version

Summary of OsREG481 (All List)

OrganismOryza sativa  
IDOsREG481  
SequenceATCCAACG  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count1942  

Entry Sequences (1942 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952CCGTTGGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCGTTGGATNONE 
J013123J12CCGTTGGATNONE 
J033026O19CCGTTGGATNONE 
J033128C08CCGTTGGATNONE 
J065116M14CCGTTGGATNONE 
J090058F15CCGTTGGATNONE 
J090079F20CCGTTGGATNONE 
Os01g0141700AB082381CGTTGGATUV-damaged DNA binding protein 2. 
AK111907CGTTGGATNONE 
AK112097CGTTGGATNONE 
Os01g0172300AK106113CGTTGGATConserved hypothetical protein. 
Os01g0176500AK102552ATCCAACGGCConserved hypothetical protein. 
Os01g0184000015-008-B06ATCCAACGGNONE 
AK071130ATCCAACGGNUC156 family protein. 
AK100604ATCCAACGGNONE 
Os01g0190000Os01g0190000ATCCAACGTaurine catabolism dioxygenase TauD/TfdA family protein. 
Os01g0254800AK067017ATCCAACGConserved hypothetical protein. 
J013089L24ATCCAACGNONE 
Os01g0262700AK100901ATCCAACGGConserved hypothetical protein. 
AK119928ATCCAACGGNONE 
J033057O20ATCCAACGGNONE 
J065093J01ATCCAACGGNONE 
J075164F23ATCCAACGGNONE 
J100025E08ATCCAACGGNONE 
J100029L03ATCCAACGGNONE 
J100079F02ATCCAACGGNONE 
Os01g0309900AK100627CCGTTGGATLipase, class 3 family protein. 
Os01g0315800AB167396ATCCAACGNONE 
AK101168ATCCAACGUDP-glucuronic acid decarboxylase (EC 4.1.1.35). 
J013075K16ATCCAACGNONE 
J013096B22ATCCAACGNONE 
J033028I19ATCCAACGNONE 
J033042O14ATCCAACGNONE 
J065137I23ATCCAACGNONE 
J065163K17ATCCAACGNONE 
J100028N19ATCCAACGNONE 
J100051G09ATCCAACGNONE 
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein. 
J075175N03ATCCAACGGCCGAGANONE 
Os01g0328400006-092-H09ATCCAACGGCNONE 
009-085-A02ATCCAACGGCNONE 
012-078-B03ATCCAACGGCNONE 
AK061988ATCCAACGGCUbiquitin. 
J013073B13ATCCAACGGCNONE 
J023135L09ATCCAACGGCNONE 
J023135O07ATCCAACGGCNONE 
J033027B12ATCCAACGGCNONE 
J033084P17ATCCAACGGCNONE 
J065010M05ATCCAACGGCNONE 
J065021N11ATCCAACGGCNONE 
J065021N12ATCCAACGGCNONE 
J065031K11ATCCAACGGCNONE 
J065072P04ATCCAACGGCNONE 
J065098D05ATCCAACGGCNONE 
J065122N23ATCCAACGGCNONE 
J065129L13ATCCAACGGCNONE 
J065135N13ATCCAACGGCNONE 
J065215N10ATCCAACGGCNONE 
J075120N22ATCCAACGGCNONE 
J090011G23ATCCAACGGCNONE 
J090014F06ATCCAACGGCNONE 
J090040G23ATCCAACGGCNONE 
J090075I20ATCCAACGGCNONE 
J090075N01ATCCAACGGCNONE 
J090089B04ATCCAACGGCNONE 
J090090F08ATCCAACGGCNONE 
J090091M17ATCCAACGGCNONE 
J090094L03ATCCAACGGCNONE 
J090099L06ATCCAACGGCNONE 
J100018A18ATCCAACGGCNONE 
J100027H13ATCCAACGGCNONE 
J100069C05ATCCAACGGCNONE 
J100086L10ATCCAACGGCNONE 
Os01g0349400AK064941ATCCAACGGCCNONE 
AK100195ATCCAACGGCCNONE 
AK105047ATCCAACGGCCNONE 
AK122182ATCCAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment). 
Os01g0506100AK102377ATCCAACGGGlobin-like family protein. 
AK109825ATCCAACGGNONE 
Os01g0578000AK060971ATCCAACGRecA bacterial DNA recombination family protein. 
AK060971ATCCAACGGTCRecA bacterial DNA recombination family protein. 
AK068701ATCCAACGNONE 
AK068701ATCCAACGGTCNONE 
J090025J16ATCCAACGNONE 
J090025J16ATCCAACGGTCNONE 
Os01g0680500AK069325ATATGGGCTCGTTGGATConserved hypothetical protein. 
J090003P06ATATGGGCTCGTTGGATNONE 
Os01g0710800013-097-E05AGCCGTTGGATNONE 
AK069973AGCCGTTGGATNONE 
AK071099AGCCGTTGGATConserved hypothetical protein. 
J023081K01AGCCGTTGGATNONE 
J023123E16AGCCGTTGGATNONE 
J033066B11AGCCGTTGGATNONE 
J065144G11AGCCGTTGGATNONE 
Os01g0714800AK108555ATCCAACGWRKY transcription factor 26. 
AY870609ATCCAACGNONE 
Os01g0757700AK102734ATCCAACGConserved hypothetical protein. 
J033106B06ATCCAACGNONE 
J065025B07ATCCAACGNONE 
J065025B08ATCCAACGNONE 
J065033E12ATCCAACGNONE 
J065197B01ATCCAACGNONE 
Os01g0766600AK061986ATCCAACGGNONE 
AK103570ATCCAACGGBSD domain containing protein. 
Os01g0801700AK073813ATCCAACGGConserved hypothetical protein. 
AK073813CGTTGGATConserved hypothetical protein. 
J033067K14ATCCAACGGNONE 
J033067K14CGTTGGATNONE 
Os01g0806300AK111352CCGTTGGATConserved hypothetical protein. 
Os01g0836800006-021-C09ATCCAACGNONE 
006-021-C09ATCCAACGGNONE 
006-091-F04ATCCAACGNONE 
006-091-F04ATCCAACGGNONE 
014-013-D08ATCCAACGNONE 
014-013-D08ATCCAACGGNONE 
015-018-F10ATCCAACGNONE 
015-018-F10ATCCAACGGNONE 
015-058-H03ATCCAACGNONE 
015-058-H03ATCCAACGGNONE 
AK061720ATCCAACGNONE 
AK061720ATCCAACGGNONE 
AK066629ATCCAACGLung seven transmembrane receptor family protein. 
AK066629ATCCAACGGLung seven transmembrane receptor family protein. 
AK098958ATCCAACGNONE 
AK098958ATCCAACGGNONE 
AK106145ATCCAACGNONE 
AK106145ATCCAACGGNONE 
AK119783ATCCAACGNONE 
AK119783ATCCAACGGNONE 
J013063N02ATCCAACGNONE 
J013063N02ATCCAACGGNONE 
J013071A10ATCCAACGNONE 
J013071A10ATCCAACGGNONE 
J013124C08ATCCAACGNONE 
J013124C08ATCCAACGGNONE 
J023055J07ATCCAACGNONE 
J023055J07ATCCAACGGNONE 
J023081H15ATCCAACGNONE 
J023081H15ATCCAACGGNONE 
J023082D01ATCCAACGNONE 
J023082D01ATCCAACGGNONE 
J023091F07ATCCAACGNONE 
J023091F07ATCCAACGGNONE 
J023091L13ATCCAACGNONE 
J023091L13ATCCAACGGNONE 
J023104G05ATCCAACGNONE 
J023104G05ATCCAACGGNONE 
J023110M16ATCCAACGNONE 
J023110M16ATCCAACGGNONE 
J023120F18ATCCAACGNONE 
J023120F18ATCCAACGGNONE 
J023128O11ATCCAACGNONE 
J023128O11ATCCAACGGNONE 
J023140B11ATCCAACGNONE 
J023140B11ATCCAACGGNONE 
J033023B15ATCCAACGNONE 
J033023B15ATCCAACGGNONE 
J033025E14ATCCAACGNONE 
J033025E14ATCCAACGGNONE 
J033027J21ATCCAACGNONE 
J033027J21ATCCAACGGNONE 
J033041F19ATCCAACGNONE 
J033041F19ATCCAACGGNONE 
J033044L10ATCCAACGNONE 
J033044L10ATCCAACGGNONE 
J033052M08ATCCAACGNONE 
J033052M08ATCCAACGGNONE 
J033084P07ATCCAACGNONE 
J033084P07ATCCAACGGNONE 
J033086P11ATCCAACGNONE 
J033086P11ATCCAACGGNONE 
J033090I20ATCCAACGNONE 
J033090I20ATCCAACGGNONE 
J033093D17ATCCAACGNONE 
J033093D17ATCCAACGGNONE 
J033099C04ATCCAACGNONE 
J033099C04ATCCAACGGNONE 
J033108M19ATCCAACGNONE 
J033108M19ATCCAACGGNONE 
J033124O20ATCCAACGNONE 
J033124O20ATCCAACGGNONE 
J033145D24ATCCAACGNONE 
J033145D24ATCCAACGGNONE 
J033145O09ATCCAACGNONE 
J033145O09ATCCAACGGNONE 
J043016F03ATCCAACGNONE 
J043016F03ATCCAACGGNONE 
J043037C06ATCCAACGNONE 
J043037C06ATCCAACGGNONE 
J053095L22ATCCAACGNONE 
J053095L22ATCCAACGGNONE 
J053100E09ATCCAACGNONE 
J053100E09ATCCAACGGNONE 
J065023G19ATCCAACGNONE 
J065023G19ATCCAACGGNONE 
J065197D03ATCCAACGNONE 
J065197D03ATCCAACGGNONE 
J090003E23ATCCAACGNONE 
J090003E23ATCCAACGGNONE 
J090012P18ATCCAACGNONE 
J090012P18ATCCAACGGNONE 
J090019E14ATCCAACGNONE 
J090019E14ATCCAACGGNONE 
J090021B01ATCCAACGNONE 
J090021B01ATCCAACGGNONE 
J090022J10ATCCAACGNONE 
J090022J10ATCCAACGGNONE 
J090045L06ATCCAACGNONE 
J090045L06ATCCAACGGNONE 
J090050J02ATCCAACGNONE 
J090050J02ATCCAACGGNONE 
J090065F15ATCCAACGNONE 
J090065F15ATCCAACGGNONE 
J100018A06ATCCAACGNONE 
J100018A06ATCCAACGGNONE 
J100022K07ATCCAACGNONE 
J100022K07ATCCAACGGNONE 
J100036H01ATCCAACGNONE 
J100036H01ATCCAACGGNONE 
J100044I09ATCCAACGNONE 
J100044I09ATCCAACGGNONE 
J100057M17ATCCAACGNONE 
J100057M17ATCCAACGGNONE 
J100058O04ATCCAACGNONE 
J100058O04ATCCAACGGNONE 
J100079C21ATCCAACGNONE 
J100079C21ATCCAACGGNONE 
J100079G13ATCCAACGNONE 
J100079G13ATCCAACGGNONE 
Os01g0840100006-095-C03ATCCAACGNONE 
011-075-F07ATCCAACGNONE 
012-010-A08ATCCAACGNONE 
012-035-A09ATCCAACGNONE 
014-010-B01ATCCAACGNONE 
014-011-H07ATCCAACGNONE 
014-040-F03ATCCAACGNONE 
014-077-C11ATCCAACGNONE 
014-078-C11ATCCAACGNONE 
014-097-A10ATCCAACGNONE 
014-097-D02ATCCAACGNONE 
014-100-D02ATCCAACGNONE 
015-012-H01ATCCAACGNONE 
015-049-G07ATCCAACGNONE 
015-066-C09ATCCAACGNONE 
016-033-C09ATCCAACGHeat shock protein Hsp70 family protein. 
016-084-F08ATCCAACGNONE 
J023037O13ATCCAACGNONE 
J033116B07ATCCAACGNONE 
J033121N13ATCCAACGNONE 
J065057F16ATCCAACGNONE 
J065112D05ATCCAACGNONE 
J065157G17ATCCAACGNONE 
J090014O03ATCCAACGNONE 
J090015K13ATCCAACGNONE 
J090021I21ATCCAACGNONE 
J090048D02ATCCAACGNONE 
J090054D14ATCCAACGNONE 
J090060J03ATCCAACGNONE 
J090063G01ATCCAACGNONE 
J090063H04ATCCAACGNONE 
J090063L13ATCCAACGNONE 
J090074E03ATCCAACGNONE 
J090096A03ATCCAACGNONE 
J090096I11ATCCAACGNONE 
J090099E16ATCCAACGNONE 
J100050G20ATCCAACGNONE 
Os01g0866200009-039-E12ATCCAACGGTCNONE 
J065059P16ATCCAACGGTCNONE 
J065063E21ATCCAACGGTCNONE 
J065078B21ATCCAACGGTCNONE 
J065079A11ATCCAACGGTCNONE 
J065087H15ATCCAACGGTCNONE 
J065137M10ATCCAACGGTCNONE 
J065138K24ATCCAACGGTCNONE 
J065142E08ATCCAACGGTCNONE 
J065171G11ATCCAACGGTCNONE 
J065183K15ATCCAACGGTCNONE 
J065192J05ATCCAACGGTCNONE 
J075151P09ATCCAACGGTCNONE 
J090020B17ATCCAACGGTCNONE 
J090067F15ATCCAACGGTCNONE 
J090070K06ATCCAACGGTCNONE 
J090094G13ATCCAACGGTCNONE 
J100081M20ATCCAACGGTCHistone H3. 
J100089D06ATCCAACGGTCNONE 
Os01g0866300006-087-C06ATCCAACGGTCNONE 
006-114-E01ATCCAACGGTCNONE 
J065202L13ATCCAACGGTCNONE 
Os01g0872000AK102239ATCCAACGGTGF-beta receptor, type I/II extracellular region family protein. 
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE 
AK072409CATCCCCCATCCAACGGCNONE 
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CATCCCCCATCCAACGGCNONE 
AY288943CATCCCCCATCCAACGGCNONE 
AY318757CATCCCCCATCCAACGGCNONE 
J013021C23CATCCCCCATCCAACGGCNONE 
J013027H03CATCCCCCATCCAACGGCNONE 
J013032C02CATCCCCCATCCAACGGCNONE 
J013068G13CATCCCCCATCCAACGGCNONE 
J013070K16CATCCCCCATCCAACGGCNONE 
J013070L02CATCCCCCATCCAACGGCNONE 
J013091E15CATCCCCCATCCAACGGCNONE 
J013109D04CATCCCCCATCCAACGGCNONE 
J013118B04CATCCCCCATCCAACGGCNONE 
J013129E08CATCCCCCATCCAACGGCNONE 
J013134I15CATCCCCCATCCAACGGCNONE 
J013146N16CATCCCCCATCCAACGGCNONE 
J023083F05CATCCCCCATCCAACGGCNONE 
J023107E17CATCCCCCATCCAACGGCNONE 
J023113D21CATCCCCCATCCAACGGCNONE 
J023123A22CATCCCCCATCCAACGGCNONE 
J023133I24CATCCCCCATCCAACGGCNONE 
J023134L21CATCCCCCATCCAACGGCNONE 
J023142N24CATCCCCCATCCAACGGCNONE 
J033051B12CATCCCCCATCCAACGGCNONE 
J033058B04CATCCCCCATCCAACGGCNONE 
J033068E24CATCCCCCATCCAACGGCNONE 
J033076D01CATCCCCCATCCAACGGCNONE 
J033088O06CATCCCCCATCCAACGGCNONE 
J033093K15CATCCCCCATCCAACGGCNONE 
J033101G18CATCCCCCATCCAACGGCNONE 
J033130A01CATCCCCCATCCAACGGCNONE 
J043027I17CATCCCCCATCCAACGGCNONE 
J043027L17CATCCCCCATCCAACGGCNONE 
J090001N13CATCCCCCATCCAACGGCNONE 
J090004L10CATCCCCCATCCAACGGCNONE 
J090027D08CATCCCCCATCCAACGGCNONE 
J090027H18CATCCCCCATCCAACGGCNONE 
J090031F16CATCCCCCATCCAACGGCNONE 
J090048L18CATCCCCCATCCAACGGCNONE 
J090050N08CATCCCCCATCCAACGGCNONE 
J090051G05CATCCCCCATCCAACGGCNONE 
J090063G03CATCCCCCATCCAACGGCNONE 
J090068P21CATCCCCCATCCAACGGCNONE 
J090072P21CATCCCCCATCCAACGGCNONE 
J090079A14CATCCCCCATCCAACGGCNONE 
J090086I20CATCCCCCATCCAACGGCNONE 
J090087D19CATCCCCCATCCAACGGCNONE 
J090099B06CATCCCCCATCCAACGGCNONE 
J100047J19CATCCCCCATCCAACGGCNONE 
J100058I06CATCCCCCATCCAACGGCNONE 
Os01g0902300Os01g0902300ATCCAACGEsterase/lipase/thioesterase domain containing protein. 
Os01g0917100AK107234ATCCAACGGCTConserved hypothetical protein. 
Os01g0933900006-115-F10CGTTGGATNONE 
009-130-C11CGTTGGATNONE 
009-183-F07CGTTGGATNONE 
009-196-F08CGTTGGATNONE 
012-078-H05CGTTGGATNONE 
015-004-D01CGTTGGATNONE 
015-083-F05CGTTGGATNONE 
AF309383CGTTGGATSimilar to Glutathione transferase III(B) (EC 2.5.1.18). 
AK059985CGTTGGATNONE 
AK103927CGTTGGATNONE 
J065026P12CGTTGGATNONE 
J065041M20CGTTGGATNONE 
J065043H06CGTTGGATNONE 
J065049E19CGTTGGATNONE 
J065097D10CGTTGGATNONE 
J065143I07CGTTGGATNONE 
J065152F10CGTTGGATNONE 
J065163F22CGTTGGATNONE 
J065166O17CGTTGGATNONE 
J065188B21CGTTGGATNONE 
J065197D18CGTTGGATNONE 
J065198E06CGTTGGATNONE 
J065199D17CGTTGGATNONE 
J065212I10CGTTGGATNONE 
J075001L04CGTTGGATNONE 
J090051G02CGTTGGATNONE 
J090074K01CGTTGGATNONE 
Os01g0951500J065043B20ATCCAACGCytochrome P450 family protein. 
Os01g0952700AK103457CCGTTGGATMetallo-dependent hydrolase, composite domain containing protein. 
Os01g0963600006-037-F11CGTTGGATNONE 
006-049-E01CGTTGGATNONE 
006-115-A02CGTTGGATNONE 
AK060804CGTTGGATABA/WDS induced protein family protein. 
AK065858CGTTGGATNONE 
AK104613CGTTGGATNONE 
J013041E22CGTTGGATNONE 
Os01g0972300009-034-G05GTCGGATCCAACGGNONE 
AK062432GTCGGATCCAACGGDVL family protein. 
Os01g0973500AK069546ATCCAACGGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os02g0100200AK121311ATCCAACGGCTSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0124800AK058547ATCCAACGHypothetical protein. 
Os02g0148600AK059287GGCCGTTGGATConserved hypothetical protein. 
Os02g0205400AK101434ATCCAACGGCCWD40-like domain containing protein. 
J043024M20ATCCAACGGCCNONE 
Os02g0209900Os02g0209900CGTTGGATSyntaxin/epimorphin family protein. 
Os02g0220600AK061944ATCCAACGGElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCCAACGGNONE 
D89802ATCCAACGGNONE 
J013042L22ATCCAACGGNONE 
J013056A14ATCCAACGGNONE 
J013120G13ATCCAACGGNONE 
J013155K19ATCCAACGGNONE 
J023002B10ATCCAACGGNONE 
J023080J19ATCCAACGGNONE 
J023081C08ATCCAACGGNONE 
J023090H05ATCCAACGGNONE 
J023091M07ATCCAACGGNONE 
J023115F09ATCCAACGGNONE 
J033025I23ATCCAACGGNONE 
J033026G12ATCCAACGGNONE 
J033035E15ATCCAACGGNONE 
J033040N13ATCCAACGGNONE 
J033046C17ATCCAACGGNONE 
J033069F02ATCCAACGGNONE 
J033071B16ATCCAACGGNONE 
J033071N22ATCCAACGGNONE 
J033088J02ATCCAACGGNONE 
J033092N24ATCCAACGGNONE 
J033093I09ATCCAACGGNONE 
J033126G06ATCCAACGGNONE 
J043003G15ATCCAACGGNONE 
J043010M11ATCCAACGGNONE 
J043024O20ATCCAACGGNONE 
J065092N03ATCCAACGGNONE 
J080004D17ATCCAACGGNONE 
J080010L09ATCCAACGGNONE 
J080021I11ATCCAACGGNONE 
J080022L01ATCCAACGGNONE 
J080029B01ATCCAACGGNONE 
J080032D11ATCCAACGGNONE 
J080039B11ATCCAACGGNONE 
J080040K17ATCCAACGGNONE 
J080041B21ATCCAACGGNONE 
J080052L24ATCCAACGGNONE 
J080054M12ATCCAACGGNONE 
J080057B15ATCCAACGGNONE 
J080078G15ATCCAACGGNONE 
J080078H06ATCCAACGGNONE 
J080079M03ATCCAACGGNONE 
J080088H16ATCCAACGGNONE 
J080093C11ATCCAACGGNONE 
J080095K09ATCCAACGGNONE 
J080095O20ATCCAACGGNONE 
J090009J19ATCCAACGGNONE 
J090040D04ATCCAACGGNONE 
J090052E14ATCCAACGGNONE 
J090063B14ATCCAACGGNONE 
J090071K04ATCCAACGGNONE 
J090075E12ATCCAACGGNONE 
J090087A06ATCCAACGGNONE 
J090094P03ATCCAACGGNONE 
J090098M14ATCCAACGGNONE 
Os02g0227400AK103143CGATGGGCATCCAACGNONE 
AY785765CGATGGGCATCCAACGPoly(A) polymerase, central region domain containing protein. 
Os02g0244700AF271995ATCCAACGNONE 
AK065029ATCCAACGNONE 
AK065425ATCCAACGSimilar to Phosphoenolpyruvate carboxylase 1 (EC 4.1.1.31) (PEPCase 1) (CP21). 
AK106451ATCCAACGNONE 
J013001G17ATCCAACGNONE 
J013023G02ATCCAACGNONE 
J013060F19ATCCAACGNONE 
J013088B14ATCCAACGNONE 
J013127H11ATCCAACGNONE 
J013132M14ATCCAACGNONE 
J013154N11ATCCAACGNONE 
J023001E17ATCCAACGNONE 
J023013K14ATCCAACGNONE 
J023038J15ATCCAACGNONE 
J023066I08ATCCAACGNONE 
J023078P20ATCCAACGNONE 
J023081I07ATCCAACGNONE 
J023087B20ATCCAACGNONE 
J023091H04ATCCAACGNONE 
J023098I04ATCCAACGNONE 
J023099G02ATCCAACGNONE 
J023101L06ATCCAACGNONE 
J023103M09ATCCAACGNONE 
J023106N02ATCCAACGNONE 
J023110H22ATCCAACGNONE 
J023113F09ATCCAACGNONE 
J023119P13ATCCAACGNONE 
J023120K17ATCCAACGNONE 
J023130C22ATCCAACGNONE 
J023134I23ATCCAACGNONE 
J033041O13ATCCAACGNONE 
J033076G10ATCCAACGNONE 
J033093G06ATCCAACGNONE 
J033098K17ATCCAACGNONE 
J033123I11ATCCAACGNONE 
J033138G06ATCCAACGNONE 
J033150A18ATCCAACGNONE 
J033150F08ATCCAACGNONE 
J043016N16ATCCAACGNONE 
J043036G23ATCCAACGNONE 
J090012G21ATCCAACGNONE 
J100019K02ATCCAACGNONE 
Os02g0281000J013060F14CGTTGGATNONE 
J013158A09CGTTGGATNONE 
J090099G01CGTTGGATNONE 
Os02g0282100AK058480ATCCAACGConserved hypothetical protein. 
J065102L06ATCCAACGNONE 
J065152P10ATCCAACGNONE 
J100043L06ATCCAACGNONE 
J100044G06ATCCAACGNONE 
J100052L20ATCCAACGNONE 
Os02g0467400AK072333AGCCGTTGGATConserved hypothetical protein. 
AK073879AGCCGTTGGATNONE 
AK121931AGCCGTTGGATNONE 
J065085B12AGCCGTTGGATNONE 
Os02g0478050J065163G01ATCCAACGConserved hypothetical protein. 
J065206E19ATCCAACGNONE 
J090046D24ATCCAACGNONE 
J090061F20ATCCAACGNONE 
Os02g0556700AK073875ATCCAACGGCCT-complex 11 family protein. 
Os02g0586400006-066-D08CGCACCGCACCGTTGGATNONE 
006-073-A01CGCACCGCACCGTTGGATNONE 
J065088B17CGCACCGCACCGTTGGATNONE 
J075065L07CGCACCGCACCGTTGGATNONE 
J100017B20CGCACCGCACCGTTGGATNONE 
J100025B03CGCACCGCACCGTTGGATNONE 
Os02g0602500015-078-E08CCGTTGGATNONE 
AK064340CCGTTGGATNONE 
AK073602CCGTTGGATIsy1-like splicing family protein. 
J033052I23CCGTTGGATNONE 
J065060C10CCGTTGGATNONE 
J065192K14CCGTTGGATNONE 
J100076I15CCGTTGGATNONE 
Os02g0611400AK101310AGCCGTTGGATProtein prenyltransferase domain containing protein. 
J033024H21AGCCGTTGGATNONE 
J033033O21AGCCGTTGGATNONE 
J065134H24AGCCGTTGGATNONE 
J090087E02AGCCGTTGGATNONE 
Os02g0659600J065119F20ATCCAACGGNONE 
J065181I02ATCCAACGGConserved hypothetical protein. 
J090092M04ATCCAACGGNONE 
Os02g0744900AK061968ATCCAACGGCTSimilar to Geranylgeranyl reductase (Fragment). 
AK098873ATCCAACGGCTNONE 
J013001C18ATCCAACGGCTNONE 
J080003D07ATCCAACGGCTNONE 
J080003H24ATCCAACGGCTNONE 
J080010C23ATCCAACGGCTNONE 
J080011I04ATCCAACGGCTNONE 
J080011O03ATCCAACGGCTNONE 
J080012F13ATCCAACGGCTNONE 
J080020E06ATCCAACGGCTNONE 
J080025H22ATCCAACGGCTNONE 
J080026D15ATCCAACGGCTNONE 
J080028D20ATCCAACGGCTNONE 
J080029P20ATCCAACGGCTNONE 
J080031K22ATCCAACGGCTNONE 
J080034I05ATCCAACGGCTNONE 
J080036E11ATCCAACGGCTNONE 
J080036H13ATCCAACGGCTNONE 
J080037E17ATCCAACGGCTNONE 
J080043N05ATCCAACGGCTNONE 
J080044L23ATCCAACGGCTNONE 
J080047N11ATCCAACGGCTNONE 
J080048O04ATCCAACGGCTNONE 
J080049M01ATCCAACGGCTNONE 
J080050F21ATCCAACGGCTNONE 
J080054F09ATCCAACGGCTNONE 
J080055N20ATCCAACGGCTNONE 
J080058C02ATCCAACGGCTNONE 
J080058K15ATCCAACGGCTNONE 
J080062G02ATCCAACGGCTNONE 
J080066H16ATCCAACGGCTNONE 
J080066O05ATCCAACGGCTNONE 
J080067O16ATCCAACGGCTNONE 
J080068E13ATCCAACGGCTNONE 
J080069P16ATCCAACGGCTNONE 
J080072M11ATCCAACGGCTNONE 
J080076H09ATCCAACGGCTNONE 
J080081G24ATCCAACGGCTNONE 
J080082J05ATCCAACGGCTNONE 
J080084I10ATCCAACGGCTNONE 
J080087L24ATCCAACGGCTNONE 
J080089H07ATCCAACGGCTNONE 
J080089M05ATCCAACGGCTNONE 
J080092G18ATCCAACGGCTNONE 
J080095N08ATCCAACGGCTNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0766600006-039-E02CCGTTGGATNONE 
009-087-E05CCGTTGGATNONE 
013-049-E02CCGTTGGATNONE 
AK059779CCGTTGGATProtein of unknown function DUF1685 family protein. 
AK099386CCGTTGGATNONE 
J033072H02CCGTTGGATNONE 
J065045F21CCGTTGGATNONE 
J065079P05CCGTTGGATNONE 
J065121M12CCGTTGGATNONE 
J065134C23CCGTTGGATNONE 
J065140G23CCGTTGGATNONE 
J065180P12CCGTTGGATNONE 
J065212O07CCGTTGGATNONE 
J100028B03CCGTTGGATNONE 
J100030E05CCGTTGGATNONE 
J100037O12CCGTTGGATNONE 
J100050P11CCGTTGGATNONE 
J100058I07CCGTTGGATNONE 
J100059G05CCGTTGGATNONE 
J100062H11CCGTTGGATNONE 
J100064L18CCGTTGGATNONE 
J100068G08CCGTTGGATNONE 
Os02g0771200011-006-B07ATCCAACGGTCNONE 
AK066823ATCCAACGGTCConserved hypothetical protein. 
AK071059ATCCAACGGTCNONE 
J013075K03ATCCAACGGTCNONE 
Os02g0776800AB042415ATCCAACGGCTNONE 
AK072308ATCCAACGGCTReplication protein A 70kDa. 
AK101212ATCCAACGGCTNONE 
J033031B02ATCCAACGGCTNONE 
J090004E18ATCCAACGGCTNONE 
J090084C24ATCCAACGGCTNONE 
Os03g0119000006-027-A04ATCCAACGGNONE 
006-096-F10ATCCAACGGNONE 
AK071417ATCCAACGGProlyl 4-hydroxylase, alpha subunit domain containing protein. 
AK104225ATCCAACGGNONE 
AK104441ATCCAACGGNONE 
J013129D22ATCCAACGGNONE 
J023091L16ATCCAACGGNONE 
J090094H21ATCCAACGGNONE 
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE 
AK101248ATCCAACGGCCGAAANONE 
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein. 
AK109354ATCCAACGGCCGAAANONE 
J033032D06ATCCAACGGCCGAAANONE 
J080308A01ATCCAACGGCCGAAANONE 
J090071H02ATCCAACGGCCGAAANONE 
J100048C10ATCCAACGGCCGAAANONE 
Os03g0124850Os03g0124850CCCATCCAACGNONE 
Os03g0134300AK102053CGTTGGATSimilar to ATP phosphoribosyl transferase. 
Os03g0135300004-017-A10ATCCAACGNONE 
006-046-A11ATCCAACGNONE 
006-110-B05ATCCAACGNONE 
AF309384ATCCAACGNONE 
AK071745ATCCAACGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK104680ATCCAACGNONE 
J013100M12ATCCAACGNONE 
J023107J18ATCCAACGNONE 
J033081B13ATCCAACGNONE 
J033087L03ATCCAACGNONE 
J065120N18ATCCAACGNONE 
J075032C15ATCCAACGNONE 
J075172P14ATCCAACGNONE 
J090049B05ATCCAACGNONE 
Os03g0146300011-078-E08ATCCAACGGCCNONE 
014-009-B07ATCCAACGGCCNONE 
AK121395ATCCAACGGCCSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319ATCCAACGGCCNONE 
J013104I06ATCCAACGGCCNONE 
J023130M16ATCCAACGGCCNONE 
J053037E13ATCCAACGGCCNONE 
J075104M08ATCCAACGGCCNONE 
J075144I22ATCCAACGGCCNONE 
J100057B09ATCCAACGGCCNONE 
Os03g0148000AK110468ATCCAACGGProtein of unknown function DUF677 family protein. 
Os03g0152900Os03g0152900GCCGTTGGATKinesin, motor region domain containing protein. 
Os03g0160200AK064836GCCCAGATCCAACGGCTConserved hypothetical protein. 
AK071081GCCCAGATCCAACGGCTNONE 
AK100712GCCCAGATCCAACGGCTNONE 
AK104859GCCCAGATCCAACGGCTNONE 
J013000F21GCCCAGATCCAACGGCTNONE 
J013024G05GCCCAGATCCAACGGCTNONE 
J013035E12GCCCAGATCCAACGGCTNONE 
J013041A17GCCCAGATCCAACGGCTNONE 
J013045D10GCCCAGATCCAACGGCTNONE 
J013045F04GCCCAGATCCAACGGCTNONE 
J013046F04GCCCAGATCCAACGGCTNONE 
J013047F10GCCCAGATCCAACGGCTNONE 
J013051E10GCCCAGATCCAACGGCTNONE 
J013059J07GCCCAGATCCAACGGCTNONE 
J013059O17GCCCAGATCCAACGGCTNONE 
J013060A20GCCCAGATCCAACGGCTNONE 
J013063J23GCCCAGATCCAACGGCTNONE 
J013066D19GCCCAGATCCAACGGCTNONE 
J013069O08GCCCAGATCCAACGGCTNONE 
J013088K24GCCCAGATCCAACGGCTNONE 
J013098G04GCCCAGATCCAACGGCTNONE 
J013100I15GCCCAGATCCAACGGCTNONE 
J013102E18GCCCAGATCCAACGGCTNONE 
J013102O09GCCCAGATCCAACGGCTNONE 
J013119M18GCCCAGATCCAACGGCTNONE 
J013123I19GCCCAGATCCAACGGCTNONE 
J013146H15GCCCAGATCCAACGGCTNONE 
J013149A14GCCCAGATCCAACGGCTNONE 
J023003A05GCCCAGATCCAACGGCTNONE 
J023013O19GCCCAGATCCAACGGCTNONE 
J023044M05GCCCAGATCCAACGGCTNONE 
J023048O03GCCCAGATCCAACGGCTNONE 
J023049L17GCCCAGATCCAACGGCTNONE 
J023060D22GCCCAGATCCAACGGCTNONE 
J023060F20GCCCAGATCCAACGGCTNONE 
J023069G09GCCCAGATCCAACGGCTNONE 
J023086E11GCCCAGATCCAACGGCTNONE 
J023091I09GCCCAGATCCAACGGCTNONE 
J023091M19GCCCAGATCCAACGGCTNONE 
J023101D06GCCCAGATCCAACGGCTNONE 
J023109B03GCCCAGATCCAACGGCTNONE 
J023113B14GCCCAGATCCAACGGCTNONE 
J023114B19GCCCAGATCCAACGGCTNONE 
J023115H16GCCCAGATCCAACGGCTNONE 
J023134F22GCCCAGATCCAACGGCTNONE 
J023139I06GCCCAGATCCAACGGCTNONE 
J023150C02GCCCAGATCCAACGGCTNONE 
J033033A14GCCCAGATCCAACGGCTNONE 
J033058O11GCCCAGATCCAACGGCTNONE 
J033060H13GCCCAGATCCAACGGCTNONE 
J033075P14GCCCAGATCCAACGGCTNONE 
J033084O05GCCCAGATCCAACGGCTNONE 
J033087G04GCCCAGATCCAACGGCTNONE 
J033092E18GCCCAGATCCAACGGCTNONE 
J033101G23GCCCAGATCCAACGGCTNONE 
J033112I05GCCCAGATCCAACGGCTNONE 
J033118E14GCCCAGATCCAACGGCTNONE 
J033118P04GCCCAGATCCAACGGCTNONE 
J033123C07GCCCAGATCCAACGGCTNONE 
J043003C01GCCCAGATCCAACGGCTNONE 
J043024B21GCCCAGATCCAACGGCTNONE 
J043030N04GCCCAGATCCAACGGCTNONE 
J043039J02GCCCAGATCCAACGGCTNONE 
J043039N08GCCCAGATCCAACGGCTNONE 
J075006N21GCCCAGATCCAACGGCTNONE 
J075008A16GCCCAGATCCAACGGCTNONE 
J075018J16GCCCAGATCCAACGGCTNONE 
J075023G04GCCCAGATCCAACGGCTNONE 
J075134F18GCCCAGATCCAACGGCTNONE 
J075181B05GCCCAGATCCAACGGCTNONE 
J090014O14GCCCAGATCCAACGGCTNONE 
J090020H22GCCCAGATCCAACGGCTNONE 
J090022G17GCCCAGATCCAACGGCTNONE 
J090023J24GCCCAGATCCAACGGCTNONE 
J090033H01GCCCAGATCCAACGGCTNONE 
J090038A03GCCCAGATCCAACGGCTNONE 
J090041O22GCCCAGATCCAACGGCTNONE 
J090049E10GCCCAGATCCAACGGCTNONE 
J090063E24GCCCAGATCCAACGGCTNONE 
J090080N12GCCCAGATCCAACGGCTNONE 
J100021G23GCCCAGATCCAACGGCTNONE 
J100028P06GCCCAGATCCAACGGCTNONE 
J100060L21GCCCAGATCCAACGGCTNONE 
J100077D16GCCCAGATCCAACGGCTNONE 
J100088I09GCCCAGATCCAACGGCTNONE 
Os03g0161000AK120446CGTTGGATConserved hypothetical protein. 
AK120446CGTTGGATConserved hypothetical protein. 
J013045A18CGTTGGATNONE 
J013045A18CGTTGGATNONE 
J013099P14CGTTGGATNONE 
J013099P14CGTTGGATNONE 
J023077D21CGTTGGATNONE 
J023077D21CGTTGGATNONE 
J023091B08CGTTGGATNONE 
J023091B08CGTTGGATNONE 
J023134M05CGTTGGATNONE 
J023134M05CGTTGGATNONE 
J065078D20CGTTGGATNONE 
J065078D20CGTTGGATNONE 
J065102P15CGTTGGATNONE 
J065102P15CGTTGGATNONE 
J065139A01CGTTGGATNONE 
J065139A01CGTTGGATNONE 
J065166H24CGTTGGATNONE 
J065166H24CGTTGGATNONE 
J065182J24CGTTGGATNONE 
J065182J24CGTTGGATNONE 
J065192E15CGTTGGATNONE 
J065192E15CGTTGGATNONE 
J065204N16CGTTGGATNONE 
J065204N16CGTTGGATNONE 
J065218E18CGTTGGATNONE 
J065218E18CGTTGGATNONE 
J090048M16CGTTGGATNONE 
J090048M16CGTTGGATNONE 
Os03g0175200J090059M15ATCCAACGNONE 
Os03g0209400006-064-D01AGCCGTTGGATNONE 
AK059829AGCCGTTGGATGot1-like protein family protein. 
J075020J24AGCCGTTGGATNONE 
J075021D13AGCCGTTGGATNONE 
J075024F20AGCCGTTGGATNONE 
J075030B10AGCCGTTGGATNONE 
J075042D12AGCCGTTGGATNONE 
J075053D16AGCCGTTGGATNONE 
J075060J09AGCCGTTGGATNONE 
J075097J19AGCCGTTGGATNONE 
J075138D24AGCCGTTGGATNONE 
J100030P20AGCCGTTGGATNONE 
J100052N12AGCCGTTGGATNONE 
Os03g0233500AK073139ATCCAACGGUBA-like domain containing protein. 
Os03g0278500AK070850CCCATCCAACGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16CCCATCCAACGGNONE 
Os03g0278900006-049-H12AGCCGTTGGATNONE 
006-082-A07AGCCGTTGGATNONE 
009-169-C04AGCCGTTGGATNONE 
AK066019AGCCGTTGGATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925AGCCGTTGGATNONE 
AY224460AGCCGTTGGATNONE 
J065021K17AGCCGTTGGATNONE 
J065141H24AGCCGTTGGATNONE 
J065142J20AGCCGTTGGATNONE 
J065152J03AGCCGTTGGATNONE 
J065163A13AGCCGTTGGATNONE 
J065191I21AGCCGTTGGATNONE 
J065193K12AGCCGTTGGATNONE 
J075003D01AGCCGTTGGATNONE 
J075017D24AGCCGTTGGATNONE 
J075060F20AGCCGTTGGATNONE 
J075154C11AGCCGTTGGATNONE 
J075173F04AGCCGTTGGATNONE 
Os03g0389900AK062245CGTTGGATNONE 
Os03g0399600AK068188ATCCAACGConserved hypothetical protein. 
J013135E21ATCCAACGNONE 
Os03g0411800009-042-G11ATCCAACGNONE 
AK121551ATCCAACGSimilar to Metal transport protein. 
AY302059ATCCAACGNONE 
J013095L05ATCCAACGNONE 
J033033B06ATCCAACGNONE 
J033118G11ATCCAACGNONE 
Os03g0413000009-180-E02ATCCAACGGNONE 
009-188-B06ATCCAACGGNONE 
AK060225ATCCAACGGNONE 
AY062181ATCCAACGGSimilar to Potential histone-like transcription factor. 
Os03g0415500AK108435CGTTGGATMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12CGTTGGATNONE 
Os03g0418600AK122114ATCCAACGConserved hypothetical protein. 
J033128A11ATCCAACGNONE 
Os03g0426900AK069123ATCCAACGGCSimilar to Heat shock protein 101. 
Os03g0429000AK102768CGTTGGATProteinase inhibitor I25, cystatin domain containing protein. 
J033107F20CGTTGGATNONE 
J065042C20CGTTGGATNONE 
J065106L01CGTTGGATNONE 
J065142N05CGTTGGATNONE 
J075112D23CGTTGGATNONE 
J080001J15CGTTGGATNONE 
J080005I06CGTTGGATNONE 
J080011L11CGTTGGATNONE 
J080011P21CGTTGGATNONE 
J080024E07CGTTGGATNONE 
J080029G10CGTTGGATNONE 
J080039C16CGTTGGATNONE 
J080039E19CGTTGGATNONE 
J080045E04CGTTGGATNONE 
J080063D02CGTTGGATNONE 
J080063L14CGTTGGATNONE 
J080077L02CGTTGGATNONE 
J080077O08CGTTGGATNONE 
J080078D15CGTTGGATNONE 
J080079M10CGTTGGATNONE 
J080085D01CGTTGGATNONE 
J080089E07CGTTGGATNONE 
J080089E22CGTTGGATNONE 
J080097B13CGTTGGATNONE 
J080302C24CGTTGGATNONE 
Os03g0431500AK110714CCGTTGGATConserved hypothetical protein. 
AK110714CGTTGGATConserved hypothetical protein. 
AK110714CGTTGGATConserved hypothetical protein. 
Os03g0436400003-106-E12CCGTTGGATNONE 
AK060848CCGTTGGATNONE 
AK065159CCGTTGGATNONE 
AK106105CCGTTGGATSimilar to A.thaliana gene induced upon wounding stress. 
J013002B24CCGTTGGATNONE 
J013057B14CCGTTGGATNONE 
J013153B16CCGTTGGATNONE 
J023023K10CCGTTGGATNONE 
J023093L09CCGTTGGATNONE 
J043017B21CCGTTGGATNONE 
J065104D18CCGTTGGATNONE 
J075074O11CCGTTGGATNONE 
J075145F17CCGTTGGATNONE 
J090079G21CCGTTGGATNONE 
J090095A03CCGTTGGATNONE 
J100027N18CCGTTGGATNONE 
Os03g0576900AK064861ATCCAACGGCCNONE 
J013000I01ATCCAACGGCCNONE 
J013169P21ATCCAACGGCCNONE 
J023001P03ATCCAACGGCCNONE 
J023009M10ATCCAACGGCCNONE 
J023025G11ATCCAACGGCCNONE 
J033046B19ATCCAACGGCCNONE 
J033149I10ATCCAACGGCCNONE 
J090081C04ATCCAACGGCCNONE 
Os03g0695400AK070048ATCCAACGAnkyrin repeat containing protein. 
AK070048ATCCAACGGTCAnkyrin repeat containing protein. 
Os03g0702000011-023-H12GCCGTTGGATNONE 
AK105398GCCGTTGGATNONE 
AK119905GCCGTTGGATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK121682GCCGTTGGATNONE 
J033070B15GCCGTTGGATNONE 
J033117B11GCCGTTGGATNONE 
Os03g0711400AK100286ATCCAACGGSimilar to Coatomer alpha subunit. 
Os03g0713100J013039M09ATCCAACGGCTNONE 
J023007K01ATCCAACGGCTNONE 
J023073H01ATCCAACGGCTNONE 
J023087M20ATCCAACGGCTNONE 
J023142E01ATCCAACGGCTNONE 
J033048E03ATCCAACGGCTNONE 
J033048F03ATCCAACGGCTSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11ATCCAACGGCTNONE 
J033074M20ATCCAACGGCTNONE 
J033084M11ATCCAACGGCTNONE 
J033091I23ATCCAACGGCTNONE 
J033100C08ATCCAACGGCTNONE 
J033123K19ATCCAACGGCTNONE 
J090006P21ATCCAACGGCTNONE 
J090045O16ATCCAACGGCTNONE 
J100087M13ATCCAACGGCTNONE 
Os03g0753600AK067449ATCCAACGGCChromo domain containing protein. 
J013107L13ATCCAACGGCNONE 
Os03g0758500016-015-D02ATCCAACGGNONE 
AK059403ATCCAACGGNONE 
AK102002ATCCAACGGPlastocyanin-like domain containing protein. 
J033079N03ATCCAACGGNONE 
J065012M05ATCCAACGGNONE 
J065045H19ATCCAACGGNONE 
J065050J08ATCCAACGGNONE 
J075189D02ATCCAACGGNONE 
J090018L03ATCCAACGGNONE 
J100043O22ATCCAACGGNONE 
J100088G17ATCCAACGGNONE 
Os03g0780400011-100-D09AGCCGTTGGATNONE 
AK061347AGCCGTTGGATNONE 
AK073162AGCCGTTGGATSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGCCGTTGGATNONE 
J065045I07AGCCGTTGGATNONE 
J090036F17AGCCGTTGGATNONE 
J090077M14AGCCGTTGGATNONE 
J100055G20AGCCGTTGGATNONE 
Os03g0799000013-010-A07GACCGTTGGATGGGNONE 
013-081-H02GACCGTTGGATGGGNONE 
AK067840GACCGTTGGATGGGSimilar to Histone H1. 
AK099211GACCGTTGGATGGGNONE 
J065066F23GACCGTTGGATGGGNONE 
J065138O20GACCGTTGGATGGGNONE 
J065163G22GACCGTTGGATGGGNONE 
J065211J01GACCGTTGGATGGGNONE 
J080027D02GACCGTTGGATGGGNONE 
J080029E20GACCGTTGGATGGGNONE 
J080045D03GACCGTTGGATGGGNONE 
J080060G13GACCGTTGGATGGGNONE 
J080067E14GACCGTTGGATGGGNONE 
J080067J04GACCGTTGGATGGGNONE 
J080067J21GACCGTTGGATGGGNONE 
J080068L09GACCGTTGGATGGGNONE 
J080077E15GACCGTTGGATGGGNONE 
J080078B03GACCGTTGGATGGGNONE 
J080086H09GACCGTTGGATGGGNONE 
J090095G02GACCGTTGGATGGGNONE 
J100058H04GACCGTTGGATGGGNONE 
Os03g0826400AK071472CCGTTGGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023095J08CCGTTGGATNONE 
Os03g0837300AK111243ATCCAACGGNONE 
AK121140ATCCAACGGNicotinate phosphoribosyltransferase and related family protein. 
AY214337ATCCAACGGNONE 
J023077G12ATCCAACGGNONE 
J023078M10ATCCAACGGNONE 
J033031B10ATCCAACGGNONE 
J033067L18ATCCAACGGNONE 
J043005P09ATCCAACGGNONE 
J090013J15ATCCAACGGNONE 
J090042E10ATCCAACGGNONE 
J090045A20ATCCAACGGNONE 
J100022H02ATCCAACGGNONE 
Os03g0847600AK066947CGTTGGATSimilar to GAMYB-binding protein. 
AK098991CGTTGGATNONE 
AK104847CGTTGGATNONE 
Os03g0850600AK067191GGCCGTTGGATConserved hypothetical protein. 
J013095N12GGCCGTTGGATNONE 
J065214L06GGCCGTTGGATNONE 
J075093J10GGCCGTTGGATNONE 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0382900009-109-B04CGTTGGATNONE 
009-174-G05CGTTGGATNONE 
009-186-E01CGTTGGATNONE 
AK062807CGTTGGATConserved hypothetical protein. 
Os04g0388900AK063224CCGTTGGATSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CCGTTGGATNONE 
J065148P22CCGTTGGATNONE 
J075040G12CCGTTGGATNONE 
Os04g0439100J013026H11ATCCAACGNONE 
J013097L15ATCCAACGNONE 
J013112G22ATCCAACGNONE 
J013160E02ATCCAACGNONE 
J043026G08ATCCAACGNONE 
Os04g0444800AB126084CGTTGGATNONE 
AK067009CGTTGGATFerric reductase-like transmembrane component family protein. 
AK070312CGTTGGATNONE 
J065053C14CGTTGGATNONE 
Os04g0558700AK110633ATCCAACGGCTConserved hypothetical protein. 
Os04g0578400AK060559AGCCGTTGGATSimilar to Beta-ring hydroxylase (Fragment). 
Os04g0583600AK059019ATCCAACGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
AK059019ATCCAACGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J023047G03ATCCAACGNONE 
J023047G03ATCCAACGNONE 
J075118B22ATCCAACGNONE 
J075118B22ATCCAACGNONE 
J090035A11ATCCAACGNONE 
J090035A11ATCCAACGNONE 
J090067I05ATCCAACGNONE 
J090067I05ATCCAACGNONE 
J100017K09ATCCAACGNONE 
J100017K09ATCCAACGNONE 
Os04g0623700AK071587CCGTTGGATNONE 
J023101P16CCGTTGGATNONE 
J100044N20CCGTTGGATNONE 
J100052H13CCGTTGGATNONE 
J100075E05CCGTTGGATNONE 
Y10118CCGTTGGATSimilar to Signal recognition particle 14 kDa protein (SRP14). 
Os04g0658600AK064729CGTTGGATNONE 
AK119253CGTTGGATNucleolar, Nop52 family protein. 
J075132J07CGTTGGATNONE 
J075157N21CGTTGGATNONE 
Os04g0664300AK110837ATCCAACGConserved hypothetical protein. 
Os04g0668700012-043-D01ATCCAACGNONE 
AK065237ATCCAACGPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCCAACGNONE 
J013002I02ATCCAACGNONE 
J013059C11ATCCAACGNONE 
J013059D22ATCCAACGNONE 
J013063G18ATCCAACGNONE 
J013088O04ATCCAACGNONE 
J013095K03ATCCAACGNONE 
J013096K15ATCCAACGNONE 
J013100O17ATCCAACGNONE 
J013102F10ATCCAACGNONE 
J013111L07ATCCAACGNONE 
J013127E24ATCCAACGNONE 
J013130A10ATCCAACGNONE 
J013134L13ATCCAACGNONE 
J023109G08ATCCAACGNONE 
J033022E17ATCCAACGNONE 
J033022N13ATCCAACGNONE 
J033026D04ATCCAACGNONE 
J033028M05ATCCAACGNONE 
J033037E04ATCCAACGNONE 
J033042D11ATCCAACGNONE 
J033044N20ATCCAACGNONE 
J033046K11ATCCAACGNONE 
J033046M21ATCCAACGNONE 
J033076E19ATCCAACGNONE 
J033076J24ATCCAACGNONE 
J033086N03ATCCAACGNONE 
J033095F22ATCCAACGNONE 
J033115F17ATCCAACGNONE 
J033117M06ATCCAACGNONE 
J033125D22ATCCAACGNONE 
J033129J10ATCCAACGNONE 
J033145E18ATCCAACGNONE 
J043021F24ATCCAACGNONE 
J053046G14ATCCAACGNONE 
J053090P03ATCCAACGNONE 
J065042N10ATCCAACGNONE 
J065053B13ATCCAACGNONE 
J065085G03ATCCAACGNONE 
J065173J11ATCCAACGNONE 
J090014M14ATCCAACGNONE 
J090027J07ATCCAACGNONE 
J090039E23ATCCAACGNONE 
J090051C15ATCCAACGNONE 
J090055H06ATCCAACGNONE 
J090062L03ATCCAACGNONE 
J100017L21ATCCAACGNONE 
J100024B07ATCCAACGNONE 
J100032G07ATCCAACGNONE 
J100040N09ATCCAACGNONE 
J100062N03ATCCAACGNONE 
J100078E07ATCCAACGNONE 
J100080E14ATCCAACGNONE 
J100084D07ATCCAACGNONE 
Os04g0670200AK073373CGTTGGATNONE 
AK099358CGTTGGATNONE 
AK107749CGTTGGATNONE 
AK109371CGTTGGATSimilar to Oryzain beta chain precursor (EC 3.4.22.-). 
D90407CGTTGGATNONE 
Os04g0674700AK106615ATCCAACGGSimilar to AMP-binding protein (Adenosine monophosphate binding protein 5 AMPBP5). 
J100049J02ATCCAACGGNONE 
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0111200009-033-A06CGTTGGATNONE 
AK101693CGTTGGATSimilar to Amino acid selective channel protein. 
J065006E13CGTTGGATNONE 
J075001D12CGTTGGATNONE 
J075005J18CGTTGGATNONE 
J075009L08CGTTGGATNONE 
J075012M21CGTTGGATNONE 
J075019K17CGTTGGATNONE 
J075020D07CGTTGGATNONE 
J075041D11CGTTGGATNONE 
J075051C03CGTTGGATNONE 
J075060C05CGTTGGATNONE 
J075079N09CGTTGGATNONE 
J075094B04CGTTGGATNONE 
J075108E08CGTTGGATNONE 
J075115G05CGTTGGATNONE 
J075147L21CGTTGGATNONE 
J075161G12CGTTGGATNONE 
J075168J11CGTTGGATNONE 
J075168L11CGTTGGATNONE 
J075174F22CGTTGGATNONE 
Os05g0222200AK068591ATCCAACGABC transporter related domain containing protein. 
AK070374ATCCAACGNONE 
Os05g0305200J065161N15ATCCAACGGTRAF-like domain containing protein. 
Os05g0316200AK060608CGTTGGATNONE 
AK101705CGTTGGATConserved hypothetical protein. 
AK111481CGTTGGATNONE 
Os05g0342100AK111106ATCCAACGGWound-induced WI12 family protein. 
Os05g0348100006-028-F04CGTTGGATNONE 
009-036-C03CGTTGGATNONE 
009-040-H02CGTTGGATNONE 
009-173-H12CGTTGGATNONE 
AK061434CGTTGGATConserved hypothetical protein. 
J065137N04CGTTGGATNONE 
J065164C10CGTTGGATNONE 
J065210H22CGTTGGATNONE 
Os05g0350500013-071-D05GCCGTTGGATNONE 
AF020787GCCGTTGGATNONE 
AK061712GCCGTTGGATNONE 
AK102897GCCGTTGGATProliferation-associated protein 1 family protein. 
J033060G23GCCGTTGGATNONE 
J033112P14GCCGTTGGATNONE 
J033127J04GCCGTTGGATNONE 
J090015L18GCCGTTGGATNONE 
J090047K03GCCGTTGGATNONE 
J090097J17GCCGTTGGATNONE 
Os05g0357850J065118C17CCGTTGGATHypothetical protein. 
J065159C03CCGTTGGATNONE 
Os05g0378900AK103841CCGTTGGATConserved hypothetical protein. 
J033148I18CCGTTGGATNONE 
J065085F12CCGTTGGATNONE 
J075041H24CCGTTGGATNONE 
J075180P06CCGTTGGATNONE 
Os05g0399100004-005-F03CCGTTGGATNONE 
009-087-E06CCGTTGGATNONE 
AK060876CCGTTGGATNONE 
J013045L10CCGTTGGATNONE 
J065010F04CCGTTGGATNONE 
J065211L20CCGTTGGATNONE 
J090068A12CCGTTGGATNONE 
J090098N18CCGTTGGATNONE 
Os05g0413200006-067-C03CCCATCCAACGGCCNONE 
006-080-C03CCCATCCAACGGCCNONE 
006-095-G10CCCATCCAACGGCCNONE 
006-115-G11CCCATCCAACGGCCNONE 
013-040-E05CCCATCCAACGGCCNONE 
AB104732CCCATCCAACGGCCNONE 
AK122099CCCATCCAACGGCCBeta-tubulin. 
J033087H20CCCATCCAACGGCCNONE 
J033117C18CCCATCCAACGGCCNONE 
J033125G10CCCATCCAACGGCCNONE 
Os05g0422900AK073629ATCCAACGGConserved hypothetical protein. 
J023126I07ATCCAACGGNONE 
J023143K12ATCCAACGGNONE 
J033051N08ATCCAACGGNONE 
J033128I04ATCCAACGGNONE 
J065067M02ATCCAACGGNONE 
J080312N05ATCCAACGGNONE 
J100032G23ATCCAACGGNONE 
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE 
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0445500009-021-C05ATCCAACGGNONE 
009-129-D11ATCCAACGGNONE 
009-147-E04ATCCAACGGNONE 
009-169-C11ATCCAACGGNONE 
AK121459ATCCAACGGSimilar to 60S acidic ribosomal protein P2B. 
D21114ATCCAACGGNONE 
J023001K23ATCCAACGGNONE 
J023107J19ATCCAACGGNONE 
J023143J09ATCCAACGGNONE 
J065049D04ATCCAACGGNONE 
J065092I06ATCCAACGGNONE 
J065188H04ATCCAACGGNONE 
Os05g0456000AK058420ATCCAACGGTCCAGAMitochondrial glycoprotein family protein. 
AK102036ATCCAACGGTCCAGANONE 
J065066F02ATCCAACGGTCCAGANONE 
Os05g0466600009-088-F09CTCCCCCATCCAACGGCNONE 
009-105-C11CTCCCCCATCCAACGGCNONE 
009-156-C06CTCCCCCATCCAACGGCNONE 
AK119240CTCCCCCATCCAACGGChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0491200AK068637ATCCAACGGCSimilar to SNF1 kinase complex anchoring protein (Fragment). 
AK071229ATCCAACGGCNONE 
Os05g0497625Os05g0497625CGTTGGATConserved hypothetical protein. 
Os05g0519700014-100-B04ATCCAACGGNONE 
AF332981ATCCAACGGNONE 
AK100903ATCCAACGGNONE 
AK105433ATCCAACGGHeat shock protein 101. 
Os05g0519800AK069435ATCCAACGGCTProtein of unknown function DUF28 family protein. 
J023024L22ATCCAACGGCTNONE 
Os05g0551700AK071216ATCCAACGtRNA isopentenyltransferase family protein. 
Os05g0560600011-097-B07ATCCAACGGCNONE 
AK067862ATCCAACGGCNONE 
AK122091ATCCAACGGCHomeodomain-like containing protein. 
J013124K11ATCCAACGGCNONE 
J033124C04ATCCAACGGCNONE 
J065013L06ATCCAACGGCNONE 
J065117J23ATCCAACGGCNONE 
Os05g0567100015-030-G11ATCCAACGGCTNONE 
AK066453ATCCAACGGCTNONE 
AK067742ATCCAACGGCTNONE 
AK098906ATCCAACGGCTNONE 
AK098911ATCCAACGGCTNONE 
AK103421ATCCAACGGCTNONE 
AK104838ATCCAACGGCTNONE 
D32144ATCCAACGGCTAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14ATCCAACGGCTNONE 
J013002H22ATCCAACGGCTNONE 
J013022G01ATCCAACGGCTNONE 
J013039N15ATCCAACGGCTNONE 
J023007F19ATCCAACGGCTNONE 
J023107B10ATCCAACGGCTNONE 
J033038D21ATCCAACGGCTNONE 
J033043E23ATCCAACGGCTNONE 
J033061A06ATCCAACGGCTNONE 
Os05g0571600Os05g0571600ATCCAACGGConserved hypothetical protein. 
Os05g0571600ATCCAACGGCConserved hypothetical protein. 
Os05g0571800009-157-G07ATCCAACGGNONE 
009-157-G07ATCCAACGGCNONE 
AK063033ATCCAACGGConserved hypothetical protein. 
AK063033ATCCAACGGCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCCAACGGCCNONE 
006-049-A11ATCCAACGGCCNONE 
006-086-F03ATCCAACGGCCNONE 
009-051-F06ATCCAACGGCCNONE 
AB015287ATCCAACGGCCNONE 
AB015972ATCCAACGGCCNONE 
AK061714ATCCAACGGCCNONE 
AK098889ATCCAACGGCCNONE 
AK121699ATCCAACGGCCSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCAACGGCCNONE 
J013072D17ATCCAACGGCCNONE 
J023028M04ATCCAACGGCCNONE 
J023031F01ATCCAACGGCCNONE 
J023114L22ATCCAACGGCCNONE 
J033058L12ATCCAACGGCCNONE 
J033073D17ATCCAACGGCCNONE 
J043031D08ATCCAACGGCCNONE 
J043036G01ATCCAACGGCCNONE 
J065144O04ATCCAACGGCCNONE 
J065181O08ATCCAACGGCCNONE 
J080066B20ATCCAACGGCCNONE 
Os05g0594500AK100617ATCCAACGTGTCGNONE 
Os05g0596200009-059-G06GACACGTGAGCCGTTGGATNONE 
AK062521GACACGTGAGCCGTTGGATNONE 
AK107887GACACGTGAGCCGTTGGATConserved hypothetical protein. 
AK108209GACACGTGAGCCGTTGGATNONE 
J065154B01GACACGTGAGCCGTTGGATNONE 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0128400AK064390ATCCAACGGNONE 
AK064390ATCCAACGGCNONE 
AK121983ATCCAACGGWD40-like domain containing protein. 
AK121983ATCCAACGGCWD40-like domain containing protein. 
Os06g0134000AJ417525ATCCAACGGCCNONE 
AJ417525ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK120319ATCCAACGGCCNONE 
AK120319ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
Os06g0146300AK101052CCGTTGGATConserved hypothetical protein. 
J075003H04CCGTTGGATNONE 
J075039J08CCGTTGGATNONE 
J075054H14CCGTTGGATNONE 
J075091E08CCGTTGGATNONE 
J075097L20CCGTTGGATNONE 
J075179P07CCGTTGGATNONE 
Os06g0172000AK068738ATCCAACGGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0179700AK065602GACCGTTGGATSimilar to DNA-binding protein phosphatase 2C. 
Os06g0212900AK071518ATCCAACGGTCHeat shock protein Hsp70 family protein. 
AK104048ATCCAACGGTCNONE 
J023019O18ATCCAACGGTCNONE 
J023090N13ATCCAACGGTCNONE 
J023101M15ATCCAACGGTCNONE 
J023122F06ATCCAACGGTCNONE 
J075023H16ATCCAACGGTCNONE 
J090006J22ATCCAACGGTCNONE 
J090075F24ATCCAACGGTCNONE 
J090095A17ATCCAACGGTCNONE 
Os06g0219600AK060429CATCCACCATCCAACGSimilar to Poly(A)-binding protein II-like. 
AK099019CATCCACCATCCAACGNONE 
J013118A14CATCCACCATCCAACGNONE 
Os06g0485100014-052-D02ATCCAACGNONE 
016-028-B05ATCCAACGNONE 
AK073906ATCCAACGNONE 
AK104282ATCCAACGNONE 
J013151L16ATCCAACGNONE 
J033040K10ATCCAACGNONE 
J033068B07ATCCAACGNONE 
J033073E23ATCCAACGNONE 
J053077E05ATCCAACGNONE 
J080311J15ATCCAACGNONE 
J100048C16ATCCAACGNONE 
J100067E21ATCCAACGNONE 
J100075B06ATCCAACGNONE 
Os06g0492550J065080E22ATCCAACGNONE 
J065197J12ATCCAACGConserved hypothetical protein. 
Os06g0562700AK109753ATCCAACGGConserved hypothetical protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0573700015-015-F02ATCCAACGGNONE 
AK106254ATCCAACGGConserved hypothetical protein. 
J065172G24ATCCAACGGNONE 
Os06g0598800011-079-A05ATCCAACGGNONE 
014-040-G10ATCCAACGGNONE 
AK101377ATCCAACGGSimilar to Fatty acid elongase 1-like protein. 
J013022A17ATCCAACGGNONE 
J023011B05ATCCAACGGNONE 
J023104L12ATCCAACGGNONE 
J033033O20ATCCAACGGNONE 
J033036C04ATCCAACGGNONE 
J065060C17ATCCAACGGNONE 
J075009D16ATCCAACGGNONE 
J075123K20ATCCAACGGNONE 
J075191A14ATCCAACGGNONE 
J090038I01ATCCAACGGNONE 
Os06g0598900AK100386ATCCAACGGCSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05ATCCAACGGCNONE 
J090043L20ATCCAACGGCNONE 
Os06g0627101J065061F03CGTTGGATHypothetical protein. 
J065143G18CGTTGGATNONE 
J065160I22CGTTGGATNONE 
J065185B08CGTTGGATNONE 
Os06g0638350J090023G17ATCCAACGGExostosin-like family protein. 
J090058M19ATCCAACGGNONE 
Os06g0647900AK073750ATCCAACGConserved hypothetical protein. 
J033029K17ATCCAACGNONE 
J033070L21ATCCAACGNONE 
Os06g0652000AB096015ATCCAACGGCCNONE 
AB096015CGTTGGATNONE 
AB120430ATCCAACGGCCNONE 
AB120430CGTTGGATNONE 
AK069977ATCCAACGGCCSimilar to T3/T7-like RNA polymerase (Fragment). 
AK069977CGTTGGATSimilar to T3/T7-like RNA polymerase (Fragment). 
J023038J05ATCCAACGGCCNONE 
J023038J05CGTTGGATNONE 
J033126K18ATCCAACGGCCNONE 
J033126K18CGTTGGATNONE 
J043039G23ATCCAACGGCCNONE 
J043039G23CGTTGGATNONE 
J090084C08ATCCAACGGCCNONE 
J090084C08CGTTGGATNONE 
Os06g0663600AK100787CCGTTGGATEndonuclease V family protein. 
Os06g0663800AK105843CGTTGGATSimilar to FKBP-type peptidyl-prolyl cis-trans isomerase 3, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (AtFKBP13) (FK506 binding protein 1). 
J075027P21CGTTGGATNONE 
J075083O05CGTTGGATNONE 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0681200AK107980CGTTGGATCupredoxin domain containing protein. 
Os06g0714000AK069538ATCCAACGGProtein of unknown function UPF0183 family protein. 
J023020A02ATCCAACGGNONE 
J023039H03ATCCAACGGNONE 
J100042E23ATCCAACGGNONE 
J100069N01ATCCAACGGNONE 
J100089L13ATCCAACGGNONE 
Os07g0104500AK108824CGTTGGATHaem peroxidase, plant/fungal/bacterial family protein. 
Os07g0105300AK107419ATCCAACGConserved hypothetical protein. 
AK109521ATCCAACGNONE 
Os07g0115300006-039-C05ATCCAACGGCCNONE 
AK061511ATCCAACGGCCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0167200003-103-H10ATCCAACGGCTNONE 
012-001-G01ATCCAACGGCTNONE 
AK120608ATCCAACGGCTSimilar to Zinc finger POZ domain protein (Fragment). 
J023093N23ATCCAACGGCTNONE 
J100059P15ATCCAACGGCTNONE 
Os07g0168000AK065622ATCCAACGSimilar to Polyribonucleotide phophorylase (Fragment). 
Os07g0262200AK071615AGCCGTCCATCCACCATCCAACGSimilar to Prohibitin. 
AK104133AGCCGTCCATCCACCATCCAACGNONE 
Os07g0474300AK108961ATCCAACGGTCConserved hypothetical protein. 
Os07g0516900009-108-C10ATCCAACGGCNONE 
AK062798ATCCAACGGCNONE 
Os07g0558000AK069272CGTTGGATNONE 
AK101867CGTTGGATABC-1 domain containing protein. 
Os07g0582800011-039-B08ATCCAACGNONE 
AK069022ATCCAACGConserved hypothetical protein. 
J023003P14ATCCAACGNONE 
J065192L23ATCCAACGNONE 
J090024H24ATCCAACGNONE 
J090049C15ATCCAACGNONE 
J090053P21ATCCAACGNONE 
J090082K08ATCCAACGNONE 
J100024J06ATCCAACGNONE 
J100033A05ATCCAACGNONE 
J100050G19ATCCAACGNONE 
J100050M06ATCCAACGNONE 
J100090D16ATCCAACGNONE 
J100090H14ATCCAACGNONE 
Os07g0586700AK102792ATCCAACGGCCConserved hypothetical protein. 
Os07g0606600AK111621ATCCAACGNONE 
AK112118ATCCAACGSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22ATCCAACGNONE 
Os07g0631000AK066723ATCCAACGGProtein of unknown function DUF298 family protein. 
Os07g0657600J065001N02AGCCGTTGGATNONE 
J065002E03AGCCGTTGGATDNA glycosylase family protein. 
Os07g0681000AK066982CCGTTGGATSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os08g0137800009-159-H01ATCCAACGNONE 
AK063041ATCCAACGCupredoxin domain containing protein. 
J065009I23ATCCAACGNONE 
J065014H24ATCCAACGNONE 
J065038D07ATCCAACGNONE 
J065051E23ATCCAACGNONE 
J065056L08ATCCAACGNONE 
J065061E12ATCCAACGNONE 
J065070L02ATCCAACGNONE 
J065091D22ATCCAACGNONE 
J065110K05ATCCAACGNONE 
J065111O11ATCCAACGNONE 
J065120L18ATCCAACGNONE 
J065121D15ATCCAACGNONE 
J065123K05ATCCAACGNONE 
J065147I09ATCCAACGNONE 
J065148D11ATCCAACGNONE 
J065148E22ATCCAACGNONE 
J065154K19ATCCAACGNONE 
J065169F01ATCCAACGNONE 
J065172D15ATCCAACGNONE 
J065179F04ATCCAACGNONE 
J065205J18ATCCAACGNONE 
J065209D24ATCCAACGNONE 
J065209L23ATCCAACGNONE 
Os08g0271400009-101-A03ATCCAACGNONE 
AK062750ATCCAACGConserved hypothetical protein. 
Os08g0290500004-010-C07CGTTGGATNONE 
009-111-A08CGTTGGATNONE 
011-046-F10CGTTGGATNONE 
AK066894CGTTGGATNONE 
AK067122CGTTGGATNONE 
AK102868CGTTGGATSimilar to AF-10 protein. 
J013089O21CGTTGGATNONE 
J033072D17CGTTGGATNONE 
J033095M14CGTTGGATNONE 
J033111N23CGTTGGATNONE 
J043024M17CGTTGGATNONE 
J065176I24CGTTGGATNONE 
J090035C05CGTTGGATNONE 
Os08g0369400J065116P10ATCCAACGAnkyrin repeat containing protein. 
J065116P10ATCCAACGGTCAnkyrin repeat containing protein. 
Os08g0404500AK103556CGTTGGATC1-like domain containing protein. 
AK108951CGTTGGATNONE 
Os08g0440100AK068551CCGTTGGATSimilar to Temperature stress-induced lipocalin. 
J013155M04CCGTTGGATNONE 
J033041C20CCGTTGGATNONE 
J043031L02CCGTTGGATNONE 
J043038J23CCGTTGGATNONE 
J065006F20CCGTTGGATNONE 
J065030H05CCGTTGGATNONE 
J065069H05CCGTTGGATNONE 
J065078M19CCGTTGGATNONE 
J065146E24CCGTTGGATNONE 
J065154J17CCGTTGGATNONE 
J065158L04CCGTTGGATNONE 
J065182J20CCGTTGGATNONE 
J065211P16CCGTTGGATNONE 
J075020M18CCGTTGGATNONE 
J075035J01CCGTTGGATNONE 
J075037K13CCGTTGGATNONE 
J075052E12CCGTTGGATNONE 
J075056I12CCGTTGGATNONE 
J075064H18CCGTTGGATNONE 
J075121E06CCGTTGGATNONE 
J075123H03CCGTTGGATNONE 
J075146P20CCGTTGGATNONE 
J075156O06CCGTTGGATNONE 
J075158A14CCGTTGGATNONE 
J075169L03CCGTTGGATNONE 
J090013K02CCGTTGGATNONE 
Os08g0483600AK099543CCGTTGGATConserved hypothetical protein. 
J100053G23CCGTTGGATNONE 
J100084K09CCGTTGGATNONE 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0518600AK071227CGTTGGATHypothetical protein. 
J023088I15CGTTGGATNONE 
Os08g0523600009-189-E05ATCCAACGGNONE 
AK063901ATCCAACGGSimilar to CTV.22. 
Os08g0540500AK106511CGTTGGATSAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0558000J080005K14ATCCAACGGCTNONE 
Os08g0558400AK071334ATCCAACGGCCSimilar to Kinesin heavy chain (Fragment). 
Os09g0127800AK103786ATCCAACGGCSimilar to Coatomer alpha subunit. 
Os09g0131400AK066362CGTTGGATNONE 
AK071640CGTTGGATNONE 
J013063N07CGTTGGATNONE 
Os09g0244200AK065536ATCCAACGConserved hypothetical protein. 
AK065536CCGTTGGATConserved hypothetical protein. 
Os09g0309900009-024-H02CGTTGGATNONE 
009-111-D03CGTTGGATNONE 
012-048-B04CGTTGGATNONE 
014-023-C03CGTTGGATNONE 
AK121830CGTTGGATHypothetical protein. 
J065022H08CGTTGGATNONE 
J065023G08CGTTGGATNONE 
J065083H23CGTTGGATNONE 
J090062C19CGTTGGATNONE 
Os09g0315200006-022-A10ATCCAACGGNONE 
AK105900ATCCAACGGConserved hypothetical protein. 
Os09g0322300AK107151ATCCAACGGHypothetical protein. 
AK107151ATCCAACGGTCCAGAHypothetical protein. 
J075023P17ATCCAACGGNONE 
J075023P17ATCCAACGGTCCAGANONE 
J075143O05ATCCAACGGNONE 
J075143O05ATCCAACGGTCCAGANONE 
Os09g0358500Os09g0358500ATCCAACGGCCNONE 
Os09g0439400AK121407ATCCAACGGCTGCGGTGCGVirulence factor, pectin lyase fold family protein. 
Os09g0457800011-043-E09ATCCAACGNONE 
015-049-D08ATCCAACGNONE 
AK101358ATCCAACGAlpha-amylase isozyme 3C precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
J043020J09ATCCAACGNONE 
J043034A10ATCCAACGNONE 
J065025A07ATCCAACGNONE 
J065081G01ATCCAACGNONE 
J065111I18ATCCAACGNONE 
J065127L15ATCCAACGNONE 
J065130H08ATCCAACGNONE 
J065146E12ATCCAACGNONE 
J065192N20ATCCAACGNONE 
J065212D06ATCCAACGNONE 
Os09g0458200AK108675ATCCAACGGConserved hypothetical protein. 
Os09g0464000AK060777ATCCAACGGCCNONE 
AK069530ATCCAACGGCCSimilar to Carbonate dehydratase-like protein. 
Os09g0484900AK067836CGTTGGATSodium/sulphate symporter family protein. 
AK105756CGTTGGATNONE 
Os09g0521700014-005-C08CGTTGGATNONE 
AK063628CGTTGGATSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507CGTTGGATNONE 
Os09g0528100009-173-A08ATCCAACGNONE 
009-190-G12ATCCAACGNONE 
AK059096ATCCAACGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os11g0132600AK102526ATCCAACGGSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0271000AK110686ATCCAACGNONE 
Os11g0294400009-034-C04CGTTGGATNONE 
AK062429CGTTGGATWW/Rsp5/WWP domain containing protein. 
J065019M12CGTTGGATNONE 
Os11g0297300AK070171CGTTGGATSimilar to Beta-D-xylosidase. 
Os11g0547000AK100677GCCGTTGGATSimilar to FKF1. 
Os11g0584100AK069971CCGTTGGATNONE 
AK106960CCGTTGGATProtein of unknown function DUF295 family protein. 
J065029I16CCGTTGGATNONE 
J075075K05CCGTTGGATNONE 
Os11g0610700012-090-B04GCCGTTGGATNONE 
AK099760GCCGTTGGATWD40-like domain containing protein. 
J065026G23GCCGTTGGATNONE 
J065062A01GCCGTTGGATNONE 
J065065J18GCCGTTGGATNONE 
J100026C05GCCGTTGGATNONE 
Os11g0703900011-004-D05ATCCAACGGCTNONE 
011-014-C03ATCCAACGGCTNONE 
011-016-C01ATCCAACGGCTNONE 
011-017-B04ATCCAACGGCTNONE 
011-017-E09ATCCAACGGCTNONE 
011-019-E12ATCCAACGGCTNONE 
011-021-H12ATCCAACGGCTNONE 
011-025-H02ATCCAACGGCTNONE 
011-027-B09ATCCAACGGCTNONE 
011-039-G07ATCCAACGGCTNONE 
011-044-G07ATCCAACGGCTNONE 
011-046-F11ATCCAACGGCTNONE 
011-070-F02ATCCAACGGCTNONE 
011-071-A07ATCCAACGGCTNONE 
011-082-A03ATCCAACGGCTNONE 
011-086-B09ATCCAACGGCTNONE 
011-092-C04ATCCAACGGCTNONE 
012-006-F02ATCCAACGGCTNONE 
012-011-G08ATCCAACGGCTNONE 
012-026-C06ATCCAACGGCTNONE 
012-026-G06ATCCAACGGCTNONE 
012-028-E05ATCCAACGGCTNONE 
012-040-A05ATCCAACGGCTNONE 
012-045-C01ATCCAACGGCTNONE 
012-046-A10ATCCAACGGCTNONE 
012-047-H09ATCCAACGGCTNONE 
012-059-A12ATCCAACGGCTNONE 
012-072-D06ATCCAACGGCTNONE 
012-073-D05ATCCAACGGCTNONE 
012-076-D08ATCCAACGGCTNONE 
012-079-G05ATCCAACGGCTNONE 
012-080-A04ATCCAACGGCTNONE 
012-080-E01ATCCAACGGCTNONE 
012-083-C03ATCCAACGGCTNONE 
012-083-G06ATCCAACGGCTNONE 
012-086-G02ATCCAACGGCTNONE 
012-091-A07ATCCAACGGCTNONE 
012-094-G10ATCCAACGGCTNONE 
012-098-A07ATCCAACGGCTNONE 
012-100-G04ATCCAACGGCTNONE 
015-001-A11ATCCAACGGCTNONE 
015-033-E01ATCCAACGGCTNONE 
015-047-F12ATCCAACGGCTNONE 
015-054-E05ATCCAACGGCTNONE 
015-063-H02ATCCAACGGCTNONE 
015-075-E10ATCCAACGGCTNONE 
015-086-F05ATCCAACGGCTNONE 
016-031-A08ATCCAACGGCTNONE 
016-053-A03ATCCAACGGCTNONE 
016-054-C09ATCCAACGGCTNONE 
016-079-C08ATCCAACGGCTNONE 
AK065431ATCCAACGGCTHeat shock protein 70. 
AK119255ATCCAACGGCTNONE 
J013021C12ATCCAACGGCTNONE 
J013021C17ATCCAACGGCTNONE 
J023027B08ATCCAACGGCTNONE 
J023078A21ATCCAACGGCTNONE 
J023097M06ATCCAACGGCTNONE 
J023100O04ATCCAACGGCTNONE 
J023107B17ATCCAACGGCTNONE 
J023108L24ATCCAACGGCTNONE 
J023109L05ATCCAACGGCTNONE 
J033022M22ATCCAACGGCTNONE 
J033023K21ATCCAACGGCTNONE 
J033031L11ATCCAACGGCTNONE 
J033034H10ATCCAACGGCTNONE 
J033037B16ATCCAACGGCTNONE 
J033037F16ATCCAACGGCTNONE 
J033037H07ATCCAACGGCTNONE 
J033046E22ATCCAACGGCTNONE 
J033050N12ATCCAACGGCTNONE 
J033064F10ATCCAACGGCTNONE 
J033064N10ATCCAACGGCTNONE 
J033066O09ATCCAACGGCTNONE 
J033068H01ATCCAACGGCTNONE 
J033068J07ATCCAACGGCTNONE 
J033070B10ATCCAACGGCTNONE 
J033070G13ATCCAACGGCTNONE 
J033073O13ATCCAACGGCTNONE 
J033075B07ATCCAACGGCTNONE 
J033079L15ATCCAACGGCTNONE 
J033081J06ATCCAACGGCTNONE 
J033086G13ATCCAACGGCTNONE 
J033086N07ATCCAACGGCTNONE 
J033086O05ATCCAACGGCTNONE 
J033091A15ATCCAACGGCTNONE 
J033091D05ATCCAACGGCTNONE 
J033094C12ATCCAACGGCTNONE 
J033099P03ATCCAACGGCTNONE 
J033107L09ATCCAACGGCTNONE 
J033108D16ATCCAACGGCTNONE 
J033109E12ATCCAACGGCTNONE 
J033109K14ATCCAACGGCTNONE 
J033112P22ATCCAACGGCTNONE 
J033116F12ATCCAACGGCTNONE 
J033116K01ATCCAACGGCTNONE 
J033118F19ATCCAACGGCTNONE 
J033121J10ATCCAACGGCTNONE 
J033126H04ATCCAACGGCTNONE 
J033131G17ATCCAACGGCTNONE 
J033131L05ATCCAACGGCTNONE 
J033136A08ATCCAACGGCTNONE 
J033136H22ATCCAACGGCTNONE 
J033143F01ATCCAACGGCTNONE 
J065040M10ATCCAACGGCTNONE 
J065046F17ATCCAACGGCTNONE 
J065048G20ATCCAACGGCTNONE 
J065071N06ATCCAACGGCTNONE 
J065084I24ATCCAACGGCTNONE 
J065171B01ATCCAACGGCTNONE 
J065191J21ATCCAACGGCTNONE 
J065199I20ATCCAACGGCTNONE 
J075076C02ATCCAACGGCTNONE 
J090002P12ATCCAACGGCTNONE 
J090003A11ATCCAACGGCTNONE 
J090003H11ATCCAACGGCTNONE 
J090009M22ATCCAACGGCTNONE 
J090009O11ATCCAACGGCTNONE 
J090014N09ATCCAACGGCTNONE 
J090015A18ATCCAACGGCTNONE 
J090016E16ATCCAACGGCTNONE 
J090016I07ATCCAACGGCTNONE 
J090017O07ATCCAACGGCTNONE 
J090019E10ATCCAACGGCTNONE 
J090020D24ATCCAACGGCTNONE 
J090021M16ATCCAACGGCTNONE 
J090022F13ATCCAACGGCTNONE 
J090023H03ATCCAACGGCTNONE 
J090024E15ATCCAACGGCTNONE 
J090024G19ATCCAACGGCTNONE 
J090026J19ATCCAACGGCTNONE 
J090030E20ATCCAACGGCTNONE 
J090030I15ATCCAACGGCTNONE 
J090032F04ATCCAACGGCTNONE 
J090033N22ATCCAACGGCTNONE 
J090033O19ATCCAACGGCTNONE 
J090036F08ATCCAACGGCTNONE 
J090039A13ATCCAACGGCTNONE 
J090042N07ATCCAACGGCTNONE 
J090043C15ATCCAACGGCTNONE 
J090043N09ATCCAACGGCTNONE 
J090053J10ATCCAACGGCTNONE 
J090054F14ATCCAACGGCTNONE 
J090057N12ATCCAACGGCTNONE 
J090061P13ATCCAACGGCTNONE 
J090062F17ATCCAACGGCTNONE 
J090065H15ATCCAACGGCTNONE 
J090067P11ATCCAACGGCTNONE 
J090068M09ATCCAACGGCTNONE 
J090069E24ATCCAACGGCTNONE 
J090069K16ATCCAACGGCTNONE 
J090070N07ATCCAACGGCTNONE 
J090072M09ATCCAACGGCTNONE 
J090075I24ATCCAACGGCTNONE 
J090075M04ATCCAACGGCTNONE 
J090077D24ATCCAACGGCTNONE 
J090080M17ATCCAACGGCTNONE 
J090080O14ATCCAACGGCTNONE 
J090081C12ATCCAACGGCTNONE 
J090084N21ATCCAACGGCTNONE 
J090084O21ATCCAACGGCTNONE 
J090087J18ATCCAACGGCTNONE 
J090092L17ATCCAACGGCTNONE 
J090097A08ATCCAACGGCTNONE 
J100017E24ATCCAACGGCTNONE 
J100018K11ATCCAACGGCTNONE 
J100019A16ATCCAACGGCTNONE 
J100023I23ATCCAACGGCTNONE 
J100024D07ATCCAACGGCTNONE 
J100025H12ATCCAACGGCTNONE 
J100027K19ATCCAACGGCTNONE 
J100028C23ATCCAACGGCTNONE 
J100029A14ATCCAACGGCTNONE 
J100029O19ATCCAACGGCTNONE 
J100030I09ATCCAACGGCTNONE 
J100030J16ATCCAACGGCTNONE 
J100031C01ATCCAACGGCTNONE 
J100031N06ATCCAACGGCTNONE 
J100033H04ATCCAACGGCTNONE 
J100034L20ATCCAACGGCTNONE 
J100036K13ATCCAACGGCTNONE 
J100039M02ATCCAACGGCTNONE 
J100040J01ATCCAACGGCTNONE 
J100042O21ATCCAACGGCTNONE 
J100042P20ATCCAACGGCTNONE 
J100047K22ATCCAACGGCTNONE 
J100049B16ATCCAACGGCTNONE 
J100052M10ATCCAACGGCTNONE 
J100053B05ATCCAACGGCTNONE 
J100053B20ATCCAACGGCTNONE 
J100055I11ATCCAACGGCTNONE 
J100056A13ATCCAACGGCTNONE 
J100057C08ATCCAACGGCTNONE 
J100057N11ATCCAACGGCTNONE 
J100057P07ATCCAACGGCTNONE 
J100059E16ATCCAACGGCTNONE 
J100063N14ATCCAACGGCTNONE 
J100069H01ATCCAACGGCTNONE 
J100071C17ATCCAACGGCTNONE 
J100071K09ATCCAACGGCTNONE 
J100077D07ATCCAACGGCTNONE 
J100078P22ATCCAACGGCTNONE 
J100080F11ATCCAACGGCTNONE 
J100081L07ATCCAACGGCTNONE 
J100083B10ATCCAACGGCTNONE 
J100083K17ATCCAACGGCTNONE 
J100085B22ATCCAACGGCTNONE 
J100085L21ATCCAACGGCTNONE 
J100086B11ATCCAACGGCTNONE 
J100087E06ATCCAACGGCTNONE 
J100087P07ATCCAACGGCTNONE 
J100089H24ATCCAACGGCTNONE 
Os12g0125200J065062L18ATCCAACGGConserved hypothetical protein. 
Os12g0137500011-018-C07GCCGTTGGATNONE 
AY224436GCCGTTGGATSimilar to Avr9/Cf-9 rapidly elicited protein 271 (Fragment). 
J013147P17GCCGTTGGATNONE 
J013153A04GCCGTTGGATNONE 
J023006N14GCCGTTGGATNONE 
J023045C20GCCGTTGGATNONE 
J033065M21GCCGTTGGATNONE 
J033070P21GCCGTTGGATNONE 
J090010P14GCCGTTGGATNONE 
J090024N03GCCGTTGGATNONE 
J090027L04GCCGTTGGATNONE 
J090068E18GCCGTTGGATNONE 
Os12g0149000AK108734ATCCAACGGCConserved hypothetical protein. 
Os12g0197400J013068J02ATCCAACGNONE 
J013074K04ATCCAACGNONE 
J013089J21ATCCAACGNONE 
J013170B12ATCCAACGNONE 
J033029L11ATCCAACGNONE 
J033051A07ATCCAACGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18ATCCAACGNONE 
J065101D01ATCCAACGNONE 
J065144J23ATCCAACGNONE 
J065206D18ATCCAACGNONE 
Os12g0223000AK110855CCGTTGGATConserved hypothetical protein. 
Os12g0264800006-098-D10ATCCAACGNONE 
AK061213ATCCAACGConserved hypothetical protein. 
Os12g0275500009-200-B09CGTTGGATNONE 
AK063250CGTTGGATHypothetical protein. 
Os12g0408800AK059660ATCCAACGNONE 
AK068032ATCCAACGNONE 
J013131D11ATCCAACGNONE 
Os12g0502100Os12g0502100GCCGTTGGATCTGGGCConserved hypothetical protein. 
Os12g0535400004-008-H02CGTTGGATNONE 
AK065318CGTTGGATHypothetical protein. 
J013002P10CGTTGGATNONE 
Os12g0578300AK100503ATCCAACGCalmodulin-binding, plant family protein. 
J023099K02ATCCAACGNONE 
Os12g0610950J075157D04AGCCGTTGGATHypothetical protein. 
Os12g0624100AK107389CGTTGGATConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.