080061E04TCAGGCCCATATNONE 
J080062C20TCAGGCCCATATNONE 
J080062F10TCAGGCCCATATNONE 
J080062L05TCAGGCCCATATNONE 
J080068L06TCAGGCCCATATNONE 
J080069N09TCAGGCCCATATNONE 
J080071M14TCAGGCCCATATNONE 
J080072K17TCAGGCCCATATNONE 
J080080A09TCAGGCCCATATNONE 
J080086A18TCAGGCCCATATNONE 
J080088O14TCAGGCCCATATNONE 
J080089O04TCAGGCCCATATNONE 
J080092G21TCAGGCCCATATNONE 
J080094K09TCAGGCCCATATNONE 
Os03g0120300AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882TTTCGGCCCATATNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0137500006-040-G01GAAGCCCATATNONE 
015-054-G04GAAGCCCATATNONE 
AK060148GAAGCCCATATNONE 
AK073584GAAGCCCATATNONE 
AK100231GAAGCCCATATSimilar to VDAC3.1. 
J013146L24GAAGCCCATATNONE 
J023022O09GAAGCCCATATNONE 
J023049J19GAAGCCCATATNONE 
J023133L05GAAGCCCATATNONE 
J023143P12GAAGCCCATATNONE 
J033040B12GAAGCCCATATNONE 
J033050O14GAAGCCCATATNONE 
J033066G05GAAGCCCATATNONE 
J065007J18GAAGCCCATATNONE 
J100067H13GAAGCCCATATNONE 
Os03g0232500AK110980TAGGCCCATATGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TAGGCCCATATNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0239300AK066038ACAGCCCATATZinc finger, C2H2-type domain containing protein. 
AK068149ACAGCCCATATNONE 
AK071768ACAGCCCATATNONE 
J053027G22ACAGCCCATATNONE 
J075048G23ACAGCCCATATNONE 
J100060G19ACAGCCCATATNONE 
Os03g0249900AK058379ATATGGGCCACConserved hypothetical protein. 
Os03g0263500006-112-E09AGCCCATATNONE 
009-122-C01AGCCCATATNONE 
AK106060AGCCCATATSimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0279600006-070-A07CCAGCCCATATNONE 
AK061080CCAGCCCATATConserved hypothetical protein. 
AK071043CCAGCCCATATNONE 
AK103191CCAGCCCATATNONE 
J065077E22CCAGCCCATATNONE 
J065208F22CCAGCCCATATNONE 
J075156K12CCAGCCCATATNONE 
Os03g0287900009-074-B07ATATGGGCCTCNONE 
014-027-E07ATATGGGCCTCNONE 
AK063663ATATGGGCCTCSimilar to Protein disulfide isomerase. 
J065009N21ATATGGGCCTCNONE 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0328000AK059469ATATGGGCDedicator of cytokinesis family protein. 
J065084N01ATATGGGCNONE 
Os03g0336000AK100067GCAGCCCATATProtein prenyltransferase domain containing protein. 
J065161K02GCAGCCCATATNONE 
J065162C21GCAGCCCATATNONE 
Os03g0343900009-077-C03TCAGCCCATATNONE 
AK105813TCAGCCCATATPhotosystem II protein PsbX family protein. 
J100059N03TCAGCCCATATNONE 
J100079C20TCAGCCCATATNONE 
Os03g0425000006-112-D01ATATGGGCNONE 
AK064858ATATGGGCNONE 
AK109392ATATGGGCNONE 
AK120385ATATGGGCBacterial immunoglobulin/albumin-binding domain containing protein. 
J013000H13ATATGGGCNONE 
J013039M21ATATGGGCNONE 
J013045P07ATATGGGCNONE 
J013151C12ATATGGGCNONE 
J023079P15ATATGGGCNONE 
J065007E21ATATGGGCNONE 
J065106D17ATATGGGCNONE 
J065184D18ATATGGGCNONE 
J090078A22ATATGGGCNONE 
Os03g0579000AK061586CCAGGCCCATATNONE 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein. 
J065157L23ATATGGGCCGGTNONE 
J065166P22ATATGGGCCGGTNONE 
Os03g0746400AK063445TTGGCCCATATProtein prenyltransferase domain containing protein. 
AK070923TTGGCCCATATNONE 
J065008K24TTGGCCCATATNONE 
Os03g0788100AK109154GCCCATATSimilar to RING-H2 finger protein ATL1P (RING-H2 finger protein ATL3). 
Os03g0795800AK102207TCCGGCCCATATProtein of unknown function UPF0005 family protein. 
J023014M02TCCGGCCCATATNONE 
J023026E12TCCGGCCCATATNONE 
J023036I07TCCGGCCCATATNONE 
J023079M08TCCGGCCCATATNONE 
J023129D24TCCGGCCCATATNONE 
J033087H03TCCGGCCCATATNONE 
J033115G02TCCGGCCCATATNONE 
J033122G06TCCGGCCCATATNONE 
J033150J15TCCGGCCCATATNONE 
J065064L16TCCGGCCCATATNONE 
J065065H20TCCGGCCCATATNONE 
J065096I18TCCGGCCCATATNONE 
J065114A10TCCGGCCCATATNONE 
J065164G10TCCGGCCCATATNONE 
J065178L20TCCGGCCCATATNONE 
J075071D20TCCGGCCCATATNONE 
Os03g0795900012-092-G05ATATGGGCCGGANONE 
015-043-D09ATATGGGCCGGANONE 
016-078-G11ATATGGGCCGGANONE 
AK068660ATATGGGCCGGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14ATATGGGCCGGANONE 
J023001L04ATATGGGCCGGANONE 
J053032K11ATATGGGCCGGANONE 
J065059E10ATATGGGCCGGANONE 
J065095H19ATATGGGCCGGANONE 
J065181M06ATATGGGCCGGANONE 
J100047D11ATATGGGCCGGANONE 
J100068G04ATATGGGCCGGANONE 
Os03g0797000AK073440TCCGGCCCATATSimilar to Indole synthase. 
AK073440TCCGGCCCATATSimilar to Indole synthase. 
Os03g0797600006-034-B06ATATGGGCCTTNONE 
006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01ATATGGGCCTTNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08ATATGGGCCTTNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388ATATGGGCCTTNONE 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412ATATGGGCCTTNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0811800AK063320ATATGGGCCCCARibosomal protein L36 family protein. 
J065094F18ATATGGGCCCCANONE 
J090029B04ATATGGGCCCCANONE 
Os03g0822100AK101094GGGCCGGCCCATATSimilar to Transposase (Fragment). 
J033024N05GGGCCGGCCCATATNONE 
Os03g0822900AK099787ATATGGGCTGCZinc finger, BED-type predicted domain containing protein. 
J013042C24ATATGGGCTGCNONE 
J013096O21ATATGGGCTGCNONE 
J023109I23ATATGGGCTGCNONE 
J033106N09ATATGGGCTGCNONE 
J033107H03ATATGGGCTGCNONE 
J033118G03ATATGGGCTGCNONE 
J033145I24ATATGGGCTGCNONE 
J065138D15ATATGGGCTGCNONE 
J065140L13ATATGGGCTGCNONE 
J065179M13ATATGGGCTGCNONE 
J065200F05ATATGGGCTGCNONE 
J075104F20ATATGGGCTGCNONE 
J075143A15ATATGGGCTGCNONE 
J075197J11ATATGGGCTGCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCGGANONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os03g0854000009-186-C03GCAGCCCATATNONE 
AK061374GCAGCCCATATProtein of unknown function UPF0131 family protein. 
J065138B11GCAGCCCATATNONE 
Os04g0194500AK121164ATATGGGCSimilar to ABC transporter-like protein. 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033044C16ATATGGGCCCCACANONE 
J090023G03ATATGGGCCCCACANONE 
J090082C21ATATGGGCCCCACANONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0528100009-090-G06TCCGGCCCATATNONE 
009-168-C11TCCGGCCCATATNONE 
AK065957TCCGGCCCATATConserved hypothetical protein. 
J013039G20TCCGGCCCATATNONE 
J013044D08TCCGGCCCATATNONE 
J065013L14TCCGGCCCATATNONE 
J065143H08TCCGGCCCATATNONE 
J065146C14TCCGGCCCATATNONE 
J065149K22TCCGGCCCATATNONE 
J065156B18TCCGGCCCATATNONE 
J065201A04TCCGGCCCATATNONE 
J065209A04TCCGGCCCATATNONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0555900009-154-G03ATATGGGCTGANONE 
AK063168ATATGGGCTGAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11ATATGGGCTGANONE 
Os04g0577000AK073711CTGGCCCATATUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CTGGCCCATATNONE 
J013127H04CTGGCCCATATNONE 
J033035G06CTGGCCCATATNONE 
J033061G23CTGGCCCATATNONE 
J033127L07CTGGCCCATATNONE 
J065015F17CTGGCCCATATNONE 
J065062G08CTGGCCCATATNONE 
J065132M07CTGGCCCATATNONE 
J065155C12CTGGCCCATATNONE 
J075055I08CTGGCCCATATNONE 
J075140D07CTGGCCCATATNONE 
J090055B21CTGGCCCATATNONE 
J100031D23CTGGCCCATATNONE 
Os04g0581300009-171-H01ATATGGGCCTCNONE 
AK063093ATATGGGCCTCSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0670800AK073170TAGGCCCATATNONE 
Os04g0688500013-068-C11TCAGCCCATATNONE 
013-082-D10TCAGCCCATATNONE 
AK067667TCAGCCCATATPeroxidase (EC 1.11.1.7). 
J013044F01TCAGCCCATATNONE 
J013068J12TCAGCCCATATNONE 
J013075A19TCAGCCCATATNONE 
J013118D03TCAGCCCATATNONE 
J013126C19TCAGCCCATATNONE 
J013162J15TCAGCCCATATNONE 
J075110L20TCAGCCCATATNONE 
J075156K24TCAGCCCATATNONE 
Os05g0101400009-126-G06ATATGGGCCCCNONE 
AK067481ATATGGGCCCCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10ATATGGGCCCCNONE 
J065186D05ATATGGGCCCCNONE 
J065193A14ATATGGGCCCCNONE 
J075082A02ATATGGGCCCCNONE 
J075100F11ATATGGGCCCCNONE 
J075111O16ATATGGGCCCCNONE 
J075172I24ATATGGGCCCCNONE 
Os05g0110100009-015-D08TGCGGCCCATATNONE 
009-023-C09TGCGGCCCATATNONE 
009-031-B11TGCGGCCCATATNONE 
009-034-C02TGCGGCCCATATNONE 
009-050-B08TGCGGCCCATATNONE 
009-065-D12TGCGGCCCATATNONE 
009-090-G08TGCGGCCCATATNONE 
009-111-H07TGCGGCCCATATNONE 
009-136-F12TGCGGCCCATATNONE 
009-138-E06TGCGGCCCATATNONE 
009-138-G12TGCGGCCCATATNONE 
009-141-D08TGCGGCCCATATNONE 
009-143-D01TGCGGCCCATATNONE 
009-179-D09TGCGGCCCATATNONE 
009-179-E03TGCGGCCCATATNONE 
009-196-A09TGCGGCCCATATNONE 
009-199-F04TGCGGCCCATATNONE 
013-021-E05TGCGGCCCATATNONE 
013-076-C04TGCGGCCCATATNONE 
013-096-F06TGCGGCCCATATNONE 
014-071-A05TGCGGCCCATATNONE 
014-077-F09TGCGGCCCATATNONE 
AK099779TGCGGCCCATATNONE 
AK121142TGCGGCCCATATConserved hypothetical protein. 
J013095A16TGCGGCCCATATNONE 
J013111A17TGCGGCCCATATNONE 
J013132G04TGCGGCCCATATNONE 
J023077M04TGCGGCCCATATNONE 
J065001B11TGCGGCCCATATNONE 
J065001E11TGCGGCCCATATNONE 
J065057G10TGCGGCCCATATNONE 
J065057L08TGCGGCCCATATNONE 
J065080E07TGCGGCCCATATNONE 
J065087K10TGCGGCCCATATNONE 
J065091M15TGCGGCCCATATNONE 
J065167A15TGCGGCCCATATNONE 
J075018F02TGCGGCCCATATNONE 
J075063F20TGCGGCCCATATNONE 
J075064F18TGCGGCCCATATNONE 
J075066N19TGCGGCCCATATNONE 
J075073I02TGCGGCCCATATNONE 
J075080P17TGCGGCCCATATNONE 
J075081F11TGCGGCCCATATNONE 
J075085E03TGCGGCCCATATNONE 
J075101G18TGCGGCCCATATNONE 
J075149N08TGCGGCCCATATNONE 
J075158I21TGCGGCCCATATNONE 
J075161M20TGCGGCCCATATNONE 
J075190F12TGCGGCCCATATNONE 
J075194K16TGCGGCCCATATNONE 
J080001E08TGCGGCCCATATNONE 
J080001F21TGCGGCCCATATNONE 
J080001H19TGCGGCCCATATNONE 
J080001O15TGCGGCCCATATNONE 
J080005I22TGCGGCCCATATNONE 
J080006K23TGCGGCCCATATNONE 
J080014D20TGCGGCCCATATNONE 
J080014I05TGCGGCCCATATNONE 
J080014K21TGCGGCCCATATNONE 
J080017I24TGCGGCCCATATNONE 
J080017K11TGCGGCCCATATNONE 
J080018F11TGCGGCCCATATNONE 
J080022L18TGCGGCCCATATNONE 
J080024N23TGCGGCCCATATNONE 
J080027J23TGCGGCCCATATNONE 
J080029B14TGCGGCCCATATNONE 
J080032F14TGCGGCCCATATNONE 
J080032K19TGCGGCCCATATNONE 
J080032O21TGCGGCCCATATNONE 
J080033P17TGCGGCCCATATNONE 
J080034I06TGCGGCCCATATNONE 
J080039F24TGCGGCCCATATNONE 
J080040O13TGCGGCCCATATNONE 
J080042B02TGCGGCCCATATNONE 
J080043E12TGCGGCCCATATNONE 
J080043J15TGCGGCCCATATNONE 
J080043N09TGCGGCCCATATNONE 
J080052J08TGCGGCCCATATNONE 
J080053K01TGCGGCCCATATNONE 
J080053K19TGCGGCCCATATNONE 
J080055J09TGCGGCCCATATNONE 
J080058D07TGCGGCCCATATNONE 
J080062F11TGCGGCCCATATNONE 
J080063J24TGCGGCCCATATNONE 
J080066H04TGCGGCCCATATNONE 
J080066I09TGCGGCCCATATNONE 
J080067B02TGCGGCCCATATNONE 
J080067N09TGCGGCCCATATNONE 
J080068D22TGCGGCCCATATNONE 
J080068K13TGCGGCCCATATNONE 
J080069N19TGCGGCCCATATNONE 
J080070D07TGCGGCCCATATNONE 
J080070E05TGCGGCCCATATNONE 
J080071G04TGCGGCCCATATNONE 
J080077G05TGCGGCCCATATNONE 
J080077O06TGCGGCCCATATNONE 
J080085F05TGCGGCCCATATNONE 
J080086E07TGCGGCCCATATNONE 
J080089G16TGCGGCCCATATNONE 
J080092K15TGCGGCCCATATNONE 
J080094A08TGCGGCCCATATNONE 
J080097A09TGCGGCCCATATNONE 
J080097J07TGCGGCCCATATNONE 
J090027N01TGCGGCCCATATNONE 
J090081J05TGCGGCCCATATNONE 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0129900AK060436TAGGCCCATATTetratricopeptide-like helical domain containing protein. 
AK102515TAGGCCCATATNONE 
Os05g0148000AK066256GCCCATATNONE 
J013057C10GCCCATATNONE 
J065105L17GCCCATATNONE 
J065188E18GCCCATATNONE 
Os05g0198700Os05g0198700ATATGGGCCCTREX1 DNA Repair family protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0255600AK073067ATATGGGCTTAThioredoxin domain 2 containing protein. 
J033022A04ATATGGGCTTANONE 
J033022B03ATATGGGCTTANONE 
J033116F22ATATGGGCTTANONE 
J065017H13ATATGGGCTTANONE 
J065038G20ATATGGGCTTANONE 
J065076J16ATATGGGCTTANONE 
J065135D06ATATGGGCTTANONE 
J065168P22ATATGGGCTTANONE 
J065188G21ATATGGGCTTANONE 
J065207C14ATATGGGCTTANONE 
J080014C23ATATGGGCTTANONE 
J080018G12ATATGGGCTTANONE 
J080021F03ATATGGGCTTANONE 
J100068C14ATATGGGCTTANONE 
Os05g0417200AK071955AGCCCATATThioredoxin-like fold domain containing protein. 
Os05g0437800015-045-B10ATATGGGCCGAGNONE 
015-045-B10TACGGCCCATATNONE 
AK106328ATATGGGCCGAGConserved hypothetical protein. 
AK106328TACGGCCCATATConserved hypothetical protein. 
Os05g0443800AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0452600009-022-A05ATATGGGCNONE 
009-166-F05ATATGGGCNONE 
AK121541ATATGGGCSimilar to Ribosomal protein L33. 
J033031N19ATATGGGCNONE 
Os05g0467300006-113-H02AGCCCATATNONE 
AK061873AGCCCATATSelT/selW/selH selenoprotein family protein. 
AK098945AGCCCATATNONE 
J013050H09AGCCCATATNONE 
J023108B17AGCCCATATNONE 
J065189J01AGCCCATATNONE 
J075011H05AGCCCATATNONE 
J075019G20AGCCCATATNONE 
Os05g0500500AK110627ATATGGGCTTGHSP20-like chaperone domain containing protein. 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0533800Os05g0533800ATATGGGCTATPase, F0 complex, subunit G, mitochondrial family protein. 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0545500AK101095ATATGGGCTConserved hypothetical protein. 
AK119499ATATGGGCTNONE 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0552900AK102095TAGGCCCATATMAP65/ASE1 family protein. 
Os05g0553700006-100-D08TCAGGCCCATATNONE 
AK099747TCAGGCCCATATNONE 
AK101606TCAGGCCCATATNONE 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCAGGCCCATATNONE 
J090086G01TCAGGCCCATATNONE 
Os05g0565200004-015-E06ATATGGGCCAGNONE 
AK067090ATATGGGCCAGSimilar to Urease accessory protein G. 
AK104200ATATGGGCCAGNONE 
AK104368ATATGGGCCAGNONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0594800AK058332GGGCTTTTATATGGGCCATAdhesion regulating molecule family protein. 
AK068013GGGCTTTTATATGGGCCATNONE 
J013129L24GGGCTTTTATATGGGCCATNONE 
Os06g0104400011-027-A07ATATGGGCNONE 
013-010-H04ATATGGGCNONE 
013-053-G04ATATGGGCNONE 
013-079-E08ATATGGGCNONE 
014-093-A05ATATGGGCNONE 
015-007-E08ATATGGGCNONE 
015-038-C04ATATGGGCNONE 
015-077-H03ATATGGGCNONE 
016-019-B06ATATGGGCNONE 
016-094-F09ATATGGGCNONE 
AK060638ATATGGGCIQ calmodulin-binding region domain containing protein. 
AK103829ATATGGGCNONE 
J043001H14ATATGGGCNONE 
J053099G05ATATGGGCNONE 
J065085L08ATATGGGCNONE 
J065104P17ATATGGGCNONE 
J065121N22ATATGGGCNONE 
J065208O13ATATGGGCNONE 
J075030D04ATATGGGCNONE 
J075076C04ATATGGGCNONE 
J075087K02ATATGGGCNONE 
J090090D16ATATGGGCNONE 
Os06g0174700AK099635GCCCATATConserved hypothetical protein. 
Os06g0192500AK067746ATGGCCCATATATP-dependent helicase, DEAH-box family protein. 
J065023K06ATGGCCCATATNONE 
J100063P08ATGGCCCATATNONE 
J100065N03ATGGCCCATATNONE 
Os06g0194000006-041-H12CCAGCCCATATNONE 
006-077-B02CCAGCCCATATNONE 
013-029-A09CCAGCCCATATNONE 
AF190770CCAGCCCATATNONE 
AK060742CCAGCCCATATNONE 
AK069833CCAGCCCATATSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCAGCCCATATNONE 
J013060G01CCAGCCCATATNONE 
J013069I06CCAGCCCATATNONE 
J013134D15CCAGCCCATATNONE 
J013149A16CCAGCCCATATNONE 
J023031B06CCAGCCCATATNONE 
J023074E17CCAGCCCATATNONE 
J023091C14CCAGCCCATATNONE 
J023101P18CCAGCCCATATNONE 
J023106O14CCAGCCCATATNONE 
J023110J17CCAGCCCATATNONE 
J023110N02CCAGCCCATATNONE 
J023128D07CCAGCCCATATNONE 
J033024O19CCAGCCCATATNONE 
J033068G19CCAGCCCATATNONE 
J033095G01CCAGCCCATATNONE 
J033108C12CCAGCCCATATNONE 
J033114C23CCAGCCCATATNONE 
J043003E04CCAGCCCATATNONE 
J053023J03CCAGCCCATATNONE 
J053026B01CCAGCCCATATNONE 
J065172F15CCAGCCCATATNONE 
J075036K13CCAGCCCATATNONE 
J090020A10CCAGCCCATATNONE 
J090073E10CCAGCCCATATNONE 
J100034P18CCAGCCCATATNONE 
J100048O18CCAGCCCATATNONE 
J100064K09CCAGCCCATATNONE 
Os06g0275500AK111743TAGGCCCATATSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0298400AK066952GAAGCCCATATWW/Rsp5/WWP domain containing protein. 
J013090J20GAAGCCCATATNONE 
J033024J05GAAGCCCATATNONE 
J033033H19GAAGCCCATATNONE 
J033057J15GAAGCCCATATNONE 
J065047L24GAAGCCCATATNONE 
J065198L23GAAGCCCATATNONE 
J065218N03GAAGCCCATATNONE 
J090001F10GAAGCCCATATNONE 
J090025N24GAAGCCCATATNONE 
J090073E16GAAGCCCATATNONE 
Os06g0299100AK066533GCCCATATGlucose/ribitol dehydrogenase family protein. 
J013073H04GCCCATATNONE 
Os06g0487620J065091C11ATATGGGCNONE 
J065094G07ATATGGGCHypothetical protein. 
Os06g0556000011-042-F02AGCCCATATNONE 
012-064-G09AGCCCATATNONE 
015-076-A04AGCCCATATNONE 
AK058304AGCCCATATNONE 
AK102763AGCCCATATSimilar to Amino acid carrier (Fragment). 
J033107D14AGCCCATATNONE 
J090050O09AGCCCATATNONE 
J100048H19AGCCCATATNONE 
J100056H17AGCCCATATNONE 
J100064D16AGCCCATATNONE 
J100080A13AGCCCATATNONE 
J100090G17AGCCCATATNONE 
Os06g0573700015-015-F02CCAGGCCCATATNONE 
AK106254CCAGGCCCATATConserved hypothetical protein. 
J065172G24CCAGGCCCATATNONE 
Os06g0607800012-010-G03ATATGGGCCTANONE 
AB070254ATATGGGCCTANONE 
AK063158ATATGGGCCTASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695ATATGGGCCTANONE 
J013074G13ATATGGGCCTANONE 
J090015C16ATATGGGCCTANONE 
J090069H10ATATGGGCCTANONE 
Os06g0646600AB061818AGGGCCCATATKNOX family class 2 homeodomain protein. 
AB061818ATATGGGCCCATTAKNOX family class 2 homeodomain protein. 
J023088C09AGGGCCCATATNONE 
J023088C09ATATGGGCCCATTANONE 
J065162G03AGGGCCCATATNONE 
J065162G03ATATGGGCCCATTANONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os07g0122300015-004-G08ATATGGGCCGCANONE 
AK103212ATATGGGCCGCANONE 
AK119295ATATGGGCCGCAProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09ATATGGGCCGCANONE 
J090007P13ATATGGGCCGCANONE 
Os07g0124500012-092-F01ATGGCCCATATNONE 
AK070529ATGGCCCATATSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000ATGGCCCATATNONE 
J090007O11ATGGCCCATATNONE 
J090010E02ATGGCCCATATNONE 
J090078C04ATGGCCCATATNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0180900006-055-B11ATATGGGCCAANONE 
006-103-F09ATATGGGCCAANONE 
011-009-E03ATATGGGCCAANONE 
011-035-H08ATATGGGCCAANONE 
014-043-F08ATATGGGCCAANONE 
AK060711ATATGGGCCAARibosomal protein L4/L1e family protein. 
AK060963ATATGGGCCAANONE 
AK104447ATATGGGCCAANONE 
AK104504ATATGGGCCAANONE 
AK104629ATATGGGCCAANONE 
J023003P15ATATGGGCCAANONE 
J023075H14ATATGGGCCAANONE 
J033101N17ATATGGGCCAANONE 
J033132M11ATATGGGCCAANONE 
J065081C24ATATGGGCCAANONE 
J080004L10ATATGGGCCAANONE 
J080009H21ATATGGGCCAANONE 
J080013F01ATATGGGCCAANONE 
J080022K24ATATGGGCCAANONE 
J080023C22ATATGGGCCAANONE 
J080024M16ATATGGGCCAANONE 
J080026K06ATATGGGCCAANONE 
J080030J23ATATGGGCCAANONE 
J080030L05ATATGGGCCAANONE 
J080031G03ATATGGGCCAANONE 
J080033C03ATATGGGCCAANONE 
J080033D02ATATGGGCCAANONE 
J080035A11ATATGGGCCAANONE 
J080035A14ATATGGGCCAANONE 
J080039E08ATATGGGCCAANONE 
J080040L15ATATGGGCCAANONE 
J080040M03ATATGGGCCAANONE 
J080041L21ATATGGGCCAANONE 
J080043E09ATATGGGCCAANONE 
J080048B14ATATGGGCCAANONE 
J080048O09ATATGGGCCAANONE 
J080051H01ATATGGGCCAANONE 
J080052H06ATATGGGCCAANONE 
J080065K05ATATGGGCCAANONE 
J080066D10ATATGGGCCAANONE 
J080066E23ATATGGGCCAANONE 
J080069F10ATATGGGCCAANONE 
J080074M06ATATGGGCCAANONE 
J080075D13ATATGGGCCAANONE 
J080076G02ATATGGGCCAANONE 
J080082G15ATATGGGCCAANONE 
J080082K06ATATGGGCCAANONE 
J080082P12ATATGGGCCAANONE 
J080085F01ATATGGGCCAANONE 
J080090H22ATATGGGCCAANONE 
J080092D07ATATGGGCCAANONE 
J080094M03ATATGGGCCAANONE 
J080094O10ATATGGGCCAANONE 
J090008I06ATATGGGCCAANONE 
J100058N20ATATGGGCCAANONE 
J100060M07ATATGGGCCAANONE 
J100062M08ATATGGGCCAANONE 
J100064L07ATATGGGCCAANONE 
J100073H16ATATGGGCCAANONE 
J100074C10ATATGGGCCAANONE 
J100075N06ATATGGGCCAANONE 
J100087P11ATATGGGCCAANONE 
J100088B13ATATGGGCCAANONE 
J100088J16ATATGGGCCAANONE 
J100088L17ATATGGGCCAANONE 
J100088O12ATATGGGCCAANONE 
Os07g0185700012-040-A11GCCCGGCCCATATNONE 
AK070572GCCCGGCCCATATConserved hypothetical protein. 
J065116D10GCCCGGCCCATATNONE 
J065122F20GCCCGGCCCATATNONE 
Os07g0188700011-058-D09ATATGGGCCTANONE 
AK063957ATATGGGCCTANONE 
AK073755ATATGGGCCTASimilar to EXO. 
AK107609ATATGGGCCTANONE 
J033066N03ATATGGGCCTANONE 
Os07g0242600AK065752CCCAGCCCATATCyclin-like F-box domain containing protein. 
J013037K22CCCAGCCCATATNONE 
Os07g0415200006-105-B10ATATGGGCTNONE 
AK061243ATATGGGCTNONE 
AK101796ATATGGGCTRibosomal L23 and L15e, core domain containing protein. 
AK104106ATATGGGCTNONE 
J033066C05ATATGGGCTNONE 
J065188B11ATATGGGCTNONE 
J065211E07ATATGGGCTNONE 
J090003E03ATATGGGCTNONE 
Os07g0423000AK109714GCCGGCCCATATMitochodrial transcription termination factor-related family protein. 
J065007I23GCCGGCCCATATNONE 
Os07g0524000009-156-F11GCCCATATNONE 
AK063026GCCCATATConserved hypothetical protein. 
Os07g0564000AK069806TGCGGCCCATATConserved hypothetical protein. 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0625500AK064628ATATGGGCTGASimilar to Fimbriata-associated protein (Fragment). 
Os07g0673100AK060100GAGGCCCATATNONE 
AK103678GAGGCCCATATRibosomal protein S8E family protein. 
AK104794GAGGCCCATATNONE 
Os07g0680300009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0682700003-131-G11ATATGGGCCGCNONE 
016-086-E10ATATGGGCCGCNONE 
AK065098ATATGGGCCGCSimilar to Chitin-binding lectin 1 precursor (PL-I). 
AK103680ATATGGGCCGCNONE 
J013001M18ATATGGGCCGCNONE 
J033136D22ATATGGGCCGCNONE 
Os07g0688100AK101635ATATGGGCCGTAProtein prenyltransferase domain containing protein. 
AK101635ATATGGGCCGTCProtein prenyltransferase domain containing protein. 
J033055B02ATATGGGCCGTANONE 
J033055B02ATATGGGCCGTCNONE 
J090013O08ATATGGGCCGTANONE 
J090013O08ATATGGGCCGTCNONE 
J090074A17ATATGGGCCGTANONE 
J090074A17ATATGGGCCGTCNONE 
Os07g0691200AK060763ATATGGGCTGTNONE 
Os08g0110200AK068841GAGGCCCATATSimilar to Fertility restorer. 
J090071I18GAGGCCCATATNONE 
Os08g0112800009-113-D03GCCGGCCCATATNONE 
AK121176GCCGGCCCATATRickettsia 17 kDa surface antigen family protein. 
J023083C18GCCGGCCCATATNONE 
J033074M10GCCGGCCCATATNONE 
J033097G10GCCGGCCCATATNONE 
J065090F05GCCGGCCCATATNONE 
J090001J03GCCGGCCCATATNONE 
J090044F23GCCGGCCCATATNONE 
J090078H09GCCGGCCCATATNONE 
J100088G23GCCGGCCCATATNONE 
Os08g0130500AK062008ATATGGGCTGGNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0192900AK103422CAAGGCCCATATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CAAGGCCCATATNONE 
Os08g0323600AK067514ATATGGGCGlycoside hydrolase, starch-binding domain containing protein. 
AK121043ATATGGGCNONE 
Os08g0365900AK059023GCCCATATNONE 
Os08g0382400AK060624ATATGGGCNONE 
Os08g0469500AK109599ATATGGGCCAAConserved hypothetical protein. 
Os08g0474600J075102L06CCAGGCCCATATNONE 
J075103J21CCAGGCCCATATNONE 
Os08g0485700AK068131TCAGCCCATATNONE 
AK069097TCAGCCCATATMethyl-CpG binding domain containing protein. 
J013130L03TCAGCCCATATNONE 
Os08g0489300AK059000GAAGCCCATATNONE 
AK104597GAAGCCCATATDNA glycosylase family protein. 
J013160G13GAAGCCCATATNONE 
J100078P21GAAGCCCATATNONE 
Os08g0508600AK105183ATATGGGCConserved hypothetical protein. 
J013042E18ATATGGGCNONE 
J100024E17ATATGGGCNONE 
J100035M11ATATGGGCNONE 
Os08g0510500011-038-F01ATATGGGCTNONE 
AK070907ATATGGGCTENT domain containing protein. 
AK100370ATATGGGCTNONE 
J100078O11ATATGGGCTNONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
Os08g0554000AK111661TGCGGCCCATATWD-40 repeat containing protein. 
AK112044TGCGGCCCATATNONE 
J013039N12TGCGGCCCATATNONE 
J013134D02TGCGGCCCATATNONE 
J013153B06TGCGGCCCATATNONE 
J033044L16TGCGGCCCATATNONE 
J033073P14TGCGGCCCATATNONE 
Os08g0557400006-024-C02CCACGGCCCATATNONE 
AK060067CCACGGCCCATATProtein tyrosine phosphatase-like protein. 
AY224424CCACGGCCCATATNONE 
Os08g0563300009-007-B01ATATGGGCCCAANONE 
AK062315ATATGGGCCCAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04ATATGGGCCCAANONE 
Os09g0103300009-007-D10AAAAGCCCATATNONE 
AK062317AAAAGCCCATATHypothetical protein. 
Os09g0109600013-044-D05GCCCATATNONE 
AK063582GCCCATATConserved hypothetical protein. 
Os09g0324300AK109691TACGGCCCATATCyclin-like F-box domain containing protein. 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0363700AK103667ATATGGGCCTAConserved hypothetical protein. 
J075001L14ATATGGGCCTANONE 
J075049M23ATATGGGCCTANONE 
J075051I04ATATGGGCCTANONE 
J075073L04ATATGGGCCTANONE 
J075077E03ATATGGGCCTANONE 
J075083J11ATATGGGCCTANONE 
J075094J22ATATGGGCCTANONE 
J075112E08ATATGGGCCTANONE 
J075137J23ATATGGGCCTANONE 
J075192E02ATATGGGCCTANONE 
J100039K04ATATGGGCCTANONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0392400AK106799GCCCATATNONE 
Os09g0397900AK101306ATATGGGCTTASimilar to FEG protein. 
AK101306ATATGGGCTTASimilar to FEG protein. 
Os09g0439800AK068870ATATGGGCConserved hypothetical protein. 
Os09g0459800AK060764ATATGGGCCACNONE 
AK100324ATATGGGCCACSimilar to ARP protein. 
AK102736ATATGGGCCACNONE 
Os09g0477700AK121644ATATGGGCCGGTConserved hypothetical protein. 
Os09g0495200AK102989CACTGACATATGGGCCCTConserved hypothetical protein. 
J075062H18CACTGACATATGGGCCCTNONE 
J075098G06CACTGACATATGGGCCCTNONE 
Os09g0532600J013002F02ACAGCCCATATNONE 
Os09g0532800J065167K16GGTCCAGAGCCCATATProtein prenyltransferase domain containing protein. 
Os09g0538200009-076-A07CCAGGCCCATATNONE 
AB032061CCAGGCCCATATProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10CCAGGCCCATATNONE 
J075134I16CCAGGCCCATATNONE 
J100031G24CCAGGCCCATATNONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0542200006-092-A09ATATGGGCCAGANONE 
AK064887ATATGGGCCAGAThioredoxin fold domain containing protein. 
AK104804ATATGGGCCAGANONE 
J013000K12ATATGGGCCAGANONE 
J013170A19ATATGGGCCAGANONE 
J033103B02ATATGGGCCAGANONE 
J065196J20ATATGGGCCAGANONE 
J075037H17ATATGGGCCAGANONE 
J075069H14ATATGGGCCAGANONE 
J075071C16ATATGGGCCAGANONE 
J075095N02ATATGGGCCAGANONE 
J075136N03ATATGGGCCAGANONE 
J075192L16ATATGGGCCAGANONE 
J100057N23ATATGGGCCAGANONE 
J100060O07ATATGGGCCAGANONE 
J100062F10ATATGGGCCAGANONE 
J100077I08ATATGGGCCAGANONE 
J100086B07ATATGGGCCAGANONE 
J100088L14ATATGGGCCAGANONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os09g0569400AK063384ATATGGGCCTCBeta-lactamase-like domain containing protein. 
AK070608ATATGGGCCTCNONE 
Os11g0128400AK102291GAAGCCCATATCDC45-like protein family protein. 
J033089K18GAAGCCCATATNONE 
Os11g0130500J065119D16ATATGGGCCGTANONE 
J065119D16ATATGGGCTGANONE 
J065169E14ATATGGGCCGTACyclin-like F-box domain containing protein. 
J065169E14ATATGGGCTGACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TACGGCCCATATConserved hypothetical protein. 
AK066342TCAGCCCATATConserved hypothetical protein. 
J065192M10TACGGCCCATATNONE 
J065192M10TCAGCCCATATNONE 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0148600AK100066CAGGCCCATATConserved hypothetical protein. 
AK102442CAGGCCCATATNONE 
J065167F17CAGGCCCATATNONE 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0214400AK111039ATATGGGCPlant disease resistance response protein family protein. 
Os11g0249300AK060391ATATGGGCCGGCConserved hypothetical protein. 
Os11g0302700AK073931TGTGGGCCCATATRecA bacterial DNA recombination family protein. 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0549690J065085G07ATATGGGCCCTConserved hypothetical protein. 
J065218B08ATATGGGCCCTNONE 
J090036H16ATATGGGCCCTNONE 
Os11g0602600006-046-H02ATATGGGCCTTNONE 
006-056-H08ATATGGGCCTTNONE 
009-116-D05ATATGGGCCTTNONE 
AK072671ATATGGGCCTTSimilar to 40S ribosomal protein S9. 
AK104660ATATGGGCCTTNONE 
J023134P20ATATGGGCCTTNONE 
J023141O13ATATGGGCCTTNONE 
J033066I15ATATGGGCCTTNONE 
J033076A08ATATGGGCCTTNONE 
J033150J23ATATGGGCCTTNONE 
J065114P19ATATGGGCCTTNONE 
J065176B01ATATGGGCCTTNONE 
J065207H21ATATGGGCCTTNONE 
J080301L21ATATGGGCCTTNONE 
J080308A08ATATGGGCCTTNONE 
J080318K23ATATGGGCCTTNONE 
J080319F17ATATGGGCCTTNONE 
J080319I10ATATGGGCCTTNONE 
J090028C08ATATGGGCCTTNONE 
J090051I24ATATGGGCCTTNONE 
J090053L21ATATGGGCCTTNONE 
J090069C20ATATGGGCCTTNONE 
J100017G08ATATGGGCCTTNONE 
J100042B06ATATGGGCCTTNONE 
J100045G24ATATGGGCCTTNONE 
J100050J19ATATGGGCCTTNONE 
J100052D23ATATGGGCCTTNONE 
J100053M03ATATGGGCCTTNONE 
J100056D08ATATGGGCCTTNONE 
J100066B19ATATGGGCCTTNONE 
J100071N23ATATGGGCCTTNONE 
J100074H01ATATGGGCCTTNONE 
J100074H19ATATGGGCCTTNONE 
J100077C06ATATGGGCCTTNONE 
Os11g0616200AK069189ATATGGGCTConserved hypothetical protein. 
AK069189ATATGGGCTGCConserved hypothetical protein. 
AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
J023004N19ATATGGGCTNONE 
J023004N19ATATGGGCTGCNONE 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
Os11g0630900AK107482ATATGGGCTMATH domain containing protein. 
Os11g0641800AK066963ATATGGGCTTGGCupredoxin domain containing protein. 
J013023J11ATATGGGCTTGGNONE 
J013058D03ATATGGGCTTGGNONE 
J013093P21ATATGGGCTTGGNONE 
J013120G19ATATGGGCTTGGNONE 
Os12g0102100J013134H02AGGGCCCATATAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0120000011-024-E09AAAGCCCATATNONE 
AK105399AAAGCCCATATProtein of unknown function DUF936, plant family protein. 
Os12g0124400AK071024ATATGGGCCGAAExostosin-like family protein. 
Os12g0127500AK064595TACGGCCCATATConserved hypothetical protein. 
AK064595TCAGCCCATATConserved hypothetical protein. 
J065067F11TACGGCCCATATNONE 
J065067F11TCAGCCCATATNONE 
J090007D02TACGGCCCATATNONE 
J090007D02TCAGCCCATATNONE 
J100035G10TACGGCCCATATNONE 
J100035G10TCAGCCCATATNONE 
J100077J10TACGGCCCATATNONE 
J100077J10TCAGCCCATATNONE 
Os12g0182200AK099737GCCCATATSimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0508266J100079P21ATATGGGCHistone deacetylase superfamily protein. 
Os12g0552200015-064-H06ATATGGGCTNONE 
AK106375ATATGGGCTSimilar to Patatin-like protein 3. 
Os12g0564800AK103886ATATGGGCTTADisease resistance protein family protein. 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0596000AK073530ATATGGGCCGGGCSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ATATGGGCCGGGCNONE 
Os12g0601300AK068213GCCCATATSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J013094J22GCCCATATNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.