version

Summary of OsREG483 (All List)

OrganismOryza sativa  
IDOsREG483  
SequenceATCCGACG  
Annotation  
PPDB MotifCCGAC  DRE core, stress response  
PLACE MotifCGACG  "CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;  
Total Entry Count2050  

Entry Sequences (2050 entries)

LocusGene modelSequenceDescription
Os01g0158100AK109233ATCCGACGGPentatricopeptide repeat containing protein. 
Os01g0184000015-008-B06CCGTCGGATCNONE 
AK071130CCGTCGGATCNUC156 family protein. 
AK100604CCGTCGGATCNONE 
Os01g0331900013-026-D04GCCACGTCGGATNONE 
AK064784GCCACGTCGGATNONE 
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GCCACGTCGGATNONE 
J033090D07GCCACGTCGGATNONE 
J090006L21GCCACGTCGGATNONE 
Os01g0363600014-029-H08CCGTCGGATNONE 
AK063667CCGTCGGATConserved hypothetical protein. 
Os01g0571700AK120410CCGTCGGATCNucleic acid-binding, OB-fold domain containing protein. 
Os01g0663400016-054-B01CCGATCCGACGGNONE 
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CCGATCCGACGGNONE 
J065180A21CCGATCCGACGGNONE 
J075026E13CCGATCCGACGGNONE 
J075109M23CCGATCCGACGGNONE 
J075151A02CCGATCCGACGGNONE 
J090004B07CCGATCCGACGGNONE 
J090023O22CCGATCCGACGGNONE 
J090054G09CCGATCCGACGGNONE 
J090058H13CCGATCCGACGGNONE 
J090076G13CCGATCCGACGGNONE 
J100057F11CCGATCCGACGGNONE 
Os01g0693900AK066034CCGTCGGATNONE 
AK066034CCGTCGGATNONE 
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein. 
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein. 
J065165G19CCGTCGGATNONE 
J065165G19CCGTCGGATNONE 
J100042C04CCGTCGGATNONE 
J100042C04CCGTCGGATNONE 
Os01g0736100011-091-H04CCGTCGGATCNONE 
015-004-D10CCGTCGGATCNONE 
AK064298CCGTCGGATCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365CCGTCGGATCNONE 
AK103355CCGTCGGATCNONE 
J033044B20CCGTCGGATCNONE 
J033094G06CCGTCGGATCNONE 
J033111N02CCGTCGGATCNONE 
J033111P10CCGTCGGATCNONE 
J033126K03CCGTCGGATCNONE 
J043034D12CCGTCGGATCNONE 
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0835500AK100241ATCCGACGGSimilar to Respiratory burst oxidase protein. 
Os01g0844800AK099801GATCCGACGGSimilar to Pumilio RBD (Fragment). 
AK102882GATCCGACGGNONE 
AK103686GATCCGACGGNONE 
Os01g0848200AK069425ATCCGACGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230ATCCGACGNONE 
Os01g0848550J065073P06CGTCGGATConserved hypothetical protein. 
Os01g0856900AK107570GATCCGACGGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03GATCCGACGNONE 
J075028J03GATCCGACGNONE 
J075052C05GATCCGACGNONE 
J075199J04GATCCGACGNONE 
J090052L20GATCCGACGNONE 
J090075L24GATCCGACGNONE 
Os01g0877400AK106754ATCCGACGSimilar to Avr9 elicitor response-like protein. 
Os01g0889400012-011-B10CGTCGGATCNONE 
AB200237CGTCGGATCNONE 
AK071407CGTCGGATCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2). 
AK119575CGTCGGATCNONE 
J023089G14CGTCGGATCNONE 
J075028N06CGTCGGATCNONE 
J075121D21CGTCGGATCNONE 
J075122K20CGTCGGATCNONE 
J075176J05CGTCGGATCNONE 
J080025B12CGTCGGATCNONE 
J080040M21CGTCGGATCNONE 
J080041I06CGTCGGATCNONE 
J080047F15CGTCGGATCNONE 
J080067B19CGTCGGATCNONE 
J080068J04CGTCGGATCNONE 
J080068M01CGTCGGATCNONE 
J080077C15CGTCGGATCNONE 
J080079M04CGTCGGATCNONE 
J080306O05CGTCGGATCNONE 
J090004J23CGTCGGATCNONE 
Os01g0900800009-086-C08GATCCGACGNONE 
AK068254GATCCGACGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713GATCCGACGNONE 
J053025O10GATCCGACGNONE 
J065063K24GATCCGACGNONE 
J065167N21GATCCGACGNONE 
J100060A20GATCCGACGNONE 
J100079J03GATCCGACGNONE 
J100087D11GATCCGACGNONE 
J100089K10GATCCGACGNONE 
Os01g0917100AK107234CCGTCGGATCConserved hypothetical protein. 
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM. 
Os02g0115900AF006825CCGTCGGATCNONE 
AK065743CCGTCGGATCEndosperm lumenal binding protein. 
AK119653CCGTCGGATCNONE 
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein. 
J065117F22CGTCGGATGAGACGTGNONE 
Os02g0223700J013106E03ATCCGACGGConserved hypothetical protein. 
J100061D19ATCCGACGGNONE 
J100088J17ATCCGACGGNONE 
Os02g0236800014-080-B04GATCCGACGGNONE 
AK068642GATCCGACGGNONE 
AK099886GATCCGACGGSimilar to Peroxidase (EC 1.11.1.7). 
AK104670GATCCGACGGNONE 
Os02g0453300006-099-D03CGTCGGATNONE 
009-120-D02CGTCGGATNONE 
AK071220CGTCGGATNONE 
AK109380CGTCGGATConserved hypothetical protein. 
J023083M17CGTCGGATNONE 
Os02g0533800009-149-F12ATCCGACGGNONE 
013-058-H02ATCCGACGGNONE 
014-017-G07ATCCGACGGNONE 
014-028-F04ATCCGACGGNONE 
014-050-G04ATCCGACGGNONE 
014-095-F04ATCCGACGGNONE 
014-099-C08ATCCGACGGNONE 
016-046-F05ATCCGACGGNONE 
AK121139ATCCGACGGConserved hypothetical protein. 
J013104A14ATCCGACGGNONE 
J023077F13ATCCGACGGNONE 
J023145I11ATCCGACGGNONE 
J065033D14ATCCGACGGNONE 
J065079I15ATCCGACGGNONE 
J065104E21ATCCGACGGNONE 
J065128E06ATCCGACGGNONE 
J065174F07ATCCGACGGNONE 
J065195B12ATCCGACGGNONE 
J065207B12ATCCGACGGNONE 
J080304M24ATCCGACGGNONE 
J090040A13ATCCGACGGNONE 
J090054B18ATCCGACGGNONE 
J100037A06ATCCGACGGNONE 
J100042F24ATCCGACGGNONE 
J100043N23ATCCGACGGNONE 
J100044H14ATCCGACGGNONE 
J100056K24ATCCGACGGNONE 
J100063O22ATCCGACGGNONE 
J100071G05ATCCGACGGNONE 
J100078G15ATCCGACGGNONE 
Os02g0605600016-017-B02GATCCGACGGCCCGNONE 
AK066104GATCCGACGGCCCGLUC7 related family protein. 
J013052G16GATCCGACGGCCCGNONE 
J043022E03GATCCGACGGCCCGNONE 
J065105P10GATCCGACGGCCCGNONE 
Os02g0626100003-107-B06ATCCGACGGNONE 
AK120127ATCCGACGGNONE 
Os02g0631000AK068667CCGTCGGATCConserved hypothetical protein. 
J013159L03CCGTCGGATCNONE 
J023119O20CCGTCGGATCNONE 
J090098N20CCGTCGGATCNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0658100AK064728CGTCGGATCNONE 
Os02g0760500009-140-F05GATCCGACGGNONE 
AK062958GATCCGACGGSimilar to ER6 protein (Fragment). 
J065057E02GATCCGACGGNONE 
J075060D20GATCCGACGGNONE 
J090090E17GATCCGACGGNONE 
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein. 
Os02g0785000AK103670ATCCGACGGlycosyl transferase, family 31 protein. 
J065179I04ATCCGACGNONE 
J065179J03ATCCGACGNONE 
Os02g0797600004-004-A08ATCCGACGGNONE 
006-050-H07ATCCGACGGNONE 
006-092-B02ATCCGACGGNONE 
006-100-B08ATCCGACGGNONE 
013-037-D09ATCCGACGGNONE 
013-068-H02ATCCGACGGNONE 
AK060857ATCCGACGGNONE 
AK098882ATCCGACGGNONE 
AK104474ATCCGACGGNONE 
AK120644ATCCGACGGConserved hypothetical protein. 
J013001F21ATCCGACGGNONE 
J013074D07ATCCGACGGNONE 
J013096H23ATCCGACGGNONE 
J013098H07ATCCGACGGNONE 
J013132L13ATCCGACGGNONE 
J013134K05ATCCGACGGNONE 
J013155B15ATCCGACGGNONE 
J023002L17ATCCGACGGNONE 
J023013B08ATCCGACGGNONE 
J023087I01ATCCGACGGNONE 
J033071O04ATCCGACGGNONE 
J065161N23ATCCGACGGNONE 
J075055G11ATCCGACGGNONE 
J075106J02ATCCGACGGNONE 
J080009D06ATCCGACGGNONE 
J080009N22ATCCGACGGNONE 
J080016L03ATCCGACGGNONE 
J080023E17ATCCGACGGNONE 
J080027A12ATCCGACGGNONE 
J080036M24ATCCGACGGNONE 
J080038N07ATCCGACGGNONE 
J080041A04ATCCGACGGNONE 
J080042K11ATCCGACGGNONE 
J080050A04ATCCGACGGNONE 
J080053G16ATCCGACGGNONE 
J080063D03ATCCGACGGNONE 
J080063F07ATCCGACGGNONE 
J080067H13ATCCGACGGNONE 
J080068F12ATCCGACGGNONE 
J080072G17ATCCGACGGNONE 
J080072I06ATCCGACGGNONE 
J080072J24ATCCGACGGNONE 
J080076G09ATCCGACGGNONE 
J080085H10ATCCGACGGNONE 
J080092I17ATCCGACGGNONE 
J080092N20ATCCGACGGNONE 
J080093G10ATCCGACGGNONE 
J090074C23ATCCGACGGNONE 
J090083O18ATCCGACGGNONE 
J100046M05ATCCGACGGNONE 
J100050N16ATCCGACGGNONE 
J100054D07ATCCGACGGNONE 
J100054O11ATCCGACGGNONE 
J100055F04ATCCGACGGNONE 
J100055H22ATCCGACGGNONE 
J100063A05ATCCGACGGNONE 
J100063I24ATCCGACGGNONE 
J100067I12ATCCGACGGNONE 
J100074A22ATCCGACGGNONE 
J100078B22ATCCGACGGNONE 
J100079B03ATCCGACGGNONE 
Os03g0177100AK068092ATCCGACGGTCCAGAConserved hypothetical protein. 
J100036F01ATCCGACGGTCCAGANONE 
J100040N06ATCCGACGGTCCAGANONE 
J100043E08ATCCGACGGTCCAGANONE 
Os03g0179400AK107046ATCCGACGSimilar to Avr9/Cf-9 induced kinase 1. 
Os03g0180400006-067-C02ATCCGACGNONE 
006-091-E05ATCCGACGNONE 
006-094-F06ATCCGACGNONE 
009-126-C06ATCCGACGNONE 
AB026558ATCCGACGNONE 
AK059929ATCCGACGNONE 
AK060026ATCCGACGNONE 
AK101031ATCCGACGProteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1). 
AK104324ATCCGACGNONE 
J023001I24ATCCGACGNONE 
J023150K05ATCCGACGNONE 
J033086P06ATCCGACGNONE 
J043017O21ATCCGACGNONE 
J043021K10ATCCGACGNONE 
J053034G22ATCCGACGNONE 
J053055G07ATCCGACGNONE 
J053095K16ATCCGACGNONE 
J065012G02ATCCGACGNONE 
J065022K22ATCCGACGNONE 
J065030B18ATCCGACGNONE 
J065030N19ATCCGACGNONE 
J065032A17ATCCGACGNONE 
J065032G24ATCCGACGNONE 
J065040M17ATCCGACGNONE 
J065071D18ATCCGACGNONE 
J065072E08ATCCGACGNONE 
J065085G14ATCCGACGNONE 
J065091H03ATCCGACGNONE 
J065108B21ATCCGACGNONE 
J065120G08ATCCGACGNONE 
J065124L20ATCCGACGNONE 
J065130M23ATCCGACGNONE 
J065138N18ATCCGACGNONE 
J065150F03ATCCGACGNONE 
J065169L24ATCCGACGNONE 
J065173G21ATCCGACGNONE 
J065201E10ATCCGACGNONE 
J065209P07ATCCGACGNONE 
J065218B04ATCCGACGNONE 
J075062P08ATCCGACGNONE 
J075097O11ATCCGACGNONE 
J090060L06ATCCGACGNONE 
J090067F04ATCCGACGNONE 
J090074G17ATCCGACGNONE 
Os03g0213600AK100407CCGTCGGATCConserved hypothetical protein. 
Os03g0217900AK119980CCGTCGGATCConserved hypothetical protein. 
J053089K18CCGTCGGATCNONE 
J090058B20CCGTCGGATCNONE 
J090081L09CCGTCGGATCNONE 
Os03g0276500011-014-A06ATCCGACGGNONE 
012-043-E04ATCCGACGGNONE 
012-096-G01ATCCGACGGNONE 
014-005-A07ATCCGACGGNONE 
014-031-F09ATCCGACGGNONE 
014-040-C09ATCCGACGGNONE 
014-092-G02ATCCGACGGNONE 
AK072830ATCCGACGGNONE 
AK099275ATCCGACGGNONE 
AK109474ATCCGACGGSimilar to Heat shock protein 70. 
J013036E08ATCCGACGGNONE 
J013047P03ATCCGACGGNONE 
J013048H14ATCCGACGGNONE 
J013060E24ATCCGACGGNONE 
J013093N10ATCCGACGGNONE 
J013123K11ATCCGACGGNONE 
J013153C09ATCCGACGGNONE 
J023010D20ATCCGACGGNONE 
J023027O13ATCCGACGGNONE 
J023029B01ATCCGACGGNONE 
J023063G14ATCCGACGGNONE 
J023083D09ATCCGACGGNONE 
J023091M13ATCCGACGGNONE 
J023121M10ATCCGACGGNONE 
J023126D10ATCCGACGGNONE 
J023139H01ATCCGACGGNONE 
J023145B18ATCCGACGGNONE 
J033029G15ATCCGACGGNONE 
J033050K13ATCCGACGGNONE 
J033057L09ATCCGACGGNONE 
J033092M15ATCCGACGGNONE 
J065007N14ATCCGACGGNONE 
J065038E07ATCCGACGGNONE 
J065043A09ATCCGACGGNONE 
J065100C19ATCCGACGGNONE 
J065117C02ATCCGACGGNONE 
J065213I04ATCCGACGGNONE 
J090001F01ATCCGACGGNONE 
J090025D07ATCCGACGGNONE 
J090037C11ATCCGACGGNONE 
J090047N11ATCCGACGGNONE 
J090053O05ATCCGACGGNONE 
J090070F11ATCCGACGGNONE 
J090082O16ATCCGACGGNONE 
J090085F20ATCCGACGGNONE 
J090096N08ATCCGACGGNONE 
Os03g0294200AK069285ATCCGACGSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0320500AK108145ATCCGACGVQ domain containing protein. 
J065122I01ATCCGACGNONE 
J100057H12ATCCGACGNONE 
J100078A15ATCCGACGNONE 
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE 
AK062803CGGGTGGGGCGTCGGATCHypothetical protein. 
AK070776CGGGTGGGGCGTCGGATCNONE 
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0337600AF119232ATCCGACGNONE 
AK070859ATCCGACGSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18ATCCGACGNONE 
J013147M17ATCCGACGNONE 
J065083M01ATCCGACGNONE 
J065199H24ATCCGACGNONE 
Os03g0343500009-042-G06CCGTCGGATCNONE 
009-063-D01CCGTCGGATCNONE 
009-156-H09CCGTCGGATCNONE 
AB117995CCGTCGGATCNONE 
AK058737CCGTCGGATCNONE 
AK059599CCGTCGGATCSimilar to 60S ribosomal protein L22-2. 
AK121502CCGTCGGATCNONE 
J023082D10CCGTCGGATCNONE 
J033022G11CCGTCGGATCNONE 
J075048M16CCGTCGGATCNONE 
J075049O20CCGTCGGATCNONE 
J075082I02CCGTCGGATCNONE 
J075105G01CCGTCGGATCNONE 
J075131K05CCGTCGGATCNONE 
J080002H01CCGTCGGATCNONE 
J080003H01CCGTCGGATCNONE 
J080005G08CCGTCGGATCNONE 
J080011M13CCGTCGGATCNONE 
J080020M02CCGTCGGATCNONE 
J080026N24CCGTCGGATCNONE 
J080028L09CCGTCGGATCNONE 
J080032O14CCGTCGGATCNONE 
J080033J12CCGTCGGATCNONE 
J080035D05CCGTCGGATCNONE 
J080039H01CCGTCGGATCNONE 
J080044B07CCGTCGGATCNONE 
J080044E23CCGTCGGATCNONE 
J080049N11CCGTCGGATCNONE 
J080050A21CCGTCGGATCNONE 
J080055L24CCGTCGGATCNONE 
J080059N20CCGTCGGATCNONE 
J080061F04CCGTCGGATCNONE 
J080078I16CCGTCGGATCNONE 
J080079G24CCGTCGGATCNONE 
J080080K13CCGTCGGATCNONE 
J080083G20CCGTCGGATCNONE 
J080087B08CCGTCGGATCNONE 
J080091L19CCGTCGGATCNONE 
J080094D06CCGTCGGATCNONE 
J090038L06CCGTCGGATCNONE 
J090075H06CCGTCGGATCNONE 
J090081D12CCGTCGGATCNONE 
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39. 
J023106M18CCGATCCGACGGCCCGNONE 
J065178J05CCGATCCGACGGCCCGNONE 
J065196F10CCGATCCGACGGCCCGNONE 
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE 
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953ATCCGACGGCCCAGGNONE 
AK099558ATCCGACGGCCCAGGNONE 
AK104547ATCCGACGGCCCAGGNONE 
J013034B14ATCCGACGGCCCAGGNONE 
J013066J17ATCCGACGGCCCAGGNONE 
J090033N14ATCCGACGGCCCAGGNONE 
Os03g0633800AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment). 
J065038L22GATCCGACGGCCCNONE 
J065185C13GATCCGACGGCCCNONE 
Os03g0654800013-068-E05CCGTCGGATNONE 
AK103330CCGTCGGATHypothetical protein. 
J033125N05CCGTCGGATNONE 
J065171F15CCGTCGGATNONE 
J100056J05CCGTCGGATNONE 
J100069D02CCGTCGGATNONE 
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein. 
AK100108CCGTCGGATCGGNONE 
J023004N24CCGTCGGATCGGNONE 
J100018K24CCGTCGGATCGGNONE 
J100032B22CCGTCGGATCGGNONE 
J100036K14CCGTCGGATCGGNONE 
J100043B05CCGTCGGATCGGNONE 
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein. 
J065100I07ATCCGACGGCCCAGGNONE 
Os03g0745600014-030-E09CGCCACGTCGGATCNONE 
J053057E07CGCCACGTCGGATCNONE 
J075044L08CGCCACGTCGGATCNONE 
J075069C24CGCCACGTCGGATCNONE 
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein. 
J075180G21CGCCACGTCGGATCNONE 
J075189M22CGCCACGTCGGATCNONE 
J075192P11CGCCACGTCGGATCNONE 
Os03g0753600AK067449CCGTCGGATCChromo domain containing protein. 
J013107L13CCGTCGGATCNONE 
Os03g0758800AJ252135GATCCGACGGNONE 
AJ312906GATCCGACGGNONE 
AK060387GATCCGACGGSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GATCCGACGGNONE 
J023109G09GATCCGACGGNONE 
J033038B14GATCCGACGGNONE 
J043013C09GATCCGACGGNONE 
J053096E21GATCCGACGGNONE 
J065026B08GATCCGACGGNONE 
J065062B16GATCCGACGGNONE 
J065066E03GATCCGACGGNONE 
J065091J12GATCCGACGGNONE 
J065164A06GATCCGACGGNONE 
J075014I20GATCCGACGGNONE 
J075117N07GATCCGACGGNONE 
J075142M03GATCCGACGGNONE 
J075175D04GATCCGACGGNONE 
J075188M01GATCCGACGGNONE 
J075199I20GATCCGACGGNONE 
J090010J12GATCCGACGGNONE 
J090025O16GATCCGACGGNONE 
J090041H05GATCCGACGGNONE 
J090078P07GATCCGACGGNONE 
J100031K10GATCCGACGGNONE 
J100055F23GATCCGACGGNONE 
J100064G05GATCCGACGGNONE 
J100080C24GATCCGACGGNONE 
J100080O07GATCCGACGGNONE 
J100090F01GATCCGACGGNONE 
Os03g0789800AK106804ATCCGACGNONE 
J065068E17ATCCGACGNONE 
J090016H22ATCCGACGNONE 
Os03g0820600013-030-F01ATCCGACGNONE 
AK058941ATCCGACGSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3). 
J065038I10ATCCGACGNONE 
J065043C23ATCCGACGNONE 
J065060H20ATCCGACGNONE 
J065065E06ATCCGACGNONE 
J065078K18ATCCGACGNONE 
J065116J24ATCCGACGNONE 
J065118G22ATCCGACGNONE 
J065129D16ATCCGACGNONE 
J065153G20ATCCGACGNONE 
J065159I03ATCCGACGNONE 
J065176E14ATCCGACGNONE 
J065187B11ATCCGACGNONE 
J065203D14ATCCGACGNONE 
J065217P15ATCCGACGNONE 
J075105D14ATCCGACGNONE 
J100036F11ATCCGACGNONE 
J100044M07ATCCGACGNONE 
Os03g0848600AK065662ATCCGACGSimilar to NOI protein. 
J013041L20ATCCGACGNONE 
J053074F15ATCCGACGNONE 
J090098L10ATCCGACGNONE 
Os04g0253000005-012-H08ATCCGACGGNONE 
009-095-D01ATCCGACGGNONE 
016-090-D11ATCCGACGGNONE 
AK073668ATCCGACGGSimilar to Histone H1. 
J013088G23ATCCGACGGNONE 
J013162C07ATCCGACGGNONE 
J023031N06ATCCGACGGNONE 
J023039N07ATCCGACGGNONE 
J023083I01ATCCGACGGNONE 
J023083O14ATCCGACGGNONE 
J023122B19ATCCGACGGNONE 
J023133L08ATCCGACGGNONE 
J033052L06ATCCGACGGNONE 
J033080E10ATCCGACGGNONE 
J090032L14ATCCGACGGNONE 
J100022N05ATCCGACGGNONE 
J100029A08ATCCGACGGNONE 
J100029H18ATCCGACGGNONE 
J100066D09ATCCGACGGNONE 
J100077M22ATCCGACGGNONE 
Os04g0269900J065139P11CGTCGGATCGGNONE 
J100034P12CGTCGGATCGGNONE 
J100045D21CGTCGGATCGGNONE 
Os04g0401000006-024-G01GATCCGACGGNONE 
009-047-D03GATCCGACGGNONE 
009-078-G04GATCCGACGGNONE 
009-083-C06GATCCGACGGNONE 
009-094-D02GATCCGACGGNONE 
009-129-B02GATCCGACGGNONE 
009-186-E03GATCCGACGGNONE 
AK070581GATCCGACGGNONE 
AK072320GATCCGACGGNONE 
AK106153GATCCGACGGHeavy metal transport/detoxification protein domain containing protein. 
Os04g0405600015-003-G04ATCCGACGGNONE 
AK068579ATCCGACGGProtein of unknown function DUF1350 family protein. 
AK101565ATCCGACGGNONE 
J013023M11ATCCGACGGNONE 
J013055A13ATCCGACGGNONE 
J013157C11ATCCGACGGNONE 
J033128I12ATCCGACGGNONE 
J065193N19ATCCGACGGNONE 
J090055C15ATCCGACGGNONE 
J090058C22ATCCGACGGNONE 
J090077L18ATCCGACGGNONE 
J090086C04ATCCGACGGNONE 
J090095D03ATCCGACGGNONE 
J100040K04ATCCGACGGNONE 
J100040M11ATCCGACGGNONE 
Os04g0449100AK110929CCGTCGGATXyloglucan fucosyltransferase family protein. 
Os04g0470300AK059742ATCCGACGGNONE 
AK070483ATCCGACGGProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06ATCCGACGGNONE 
J090047A18ATCCGACGGNONE 
Os04g0484900AK122179GATCCGACGGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J023093A12GATCCGACGGNONE 
J033024H07GATCCGACGGNONE 
J033149C03GATCCGACGGNONE 
Os04g0530300009-053-E04CGTCGGATCGGNONE 
009-074-E03CGTCGGATCGGNONE 
AK066705CGTCGGATCGGConserved hypothetical protein. 
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein. 
Os04g0576300J065199E10GATCCGACGPseudouridylate synthase TruB, N-terminal domain containing protein. 
Os04g0627900AK108443ATCCGACGTranslation initiation factor SUI1 domain containing protein. 
J065178D17ATCCGACGNONE 
Os04g0661300AK070723ATCCGACGGConserved hypothetical protein. 
AK103942ATCCGACGGNONE 
Os04g0668700012-043-D01ATCCGACGNONE 
AK065237ATCCGACGPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCCGACGNONE 
J013002I02ATCCGACGNONE 
J013059C11ATCCGACGNONE 
J013059D22ATCCGACGNONE 
J013063G18ATCCGACGNONE 
J013088O04ATCCGACGNONE 
J013095K03ATCCGACGNONE 
J013096K15ATCCGACGNONE 
J013100O17ATCCGACGNONE 
J013102F10ATCCGACGNONE 
J013111L07ATCCGACGNONE 
J013127E24ATCCGACGNONE 
J013130A10ATCCGACGNONE 
J013134L13ATCCGACGNONE 
J023109G08ATCCGACGNONE 
J033022E17ATCCGACGNONE 
J033022N13ATCCGACGNONE 
J033026D04ATCCGACGNONE 
J033028M05ATCCGACGNONE 
J033037E04ATCCGACGNONE 
J033042D11ATCCGACGNONE 
J033044N20ATCCGACGNONE 
J033046K11ATCCGACGNONE 
J033046M21ATCCGACGNONE 
J033076E19ATCCGACGNONE 
J033076J24ATCCGACGNONE 
J033086N03ATCCGACGNONE 
J033095F22ATCCGACGNONE 
J033115F17ATCCGACGNONE 
J033117M06ATCCGACGNONE 
J033125D22ATCCGACGNONE 
J033129J10ATCCGACGNONE 
J033145E18ATCCGACGNONE 
J043021F24ATCCGACGNONE 
J053046G14ATCCGACGNONE 
J053090P03ATCCGACGNONE 
J065042N10ATCCGACGNONE 
J065053B13ATCCGACGNONE 
J065085G03ATCCGACGNONE 
J065173J11ATCCGACGNONE 
J090014M14ATCCGACGNONE 
J090027J07ATCCGACGNONE 
J090039E23ATCCGACGNONE 
J090051C15ATCCGACGNONE 
J090055H06ATCCGACGNONE 
J090062L03ATCCGACGNONE 
J100017L21ATCCGACGNONE 
J100024B07ATCCGACGNONE 
J100032G07ATCCGACGNONE 
J100040N09ATCCGACGNONE 
J100062N03ATCCGACGNONE 
J100078E07ATCCGACGNONE 
J100080E14ATCCGACGNONE 
J100084D07ATCCGACGNONE 
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE 
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCGATCCGACGCGTCCGTCCGNONE 
J100041J04CCGATCCGACGCGTCCGTCCGNONE 
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein. 
J033091I05ATCCGACGTGGCNONE 
Os05g0151200J065041L18ATCCGACGTspO/MBR-related protein family protein. 
J065168L08ATCCGACGNONE 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0176100AF030052ATCCGACGGNONE 
AF030052ATCCGACGGCCGAGATNONE 
AK067850ATCCGACGGNONE 
AK067850ATCCGACGGCCGAGATNONE 
AK067967ATCCGACGGNONE 
AK067967ATCCGACGGCCGAGATNONE 
AK098978ATCCGACGGNONE 
AK098978ATCCGACGGCCGAGATNONE 
AK099228ATCCGACGGNONE 
AK099228ATCCGACGGCCGAGATNONE 
AK099281ATCCGACGGNONE 
AK099281ATCCGACGGCCGAGATNONE 
AK100188ATCCGACGGSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140ATCCGACGGNONE 
AK102140ATCCGACGGCCGAGATNONE 
Os05g0189900AK061489ATCCGACGGVirulence factor, pectin lyase fold family protein. 
Os05g0249100016-087-B02CGTCGGATNONE 
AK064291CGTCGGATConserved hypothetical protein. 
AK103049CGTCGGATNONE 
J033117G22CGTCGGATNONE 
J065021C19CGTCGGATNONE 
J065205P17CGTCGGATNONE 
Os05g0379300AK109293CCGTCGGATConserved hypothetical protein. 
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1. 
AK098990TTTTGGGCCCAATCCGACGNONE 
AK104689TTTTGGGCCCAATCCGACGNONE 
J013094L23TTTTGGGCCCAATCCGACGNONE 
J065118O04TTTTGGGCCCAATCCGACGNONE 
Os05g0395300AK066212CGGACGGCATCCGACGGProtein of unknown function DUF21 domain containing protein. 
Os05g0400700009-099-F02GATCCGACGGNONE 
AK072739GATCCGACGGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GATCCGACGGNONE 
J023138C10GATCCGACGGNONE 
Os05g0411600AK101609CGTCGGATCCGACSingle-stranded nucleic acid binding R3H domain containing protein. 
AY224459CGTCGGATCCGACNONE 
J065042L01CGTCGGATCCGACNONE 
J100068I05CGTCGGATCCGACNONE 
J100075L14CGTCGGATCCGACNONE 
Os05g0415600AK065818CCGTCGGATCNONE 
J013042K21CCGTCGGATCNONE 
J013114E15CCGTCGGATCNONE 
J013131H02CCGTCGGATCNONE 
J023041G06CCGTCGGATCNONE 
J100037M21CCGTCGGATCNONE 
Os05g0422900AK073629GATCCGACGConserved hypothetical protein. 
J023126I07GATCCGACGNONE 
J023143K12GATCCGACGNONE 
J033051N08GATCCGACGNONE 
J033128I04GATCCGACGNONE 
J065067M02GATCCGACGNONE 
J080312N05GATCCGACGNONE 
J100032G23GATCCGACGNONE 
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE 
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0430200J090095K16ATCCGACGGCCCGNONE 
Os05g0454400AK107942ATCCGACGConserved hypothetical protein. 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0460000011-074-F09ATCCGACGGNONE 
J023002L01ATCCGACGGNONE 
J023060I12ATCCGACGGNONE 
J023060O12ATCCGACGGNONE 
J023106P08ATCCGACGGNONE 
J023141D17ATCCGACGGNONE 
J023150E11ATCCGACGGSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20ATCCGACGGNONE 
J033039H14ATCCGACGGNONE 
J033101B11ATCCGACGGNONE 
J033101B12ATCCGACGGNONE 
J033114A09ATCCGACGGNONE 
J090037G06ATCCGACGGNONE 
J090048G13ATCCGACGGNONE 
J090090F15ATCCGACGGNONE 
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment). 
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE 
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE 
Os05g0552300AK062179ATCCGACGGSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK065272ATCCGACGGNONE 
AK121567ATCCGACGGNONE 
J013002L07ATCCGACGGNONE 
J013096F06ATCCGACGGNONE 
J013111B06ATCCGACGGNONE 
J023024K23ATCCGACGGNONE 
J023036P19ATCCGACGGNONE 
J033034A18ATCCGACGGNONE 
J033034P13ATCCGACGGNONE 
J033051E12ATCCGACGGNONE 
J033087M05ATCCGACGGNONE 
J033092G03ATCCGACGGNONE 
J033098N21ATCCGACGGNONE 
J033103B15ATCCGACGGNONE 
J043038F23ATCCGACGGNONE 
J065096K22ATCCGACGGNONE 
J065167D17ATCCGACGGNONE 
J100040H06ATCCGACGGNONE 
J100048M06ATCCGACGGNONE 
J100087G01ATCCGACGGNONE 
Os05g0571800009-157-G07ATCCGACGGNONE 
AK063033ATCCGACGGConserved hypothetical protein. 
Os05g0574500006-021-A08ATCCGACGGCCGAAANONE 
006-049-A11ATCCGACGGCCGAAANONE 
006-086-F03ATCCGACGGCCGAAANONE 
009-051-F06ATCCGACGGCCGAAANONE 
AB015287ATCCGACGGCCGAAANONE 
AB015972ATCCGACGGCCGAAANONE 
AK061714ATCCGACGGCCGAAANONE 
AK098889ATCCGACGGCCGAAANONE 
AK121699ATCCGACGGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCGACGGCCGAAANONE 
J013072D17ATCCGACGGCCGAAANONE 
J023028M04ATCCGACGGCCGAAANONE 
J023031F01ATCCGACGGCCGAAANONE 
J023114L22ATCCGACGGCCGAAANONE 
J033058L12ATCCGACGGCCGAAANONE 
J033073D17ATCCGACGGCCGAAANONE 
J043031D08ATCCGACGGCCGAAANONE 
J043036G01ATCCGACGGCCGAAANONE 
J065144O04ATCCGACGGCCGAAANONE 
J065181O08ATCCGACGGCCGAAANONE 
J080066B20ATCCGACGGCCGAAANONE 
Os05g0591400AK120015GATCCGACGGHeat shock protein Hsp70 family protein. 
Os05g0592600011-064-D09ATCCGACGNONE 
015-032-B11ATCCGACGNONE 
AK073484ATCCGACGInitiation factor 2 family protein. 
AK099632ATCCGACGNONE 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J090038E06ATCCGACGGCCCAGATNONE 
Os06g0153600AK099903CCGAGCCGTCGGATNONE 
AK109685CCGAGCCGTCGGATConserved hypothetical protein. 
Os06g0192600AB033535ATCCGACGGNONE 
AB033535CCGTCGGATCNONE 
AK061876ATCCGACGG26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7). 
AK061876CCGTCGGATC26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7). 
AK070538ATCCGACGGNONE 
AK070538CCGTCGGATCNONE 
AK100060ATCCGACGGNONE 
AK100060CCGTCGGATCNONE 
AK103801ATCCGACGGNONE 
AK103801CCGTCGGATCNONE 
Os06g0265000AK100247ATCCGACGGSimilar to Asparagine synthetase. 
D83378ATCCGACGGNONE 
J013033O15ATCCGACGGNONE 
J013037K20ATCCGACGGNONE 
J013058I07ATCCGACGGNONE 
J033125M21ATCCGACGGNONE 
J033142B02ATCCGACGGNONE 
J043030E23ATCCGACGGNONE 
J043034K11ATCCGACGGNONE 
J053050B10ATCCGACGGNONE 
J053061I09ATCCGACGGNONE 
J053068F17ATCCGACGGNONE 
J053074G11ATCCGACGGNONE 
J053095N11ATCCGACGGNONE 
J090028M17ATCCGACGGNONE 
J090031O08ATCCGACGGNONE 
J090094C22ATCCGACGGNONE 
J100045M24ATCCGACGGNONE 
J100055P03ATCCGACGGNONE 
J100073O10ATCCGACGGNONE 
J100081K21ATCCGACGGNONE 
U55873ATCCGACGGNONE 
Os06g0308300AK059211CCGTCGGATCGGNONE 
AK101549CCGTCGGATCGGNONE 
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein. 
J090014G18CCGTCGGATCGGNONE 
J090082B01CCGTCGGATCGGNONE 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0518100AK119810CGTCGGATCConserved hypothetical protein. 
Os06g0560400AK103575CCGATCCGACGTGTCCNONE 
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0596300AK120303CCGTCGGATCSimilar to Acyl-ACP thioesterase (Fragment). 
Os06g0621300AK068751ATCCGACGConserved hypothetical protein. 
J013159I20ATCCGACGNONE 
Os06g0696400011-019-C01CCGTCGGATNONE 
011-027-D04CCGTCGGATNONE 
013-051-H10CCGTCGGATNONE 
013-054-A06CCGTCGGATNONE 
013-061-D06CCGTCGGATNONE 
013-088-F04CCGTCGGATNONE 
014-018-C07CCGTCGGATNONE 
014-026-E10CCGTCGGATNONE 
AK058291CCGTCGGATNONE 
AK066125CCGTCGGATNONE 
AK104912CCGTCGGATNONE 
BT014685CCGTCGGATSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCGTCGGATNONE 
J065065L22CCGTCGGATNONE 
J065084O06CCGTCGGATNONE 
J075006O13CCGTCGGATNONE 
J075013J18CCGTCGGATNONE 
J075018L23CCGTCGGATNONE 
J075036E14CCGTCGGATNONE 
J075039K21CCGTCGGATNONE 
J075075H13CCGTCGGATNONE 
J075091A14CCGTCGGATNONE 
J075093I09CCGTCGGATNONE 
J075136L17CCGTCGGATNONE 
J075156M24CCGTCGGATNONE 
J075174J01CCGTCGGATNONE 
J075179P15CCGTCGGATNONE 
J075181F02CCGTCGGATNONE 
J075194L24CCGTCGGATNONE 
J080302J02CCGTCGGATNONE 
J080304J11CCGTCGGATNONE 
J080308A15CCGTCGGATNONE 
J100041B09CCGTCGGATNONE 
Os06g0696500J080303G16CGTCGGATSimilar to Xyloglycan endo-transglycosylase precursor. 
J080310K14CGTCGGATNONE 
J080317J18CGTCGGATNONE 
J080318F11CGTCGGATNONE 
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE 
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein. 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0115500AK108206GATCCGACGGConserved hypothetical protein. 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1. 
AK059544CCGTCGGATSimilar to Variant of histone H1. 
AK099050CCGATCCGACGGNONE 
AK099050CCGTCGGATNONE 
AK102642CCGATCCGACGGNONE 
AK102642CCGTCGGATNONE 
AK106132CCGATCCGACGGNONE 
AK106132CCGTCGGATNONE 
J023037O08CCGATCCGACGGNONE 
J023037O08CCGTCGGATNONE 
J023050M02CCGATCCGACGGNONE 
J023050M02CCGTCGGATNONE 
J023087A10CCGATCCGACGGNONE 
J023087A10CCGTCGGATNONE 
J033027D14CCGATCCGACGGNONE 
J033027D14CCGTCGGATNONE 
J033028N17CCGATCCGACGGNONE 
J033028N17CCGTCGGATNONE 
J033043P10CCGATCCGACGGNONE 
J033043P10CCGTCGGATNONE 
J033051D07CCGATCCGACGGNONE 
J033051D07CCGTCGGATNONE 
J033073M07CCGATCCGACGGNONE 
J033073M07CCGTCGGATNONE 
J033075H01CCGATCCGACGGNONE 
J033075H01CCGTCGGATNONE 
J033084E04CCGATCCGACGGNONE 
J033084E04CCGTCGGATNONE 
J033096D10CCGATCCGACGGNONE 
J033096D10CCGTCGGATNONE 
J033100F04CCGATCCGACGGNONE 
J033100F04CCGTCGGATNONE 
J033114B06CCGATCCGACGGNONE 
J033114B06CCGTCGGATNONE 
J033117C10CCGATCCGACGGNONE 
J033117C10CCGTCGGATNONE 
J033140B21CCGATCCGACGGNONE 
J033140B21CCGTCGGATNONE 
J043034J07CCGATCCGACGGNONE 
J043034J07CCGTCGGATNONE 
J065006F04CCGATCCGACGGNONE 
J065006F04CCGTCGGATNONE 
J065130H16CCGATCCGACGGNONE 
J065130H16CCGTCGGATNONE 
J075020G13CCGATCCGACGGNONE 
J075020G13CCGTCGGATNONE 
J075108M17CCGATCCGACGGNONE 
J075108M17CCGTCGGATNONE 
J080018A06CCGATCCGACGGNONE 
J080018A06CCGTCGGATNONE 
J080037J11CCGATCCGACGGNONE 
J080037J11CCGTCGGATNONE 
J080048F15CCGATCCGACGGNONE 
J080048F15CCGTCGGATNONE 
J080057D16CCGATCCGACGGNONE 
J080057D16CCGTCGGATNONE 
J080069A10CCGATCCGACGGNONE 
J080069A10CCGTCGGATNONE 
J080086L09CCGATCCGACGGNONE 
J080086L09CCGTCGGATNONE 
J080088A17CCGATCCGACGGNONE 
J080088A17CCGTCGGATNONE 
J100046F24CCGATCCGACGGNONE 
J100046F24CCGTCGGATNONE 
Os07g0202450J065010G16GATCCGACGGNONE 
J065085G13GATCCGACGGNONE 
J065117M22GATCCGACGGNONE 
J065147K06GATCCGACGGNONE 
J065207G15GATCCGACGGNONE 
J090089M07GATCCGACGGNONE 
J100064D20GATCCGACGGSimilar to Mitosis protein dim1. 
Os07g0209000AK059111CCGTCGGATCSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319CCGTCGGATCNONE 
Os07g0258700AK068718ATCCGACGNONE 
AK069407ATCCGACGBTB domain containing protein. 
AK106061ATCCGACGNONE 
J080039L24ATCCGACGNONE 
Os07g0415200006-105-B10CCGTCGGATNONE 
AK061243CCGTCGGATNONE 
AK101796CCGTCGGATRibosomal L23 and L15e, core domain containing protein. 
AK104106CCGTCGGATNONE 
J033066C05CCGTCGGATNONE 
J065188B11CCGTCGGATNONE 
J065211E07CCGTCGGATNONE 
J090003E03CCGTCGGATNONE 
Os07g0419800J080309B06CCGTCGGATNONE 
Os07g0541500AK111550ATCCGACGGSimilar to KI domain interacting kinase 1. 
Os07g0545400009-136-E03CCGATCCGACGGNONE 
013-015-G08CCGATCCGACGGNONE 
AK059228CCGATCCGACGGNONE 
J065040D09CCGATCCGACGGNONE 
J065051C19CCGATCCGACGGNONE 
J065139B05CCGATCCGACGGNONE 
J065160E20CCGATCCGACGGNONE 
J065207I17CCGATCCGACGGNONE 
J080319M24CCGATCCGACGGNONE 
Os07g0557500AK101830ATCCGACGZinc finger, RING-type domain containing protein. 
J013075M04ATCCGACGNONE 
J033068I24ATCCGACGNONE 
Os07g0562700003-111-G08ATCCGACGTGGCNONE 
004-013-E07ATCCGACGTGGCNONE 
006-021-D03ATCCGACGTGGCNONE 
006-021-D07ATCCGACGTGGCNONE 
006-021-F09ATCCGACGTGGCNONE 
006-023-D01ATCCGACGTGGCNONE 
006-024-F04ATCCGACGTGGCNONE 
006-024-G09ATCCGACGTGGCNONE 
006-024-G11ATCCGACGTGGCNONE 
006-025-A10ATCCGACGTGGCNONE 
006-025-B08ATCCGACGTGGCNONE 
006-025-E10ATCCGACGTGGCNONE 
006-025-F10ATCCGACGTGGCNONE 
006-026-B04ATCCGACGTGGCNONE 
006-026-C08ATCCGACGTGGCNONE 
006-026-D03ATCCGACGTGGCNONE 
006-026-F03ATCCGACGTGGCNONE 
006-026-F08ATCCGACGTGGCNONE 
006-026-F12ATCCGACGTGGCNONE 
006-027-A10ATCCGACGTGGCNONE 
006-027-C03ATCCGACGTGGCNONE 
006-028-C03ATCCGACGTGGCNONE 
006-029-E02ATCCGACGTGGCNONE 
006-029-G05ATCCGACGTGGCNONE 
006-030-A10ATCCGACGTGGCNONE 
006-030-C06ATCCGACGTGGCNONE 
006-030-D03ATCCGACGTGGCNONE 
006-030-D06ATCCGACGTGGCNONE 
006-030-G05ATCCGACGTGGCNONE 
006-031-B10ATCCGACGTGGCNONE 
006-031-D04ATCCGACGTGGCNONE 
006-031-D11ATCCGACGTGGCNONE 
006-031-H09ATCCGACGTGGCNONE 
006-032-C09ATCCGACGTGGCNONE 
006-032-H09ATCCGACGTGGCNONE 
006-033-B02ATCCGACGTGGCNONE 
006-033-B09ATCCGACGTGGCNONE 
006-033-E01ATCCGACGTGGCNONE 
006-033-F06ATCCGACGTGGCNONE 
006-033-G03ATCCGACGTGGCNONE 
006-034-A08ATCCGACGTGGCNONE 
006-034-C09ATCCGACGTGGCNONE 
006-034-F06ATCCGACGTGGCNONE 
006-035-B12ATCCGACGTGGCNONE 
006-035-C12ATCCGACGTGGCNONE 
006-035-H04ATCCGACGTGGCNONE 
006-035-H12ATCCGACGTGGCNONE 
006-036-A05ATCCGACGTGGCNONE 
006-036-A09ATCCGACGTGGCNONE 
006-036-B10ATCCGACGTGGCNONE 
006-036-C03ATCCGACGTGGCNONE 
006-036-E06ATCCGACGTGGCNONE 
006-037-H11ATCCGACGTGGCNONE 
006-038-G01ATCCGACGTGGCNONE 
006-039-B01ATCCGACGTGGCNONE 
006-039-B12ATCCGACGTGGCNONE 
006-039-C02ATCCGACGTGGCNONE 
006-039-E06ATCCGACGTGGCNONE 
006-039-G12ATCCGACGTGGCNONE 
006-040-G07ATCCGACGTGGCNONE 
006-041-H04ATCCGACGTGGCNONE 
006-042-A11ATCCGACGTGGCNONE 
006-042-E07ATCCGACGTGGCNONE 
006-042-F12ATCCGACGTGGCNONE 
006-043-C01ATCCGACGTGGCNONE 
006-045-H12ATCCGACGTGGCNONE 
006-046-A12ATCCGACGTGGCNONE 
006-046-F03ATCCGACGTGGCNONE 
006-047-A07ATCCGACGTGGCNONE 
006-047-A09ATCCGACGTGGCNONE 
006-047-E10ATCCGACGTGGCNONE 
006-047-G12ATCCGACGTGGCNONE 
006-048-B04ATCCGACGTGGCNONE 
006-049-D01ATCCGACGTGGCNONE 
006-049-G02ATCCGACGTGGCNONE 
006-049-G10ATCCGACGTGGCNONE 
006-049-H04ATCCGACGTGGCNONE 
006-050-D05ATCCGACGTGGCNONE 
006-050-F05ATCCGACGTGGCNONE 
006-051-B05ATCCGACGTGGCNONE 
006-051-G12ATCCGACGTGGCNONE 
006-052-D12ATCCGACGTGGCNONE 
006-053-D06ATCCGACGTGGCNONE 
006-054-H02ATCCGACGTGGCNONE 
006-055-A03ATCCGACGTGGCNONE 
006-055-C01ATCCGACGTGGCNONE 
006-055-E07ATCCGACGTGGCNONE 
006-055-H06ATCCGACGTGGCNONE 
006-056-F06ATCCGACGTGGCNONE 
006-057-D03ATCCGACGTGGCNONE 
006-057-D05ATCCGACGTGGCNONE 
006-057-G01ATCCGACGTGGCNONE 
006-058-A03ATCCGACGTGGCNONE 
006-058-B06ATCCGACGTGGCNONE 
006-059-A09ATCCGACGTGGCNONE 
006-059-H11ATCCGACGTGGCNONE 
006-060-A04ATCCGACGTGGCNONE 
006-060-A09ATCCGACGTGGCNONE 
006-060-C11ATCCGACGTGGCNONE 
006-060-D08ATCCGACGTGGCNONE 
006-061-A04ATCCGACGTGGCNONE 
006-061-E01ATCCGACGTGGCNONE 
006-061-G10ATCCGACGTGGCNONE 
006-061-H12ATCCGACGTGGCNONE 
006-062-B07ATCCGACGTGGCNONE 
006-062-G03ATCCGACGTGGCNONE 
006-062-H12ATCCGACGTGGCNONE 
006-063-D05ATCCGACGTGGCNONE 
006-063-E04ATCCGACGTGGCNONE 
006-063-F05ATCCGACGTGGCNONE 
006-063-G05ATCCGACGTGGCNONE 
006-064-B07ATCCGACGTGGCNONE 
006-065-C11ATCCGACGTGGCNONE 
006-065-H02ATCCGACGTGGCNONE 
006-067-C12ATCCGACGTGGCNONE 
006-067-F10ATCCGACGTGGCNONE 
006-068-E02ATCCGACGTGGCNONE 
006-068-G04ATCCGACGTGGCNONE 
006-069-A02ATCCGACGTGGCNONE 
006-071-A07ATCCGACGTGGCNONE 
006-072-F11ATCCGACGTGGCNONE 
006-072-F12ATCCGACGTGGCNONE 
006-073-E12ATCCGACGTGGCNONE 
006-073-F08ATCCGACGTGGCNONE 
006-073-H07ATCCGACGTGGCNONE 
006-074-A07ATCCGACGTGGCNONE 
006-075-A12ATCCGACGTGGCNONE 
006-075-B01ATCCGACGTGGCNONE 
006-075-H10ATCCGACGTGGCNONE 
006-075-H12ATCCGACGTGGCNONE 
006-076-B06ATCCGACGTGGCNONE 
006-077-A09ATCCGACGTGGCNONE 
006-077-D05ATCCGACGTGGCNONE 
006-078-C11ATCCGACGTGGCNONE 
006-078-D12ATCCGACGTGGCNONE 
006-078-E02ATCCGACGTGGCNONE 
006-079-A01ATCCGACGTGGCNONE 
006-079-E02ATCCGACGTGGCNONE 
006-079-F03ATCCGACGTGGCNONE 
006-080-G11ATCCGACGTGGCNONE 
006-081-C02ATCCGACGTGGCNONE 
006-081-C08ATCCGACGTGGCNONE 
006-082-B06ATCCGACGTGGCNONE 
006-082-C11ATCCGACGTGGCNONE 
006-082-H04ATCCGACGTGGCNONE 
006-083-E04ATCCGACGTGGCNONE 
006-083-H12ATCCGACGTGGCNONE 
006-084-C08ATCCGACGTGGCNONE 
006-084-E07ATCCGACGTGGCNONE 
006-084-E10ATCCGACGTGGCNONE 
006-085-E06ATCCGACGTGGCNONE 
006-085-E10ATCCGACGTGGCNONE 
006-086-F06ATCCGACGTGGCNONE 
006-087-D08ATCCGACGTGGCNONE 
006-087-F03ATCCGACGTGGCNONE 
006-087-F10ATCCGACGTGGCNONE 
006-087-G07ATCCGACGTGGCNONE 
006-088-A02ATCCGACGTGGCNONE 
006-089-A04ATCCGACGTGGCNONE 
006-089-B12ATCCGACGTGGCNONE 
006-089-D06ATCCGACGTGGCNONE 
006-089-D10ATCCGACGTGGCNONE 
006-089-H05ATCCGACGTGGCNONE 
006-090-C06ATCCGACGTGGCNONE 
006-091-A03ATCCGACGTGGCNONE 
006-091-E04ATCCGACGTGGCNONE 
006-091-H12ATCCGACGTGGCNONE 
006-092-A08ATCCGACGTGGCNONE 
006-092-F01ATCCGACGTGGCNONE 
006-092-G08ATCCGACGTGGCNONE 
006-093-B12ATCCGACGTGGCNONE 
006-093-D04ATCCGACGTGGCNONE 
006-093-F01ATCCGACGTGGCNONE 
006-094-A08ATCCGACGTGGCNONE 
006-094-F01ATCCGACGTGGCNONE 
006-094-F03ATCCGACGTGGCNONE 
006-095-C12ATCCGACGTGGCNONE 
006-095-E10ATCCGACGTGGCNONE 
006-095-E12ATCCGACGTGGCNONE 
006-095-G06ATCCGACGTGGCNONE 
006-096-B12ATCCGACGTGGCNONE 
006-096-C12ATCCGACGTGGCNONE 
006-096-G02ATCCGACGTGGCNONE 
006-097-D01ATCCGACGTGGCNONE 
006-097-D07ATCCGACGTGGCNONE 
006-097-F04ATCCGACGTGGCNONE 
006-098-C07ATCCGACGTGGCNONE 
006-098-D04ATCCGACGTGGCNONE 
006-099-E06ATCCGACGTGGCNONE 
006-099-F02ATCCGACGTGGCNONE 
006-099-F10ATCCGACGTGGCNONE 
006-100-A07ATCCGACGTGGCNONE 
006-100-B10ATCCGACGTGGCNONE 
006-100-G01ATCCGACGTGGCNONE 
006-100-H06ATCCGACGTGGCNONE 
006-101-D01ATCCGACGTGGCNONE 
006-101-F03ATCCGACGTGGCNONE 
006-102-A12ATCCGACGTGGCNONE 
006-102-B11ATCCGACGTGGCNONE 
006-102-C03ATCCGACGTGGCNONE 
006-102-F11ATCCGACGTGGCNONE 
006-103-A08ATCCGACGTGGCNONE 
006-103-B06ATCCGACGTGGCNONE 
006-103-D01ATCCGACGTGGCNONE 
006-103-F02ATCCGACGTGGCNONE 
006-104-B02ATCCGACGTGGCNONE 
006-104-C01ATCCGACGTGGCNONE 
006-104-F09ATCCGACGTGGCNONE 
006-104-H11ATCCGACGTGGCNONE 
006-105-A03ATCCGACGTGGCNONE 
006-105-D09ATCCGACGTGGCNONE 
006-106-B10ATCCGACGTGGCNONE 
006-107-A06ATCCGACGTGGCNONE 
006-107-C04ATCCGACGTGGCNONE 
006-107-E03ATCCGACGTGGCNONE 
006-107-F05ATCCGACGTGGCNONE 
006-108-C09ATCCGACGTGGCNONE 
006-109-C09ATCCGACGTGGCNONE 
006-109-D10ATCCGACGTGGCNONE 
006-109-E06ATCCGACGTGGCNONE 
006-109-E10ATCCGACGTGGCNONE 
006-110-A06ATCCGACGTGGCNONE 
006-110-C11ATCCGACGTGGCNONE 
006-111-A02ATCCGACGTGGCNONE 
006-111-F02ATCCGACGTGGCNONE 
006-112-A08ATCCGACGTGGCNONE 
006-112-H06ATCCGACGTGGCNONE 
006-113-A08ATCCGACGTGGCNONE 
006-113-B01ATCCGACGTGGCNONE 
006-113-C05ATCCGACGTGGCNONE 
006-113-D01ATCCGACGTGGCNONE 
006-113-D04ATCCGACGTGGCNONE 
006-113-D06ATCCGACGTGGCNONE 
006-113-E09ATCCGACGTGGCNONE 
006-114-F06ATCCGACGTGGCNONE 
006-116-B02ATCCGACGTGGCNONE 
006-117-B07ATCCGACGTGGCNONE 
006-117-G04ATCCGACGTGGCNONE 
006-118-D01ATCCGACGTGGCNONE 
006-118-D12ATCCGACGTGGCNONE 
006-118-F12ATCCGACGTGGCNONE 
006-118-G12ATCCGACGTGGCNONE 
006-119-B08ATCCGACGTGGCNONE 
006-120-E09ATCCGACGTGGCNONE 
006-120-G05ATCCGACGTGGCNONE 
006-120-G10ATCCGACGTGGCNONE 
009-022-D12ATCCGACGTGGCNONE 
009-051-H08ATCCGACGTGGCNONE 
009-065-F05ATCCGACGTGGCNONE 
009-070-A06ATCCGACGTGGCNONE 
009-073-B07ATCCGACGTGGCNONE 
009-092-C10ATCCGACGTGGCNONE 
009-093-D03ATCCGACGTGGCNONE 
009-103-B04ATCCGACGTGGCNONE 
009-106-H08ATCCGACGTGGCNONE 
009-120-B05ATCCGACGTGGCNONE 
009-121-F05ATCCGACGTGGCNONE 
009-122-B04ATCCGACGTGGCNONE 
009-122-D08ATCCGACGTGGCNONE 
009-123-F07ATCCGACGTGGCNONE 
009-125-G02ATCCGACGTGGCNONE 
009-128-F02ATCCGACGTGGCNONE 
009-128-H07ATCCGACGTGGCNONE 
009-131-C06ATCCGACGTGGCNONE 
009-132-F08ATCCGACGTGGCNONE 
009-133-G08ATCCGACGTGGCNONE 
009-134-D09ATCCGACGTGGCNONE 
009-135-F01ATCCGACGTGGCNONE 
009-149-E11ATCCGACGTGGCNONE 
009-153-H04ATCCGACGTGGCNONE 
009-161-E04ATCCGACGTGGCNONE 
009-163-A09ATCCGACGTGGCNONE 
009-163-C05ATCCGACGTGGCNONE 
009-163-E10ATCCGACGTGGCNONE 
009-165-F04ATCCGACGTGGCNONE 
009-166-A07ATCCGACGTGGCNONE 
009-169-G12ATCCGACGTGGCNONE 
009-172-G08ATCCGACGTGGCNONE 
009-179-E06ATCCGACGTGGCNONE 
009-181-F09ATCCGACGTGGCNONE 
009-190-G07ATCCGACGTGGCNONE 
009-191-D01ATCCGACGTGGCNONE 
009-195-G02ATCCGACGTGGCNONE 
AF022738ATCCGACGTGGCNONE 
AK061512ATCCGACGTGGCNONE 
AK068972ATCCGACGTGGCNONE 
AK103926ATCCGACGTGGCNONE 
AK103999ATCCGACGTGGCNONE 
AK104224ATCCGACGTGGCNONE 
AK104465ATCCGACGTGGCNONE 
AK104495ATCCGACGTGGCNONE 
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533ATCCGACGTGGCNONE 
AK119545ATCCGACGTGGCNONE 
J013043L10ATCCGACGTGGCNONE 
J013050A09ATCCGACGTGGCNONE 
J023001G03ATCCGACGTGGCNONE 
J023024D14ATCCGACGTGGCNONE 
J023072E11ATCCGACGTGGCNONE 
J023149E18ATCCGACGTGGCNONE 
J033029B16ATCCGACGTGGCNONE 
J065001O21ATCCGACGTGGCNONE 
J065035B04ATCCGACGTGGCNONE 
J065044D18ATCCGACGTGGCNONE 
J065057F12ATCCGACGTGGCNONE 
J065060A11ATCCGACGTGGCNONE 
J065062G15ATCCGACGTGGCNONE 
J065080F13ATCCGACGTGGCNONE 
J065084N12ATCCGACGTGGCNONE 
J065101D02ATCCGACGTGGCNONE 
J065107C07ATCCGACGTGGCNONE 
J065112N24ATCCGACGTGGCNONE 
J065141I16ATCCGACGTGGCNONE 
J065147D05ATCCGACGTGGCNONE 
J065167H02ATCCGACGTGGCNONE 
J065207K23ATCCGACGTGGCNONE 
J075008E16ATCCGACGTGGCNONE 
J075014F03ATCCGACGTGGCNONE 
J075015O17ATCCGACGTGGCNONE 
J075020H20ATCCGACGTGGCNONE 
J075021E22ATCCGACGTGGCNONE 
J075023N13ATCCGACGTGGCNONE 
J075028H10ATCCGACGTGGCNONE 
J075040F20ATCCGACGTGGCNONE 
J075051L23ATCCGACGTGGCNONE 
J075069G16ATCCGACGTGGCNONE 
J075084F24ATCCGACGTGGCNONE 
J075090H09ATCCGACGTGGCNONE 
J075092M21ATCCGACGTGGCNONE 
J075110C10ATCCGACGTGGCNONE 
J075111J12ATCCGACGTGGCNONE 
J075114L04ATCCGACGTGGCNONE 
J075139E02ATCCGACGTGGCNONE 
J075160M10ATCCGACGTGGCNONE 
J075176J03ATCCGACGTGGCNONE 
J075183I17ATCCGACGTGGCNONE 
J075191N10ATCCGACGTGGCNONE 
J075193D07ATCCGACGTGGCNONE 
J075194M16ATCCGACGTGGCNONE 
J075197K04ATCCGACGTGGCNONE 
J080032I11ATCCGACGTGGCNONE 
J080076M11ATCCGACGTGGCNONE 
J080311J08ATCCGACGTGGCNONE 
J080317E05ATCCGACGTGGCNONE 
J090034L08ATCCGACGTGGCNONE 
J100040D19ATCCGACGTGGCNONE 
J100074C11ATCCGACGTGGCNONE 
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein. 
J023030F23CCGATCCGACGGCCCGNONE 
J065165H21CCGATCCGACGGCCCGNONE 
J065193G01CCGATCCGACGGCCCGNONE 
J075093F03CCGATCCGACGGCCCGNONE 
Os07g0605200AF091458GATCCGACGGNONE 
AF139665GATCCGACGGNONE 
AJ011675GATCCGACGGNONE 
AK064704GATCCGACGGMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15GATCCGACGGNONE 
J090034M06GATCCGACGGNONE 
J090079L24GATCCGACGGNONE 
Os07g0620300AK059588CCGTCGGATNONE 
AK099000CCGTCGGATNONE 
AK099150CCGTCGGATNONE 
AK119518CCGTCGGATClathrin adaptor complex, medium chain family protein. 
Os07g0633200AK061338GATCCGACGGSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GATCCGACGGNONE 
J033096E22GATCCGACGGNONE 
J033125D06GATCCGACGGNONE 
J075048C23GATCCGACGGNONE 
J075050G02GATCCGACGGNONE 
J075104J04GATCCGACGGNONE 
J075144N04GATCCGACGGNONE 
Os07g0637100AK111132ATCCGACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os08g0101100AK069900CCGTCGGATCHigh mobility group box domain containing protein. 
Os08g0171000AK071278CCGTCGGATCConserved hypothetical protein. 
J023113L21CCGTCGGATCNONE 
Os08g0187700AK099689CGTCGGATCRegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0248800AB037416ATCCGACGSimilar to Aspartate carbamoyltransferase 3, chloroplast precursor (EC 2.1.3.2) (Aspartate transcarbamylase 3) (ATCase 3). 
AK065010ATCCGACGNONE 
J013001F02ATCCGACGNONE 
Os08g0386300AK059323CGTCGGATNONE 
AK070379CGTCGGATCytochrome b5 domain containing protein. 
J023054P20CGTCGGATNONE 
J033089H01CGTCGGATNONE 
J065013I01CGTCGGATNONE 
J065212E17CGTCGGATNONE 
J080317O15CGTCGGATNONE 
J090018O07CGTCGGATNONE 
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE 
J065104D10GTGTGGGCCGGCCGTCGGATNONE 
J065110F18GTGTGGGCCGGCCGTCGGATNONE 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AY644647CGCCACGTCGGATNONE 
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein. 
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein. 
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0481500J065054C23CGTCGGATConserved hypothetical protein. 
J065218E06CGTCGGATNONE 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0544500AK071354CGTCGGATSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os08g0556000AK068463GCCACGTCGGATSimilar to YTH domain protein 2 (High-glucose-regulated protein 8) (NY-REN-2 antigen) (CLL-associated antigen KW-14). 
Os09g0115400AK067816CGTCGGATNONE 
AK101706CGTCGGATSimilar to Poly(A)-binding protein. 
Os09g0123100AK103665GATCCGACGGTetratricopeptide-like helical domain containing protein. 
J013104A07GATCCGACGGNONE 
J013130B03GATCCGACGGNONE 
J013151K05GATCCGACGGNONE 
J023036M18GATCCGACGGNONE 
J023064M07GATCCGACGGNONE 
J023084H20GATCCGACGGNONE 
J023139A11GATCCGACGGNONE 
J023148O20GATCCGACGGNONE 
J033027B17GATCCGACGGNONE 
J033029B12GATCCGACGGNONE 
J033067E23GATCCGACGGNONE 
J033069D06GATCCGACGGNONE 
J033093L17GATCCGACGGNONE 
J033098N22GATCCGACGGNONE 
J033112B12GATCCGACGGNONE 
J033115E15GATCCGACGGNONE 
J033127F08GATCCGACGGNONE 
J033128P17GATCCGACGGNONE 
J033135J15GATCCGACGGNONE 
Os09g0240500009-015-D11CCGTCGGATCNONE 
009-039-B12CCGTCGGATCNONE 
AF493793CCGTCGGATCNONE 
AK062451CCGTCGGATCNONE 
AK067676CCGTCGGATCNONE 
AK069796CCGTCGGATCSimilar to Sulfate transporter 4.1, chloroplast precursor (AST82). 
Os09g0315200006-022-A10CCGTCGGATNONE 
AK105900CCGTCGGATConserved hypothetical protein. 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
011-030-A03GATCCGACGGNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK061601GATCCGACGGNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
AK063310GATCCGACGGHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
J100063G01GATCCGACGGNONE 
Os09g0416700AK061283ATCCGACGNONE 
AK061283ATCCGACGNONE 
AK101300ATCCGACGVesicle transport v-SNARE family protein. 
AK101300ATCCGACGVesicle transport v-SNARE family protein. 
J075138J18ATCCGACGNONE 
J075138J18ATCCGACGNONE 
Os09g0449600009-188-G11ATCCGACGGNONE 
016-031-E04ATCCGACGGNONE 
AK065937ATCCGACGGNONE 
J013043E22ATCCGACGGNONE 
J013123B08ATCCGACGGNONE 
J013134D04ATCCGACGGNONE 
J033061M16ATCCGACGGNONE 
J090091L19ATCCGACGGNONE 
J100025J23ATCCGACGGNONE 
Os09g0451500AK062254ATCCGACGThioredoxin domain 2 containing protein. 
AK072941ATCCGACGNONE 
Os09g0480600AK107853GATCCGACGGHypothetical protein. 
Os09g0526700011-075-B12GATCCGACGGNONE 
AB097460GATCCGACGGNONE 
AK073610GATCCGACGGSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977GATCCGACGGNONE 
Os09g0558200016-083-C09GATCCGACGNONE 
AK068834GATCCGACGNONE 
AK103673GATCCGACGHomeodomain-like containing protein. 
J013159M18GATCCGACGNONE 
J065022I04GATCCGACGNONE 
J065089B19GATCCGACGNONE 
Os09g0568800AK059234ATCCGACGGSimilar to Ribosomal protein S25 (40S ribosomal 25S subunit). 
J033140B10ATCCGACGGNONE 
J033142B10ATCCGACGGNONE 
J065011L22ATCCGACGGNONE 
J065030J07ATCCGACGGNONE 
J065038K20ATCCGACGGNONE 
J065040B12ATCCGACGGNONE 
J065056B12ATCCGACGGNONE 
J065064L14ATCCGACGGNONE 
J065116B03ATCCGACGGNONE 
J065128E10ATCCGACGGNONE 
J065135B14ATCCGACGGNONE 
J065143F21ATCCGACGGNONE 
J065197F15ATCCGACGGNONE 
J075011K03ATCCGACGGNONE 
J075015B17ATCCGACGGNONE 
J075021I04ATCCGACGGNONE 
J075025G18ATCCGACGGNONE 
J075030E17ATCCGACGGNONE 
J075034A22ATCCGACGGNONE 
J075035C18ATCCGACGGNONE 
J075081E22ATCCGACGGNONE 
J075090F16ATCCGACGGNONE 
J075120P07ATCCGACGGNONE 
J075151D16ATCCGACGGNONE 
J075183B11ATCCGACGGNONE 
J075187N12ATCCGACGGNONE 
J075195N06ATCCGACGGNONE 
J080008P04ATCCGACGGNONE 
J080009D04ATCCGACGGNONE 
J080017F06ATCCGACGGNONE 
J080030A10ATCCGACGGNONE 
J080031K06ATCCGACGGNONE 
J080044N14ATCCGACGGNONE 
J080046B13ATCCGACGGNONE 
J080046I07ATCCGACGGNONE 
J080047D05ATCCGACGGNONE 
J080050F09ATCCGACGGNONE 
J080059H13ATCCGACGGNONE 
J080071G18ATCCGACGGNONE 
J080074K19ATCCGACGGNONE 
J080082L07ATCCGACGGNONE 
J080086N23ATCCGACGGNONE 
J080088H05ATCCGACGGNONE 
J080088P03ATCCGACGGNONE 
J080090N24ATCCGACGGNONE 
J080093G02ATCCGACGGNONE 
J080311L14ATCCGACGGNONE 
J090021N07ATCCGACGGNONE 
J100045I01ATCCGACGGNONE 
J100057A16ATCCGACGGNONE 
Os11g0153800009-146-G07GATCCGACGGNONE 
AK058630GATCCGACGGSimilar to Ribosomal protein S25 (40S ribosomal 25S subunit). 
J075071N04GATCCGACGGNONE 
Os11g0202300AK066860CGTCGGATNONE 
AK068673CGTCGGATConserved hypothetical protein. 
J013073M16CGTCGGATNONE 
J013088K08CGTCGGATNONE 
Os11g0210300009-169-E10ATCCGACGGNONE 
012-007-H08ATCCGACGGNONE 
012-065-A02ATCCGACGGNONE 
012-095-H06ATCCGACGGNONE 
015-007-F02ATCCGACGGNONE 
015-017-F10ATCCGACGGNONE 
015-078-F12ATCCGACGGNONE 
016-085-G04ATCCGACGGNONE 
AK061267ATCCGACGGNONE 
AK069330ATCCGACGGAlcohol dehydrogenase 1. 
D10412ATCCGACGGNONE 
J023026C01ATCCGACGGNONE 
J023037O21ATCCGACGGNONE 
J023044J09ATCCGACGGNONE 
J023066N19ATCCGACGGNONE 
J023100L06ATCCGACGGNONE 
J023121G14ATCCGACGGNONE 
J023132I24ATCCGACGGNONE 
J023134J18ATCCGACGGNONE 
J033024J23ATCCGACGGNONE 
J033029B21ATCCGACGGNONE 
J033030H09ATCCGACGGNONE 
J033040N09ATCCGACGGNONE 
J033050I11ATCCGACGGNONE 
J033052F03ATCCGACGGNONE 
J033067J22ATCCGACGGNONE 
J033068K15ATCCGACGGNONE 
J033070A13ATCCGACGGNONE 
J033072A02ATCCGACGGNONE 
J033072F17ATCCGACGGNONE 
J033081C02ATCCGACGGNONE 
J033082F08ATCCGACGGNONE 
J033086L02ATCCGACGGNONE 
J033087O09ATCCGACGGNONE 
J033088P05ATCCGACGGNONE 
J033094D13ATCCGACGGNONE 
J033098I11ATCCGACGGNONE 
J033102I15ATCCGACGGNONE 
J033102P13ATCCGACGGNONE 
J033103N07ATCCGACGGNONE 
J033109A11ATCCGACGGNONE 
J033109O05ATCCGACGGNONE 
J033111K07ATCCGACGGNONE 
J033113I09ATCCGACGGNONE 
J033113I10ATCCGACGGNONE 
J033115B12ATCCGACGGNONE 
J033121D20ATCCGACGGNONE 
J033125H21ATCCGACGGNONE 
J033128M09ATCCGACGGNONE 
J033135L03ATCCGACGGNONE 
J033136O13ATCCGACGGNONE 
J043003H06ATCCGACGGNONE 
J043010B17ATCCGACGGNONE 
J043015O11ATCCGACGGNONE 
J043026D03ATCCGACGGNONE 
J043030G18ATCCGACGGNONE 
J043035L17ATCCGACGGNONE 
J043037K04ATCCGACGGNONE 
J043040G24ATCCGACGGNONE 
J053024N13ATCCGACGGNONE 
J065035H08ATCCGACGGNONE 
J065116G23ATCCGACGGNONE 
J065138J15ATCCGACGGNONE 
J065161L12ATCCGACGGNONE 
J075011O04ATCCGACGGNONE 
J075109M05ATCCGACGGNONE 
J075133K12ATCCGACGGNONE 
J075167H23ATCCGACGGNONE 
J075198I09ATCCGACGGNONE 
J100023O11ATCCGACGGNONE 
J100042B17ATCCGACGGNONE 
J100052M16ATCCGACGGNONE 
J100059M23ATCCGACGGNONE 
J100076G19ATCCGACGGNONE 
X16296ATCCGACGGNONE 
Os11g0237600J023045M16ATCCGACGNB-ARC domain containing protein. 
J075186H09ATCCGACGNONE 
Os11g0557700AK071694CCGATCCGACGNONE 
AK107593CCGATCCGACGSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23CCGATCCGACGNONE 
Os12g0149000AK108734GATCCGACGGConserved hypothetical protein. 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0210200AF309381CCGATCCGACGNONE 
AK069105CCGATCCGACGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CCGATCCGACGNONE 
J033069C11CCGATCCGACGNONE 
J065087E20CCGATCCGACGNONE 
J065097G21CCGATCCGACGNONE 
Os12g0263100AK102127ATCCGACGGSimilar to Zinc finger, DHHC domain containing 4. 
J090099K03ATCCGACGGNONE 
Os12g0485500AK071132CGGATCGGATCCGACGGSimilar to HesB/YadR/YfhF family protein. 
AK099510CGGATCGGATCCGACGGNONE 
J065024D15CGGATCGGATCCGACGGNONE 
J075168O15CGGATCGGATCCGACGGNONE 
J075190F06CGGATCGGATCCGACGGNONE 
Os12g0562100AK064831CCGTCGGATCConserved hypothetical protein. 
AK065844CCGTCGGATCNONE 
J013000F11CCGTCGGATCNONE 
Os12g0578200AK105512GATCCGACGGSimilar to Chorismate mutase, chloroplast precursor (EC 5.4.99.5) (CM-1). 
Os12g0605800AK121511ACCCCCCATCCGACGSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0632000AF010580ACCCCCCACCGTCGGATNONE 
AJ002893ACCCCCCACCGTCGGATSimilar to Glycine-rich RNA-binding protein 1 (Fragment). 
J065001J09ACCCCCCACCGTCGGATNONE 
J065002D04ACCCCCCACCGTCGGATNONE 
J065041I19ACCCCCCACCGTCGGATNONE 
J065051I02ACCCCCCACCGTCGGATNONE 
J065054G12ACCCCCCACCGTCGGATNONE 
J065061A03ACCCCCCACCGTCGGATNONE 
J065061B03ACCCCCCACCGTCGGATNONE 
J065062D24ACCCCCCACCGTCGGATNONE 
J065079O14ACCCCCCACCGTCGGATNONE 
J065083P21ACCCCCCACCGTCGGATNONE 
J065098H21ACCCCCCACCGTCGGATNONE 
J065101F01ACCCCCCACCGTCGGATNONE 
J065102M05ACCCCCCACCGTCGGATNONE 
J065121E24ACCCCCCACCGTCGGATNONE 
J065138P03ACCCCCCACCGTCGGATNONE 
J065161B22ACCCCCCACCGTCGGATNONE 
J065163E13ACCCCCCACCGTCGGATNONE 
J065165D14ACCCCCCACCGTCGGATNONE 
J065169J17ACCCCCCACCGTCGGATNONE 
J065191B15ACCCCCCACCGTCGGATNONE 
J065197C23ACCCCCCACCGTCGGATNONE 
J075002C02ACCCCCCACCGTCGGATNONE 
J075003D03ACCCCCCACCGTCGGATNONE 
J075003M01ACCCCCCACCGTCGGATNONE 
J075011J11ACCCCCCACCGTCGGATNONE 
J075013I09ACCCCCCACCGTCGGATNONE 
J075013P21ACCCCCCACCGTCGGATNONE 
J075020D15ACCCCCCACCGTCGGATNONE 
J075020L10ACCCCCCACCGTCGGATNONE 
J075025P14ACCCCCCACCGTCGGATNONE 
J075031G13ACCCCCCACCGTCGGATNONE 
J075044J01ACCCCCCACCGTCGGATNONE 
J075048K03ACCCCCCACCGTCGGATNONE 
J075081H02ACCCCCCACCGTCGGATNONE 
J075081M24ACCCCCCACCGTCGGATNONE 
J075093H13ACCCCCCACCGTCGGATNONE 
J075096I02ACCCCCCACCGTCGGATNONE 
J075096K17ACCCCCCACCGTCGGATNONE 
J075097I08ACCCCCCACCGTCGGATNONE 
J075097L19ACCCCCCACCGTCGGATNONE 
J075098K03ACCCCCCACCGTCGGATNONE 
J075099L15ACCCCCCACCGTCGGATNONE 
J075118E23ACCCCCCACCGTCGGATNONE 
J075118H23ACCCCCCACCGTCGGATNONE 
J075118J24ACCCCCCACCGTCGGATNONE 
J075127N03ACCCCCCACCGTCGGATNONE 
J075142H14ACCCCCCACCGTCGGATNONE 
J075146D17ACCCCCCACCGTCGGATNONE 
J075156K21ACCCCCCACCGTCGGATNONE 
J080016A22ACCCCCCACCGTCGGATNONE 
J080016B03ACCCCCCACCGTCGGATNONE 
J080040H01ACCCCCCACCGTCGGATNONE 
J080068A22ACCCCCCACCGTCGGATNONE 
J080068G23ACCCCCCACCGTCGGATNONE 
J080071M07ACCCCCCACCGTCGGATNONE 
J080072C22ACCCCCCACCGTCGGATNONE 
J080092L23ACCCCCCACCGTCGGATNONE 
J080094M23ACCCCCCACCGTCGGATNONE 
J080094P05ACCCCCCACCGTCGGATNONE 
J080304H19ACCCCCCACCGTCGGATNONE 
J090045K01ACCCCCCACCGTCGGATNONE 
J090051E23ACCCCCCACCGTCGGATNONE 
J090084I02ACCCCCCACCGTCGGATNONE 
J100024B13ACCCCCCACCGTCGGATNONE 
J100024H16ACCCCCCACCGTCGGATNONE 
J100025F08ACCCCCCACCGTCGGATNONE 
J100026C20ACCCCCCACCGTCGGATNONE 
J100026J20ACCCCCCACCGTCGGATNONE 
J100026J24ACCCCCCACCGTCGGATNONE 
J100026K14ACCCCCCACCGTCGGATNONE 
J100026M15ACCCCCCACCGTCGGATNONE 
J100027A21ACCCCCCACCGTCGGATNONE 
J100027C08ACCCCCCACCGTCGGATNONE 
J100027D04ACCCCCCACCGTCGGATNONE 
J100027F17ACCCCCCACCGTCGGATNONE 
J100027G08ACCCCCCACCGTCGGATNONE 
J100027H22ACCCCCCACCGTCGGATNONE 
J100027N15ACCCCCCACCGTCGGATNONE 
J100028F01ACCCCCCACCGTCGGATNONE 
J100028J11ACCCCCCACCGTCGGATNONE 
J100029B19ACCCCCCACCGTCGGATNONE 
J100029C17ACCCCCCACCGTCGGATNONE 
J100029K13ACCCCCCACCGTCGGATNONE 
J100029N17ACCCCCCACCGTCGGATNONE 
J100030A16ACCCCCCACCGTCGGATNONE 
J100030F13ACCCCCCACCGTCGGATNONE 
J100030M17ACCCCCCACCGTCGGATNONE 
J100030N04ACCCCCCACCGTCGGATNONE 
J100030N09ACCCCCCACCGTCGGATNONE 
J100031F16ACCCCCCACCGTCGGATNONE 
J100031I07ACCCCCCACCGTCGGATNONE 
J100031K06ACCCCCCACCGTCGGATNONE 
J100031K09ACCCCCCACCGTCGGATNONE 
J100032E01ACCCCCCACCGTCGGATNONE 
J100032F13ACCCCCCACCGTCGGATNONE 
J100032I20ACCCCCCACCGTCGGATNONE 
J100032N21ACCCCCCACCGTCGGATNONE 
J100032O06ACCCCCCACCGTCGGATNONE 
J100033E08ACCCCCCACCGTCGGATNONE 
J100033M19ACCCCCCACCGTCGGATNONE 
J100033M22ACCCCCCACCGTCGGATNONE 
J100034B22ACCCCCCACCGTCGGATNONE 
J100034H08ACCCCCCACCGTCGGATNONE 
J100034K22ACCCCCCACCGTCGGATNONE 
J100034N04ACCCCCCACCGTCGGATNONE 
J100034P17ACCCCCCACCGTCGGATNONE 
J100035K22ACCCCCCACCGTCGGATNONE 
J100035L11ACCCCCCACCGTCGGATNONE 
J100035N24ACCCCCCACCGTCGGATNONE 
J100036L18ACCCCCCACCGTCGGATNONE 
J100037B01ACCCCCCACCGTCGGATNONE 
J100037F04ACCCCCCACCGTCGGATNONE 
J100037H23ACCCCCCACCGTCGGATNONE 
J100037L18ACCCCCCACCGTCGGATNONE 
J100038B05ACCCCCCACCGTCGGATNONE 
J100038F13ACCCCCCACCGTCGGATNONE 
J100038K04ACCCCCCACCGTCGGATNONE 
J100039G20ACCCCCCACCGTCGGATNONE 
J100040G09ACCCCCCACCGTCGGATNONE 
J100041A11ACCCCCCACCGTCGGATNONE 
J100041B22ACCCCCCACCGTCGGATNONE 
J100041K06ACCCCCCACCGTCGGATNONE 
J100041O09ACCCCCCACCGTCGGATNONE 
J100042A20ACCCCCCACCGTCGGATNONE 
J100042C07ACCCCCCACCGTCGGATNONE 
J100042I02ACCCCCCACCGTCGGATNONE 
J100042K03ACCCCCCACCGTCGGATNONE 
J100043C18ACCCCCCACCGTCGGATNONE 
J100043D20ACCCCCCACCGTCGGATNONE 
J100043F08ACCCCCCACCGTCGGATNONE 
J100043G23ACCCCCCACCGTCGGATNONE 
J100043H22ACCCCCCACCGTCGGATNONE 
J100043I23ACCCCCCACCGTCGGATNONE 
J100043K11ACCCCCCACCGTCGGATNONE 
J100043P03ACCCCCCACCGTCGGATNONE 
J100044C01ACCCCCCACCGTCGGATNONE 
J100044F02ACCCCCCACCGTCGGATNONE 
J100044L10ACCCCCCACCGTCGGATNONE 
J100045A13ACCCCCCACCGTCGGATNONE 
J100045D16ACCCCCCACCGTCGGATNONE 
J100045D23ACCCCCCACCGTCGGATNONE 
J100045F09ACCCCCCACCGTCGGATNONE 
J100045H22ACCCCCCACCGTCGGATNONE 
J100045O07ACCCCCCACCGTCGGATNONE 
J100046J15ACCCCCCACCGTCGGATNONE 
J100046K14ACCCCCCACCGTCGGATNONE 
J100046L15ACCCCCCACCGTCGGATNONE 
J100047L23ACCCCCCACCGTCGGATNONE 
J100047P05ACCCCCCACCGTCGGATNONE 
J100048A20ACCCCCCACCGTCGGATNONE 
J100048C22ACCCCCCACCGTCGGATNONE 
J100048G17ACCCCCCACCGTCGGATNONE 
J100048J20ACCCCCCACCGTCGGATNONE 
J100048K18ACCCCCCACCGTCGGATNONE 
J100048L22ACCCCCCACCGTCGGATNONE 
J100048O22ACCCCCCACCGTCGGATNONE 
J100049F18ACCCCCCACCGTCGGATNONE 
J100049M03ACCCCCCACCGTCGGATNONE 
J100050C20ACCCCCCACCGTCGGATNONE 
J100050G14ACCCCCCACCGTCGGATNONE 
J100050O10ACCCCCCACCGTCGGATNONE 
J100051E09ACCCCCCACCGTCGGATNONE 
J100051F20ACCCCCCACCGTCGGATNONE 
J100051I22ACCCCCCACCGTCGGATNONE 
J100051J11ACCCCCCACCGTCGGATNONE 
J100051J17ACCCCCCACCGTCGGATNONE 
J100052A04ACCCCCCACCGTCGGATNONE 
J100052E01ACCCCCCACCGTCGGATNONE 
J100052E13ACCCCCCACCGTCGGATNONE 
J100054A10ACCCCCCACCGTCGGATNONE 
J100054B08ACCCCCCACCGTCGGATNONE 
J100054B12ACCCCCCACCGTCGGATNONE 
J100054F05ACCCCCCACCGTCGGATNONE 
J100054I16ACCCCCCACCGTCGGATNONE 
J100054L18ACCCCCCACCGTCGGATNONE 
J100055A03ACCCCCCACCGTCGGATNONE 
J100055K11ACCCCCCACCGTCGGATNONE 
J100056I06ACCCCCCACCGTCGGATNONE 
J100056I16ACCCCCCACCGTCGGATNONE 
J100056M20ACCCCCCACCGTCGGATNONE 
J100057D04ACCCCCCACCGTCGGATNONE 
J100057E15ACCCCCCACCGTCGGATNONE 
J100057G07ACCCCCCACCGTCGGATNONE 
J100057H22ACCCCCCACCGTCGGATNONE 
J100058H07ACCCCCCACCGTCGGATNONE 
J100058M11ACCCCCCACCGTCGGATNONE 
J100058M20ACCCCCCACCGTCGGATNONE 
J100058N04ACCCCCCACCGTCGGATNONE 
J100058N16ACCCCCCACCGTCGGATNONE 
J100058O11ACCCCCCACCGTCGGATNONE 
J100059A20ACCCCCCACCGTCGGATNONE 
J100059E05ACCCCCCACCGTCGGATNONE 
J100059K17ACCCCCCACCGTCGGATNONE 
J100059M07ACCCCCCACCGTCGGATNONE 
J100060A07ACCCCCCACCGTCGGATNONE 
J100060G24ACCCCCCACCGTCGGATNONE 
J100060I15ACCCCCCACCGTCGGATNONE 
J100060M15ACCCCCCACCGTCGGATNONE 
J100060M20ACCCCCCACCGTCGGATNONE 
J100060N23ACCCCCCACCGTCGGATNONE 
J100061H20ACCCCCCACCGTCGGATNONE 
J100062C04ACCCCCCACCGTCGGATNONE 
J100062C22ACCCCCCACCGTCGGATNONE 
J100062F20ACCCCCCACCGTCGGATNONE 
J100062G08ACCCCCCACCGTCGGATNONE 
J100062H17ACCCCCCACCGTCGGATNONE 
J100062I05ACCCCCCACCGTCGGATNONE 
J100062L21ACCCCCCACCGTCGGATNONE 
J100062O04ACCCCCCACCGTCGGATNONE 
J100063B10ACCCCCCACCGTCGGATNONE 
J100063C01ACCCCCCACCGTCGGATNONE 
J100063D11ACCCCCCACCGTCGGATNONE 
J100064B18ACCCCCCACCGTCGGATNONE 
J100064G01ACCCCCCACCGTCGGATNONE 
J100064K07ACCCCCCACCGTCGGATNONE 
J100064L09ACCCCCCACCGTCGGATNONE 
J100064M13ACCCCCCACCGTCGGATNONE 
J100064O10ACCCCCCACCGTCGGATNONE 
J100065J24ACCCCCCACCGTCGGATNONE 
J100065N15ACCCCCCACCGTCGGATNONE 
J100066E13ACCCCCCACCGTCGGATNONE 
J100066G16ACCCCCCACCGTCGGATNONE 
J100066J03ACCCCCCACCGTCGGATNONE 
J100066K06ACCCCCCACCGTCGGATNONE 
J100066P15ACCCCCCACCGTCGGATNONE 
J100067D12ACCCCCCACCGTCGGATNONE 
J100067G04ACCCCCCACCGTCGGATNONE 
J100067G18ACCCCCCACCGTCGGATNONE 
J100067I18ACCCCCCACCGTCGGATNONE 
J100067K04ACCCCCCACCGTCGGATNONE 
J100068C21ACCCCCCACCGTCGGATNONE 
J100068D08ACCCCCCACCGTCGGATNONE 
J100068G17ACCCCCCACCGTCGGATNONE 
J100068H09ACCCCCCACCGTCGGATNONE 
J100069F05ACCCCCCACCGTCGGATNONE 
J100069I20ACCCCCCACCGTCGGATNONE 
J100069J05ACCCCCCACCGTCGGATNONE 
J100070D16ACCCCCCACCGTCGGATNONE 
J100070I09ACCCCCCACCGTCGGATNONE 
J100070K06ACCCCCCACCGTCGGATNONE 
J100071G09ACCCCCCACCGTCGGATNONE 
J100071H20ACCCCCCACCGTCGGATNONE 
J100071K07ACCCCCCACCGTCGGATNONE 
J100071L03ACCCCCCACCGTCGGATNONE 
J100071L13ACCCCCCACCGTCGGATNONE 
J100072A11ACCCCCCACCGTCGGATNONE 
J100072C19ACCCCCCACCGTCGGATNONE 
J100072E13ACCCCCCACCGTCGGATNONE 
J100072E16ACCCCCCACCGTCGGATNONE 
J100072M06ACCCCCCACCGTCGGATNONE 
J100072O10ACCCCCCACCGTCGGATNONE 
J100073E05ACCCCCCACCGTCGGATNONE 
J100073L14ACCCCCCACCGTCGGATNONE 
J100073N05ACCCCCCACCGTCGGATNONE 
J100074I04ACCCCCCACCGTCGGATNONE 
J100074K21ACCCCCCACCGTCGGATNONE 
J100074L22ACCCCCCACCGTCGGATNONE 
J100074N07ACCCCCCACCGTCGGATNONE 
J100075F18ACCCCCCACCGTCGGATNONE 
J100075H14ACCCCCCACCGTCGGATNONE 
J100075I03ACCCCCCACCGTCGGATNONE 
J100075K02ACCCCCCACCGTCGGATNONE 
J100075K11ACCCCCCACCGTCGGATNONE 
J100075K16ACCCCCCACCGTCGGATNONE 
J100075N08ACCCCCCACCGTCGGATNONE 
J100076A03ACCCCCCACCGTCGGATNONE 
J100076C05ACCCCCCACCGTCGGATNONE 
J100076I24ACCCCCCACCGTCGGATNONE 
J100077H07ACCCCCCACCGTCGGATNONE 
J100077P09ACCCCCCACCGTCGGATNONE 
J100078C15ACCCCCCACCGTCGGATNONE 
J100078J15ACCCCCCACCGTCGGATNONE 
J100078K02ACCCCCCACCGTCGGATNONE 
J100078K23ACCCCCCACCGTCGGATNONE 
J100078M11ACCCCCCACCGTCGGATNONE 
J100079E21ACCCCCCACCGTCGGATNONE 
J100079F03ACCCCCCACCGTCGGATNONE 
J100079K13ACCCCCCACCGTCGGATNONE 
J100081L17ACCCCCCACCGTCGGATNONE 
J100081P09ACCCCCCACCGTCGGATNONE 
J100082D14ACCCCCCACCGTCGGATNONE 
J100083E07ACCCCCCACCGTCGGATNONE 
J100083H07ACCCCCCACCGTCGGATNONE 
J100084B12ACCCCCCACCGTCGGATNONE 
J100084C20ACCCCCCACCGTCGGATNONE 
J100084D21ACCCCCCACCGTCGGATNONE 
J100084L21ACCCCCCACCGTCGGATNONE 
J100085I10ACCCCCCACCGTCGGATNONE 
J100085L22ACCCCCCACCGTCGGATNONE 
J100085M20ACCCCCCACCGTCGGATNONE 
J100086G15ACCCCCCACCGTCGGATNONE 
J100086N03ACCCCCCACCGTCGGATNONE 
J100087E11ACCCCCCACCGTCGGATNONE 
J100087I01ACCCCCCACCGTCGGATNONE 
J100088C17ACCCCCCACCGTCGGATNONE 
J100088N20ACCCCCCACCGTCGGATNONE 
J100089I18ACCCCCCACCGTCGGATNONE 
J100089M13ACCCCCCACCGTCGGATNONE 
J100090E17ACCCCCCACCGTCGGATNONE 
J100090J19ACCCCCCACCGTCGGATNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.