version

Summary of OsREG484 (All List)

OrganismOryza sativa  
IDOsREG484  
SequenceATCGGACG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count3014  

Entry Sequences (3014 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10GCCGTCCGATNONE 
009-108-B10GCCGTCCGATNONE 
AK059844GCCGTCCGATNONE 
AK121523GCCGTCCGATSimilar to 40S ribosomal protein S5-1. 
J023037D16GCCGTCCGATNONE 
J033028P14GCCGTCCGATNONE 
J033064M07GCCGTCCGATNONE 
J033123M01GCCGTCCGATNONE 
J065026O07GCCGTCCGATNONE 
J065082A05GCCGTCCGATNONE 
J075003I02GCCGTCCGATNONE 
J075170J15GCCGTCCGATNONE 
J100040D18GCCGTCCGATNONE 
Os01g0140400AK063999CCGTCCGATCCGLeucine rich repeat, N-terminal domain containing protein. 
Os01g0141600016-051-A03GATCGGACGGCTNONE 
016-051-A03GATCGGACGGCTNONE 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
Os01g0198900009-135-H10CGTCCGATNONE 
AK060553CGTCCGATNONE 
AK069974CGTCCGATConserved hypothetical protein. 
AK099171CGTCCGATNONE 
J075093J21CGTCCGATNONE 
J075097P05CGTCCGATNONE 
J100056E09CGTCCGATNONE 
J100065A15CGTCCGATNONE 
J100070C06CGTCCGATNONE 
J100079K19CGTCCGATNONE 
Os01g0201400AK070397ATCGGACGRapid ALkalinization Factor family protein. 
Os01g0242900009-042-C12ATCGGACGGACNONE 
AK071658ATCGGACGGACConserved hypothetical protein. 
J090060H23ATCGGACGGACNONE 
J090083G05ATCGGACGGACNONE 
J090083K20ATCGGACGGACNONE 
J100029D18ATCGGACGGACNONE 
J100068A08ATCGGACGGACNONE 
Os01g0270300006-026-A05GATCGGACGGCCNONE 
AK060365GATCGGACGGCCNONE 
AK101508GATCGGACGGCCSimilar to Cationic peroxidase isozyme 40K precursor. 
AK103467GATCGGACGGCCNONE 
J033084K19GATCGGACGGCCNONE 
J033105B06GATCGGACGGCCNONE 
J100043C10GATCGGACGGCCNONE 
Os01g0281200AK107209CCGTCCGATCSimilar to Type B-like cyclin (Fragment). 
AY647458CCGTCCGATCNONE 
Os01g0314300AK073419CGTCCGATUncharacterized domain 2 containing protein. 
AK104939CGTCCGATNONE 
J033044B03CGTCCGATNONE 
J033060E12CGTCCGATNONE 
J043037E21CGTCCGATNONE 
J065019O18CGTCCGATNONE 
J065025P22CGTCCGATNONE 
J065042P06CGTCCGATNONE 
J065074C19CGTCCGATNONE 
J065074E13CGTCCGATNONE 
J065094E05CGTCCGATNONE 
J065108N08CGTCCGATNONE 
J065134L13CGTCCGATNONE 
J065152N24CGTCCGATNONE 
J065162N24CGTCCGATNONE 
J065170P16CGTCCGATNONE 
J065177M20CGTCCGATNONE 
J065187N01CGTCCGATNONE 
J075012N12CGTCCGATNONE 
J075046C17CGTCCGATNONE 
J075055N06CGTCCGATNONE 
J075141H03CGTCCGATNONE 
J075150M11CGTCCGATNONE 
J090005B16CGTCCGATNONE 
J090079L11CGTCCGATNONE 
J100039F16CGTCCGATNONE 
Os01g0328400006-092-H09CCGTCCGATCNONE 
009-085-A02CCGTCCGATCNONE 
012-078-B03CCGTCCGATCNONE 
AK061988CCGTCCGATCUbiquitin. 
J013073B13CCGTCCGATCNONE 
J023135L09CCGTCCGATCNONE 
J023135O07CCGTCCGATCNONE 
J033027B12CCGTCCGATCNONE 
J033084P17CCGTCCGATCNONE 
J065010M05CCGTCCGATCNONE 
J065021N11CCGTCCGATCNONE 
J065021N12CCGTCCGATCNONE 
J065031K11CCGTCCGATCNONE 
J065072P04CCGTCCGATCNONE 
J065098D05CCGTCCGATCNONE 
J065122N23CCGTCCGATCNONE 
J065129L13CCGTCCGATCNONE 
J065135N13CCGTCCGATCNONE 
J065215N10CCGTCCGATCNONE 
J075120N22CCGTCCGATCNONE 
J090011G23CCGTCCGATCNONE 
J090014F06CCGTCCGATCNONE 
J090040G23CCGTCCGATCNONE 
J090075I20CCGTCCGATCNONE 
J090075N01CCGTCCGATCNONE 
J090089B04CCGTCCGATCNONE 
J090090F08CCGTCCGATCNONE 
J090091M17CCGTCCGATCNONE 
J090094L03CCGTCCGATCNONE 
J090099L06CCGTCCGATCNONE 
J100018A18CCGTCCGATCNONE 
J100027H13CCGTCCGATCNONE 
J100069C05CCGTCCGATCNONE 
J100086L10CCGTCCGATCNONE 
Os01g0347100AK100716CGGATCGGACGGCTProtein of unknown function DUF1399 family protein. 
Os01g0506100AK102377ATCGGACGGCTGlobin-like family protein. 
AK109825ATCGGACGGCTNONE 
Os01g0513800012-032-E11AGCCGTCCGATNONE 
AK100776AGCCGTCCGATSimilar to Brix domain containing protein 1 homolog. 
J023120C10AGCCGTCCGATNONE 
J033044A22AGCCGTCCGATNONE 
J033048H13AGCCGTCCGATNONE 
J033118F03AGCCGTCCGATNONE 
J065176B05AGCCGTCCGATNONE 
J075026B19AGCCGTCCGATNONE 
J075048I23AGCCGTCCGATNONE 
J075141A19AGCCGTCCGATNONE 
J075148E05AGCCGTCCGATNONE 
J090031M12AGCCGTCCGATNONE 
Os01g0558500AK099982ATCGGACGGCCPWWP domain containing protein. 
J065096J12ATCGGACGGCCNONE 
Os01g0606900AK065697ATCGGACGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0610100006-029-C12ATCGGACGGACNONE 
006-050-D02ATCGGACGGACNONE 
006-099-A06ATCGGACGGACNONE 
009-029-G03ATCGGACGGACNONE 
009-158-F07ATCGGACGGACNONE 
AK059810ATCGGACGGACSimilar to Clone ZZZ51 mRNA sequence. 
AK104951ATCGGACGGACNONE 
J065067E14ATCGGACGGACNONE 
J065073H01ATCGGACGGACNONE 
J065094E10ATCGGACGGACNONE 
J075041P17ATCGGACGGACNONE 
J075051M22ATCGGACGGACNONE 
J075089J01ATCGGACGGACNONE 
J075119L21ATCGGACGGACNONE 
J075161I08ATCGGACGGACNONE 
J090072B22ATCGGACGGACNONE 
Os01g0637600AK106980GCCGTCCGATSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0663400016-054-B01GATCGGACGGCNONE 
AK072283GATCGGACGGCSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645GATCGGACGGCNONE 
J065180A21GATCGGACGGCNONE 
J075026E13GATCGGACGGCNONE 
J075109M23GATCGGACGGCNONE 
J075151A02GATCGGACGGCNONE 
J090004B07GATCGGACGGCNONE 
J090023O22GATCGGACGGCNONE 
J090054G09GATCGGACGGCNONE 
J090058H13GATCGGACGGCNONE 
J090076G13GATCGGACGGCNONE 
J100057F11GATCGGACGGCNONE 
Os01g0691500AK073675CGTCCGATNONE 
AK107426CGTCCGATCytidylyltransferase domain containing protein. 
J013055P17CGTCCGATNONE 
J033050M21CGTCCGATNONE 
Os01g0691600AK103297ATCGGACGSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
Os01g0693900AK066034AGCCGTCCGATCNONE 
AK099894AGCCGTCCGATCPeptidyl-tRNA hydrolase family protein. 
J065165G19AGCCGTCCGATCNONE 
J100042C04AGCCGTCCGATCNONE 
Os01g0705700003-130-H06GATCGGACGGNONE 
AK064946GATCGGACGGSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
J013000P16GATCGGACGGNONE 
Os01g0730700AK109770CGTCCGATCWRKY transcription factor 14 (WRKY14). 
AY870603CGTCCGATCNONE 
J100033I11CGTCCGATCNONE 
J100047E19CGTCCGATCNONE 
J100050L18CGTCCGATCNONE 
Os01g0732200015-078-D03GATCGGACGGCTNONE 
AK067563GATCGGACGGCTGTP-binding protein, HSR1-related domain containing protein. 
J013111I12GATCGGACGGCTNONE 
J033113N16GATCGGACGGCTNONE 
J033124C05GATCGGACGGCTNONE 
Os01g0761100AK122112GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 
Os01g0766200AK069471ATCGGACGGCZinc finger, RING-type domain containing protein. 
AK070278ATCGGACGGCNONE 
J013074F08ATCGGACGGCNONE 
J023023M16ATCGGACGGCNONE 
J023049F08ATCGGACGGCNONE 
J065061D21ATCGGACGGCNONE 
J100083B13ATCGGACGGCNONE 
Os01g0796700AK120491ATCGGACGGZinc finger, RING-type domain containing protein. 
Os01g0801000AK064082ATCGGACGGCCNONE 
AK101426ATCGGACGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0801600AY224556CCGTCCGATCNONE 
Os01g0813400006-025-B06ATCGGACGGACNONE 
006-030-C07ATCGGACGGACNONE 
006-068-F06ATCGGACGGACNONE 
006-096-E09ATCGGACGGACNONE 
006-097-B11ATCGGACGGACNONE 
006-104-H02ATCGGACGGACNONE 
AK062251ATCGGACGGACNONE 
AK065370ATCGGACGGACSimilar to ADP-ribosylation factor 1. 
J013022G24ATCGGACGGACNONE 
J013104C07ATCGGACGGACNONE 
J023074M17ATCGGACGGACNONE 
J043027C07ATCGGACGGACNONE 
J065026K05ATCGGACGGACNONE 
J065103I01ATCGGACGGACNONE 
J090025M17ATCGGACGGACNONE 
J100027L03ATCGGACGGACNONE 
J100054I20ATCGGACGGACNONE 
Os01g0817700003-108-A10CCGTCCGATNONE 
AK060836CCGTCCGATNONE 
AK065059CCGTCCGATSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10CCGTCCGATNONE 
J013047D19CCGTCCGATNONE 
J013056K09CCGTCCGATNONE 
J013068P20CCGTCCGATNONE 
J013108G18CCGTCCGATNONE 
J023007N01CCGTCCGATNONE 
J023008A22CCGTCCGATNONE 
J023010B02CCGTCCGATNONE 
J023029O13CCGTCCGATNONE 
J023064F21CCGTCCGATNONE 
J023073E22CCGTCCGATNONE 
J023143E14CCGTCCGATNONE 
J033027N20CCGTCCGATNONE 
J033032G14CCGTCCGATNONE 
J033037E03CCGTCCGATNONE 
J033057N19CCGTCCGATNONE 
J033065E16CCGTCCGATNONE 
J033066B19CCGTCCGATNONE 
J033069G01CCGTCCGATNONE 
J033071B03CCGTCCGATNONE 
J033080C12CCGTCCGATNONE 
J033081K19CCGTCCGATNONE 
J033096B19CCGTCCGATNONE 
J033101E20CCGTCCGATNONE 
J033135L21CCGTCCGATNONE 
J033139I07CCGTCCGATNONE 
J033150A21CCGTCCGATNONE 
J043036J05CCGTCCGATNONE 
J043039D03CCGTCCGATNONE 
J043039F19CCGTCCGATNONE 
J090006K04CCGTCCGATNONE 
J090017G14CCGTCCGATNONE 
J090034E23CCGTCCGATNONE 
J090039D07CCGTCCGATNONE 
J090039I09CCGTCCGATNONE 
J090044F21CCGTCCGATNONE 
J090049J12CCGTCCGATNONE 
J090053A19CCGTCCGATNONE 
J090061E23CCGTCCGATNONE 
J090079K09CCGTCCGATNONE 
J090092F21CCGTCCGATNONE 
J100022E04CCGTCCGATNONE 
J100038I01CCGTCCGATNONE 
J100066C22CCGTCCGATNONE 
J100067C11CCGTCCGATNONE 
J100073F07CCGTCCGATNONE 
J100084I24CCGTCCGATNONE 
Os01g0830100AK069755CGGATCGGACGGAPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0837600AK108007ATCGGACGGCCConserved hypothetical protein 1589, plant family protein. 
J065005C19ATCGGACGGCCNONE 
J065025H20ATCGGACGGCCNONE 
J065061E22ATCGGACGGCCNONE 
J065065F14ATCGGACGGCCNONE 
J065083O21ATCGGACGGCCNONE 
J065201G05ATCGGACGGCCNONE 
Os01g0896800AK065268AGCCGTCCGATCNONE 
AK104693AGCCGTCCGATCEukaryotic ribosomal protein L5 family protein. 
J013126P09AGCCGTCCGATCNONE 
J033046N15AGCCGTCCGATCNONE 
J090008K02AGCCGTCCGATCNONE 
J090024F15AGCCGTCCGATCNONE 
J090074I23AGCCGTCCGATCNONE 
J090093F03AGCCGTCCGATCNONE 
J090096N02AGCCGTCCGATCNONE 
Os01g0927000AK106700AGCCGTCCGATCSimilar to SET domain-containing protein SET118. 
AK106700ATCGGACGGCSimilar to SET domain-containing protein SET118. 
Os01g0953400AK101164GATCGGACGNONE 
AK107454GATCGGACGNB-ARC domain containing protein. 
J033028C06GATCGGACGNONE 
J033036L10GATCGGACGNONE 
J043016F17GATCGGACGNONE 
J090057K16GATCGGACGNONE 
Os01g0971100009-033-D02CCGTCCGATNONE 
AK069516CCGTCCGATDrought induced 19 family protein. 
J023022E04CCGTCCGATNONE 
J023067L15CCGTCCGATNONE 
J023110D22CCGTCCGATNONE 
J075034M07CCGTCCGATNONE 
J075107K18CCGTCCGATNONE 
J075172M23CCGTCCGATNONE 
J100067J03CCGTCCGATNONE 
Os02g0100200AK121311CCGTCCGATSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0121100012-035-F06GGCCGTCCGATCNONE 
013-031-H05GGCCGTCCGATCNONE 
013-058-E11GGCCGTCCGATCNONE 
014-010-D01GGCCGTCCGATCNONE 
AK070711GGCCGTCCGATCConserved hypothetical protein. 
AK119758GGCCGTCCGATCNONE 
J013033G12GGCCGTCCGATCNONE 
J023007M16GGCCGTCCGATCNONE 
J023020K20GGCCGTCCGATCNONE 
J023061H10GGCCGTCCGATCNONE 
J033027H20GGCCGTCCGATCNONE 
J033051E18GGCCGTCCGATCNONE 
J090005F12GGCCGTCCGATCNONE 
J090017A20GGCCGTCCGATCNONE 
J090018G11GGCCGTCCGATCNONE 
J090062C18GGCCGTCCGATCNONE 
J100027N10GGCCGTCCGATCNONE 
J100032L14GGCCGTCCGATCNONE 
J100045C14GGCCGTCCGATCNONE 
J100061M09GGCCGTCCGATCNONE 
J100062K11GGCCGTCCGATCNONE 
J100064H11GGCCGTCCGATCNONE 
J100074H16GGCCGTCCGATCNONE 
J100082N01GGCCGTCCGATCNONE 
Os02g0122300016-074-F09CCGTCCGATNONE 
AK073059CCGTCCGATNONE 
AK106553CCGTCCGATConserved hypothetical protein. 
J065085D17CCGTCCGATNONE 
J065167I17CCGTCCGATNONE 
Os02g0135800006-039-F03GATCGGACGNONE 
AB055156GATCGGACGSimilar to Sec13-like protein (Fragment). 
AK111732GATCGGACGNONE 
AK112028GATCGGACGNONE 
J023038B14GATCGGACGNONE 
J023039H16GATCGGACGNONE 
J033033L03GATCGGACGNONE 
J033082B07GATCGGACGNONE 
J065076M03GATCGGACGNONE 
J065159C05GATCGGACGNONE 
J075052L24GATCGGACGNONE 
J075087J09GATCGGACGNONE 
J075119I03GATCGGACGNONE 
J075124I20GATCGGACGNONE 
J100042B01GATCGGACGNONE 
J100067M10GATCGGACGNONE 
Os02g0148100AF216317GATCGGACGGCCNONE 
AF241166GATCGGACGGCCNONE 
AK119650GATCGGACGGCCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0216200AK108648AGCCGTCCGATCHypothetical protein. 
Os02g0219000AK064689GATCGGACGGInterferon-related developmental regulator domain containing protein. 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK061944GCCGTCCGATCElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK103901ATCGGACGGNONE 
AK104946ATCGGACGGCCGAGATNONE 
AK104946GCCGTCCGATCNONE 
D89802ATCGGACGGCCGAGATNONE 
D89802GCCGTCCGATCNONE 
J013042L22ATCGGACGGCCGAGATNONE 
J013042L22GCCGTCCGATCNONE 
J013056A14ATCGGACGGCCGAGATNONE 
J013056A14GCCGTCCGATCNONE 
J013058O03ATCGGACGGNONE 
J013120G13ATCGGACGGCCGAGATNONE 
J013120G13GCCGTCCGATCNONE 
J013124E21ATCGGACGGNONE 
J013155K19ATCGGACGGCCGAGATNONE 
J013155K19GCCGTCCGATCNONE 
J023002B10ATCGGACGGCCGAGATNONE 
J023002B10GCCGTCCGATCNONE 
J023023L03ATCGGACGGNONE 
J023023L21ATCGGACGGNONE 
J023061N01ATCGGACGGNONE 
J023065O09ATCGGACGGNONE 
J023080J19ATCGGACGGCCGAGATNONE 
J023080J19GCCGTCCGATCNONE 
J023081C08ATCGGACGGCCGAGATNONE 
J023081C08GCCGTCCGATCNONE 
J023090H05ATCGGACGGCCGAGATNONE 
J023090H05GCCGTCCGATCNONE 
J023091M07ATCGGACGGCCGAGATNONE 
J023091M07GCCGTCCGATCNONE 
J023106J17ATCGGACGGNONE 
J023115F09ATCGGACGGCCGAGATNONE 
J023115F09GCCGTCCGATCNONE 
J023119N08ATCGGACGGNONE 
J033025I23ATCGGACGGCCGAGATNONE 
J033025I23GCCGTCCGATCNONE 
J033026G12ATCGGACGGCCGAGATNONE 
J033026G12GCCGTCCGATCNONE 
J033035E15ATCGGACGGCCGAGATNONE 
J033035E15GCCGTCCGATCNONE 
J033040N13ATCGGACGGCCGAGATNONE 
J033040N13GCCGTCCGATCNONE 
J033046C17ATCGGACGGCCGAGATNONE 
J033046C17GCCGTCCGATCNONE 
J033058A19ATCGGACGGNONE 
J033069F02ATCGGACGGCCGAGATNONE 
J033069F02GCCGTCCGATCNONE 
J033071B16ATCGGACGGCCGAGATNONE 
J033071B16GCCGTCCGATCNONE 
J033071N22ATCGGACGGCCGAGATNONE 
J033071N22GCCGTCCGATCNONE 
J033088J02ATCGGACGGCCGAGATNONE 
J033088J02GCCGTCCGATCNONE 
J033092N24ATCGGACGGCCGAGATNONE 
J033092N24GCCGTCCGATCNONE 
J033093I09ATCGGACGGCCGAGATNONE 
J033093I09GCCGTCCGATCNONE 
J033098O13ATCGGACGGNONE 
J033100M18ATCGGACGGNONE 
J033125A21ATCGGACGGNONE 
J033126G06ATCGGACGGCCGAGATNONE 
J033126G06GCCGTCCGATCNONE 
J033148C12ATCGGACGGNONE 
J043003G15ATCGGACGGCCGAGATNONE 
J043003G15GCCGTCCGATCNONE 
J043010M11ATCGGACGGCCGAGATNONE 
J043010M11GCCGTCCGATCNONE 
J043017F03ATCGGACGGNONE 
J043024O20ATCGGACGGCCGAGATNONE 
J043024O20GCCGTCCGATCNONE 
J043032J02ATCGGACGGNONE 
J053047N10ATCGGACGGNONE 
J053089P04ATCGGACGGNONE 
J065051K09ATCGGACGGNONE 
J065064H24ATCGGACGGNONE 
J065092N03ATCGGACGGCCGAGATNONE 
J065092N03GCCGTCCGATCNONE 
J080004D17ATCGGACGGCCGAGATNONE 
J080004D17GCCGTCCGATCNONE 
J080010L09ATCGGACGGCCGAGATNONE 
J080010L09GCCGTCCGATCNONE 
J080021I11ATCGGACGGCCGAGATNONE 
J080021I11GCCGTCCGATCNONE 
J080022L01ATCGGACGGCCGAGATNONE 
J080022L01GCCGTCCGATCNONE 
J080029B01ATCGGACGGCCGAGATNONE 
J080029B01GCCGTCCGATCNONE 
J080032D11ATCGGACGGCCGAGATNONE 
J080032D11GCCGTCCGATCNONE 
J080039B11ATCGGACGGCCGAGATNONE 
J080039B11GCCGTCCGATCNONE 
J080040K17ATCGGACGGCCGAGATNONE 
J080040K17GCCGTCCGATCNONE 
J080041B21ATCGGACGGCCGAGATNONE 
J080041B21GCCGTCCGATCNONE 
J080052L24ATCGGACGGCCGAGATNONE 
J080052L24GCCGTCCGATCNONE 
J080054M12ATCGGACGGCCGAGATNONE 
J080054M12GCCGTCCGATCNONE 
J080057B15ATCGGACGGCCGAGATNONE 
J080057B15GCCGTCCGATCNONE 
J080078G15ATCGGACGGCCGAGATNONE 
J080078G15GCCGTCCGATCNONE 
J080078H06ATCGGACGGCCGAGATNONE 
J080078H06GCCGTCCGATCNONE 
J080079M03ATCGGACGGCCGAGATNONE 
J080079M03GCCGTCCGATCNONE 
J080088H16ATCGGACGGCCGAGATNONE 
J080088H16GCCGTCCGATCNONE 
J080093C11ATCGGACGGCCGAGATNONE 
J080093C11GCCGTCCGATCNONE 
J080095K09ATCGGACGGCCGAGATNONE 
J080095K09GCCGTCCGATCNONE 
J080095O20ATCGGACGGCCGAGATNONE 
J080095O20GCCGTCCGATCNONE 
J090001L06ATCGGACGGNONE 
J090009J19ATCGGACGGCCGAGATNONE 
J090009J19GCCGTCCGATCNONE 
J090017C24ATCGGACGGNONE 
J090040D04ATCGGACGGCCGAGATNONE 
J090040D04GCCGTCCGATCNONE 
J090052E14ATCGGACGGCCGAGATNONE 
J090052E14GCCGTCCGATCNONE 
J090058G15ATCGGACGGNONE 
J090058H23ATCGGACGGNONE 
J090061G20ATCGGACGGNONE 
J090063B14ATCGGACGGCCGAGATNONE 
J090063B14GCCGTCCGATCNONE 
J090069N23ATCGGACGGNONE 
J090071A08ATCGGACGGNONE 
J090071K04ATCGGACGGCCGAGATNONE 
J090071K04GCCGTCCGATCNONE 
J090074A08ATCGGACGGNONE 
J090075E12ATCGGACGGCCGAGATNONE 
J090075E12GCCGTCCGATCNONE 
J090077B15ATCGGACGGNONE 
J090081K06ATCGGACGGNONE 
J090083I05ATCGGACGGNONE 
J090087A06ATCGGACGGCCGAGATNONE 
J090087A06GCCGTCCGATCNONE 
J090091O22ATCGGACGGNONE 
J090094P03ATCGGACGGCCGAGATNONE 
J090094P03GCCGTCCGATCNONE 
J090097L10ATCGGACGGNONE 
J090098M14ATCGGACGGCCGAGATNONE 
J090098M14GCCGTCCGATCNONE 
J100026B11ATCGGACGGNONE 
J100044M01ATCGGACGGNONE 
J100046F10ATCGGACGGNONE 
J100051K14ATCGGACGGNONE 
J100060D22ATCGGACGGNONE 
J100060H18ATCGGACGGNONE 
J100070I06ATCGGACGGNONE 
J100071C04ATCGGACGGNONE 
J100078M13ATCGGACGGNONE 
J100080E17ATCGGACGGNONE 
J100083I09ATCGGACGGNONE 
Os02g0287000006-107-B10AGCCGTCCGATCNONE 
006-120-E07AGCCGTCCGATCNONE 
AF052503AGCCGTCCGATCNONE 
AK059647AGCCGTCCGATCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AGCCGTCCGATCNONE 
J023048M05AGCCGTCCGATCNONE 
J033107L10AGCCGTCCGATCNONE 
J065019A12AGCCGTCCGATCNONE 
J065064J21AGCCGTCCGATCNONE 
J065071D15AGCCGTCCGATCNONE 
J065094L12AGCCGTCCGATCNONE 
J065095L06AGCCGTCCGATCNONE 
J065097J11AGCCGTCCGATCNONE 
J065099M08AGCCGTCCGATCNONE 
J065104D01AGCCGTCCGATCNONE 
J065107L02AGCCGTCCGATCNONE 
J065110D14AGCCGTCCGATCNONE 
J065135J07AGCCGTCCGATCNONE 
J065137C16AGCCGTCCGATCNONE 
J065150C07AGCCGTCCGATCNONE 
J065165I10AGCCGTCCGATCNONE 
J065189F07AGCCGTCCGATCNONE 
J065205L22AGCCGTCCGATCNONE 
J065214C09AGCCGTCCGATCNONE 
J065217G17AGCCGTCCGATCNONE 
J075029E17AGCCGTCCGATCNONE 
J075054O16AGCCGTCCGATCNONE 
J075068N23AGCCGTCCGATCNONE 
J075135N18AGCCGTCCGATCNONE 
J075152G09AGCCGTCCGATCNONE 
J075162D10AGCCGTCCGATCNONE 
J075164F11AGCCGTCCGATCNONE 
J080036L12AGCCGTCCGATCNONE 
J080049K18AGCCGTCCGATCNONE 
J080060P03AGCCGTCCGATCNONE 
J080062G16AGCCGTCCGATCNONE 
J080062G21AGCCGTCCGATCNONE 
J080064N07AGCCGTCCGATCNONE 
J080075I22AGCCGTCCGATCNONE 
J080086F20AGCCGTCCGATCNONE 
J080087G07AGCCGTCCGATCNONE 
J080088I06AGCCGTCCGATCNONE 
J080302B20AGCCGTCCGATCNONE 
J080303L14AGCCGTCCGATCNONE 
J080309O12AGCCGTCCGATCNONE 
J080317F12AGCCGTCCGATCNONE 
J080317P18AGCCGTCCGATCNONE 
J090013L15AGCCGTCCGATCNONE 
J090043N04AGCCGTCCGATCNONE 
J090085G01AGCCGTCCGATCNONE 
J090085G19AGCCGTCCGATCNONE 
Os02g0299600AK069297CCGTCCGATCProtein of unknown function DUF1242 family protein. 
Os02g0317500AK102355ATCGGACGCyclin-like F-box domain containing protein. 
AK102355ATCGGACGGCyclin-like F-box domain containing protein. 
J065039N02ATCGGACGNONE 
J065039N02ATCGGACGGNONE 
J065213B01ATCGGACGNONE 
J065213B01ATCGGACGGNONE 
J075173H12ATCGGACGNONE 
J075173H12ATCGGACGGNONE 
J090087A18ATCGGACGNONE 
J090087A18ATCGGACGGNONE 
J100025O06ATCGGACGNONE 
J100025O06ATCGGACGGNONE 
Os02g0453300006-099-D03CCGTCCGATCNONE 
009-120-D02CCGTCCGATCNONE 
AK071220CCGTCCGATCNONE 
AK109380CCGTCCGATCConserved hypothetical protein. 
J023083M17CCGTCCGATCNONE 
Os02g0462800AK110587GCCGTCCGATCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GCCGTCCGATCNONE 
Os02g0533900AB062681CGGATCGGACGGNONE 
AK061722CGGATCGGACGGNONE 
AK106147CGGATCGGACGGNONE 
AK121892CGGATCGGACGGSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0556700AK073875GGCCGTCCGATCT-complex 11 family protein. 
Os02g0601800AB060276GTCCGTCCGATCNONE 
AK099539GTCCGTCCGATCNONE 
AK101873GTCCGTCCGATCBromodomain containing protein. 
AK106801GTCCGTCCGATCNONE 
AK121758GTCCGTCCGATCNONE 
AK121891GTCCGTCCGATCNONE 
J013059H01GTCCGTCCGATCNONE 
J013092F08GTCCGTCCGATCNONE 
J013146J04GTCCGTCCGATCNONE 
J023001K12GTCCGTCCGATCNONE 
J023002H16GTCCGTCCGATCNONE 
J023013B10GTCCGTCCGATCNONE 
J023081I22GTCCGTCCGATCNONE 
J023084K19GTCCGTCCGATCNONE 
J023150E24GTCCGTCCGATCNONE 
J033023B18GTCCGTCCGATCNONE 
J033025F18GTCCGTCCGATCNONE 
J033048P08GTCCGTCCGATCNONE 
J033060M24GTCCGTCCGATCNONE 
J033070G06GTCCGTCCGATCNONE 
J033088P12GTCCGTCCGATCNONE 
J033105C13GTCCGTCCGATCNONE 
J043009N18GTCCGTCCGATCNONE 
J065103G21GTCCGTCCGATCNONE 
J075039H15GTCCGTCCGATCNONE 
J090014K10GTCCGTCCGATCNONE 
J090022N02GTCCGTCCGATCNONE 
J090033F18GTCCGTCCGATCNONE 
J090033I04GTCCGTCCGATCNONE 
J090041F11GTCCGTCCGATCNONE 
J090045P20GTCCGTCCGATCNONE 
J090054B01GTCCGTCCGATCNONE 
J090055M12GTCCGTCCGATCNONE 
J090071K09GTCCGTCCGATCNONE 
J090098O16GTCCGTCCGATCNONE 
J090099P15GTCCGTCCGATCNONE 
J100050I16GTCCGTCCGATCNONE 
Os02g0622400005-010-C04AGCCGTCCGATCNONE 
AK061679AGCCGTCCGATCConserved hypothetical protein. 
J013058H01AGCCGTCCGATCNONE 
J013095D07AGCCGTCCGATCNONE 
J023054G05AGCCGTCCGATCNONE 
J023093A17AGCCGTCCGATCNONE 
J023146P16AGCCGTCCGATCNONE 
J033089D16AGCCGTCCGATCNONE 
J033099G12AGCCGTCCGATCNONE 
J033131N10AGCCGTCCGATCNONE 
J053073J04AGCCGTCCGATCNONE 
J053074P03AGCCGTCCGATCNONE 
J053075M06AGCCGTCCGATCNONE 
J053088K13AGCCGTCCGATCNONE 
J090039F18AGCCGTCCGATCNONE 
J090045M03AGCCGTCCGATCNONE 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0720200AK105451ATCGGACGGNONE 
AK121803ATCGGACGGSimilar to 65kD microtubule associated protein. 
Os02g0744000AK064898CGTCCGATConserved hypothetical protein. 
AK104827CGTCCGATNONE 
J013000L12CGTCCGATNONE 
J013156N02CGTCCGATNONE 
J065001H14CGTCCGATNONE 
J065038D18CGTCCGATNONE 
J065039I18CGTCCGATNONE 
J065047C13CGTCCGATNONE 
J065053J09CGTCCGATNONE 
J065064G03CGTCCGATNONE 
J065066M05CGTCCGATNONE 
J065068O10CGTCCGATNONE 
J065090H22CGTCCGATNONE 
J065113L19CGTCCGATNONE 
J065121M02CGTCCGATNONE 
J065122K23CGTCCGATNONE 
J065138C12CGTCCGATNONE 
J065153E14CGTCCGATNONE 
J065156N12CGTCCGATNONE 
J065158L20CGTCCGATNONE 
J065166I06CGTCCGATNONE 
J065174L15CGTCCGATNONE 
J065175N03CGTCCGATNONE 
J090092C23CGTCCGATNONE 
Os02g0750500AK101960GGCCGTCCGATSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GGCCGTCCGATNONE 
J065054F02GGCCGTCCGATNONE 
J065124N03GGCCGTCCGATNONE 
J090001H12GGCCGTCCGATNONE 
J100057J01GGCCGTCCGATNONE 
J100062F12GGCCGTCCGATNONE 
Os02g0754300009-048-D05AGCCGTCCGATNONE 
AK059012AGCCGTCCGATNONE 
AK068621AGCCGTCCGATNONE 
AK099805AGCCGTCCGATRibosomal protein L29 family protein. 
J065102P04AGCCGTCCGATNONE 
J065161I03AGCCGTCCGATNONE 
Os02g0776800AB042415GGCCGTCCGATNONE 
AK072308GGCCGTCCGATReplication protein A 70kDa. 
AK101212GGCCGTCCGATNONE 
J033031B02GGCCGTCCGATNONE 
J090004E18GGCCGTCCGATNONE 
J090084C24GGCCGTCCGATNONE 
Os02g0807750J075136J04GCCGTCCGATCHypothetical protein. 
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein. 
J023149K08AGCCGTCCGATCCCCACGTNONE 
J033042K17AGCCGTCCGATCCCCACGTNONE 
J033073E05AGCCGTCCGATCCCCACGTNONE 
J043032K02AGCCGTCCGATCCCCACGTNONE 
J090009D04AGCCGTCCGATCCCCACGTNONE 
J090037M16AGCCGTCCGATCCCCACGTNONE 
Os03g0115400003-126-D04CGTCCGATCCGNONE 
AK103356CGTCCGATCCGWD40-like domain containing protein. 
AK103522CGTCCGATCCGNONE 
J033126K20CGTCCGATCCGNONE 
J033131K03CGTCCGATCCGNONE 
J033131K05CGTCCGATCCGNONE 
J033136B16CGTCCGATCCGNONE 
J033147E04CGTCCGATCCGNONE 
J043027H03CGTCCGATCCGNONE 
J065173H02CGTCCGATCCGNONE 
J075032C10CGTCCGATCCGNONE 
J075040D19CGTCCGATCCGNONE 
J075060L18CGTCCGATCCGNONE 
J075084N07CGTCCGATCCGNONE 
J075112M18CGTCCGATCCGNONE 
J075132I01CGTCCGATCCGNONE 
J075195E06CGTCCGATCCGNONE 
J090016B20CGTCCGATCCGNONE 
J090063F20CGTCCGATCCGNONE 
J100061H04CGTCCGATCCGNONE 
J100089D15CGTCCGATCCGNONE 
Os03g0132900006-025-D05ATCGGACGGANONE 
006-080-C01ATCGGACGGANONE 
AF001501ATCGGACGGANONE 
AK059871ATCGGACGGANONE 
AK099355ATCGGACGGASimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03ATCGGACGGANONE 
J033044P19ATCGGACGGANONE 
J033119B12ATCGGACGGANONE 
J075009H20ATCGGACGGANONE 
J075122E04ATCGGACGGANONE 
J075161D07ATCGGACGGANONE 
Os03g0136200004-011-E10AGCCGTCCGATCNONE 
006-067-A08AGCCGTCCGATCNONE 
011-007-E02AGCCGTCCGATCNONE 
011-099-H10AGCCGTCCGATCNONE 
012-044-D08AGCCGTCCGATCNONE 
013-045-G12AGCCGTCCGATCNONE 
013-062-C09AGCCGTCCGATCNONE 
013-072-F09AGCCGTCCGATCNONE 
013-085-B12AGCCGTCCGATCNONE 
013-097-E09AGCCGTCCGATCNONE 
013-097-F09AGCCGTCCGATCNONE 
014-013-C09AGCCGTCCGATCNONE 
014-082-D08AGCCGTCCGATCNONE 
015-071-A09AGCCGTCCGATCNONE 
AF042333AGCCGTCCGATCNONE 
AK060887AGCCGTCCGATCNONE 
AK121681AGCCGTCCGATC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14AGCCGTCCGATCNONE 
J013123F01AGCCGTCCGATCNONE 
J023050A02AGCCGTCCGATCNONE 
J033046H22AGCCGTCCGATCNONE 
J033070A11AGCCGTCCGATCNONE 
J065059G11AGCCGTCCGATCNONE 
J065068F10AGCCGTCCGATCNONE 
J065164A10AGCCGTCCGATCNONE 
J075031F07AGCCGTCCGATCNONE 
J075054J01AGCCGTCCGATCNONE 
J075086M04AGCCGTCCGATCNONE 
J075118K23AGCCGTCCGATCNONE 
J075122A09AGCCGTCCGATCNONE 
J075123D06AGCCGTCCGATCNONE 
J075129A22AGCCGTCCGATCNONE 
J075161E07AGCCGTCCGATCNONE 
J075179H04AGCCGTCCGATCNONE 
J075181C06AGCCGTCCGATCNONE 
J075186A12AGCCGTCCGATCNONE 
J090014H16AGCCGTCCGATCNONE 
J090045G17AGCCGTCCGATCNONE 
J090048B09AGCCGTCCGATCNONE 
J090052J23AGCCGTCCGATCNONE 
J090052K22AGCCGTCCGATCNONE 
J090059F10AGCCGTCCGATCNONE 
J090080F19AGCCGTCCGATCNONE 
J100039J08AGCCGTCCGATCNONE 
J100044K02AGCCGTCCGATCNONE 
J100051E16AGCCGTCCGATCNONE 
J100053F08AGCCGTCCGATCNONE 
J100056F07AGCCGTCCGATCNONE 
J100058A10AGCCGTCCGATCNONE 
Os03g0145700AK065716CGTCCGATNONE 
J013039F14CGTCCGATNONE 
J013091M20CGTCCGATNONE 
J065059P20CGTCCGATNONE 
J065128M07CGTCCGATNONE 
J065136N23CGTCCGATNONE 
J065163H21CGTCCGATNONE 
J065176B18CGTCCGATNONE 
J065177A17CGTCCGATNONE 
J065201F24CGTCCGATNONE 
Os03g0151500AK109181GATCGGACGGConserved hypothetical protein. 
Os03g0156500011-075-F02ATCGGACGGGCCGCANONE 
011-075-F02GATCGGACGGNONE 
012-077-G10ATCGGACGGGCCGCANONE 
012-077-G10GATCGGACGGNONE 
AK103466ATCGGACGGGCCGCALupus La protein family protein. 
AK103466GATCGGACGGLupus La protein family protein. 
J013088H17ATCGGACGGGCCGCANONE 
J013088H17GATCGGACGGNONE 
J013135G21ATCGGACGGGCCGCANONE 
J013135G21GATCGGACGGNONE 
J033050E10ATCGGACGGGCCGCANONE 
J033050E10GATCGGACGGNONE 
J033050J01ATCGGACGGGCCGCANONE 
J033050J01GATCGGACGGNONE 
J033129N23ATCGGACGGGCCGCANONE 
J033129N23GATCGGACGGNONE 
J065085L16ATCGGACGGGCCGCANONE 
J065085L16GATCGGACGGNONE 
J065101B19ATCGGACGGGCCGCANONE 
J065101B19GATCGGACGGNONE 
J065167N03ATCGGACGGGCCGCANONE 
J065167N03GATCGGACGGNONE 
J090009O21ATCGGACGGGCCGCANONE 
J090009O21GATCGGACGGNONE 
J090049D11ATCGGACGGGCCGCANONE 
J090049D11GATCGGACGGNONE 
J100017F23ATCGGACGGGCCGCANONE 
J100017F23GATCGGACGGNONE 
J100040E12ATCGGACGGGCCGCANONE 
J100040E12GATCGGACGGNONE 
J100055O18ATCGGACGGGCCGCANONE 
J100055O18GATCGGACGGNONE 
J100061K08ATCGGACGGGCCGCANONE 
J100061K08GATCGGACGGNONE 
J100072M05ATCGGACGGGCCGCANONE 
J100072M05GATCGGACGGNONE 
J100077B08ATCGGACGGGCCGCANONE 
J100077B08GATCGGACGGNONE 
J100086G03ATCGGACGGGCCGCANONE 
J100086G03GATCGGACGGNONE 
Os03g0159600AK106743CCAACGGCGTCCGATSimilar to Rab28 protein. 
J075041K15CCAACGGCGTCCGATNONE 
J075051E03CCAACGGCGTCCGATNONE 
J075055P19CCAACGGCGTCCGATNONE 
J075096D01CCAACGGCGTCCGATNONE 
Os03g0160900J065071D24ATCGGACGGCTNONE 
J065132L03ATCGGACGGCTHypothetical protein. 
J075189L19ATCGGACGGCTNONE 
Os03g0177100AK068092AGCCGTCCGATCConserved hypothetical protein. 
J100036F01AGCCGTCCGATCNONE 
J100040N06AGCCGTCCGATCNONE 
J100043E08AGCCGTCCGATCNONE 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0217900AK119980AGCCGTCCGATConserved hypothetical protein. 
J053089K18AGCCGTCCGATNONE 
J090058B20AGCCGTCCGATNONE 
J090081L09AGCCGTCCGATNONE 
Os03g0232500AK110980ATCGGACGGTP-binding protein, HSR1-related domain containing protein. 
J100036C06ATCGGACGNONE 
Os03g0245100AK059346ATCGGACGGCTNONE 
AK069529ATCGGACGGCTDihydrodipicolinate reductase family protein. 
AK102253ATCGGACGGCTNONE 
J023004J01ATCGGACGGCTNONE 
J033089J05ATCGGACGGCTNONE 
Os03g0269300011-021-H03AGCCGTCCGATCNONE 
011-029-B01AGCCGTCCGATCNONE 
AK111855AGCCGTCCGATCNONE 
AK111884AGCCGTCCGATCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0285800AF216315GCCGTCCGATCNONE 
AF332873GCCGTCCGATCNONE 
AF479883GCCGTCCGATCNONE 
AF479884GCCGTCCGATCNONE 
AJ250311GCCGTCCGATCNONE 
AJ486975GCCGTCCGATCNONE 
AK067339GCCGTCCGATCMAP Kinase. 
AK104834GCCGTCCGATCNONE 
J013102O17GCCGTCCGATCNONE 
J023055N19GCCGTCCGATCNONE 
J023099F06GCCGTCCGATCNONE 
J065144H06GCCGTCCGATCNONE 
J065153A14GCCGTCCGATCNONE 
J065212K01GCCGTCCGATCNONE 
Os03g0296300AK100042CGGATCGGACGGMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os03g0296400AK073460CCGTCCGATCCGSimilar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment). 
AK104149CCGTCCGATCCGNONE 
AK105818CCGTCCGATCCGNONE 
Os03g0300200AK102070ATCGGACGGCTSimilar to Ubiquitin-specific protease 16. 
Os03g0314800AK103334GCCGTCCGATCPlant neutral invertase family protein. 
Os03g0334800AK101595ATCGGACGLung seven transmembrane receptor family protein. 
AK101595CGTCCGATLung seven transmembrane receptor family protein. 
J023110B03ATCGGACGNONE 
J023110B03CGTCCGATNONE 
J065102E22ATCGGACGNONE 
J065102E22CGTCCGATNONE 
J065102F24ATCGGACGNONE 
J065102F24CGTCCGATNONE 
J065140O22ATCGGACGNONE 
J065140O22CGTCCGATNONE 
J075001N09ATCGGACGNONE 
J075001N09CGTCCGATNONE 
J075057F24ATCGGACGNONE 
J075057F24CGTCCGATNONE 
J075197K01ATCGGACGNONE 
J075197K01CGTCCGATNONE 
J090080D05ATCGGACGNONE 
J090080D05CGTCCGATNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AB026559ATCGGACGGCGCGCGACNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCGCGCGACNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
AK101195ATCGGACGGCGCGCGACNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCGCGCGACNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCGCGCGACNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCGCGCGACNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCGCGCGACNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCGCGCGACNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCGCGCGACNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCGCGCGACNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCGCGCGACNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCGCGCGACNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCGCGCGACNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCGCGCGACNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCGCGCGACNONE 
Os03g0390600009-122-E09GCCGTCCGATCNONE 
J065165K04GCCGTCCGATCNONE 
Os03g0425100AK070206GCCGTCCGATCHypothetical protein. 
J023042E01GCCGTCCGATCNONE 
Os03g0574300AK072541ATCGGACGGCCHypothetical protein. 
J023134M10ATCGGACGGCCNONE 
Os03g0646300AK069229CGGATCGGACGGSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0659900AK067560TCTGGACCGTCCGATCSimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
J090029C14TCTGGACCGTCCGATCNONE 
Os03g0668400AK119454ATCGGACGProtein of unknown function DUF860, plant family protein. 
Os03g0670700009-028-B03GCCGTCCGATCNONE 
009-036-H12GCCGTCCGATCNONE 
009-053-H05GCCGTCCGATCNONE 
009-126-B02GCCGTCCGATCNONE 
009-135-D07GCCGTCCGATCNONE 
009-148-A03GCCGTCCGATCNONE 
009-148-A12GCCGTCCGATCNONE 
009-152-B02GCCGTCCGATCNONE 
009-153-B06GCCGTCCGATCNONE 
009-166-G05GCCGTCCGATCNONE 
009-181-A09GCCGTCCGATCNONE 
011-061-D07GCCGTCCGATCNONE 
012-043-C04GCCGTCCGATCNONE 
013-001-A02GCCGTCCGATCNONE 
013-004-F05GCCGTCCGATCNONE 
013-008-C08GCCGTCCGATCNONE 
013-015-B09GCCGTCCGATCNONE 
013-016-G05GCCGTCCGATCNONE 
013-023-A06GCCGTCCGATCNONE 
013-023-B06GCCGTCCGATCNONE 
013-032-F09GCCGTCCGATCNONE 
013-059-C07GCCGTCCGATCNONE 
013-071-E09GCCGTCCGATCNONE 
013-073-D06GCCGTCCGATCNONE 
013-077-C02GCCGTCCGATCNONE 
013-078-B12GCCGTCCGATCNONE 
013-093-A01GCCGTCCGATCNONE 
014-002-B12GCCGTCCGATCNONE 
014-003-E08GCCGTCCGATCNONE 
014-004-D06GCCGTCCGATCNONE 
014-007-C11GCCGTCCGATCNONE 
014-007-G10GCCGTCCGATCNONE 
014-019-C04GCCGTCCGATCNONE 
014-021-F05GCCGTCCGATCNONE 
014-024-G06GCCGTCCGATCNONE 
014-027-C07GCCGTCCGATCNONE 
014-027-D03GCCGTCCGATCNONE 
014-029-E07GCCGTCCGATCNONE 
014-031-B04GCCGTCCGATCNONE 
014-033-B05GCCGTCCGATCNONE 
014-033-C03GCCGTCCGATCNONE 
014-033-C12GCCGTCCGATCNONE 
014-036-F01GCCGTCCGATCNONE 
014-037-C04GCCGTCCGATCNONE 
014-040-H02GCCGTCCGATCNONE 
014-045-H04GCCGTCCGATCNONE 
014-045-H06GCCGTCCGATCNONE 
014-052-A08GCCGTCCGATCNONE 
014-076-G01GCCGTCCGATCNONE 
014-083-F04GCCGTCCGATCNONE 
014-086-E01GCCGTCCGATCNONE 
014-091-D02GCCGTCCGATCNONE 
014-091-F05GCCGTCCGATCNONE 
014-093-E10GCCGTCCGATCNONE 
014-100-C10GCCGTCCGATCNONE 
015-011-H02GCCGTCCGATCNONE 
015-073-B03GCCGTCCGATCNONE 
AF010579GCCGTCCGATCNONE 
AK059164GCCGTCCGATCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCCGTCCGATCNONE 
AK119238GCCGTCCGATCNONE 
AK119242GCCGTCCGATCNONE 
J023037K17GCCGTCCGATCNONE 
J033136F11GCCGTCCGATCNONE 
J065008C13GCCGTCCGATCNONE 
J065032K18GCCGTCCGATCNONE 
J065043N10GCCGTCCGATCNONE 
J065045E06GCCGTCCGATCNONE 
J065046P21GCCGTCCGATCNONE 
J065048J17GCCGTCCGATCNONE 
J065053I23GCCGTCCGATCNONE 
J065053P03GCCGTCCGATCNONE 
J065054C13GCCGTCCGATCNONE 
J065058I17GCCGTCCGATCNONE 
J065061I12GCCGTCCGATCNONE 
J065062E09GCCGTCCGATCNONE 
J065063P04GCCGTCCGATCNONE 
J065068J07GCCGTCCGATCNONE 
J065076D02GCCGTCCGATCNONE 
J065083O07GCCGTCCGATCNONE 
J065090J02GCCGTCCGATCNONE 
J065093N08GCCGTCCGATCNONE 
J065097F02GCCGTCCGATCNONE 
J065112H17GCCGTCCGATCNONE 
J065121B01GCCGTCCGATCNONE 
J065124F12GCCGTCCGATCNONE 
J065130L03GCCGTCCGATCNONE 
J065131K05GCCGTCCGATCNONE 
J065132C06GCCGTCCGATCNONE 
J065135J18GCCGTCCGATCNONE 
J065138J22GCCGTCCGATCNONE 
J065140G21GCCGTCCGATCNONE 
J065161B19GCCGTCCGATCNONE 
J065162F22GCCGTCCGATCNONE 
J065162M09GCCGTCCGATCNONE 
J065163D03GCCGTCCGATCNONE 
J065163O21GCCGTCCGATCNONE 
J065165H11GCCGTCCGATCNONE 
J065165O16GCCGTCCGATCNONE 
J065167N06GCCGTCCGATCNONE 
J065168I08GCCGTCCGATCNONE 
J065170A14GCCGTCCGATCNONE 
J065170L03GCCGTCCGATCNONE 
J065171C08GCCGTCCGATCNONE 
J065173G11GCCGTCCGATCNONE 
J065173M09GCCGTCCGATCNONE 
J065176P07GCCGTCCGATCNONE 
J065178K24GCCGTCCGATCNONE 
J065185O12GCCGTCCGATCNONE 
J065191E02GCCGTCCGATCNONE 
J065204H10GCCGTCCGATCNONE 
J075033C23GCCGTCCGATCNONE 
J075041M21GCCGTCCGATCNONE 
J075043F13GCCGTCCGATCNONE 
J075044D02GCCGTCCGATCNONE 
J075044J15GCCGTCCGATCNONE 
J075048L07GCCGTCCGATCNONE 
J075054G12GCCGTCCGATCNONE 
J075055J10GCCGTCCGATCNONE 
J075059F09GCCGTCCGATCNONE 
J075066M23GCCGTCCGATCNONE 
J075071O09GCCGTCCGATCNONE 
J075085G23GCCGTCCGATCNONE 
J075086B21GCCGTCCGATCNONE 
J075087L18GCCGTCCGATCNONE 
J075087L21GCCGTCCGATCNONE 
J075087N14GCCGTCCGATCNONE 
J075088O13GCCGTCCGATCNONE 
J075089B06GCCGTCCGATCNONE 
J075089E20GCCGTCCGATCNONE 
J075090J01GCCGTCCGATCNONE 
J075090L05GCCGTCCGATCNONE 
J075091G05GCCGTCCGATCNONE 
J075091N06GCCGTCCGATCNONE 
J075093G08GCCGTCCGATCNONE 
J075094C13GCCGTCCGATCNONE 
J075095K01GCCGTCCGATCNONE 
J075096C02GCCGTCCGATCNONE 
J075097L16GCCGTCCGATCNONE 
J075097O10GCCGTCCGATCNONE 
J075098H24GCCGTCCGATCNONE 
J075099H02GCCGTCCGATCNONE 
J075099J11GCCGTCCGATCNONE 
J075099L08GCCGTCCGATCNONE 
J075109I11GCCGTCCGATCNONE 
J075114F03GCCGTCCGATCNONE 
J075121G07GCCGTCCGATCNONE 
J075122D23GCCGTCCGATCNONE 
J075132O07GCCGTCCGATCNONE 
J075141L21GCCGTCCGATCNONE 
J075142I08GCCGTCCGATCNONE 
J075145A06GCCGTCCGATCNONE 
J075147J15GCCGTCCGATCNONE 
J075150B09GCCGTCCGATCNONE 
J075151E07GCCGTCCGATCNONE 
J075161M16GCCGTCCGATCNONE 
J075190I16GCCGTCCGATCNONE 
J075192L05GCCGTCCGATCNONE 
J075192O03GCCGTCCGATCNONE 
J075192O08GCCGTCCGATCNONE 
J075193L12GCCGTCCGATCNONE 
J080001M24GCCGTCCGATCNONE 
J080004E20GCCGTCCGATCNONE 
J080005K15GCCGTCCGATCNONE 
J080005L05GCCGTCCGATCNONE 
J080014P20GCCGTCCGATCNONE 
J080029D12GCCGTCCGATCNONE 
J080030H09GCCGTCCGATCNONE 
J080039G05GCCGTCCGATCNONE 
J080040E18GCCGTCCGATCNONE 
J080041B02GCCGTCCGATCNONE 
J080041E06GCCGTCCGATCNONE 
J080041G05GCCGTCCGATCNONE 
J080041G24GCCGTCCGATCNONE 
J080041H07GCCGTCCGATCNONE 
J080041K03GCCGTCCGATCNONE 
J080047G01GCCGTCCGATCNONE 
J080052E07GCCGTCCGATCNONE 
J080053B15GCCGTCCGATCNONE 
J080053N01GCCGTCCGATCNONE 
J080054I01GCCGTCCGATCNONE 
J080054N02GCCGTCCGATCNONE 
J080063P03GCCGTCCGATCNONE 
J080064E13GCCGTCCGATCNONE 
J080064G13GCCGTCCGATCNONE 
J080065F02GCCGTCCGATCNONE 
J080065G03GCCGTCCGATCNONE 
J080065K17GCCGTCCGATCNONE 
J080067D06GCCGTCCGATCNONE 
J080067H23GCCGTCCGATCNONE 
J080067M15GCCGTCCGATCNONE 
J080068B20GCCGTCCGATCNONE 
J080068G24GCCGTCCGATCNONE 
J080072K19GCCGTCCGATCNONE 
J080076I24GCCGTCCGATCNONE 
J080092F05GCCGTCCGATCNONE 
J080092K14GCCGTCCGATCNONE 
J080092N22GCCGTCCGATCNONE 
J080093K02GCCGTCCGATCNONE 
J080094C08GCCGTCCGATCNONE 
J080094E09GCCGTCCGATCNONE 
J080094E20GCCGTCCGATCNONE 
J080094G08GCCGTCCGATCNONE 
J080094H18GCCGTCCGATCNONE 
J080094P22GCCGTCCGATCNONE 
J080095J23GCCGTCCGATCNONE 
J080096F14GCCGTCCGATCNONE 
J080097A21GCCGTCCGATCNONE 
J080097I07GCCGTCCGATCNONE 
J080097J02GCCGTCCGATCNONE 
J080097K01GCCGTCCGATCNONE 
J080097K03GCCGTCCGATCNONE 
J080305H18GCCGTCCGATCNONE 
J080306G01GCCGTCCGATCNONE 
J080306O08GCCGTCCGATCNONE 
J080311I01GCCGTCCGATCNONE 
J080315N24GCCGTCCGATCNONE 
J090003K21GCCGTCCGATCNONE 
J090008C20GCCGTCCGATCNONE 
J090008K19GCCGTCCGATCNONE 
J090008P13GCCGTCCGATCNONE 
J090015H22GCCGTCCGATCNONE 
J090016M01GCCGTCCGATCNONE 
J090018E13GCCGTCCGATCNONE 
J090018G03GCCGTCCGATCNONE 
J090018L17GCCGTCCGATCNONE 
J090019H11GCCGTCCGATCNONE 
J090021B19GCCGTCCGATCNONE 
J090021K02GCCGTCCGATCNONE 
J090023H15GCCGTCCGATCNONE 
J090034E03GCCGTCCGATCNONE 
J090045D16GCCGTCCGATCNONE 
J090045I06GCCGTCCGATCNONE 
J090047L09GCCGTCCGATCNONE 
J090048B05GCCGTCCGATCNONE 
J090048D11GCCGTCCGATCNONE 
J090048N11GCCGTCCGATCNONE 
J090050F20GCCGTCCGATCNONE 
J090052M20GCCGTCCGATCNONE 
J090083H03GCCGTCCGATCNONE 
J090084C12GCCGTCCGATCNONE 
J090095B05GCCGTCCGATCNONE 
J090095M18GCCGTCCGATCNONE 
J100024I22GCCGTCCGATCNONE 
J100024J12GCCGTCCGATCNONE 
J100024J22GCCGTCCGATCNONE 
J100025F07GCCGTCCGATCNONE 
J100026B13GCCGTCCGATCNONE 
J100027N03GCCGTCCGATCNONE 
J100029F14GCCGTCCGATCNONE 
J100029L20GCCGTCCGATCNONE 
J100032C22GCCGTCCGATCNONE 
J100032I08GCCGTCCGATCNONE 
J100032O05GCCGTCCGATCNONE 
J100033J24GCCGTCCGATCNONE 
J100033L12GCCGTCCGATCNONE 
J100034K06GCCGTCCGATCNONE 
J100037D09GCCGTCCGATCNONE 
J100038H02GCCGTCCGATCNONE 
J100039A12GCCGTCCGATCNONE 
J100039N12GCCGTCCGATCNONE 
J100039O21GCCGTCCGATCNONE 
J100040K05GCCGTCCGATCNONE 
J100042A02GCCGTCCGATCNONE 
J100042A17GCCGTCCGATCNONE 
J100043C15GCCGTCCGATCNONE 
J100044A17GCCGTCCGATCNONE 
J100044E18GCCGTCCGATCNONE 
J100044I11GCCGTCCGATCNONE 
J100044J15GCCGTCCGATCNONE 
J100045E23GCCGTCCGATCNONE 
J100049B18GCCGTCCGATCNONE 
J100050G04GCCGTCCGATCNONE 
J100051D06GCCGTCCGATCNONE 
J100051H20GCCGTCCGATCNONE 
J100052J01GCCGTCCGATCNONE 
J100052K07GCCGTCCGATCNONE 
J100055I01GCCGTCCGATCNONE 
J100057D02GCCGTCCGATCNONE 
J100059G14GCCGTCCGATCNONE 
J100059G21GCCGTCCGATCNONE 
J100059H03GCCGTCCGATCNONE 
J100059H15GCCGTCCGATCNONE 
J100063E13GCCGTCCGATCNONE 
J100063M02GCCGTCCGATCNONE 
J100064B17GCCGTCCGATCNONE 
J100064F11GCCGTCCGATCNONE 
J100066G12GCCGTCCGATCNONE 
J100066H09GCCGTCCGATCNONE 
J100068B12GCCGTCCGATCNONE 
J100068L16GCCGTCCGATCNONE 
J100068M23GCCGTCCGATCNONE 
J100069A02GCCGTCCGATCNONE 
J100069D07GCCGTCCGATCNONE 
J100069M13GCCGTCCGATCNONE 
J100070C07GCCGTCCGATCNONE 
J100070J11GCCGTCCGATCNONE 
J100070L20GCCGTCCGATCNONE 
J100071H10GCCGTCCGATCNONE 
J100072L14GCCGTCCGATCNONE 
J100072N12GCCGTCCGATCNONE 
J100073A21GCCGTCCGATCNONE 
J100074K17GCCGTCCGATCNONE 
J100074M04GCCGTCCGATCNONE 
J100075F11GCCGTCCGATCNONE 
J100076E23GCCGTCCGATCNONE 
J100076G03GCCGTCCGATCNONE 
J100077K01GCCGTCCGATCNONE 
J100077N23GCCGTCCGATCNONE 
J100079H17GCCGTCCGATCNONE 
J100081N01GCCGTCCGATCNONE 
J100082E04GCCGTCCGATCNONE 
J100082K11GCCGTCCGATCNONE 
J100085H23GCCGTCCGATCNONE 
J100086O18GCCGTCCGATCNONE 
J100087F21GCCGTCCGATCNONE 
J100088E02GCCGTCCGATCNONE 
J100088F08GCCGTCCGATCNONE 
J100088G24GCCGTCCGATCNONE 
J100088K20GCCGTCCGATCNONE 
J100089B19GCCGTCCGATCNONE 
J100089K22GCCGTCCGATCNONE 
J100089N22GCCGTCCGATCNONE 
J100089O17GCCGTCCGATCNONE 
J100090N05GCCGTCCGATCNONE 
Os03g0684400AK100086CCGTCCGATCCGMg2+ transporter protein, CorA-like family protein. 
AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0686700006-062-F06GATCGGACGGNONE 
AK109359GATCGGACGGConserved hypothetical protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0699300AK120407CCGAGCCGTCCGATCSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase). 
Os03g0699400AK069110CGTCCGATSilencing group B protein. 
J023009F11CGTCCGATNONE 
J065010K14CGTCCGATNONE 
J065013G22CGTCCGATNONE 
J065041E22CGTCCGATNONE 
J065045P04CGTCCGATNONE 
J065060N03CGTCCGATNONE 
J065077K12CGTCCGATNONE 
J090024D16CGTCCGATNONE 
J100031M08CGTCCGATNONE 
J100075I05CGTCCGATNONE 
Os03g0710000006-023-G11ATCGGACGGACNONE 
006-050-E05ATCGGACGGACNONE 
AK060065ATCGGACGGACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364ATCGGACGGACNONE 
AK104418ATCGGACGGACNONE 
J033051P12ATCGGACGGACNONE 
J065046L09ATCGGACGGACNONE 
J075021F06ATCGGACGGACNONE 
J075106P12ATCGGACGGACNONE 
Os03g0718000AB116722CGTCCGATNONE 
AK105178CGTCCGATSimilar to Anthranilate synthase beta chain. 
Os03g0728100AK068717TCCGTCCGATCHeat shock protein DnaJ, N-terminal domain containing protein. 
AK099970TCCGTCCGATCNONE 
Os03g0728800AK068068ATCGGACGGCSimilar to RNA helicase (Fragment). 
J013129E17ATCGGACGGCNONE 
J065158C03ATCGGACGGCNONE 
J075173I18ATCGGACGGCNONE 
J075181P17ATCGGACGGCNONE 
J090026F13ATCGGACGGCNONE 
J090029J16ATCGGACGGCNONE 
J090058N01ATCGGACGGCNONE 
J090082F21ATCGGACGGCNONE 
J100067H15ATCGGACGGCNONE 
J100085I09ATCGGACGGCNONE 
Os03g0746000AK073682AGCCGTCCGATCConserved hypothetical protein. 
AK111472AGCCGTCCGATCNONE 
J090083F05AGCCGTCCGATCNONE 
Os03g0751100AK102404CCGTCCGATCSimilar to Isp4 protein-like. 
Os03g0758400004-001-G04CGTCCGATNONE 
AK111573CGTCCGATNONE 
Os03g0780600AK120180CCGTCCGATNONE 
D13224CCGTCCGATTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCGTCCGATNONE 
J033022G05CCGTCCGATNONE 
J033028A16CCGTCCGATNONE 
J033050M08CCGTCCGATNONE 
J090053F04CCGTCCGATNONE 
J090064E19CCGTCCGATNONE 
J090083J24CCGTCCGATNONE 
J100024I23CCGTCCGATNONE 
Os03g0784400AK103474CCGTCCGATCProtein of unknown function DUF1692 domain containing protein. 
J023135I15CCGTCCGATCNONE 
J033130D12CCGTCCGATCNONE 
J043035E20CCGTCCGATCNONE 
J065206K15CCGTCCGATCNONE 
J075053J20CCGTCCGATCNONE 
J075129B11CCGTCCGATCNONE 
J090003E22CCGTCCGATCNONE 
J100023E23CCGTCCGATCNONE 
Os03g0811100AK072463ATCGGACGGCTSimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC 6.6.1.1) (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
Os03g0815900013-097-G08AGCCGTCCGATCGGACNONE 
AK065258AGCCGTCCGATCGGACNONE 
AK119756AGCCGTCCGATCGGACSimilar to DNA-directed RNA polymerase. 
J013002J17AGCCGTCCGATCGGACNONE 
J013074A12AGCCGTCCGATCGGACNONE 
J023045C17AGCCGTCCGATCGGACNONE 
J033050E21AGCCGTCCGATCGGACNONE 
J053094P05AGCCGTCCGATCGGACNONE 
J090038F11AGCCGTCCGATCGGACNONE 
J090072J01AGCCGTCCGATCGGACNONE 
J100026H07AGCCGTCCGATCGGACNONE 
J100040O06AGCCGTCCGATCGGACNONE 
J100083D07AGCCGTCCGATCGGACNONE 
Os03g0822800AK069263GGCCGTCCGATCNONE 
AK099592GGCCGTCCGATCSimilar to Chaperone protein dnaJ 1. 
J013043N03GGCCGTCCGATCNONE 
Os03g0826800006-081-B04ATCGGACGGCTNONE 
006-081-B04CCGTCCGATCNONE 
015-050-A02ATCGGACGGCTNONE 
015-050-A02CCGTCCGATCNONE 
AK065702ATCGGACGGCTConserved hypothetical protein. 
AK065702CCGTCCGATCConserved hypothetical protein. 
AK119789ATCGGACGGCTNONE 
AK119789CCGTCCGATCNONE 
J013035P06ATCGGACGGCTNONE 
J013035P06CCGTCCGATCNONE 
J023025I11ATCGGACGGCTNONE 
J023025I11CCGTCCGATCNONE 
J065023J15ATCGGACGGCTNONE 
J065023J15CCGTCCGATCNONE 
J065204K04ATCGGACGGCTNONE 
J065204K04CCGTCCGATCNONE 
J075021L07ATCGGACGGCTNONE 
J075021L07CCGTCCGATCNONE 
J075104F02ATCGGACGGCTNONE 
J075104F02CCGTCCGATCNONE 
J075146J05ATCGGACGGCTNONE 
J075146J05CCGTCCGATCNONE 
J100026H04ATCGGACGGCTNONE 
J100026H04CCGTCCGATCNONE 
J100031M07ATCGGACGGCTNONE 
J100031M07CCGTCCGATCNONE 
J100035A06ATCGGACGGCTNONE 
J100035A06CCGTCCGATCNONE 
J100052J05ATCGGACGGCTNONE 
J100052J05CCGTCCGATCNONE 
J100059F12ATCGGACGGCTNONE 
J100059F12CCGTCCGATCNONE 
J100071F10ATCGGACGGCTNONE 
J100071F10CCGTCCGATCNONE 
J100074G08ATCGGACGGCTNONE 
J100074G08CCGTCCGATCNONE 
J100074G24ATCGGACGGCTNONE 
J100074G24CCGTCCGATCNONE 
J100082L21ATCGGACGGCTNONE 
J100082L21CCGTCCGATCNONE 
Os03g0854800J090007D13CCGTCCGATCNONE 
J090085N22CCGTCCGATCNONE 
Os04g0266400AK065632GCCGTCCGATNONE 
AK068202GCCGTCCGATSimilar to AHM2 (Fragment). 
AK072046GCCGTCCGATNONE 
AK105688GCCGTCCGATNONE 
Os04g0270200006-099-F09ATCGGACGNONE 
006-099-F09ATCGGACGGCCNONE 
AK061854ATCGGACGProtein of unknown function UPF0172 family protein. 
AK061854ATCGGACGGCCProtein of unknown function UPF0172 family protein. 
AK099002ATCGGACGNONE 
AK099002ATCGGACGGCCNONE 
J013110N19ATCGGACGNONE 
J013110N19ATCGGACGGCCNONE 
J075054J19ATCGGACGNONE 
J075054J19ATCGGACGGCCNONE 
Os04g0278000AK120988GATCGGACGSimilar to PRLI-interacting factor G (Fragment). 
Os04g0286400009-144-C10GCCGTCCGATNONE 
AK062974GCCGTCCGATHypothetical protein. 
Os04g0401800AB197127AGCCGTCCGATCCGDNA repair metallo-beta-lactamase domain containing protein. 
AB197127GATCGGACGGCTDNA repair metallo-beta-lactamase domain containing protein. 
AK103868AGCCGTCCGATCCGNONE 
AK103868GATCGGACGGCTNONE 
J033149H08AGCCGTCCGATCCGNONE 
J033149H08GATCGGACGGCTNONE 
J065020C11AGCCGTCCGATCCGNONE 
J065020C11GATCGGACGGCTNONE 
J075179J09AGCCGTCCGATCCGNONE 
J075179J09GATCGGACGGCTNONE 
J090034B13AGCCGTCCGATCCGNONE 
J090034B13GATCGGACGGCTNONE 
Os04g0405401J013026L01CGTGGACCGTCCGATNONE 
J033141G07CGTGGACCGTCCGATHypothetical protein. 
J033144F10CGTGGACCGTCCGATNONE 
J033145F10CGTGGACCGTCCGATNONE 
J065065C15CGTGGACCGTCCGATNONE 
J065107C14CGTGGACCGTCCGATNONE 
J065140M21CGTGGACCGTCCGATNONE 
J075192C06CGTGGACCGTCCGATNONE 
Os04g0409600J065199G22CCGTCCGATNONE 
J075074G17CCGTCCGATNONE 
J075137E03CCGTCCGATNONE 
J090088M17CCGTCCGATNONE 
Os04g0423600AK065331ATCGGACGGNuclear protein SET domain containing protein. 
J013000M22ATCGGACGGNONE 
J013069D18ATCGGACGGNONE 
J023099G24ATCGGACGGNONE 
J033041P19ATCGGACGGNONE 
Os04g0448200AK068842CGTCCGATCCGConserved hypothetical protein. 
Os04g0482300015-088-C07ATCGGACGGNONE 
AK064143ATCGGACGGBTB domain containing protein. 
J065053L16ATCGGACGGNONE 
J065053N15ATCGGACGGNONE 
Os04g0485400AK109290CCGTCCGATCSimilar to Nucleotide-binding protein. 
AK120649CCGTCCGATCNONE 
J013156K04CCGTCCGATCNONE 
J043026O10CCGTCCGATCNONE 
Os04g0496400011-042-H11ATCGGACGGACNONE 
AK111787ATCGGACGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY224465ATCGGACGGACNONE 
J033106N02ATCGGACGGACNONE 
J043026P11ATCGGACGGACNONE 
J065134J18ATCGGACGGACNONE 
Os04g0496600AK065058ATCGGACGGCConserved hypothetical protein. 
J013001J09ATCGGACGGCNONE 
J013037C18ATCGGACGGCNONE 
J013126H05ATCGGACGGCNONE 
J090062G17ATCGGACGGCNONE 
Os04g0506300AK063591ATCGGACGGTCCAGATMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08ATCGGACGGTCCAGANONE 
Os04g0510000AK109180ATCGGACGGConserved hypothetical protein. 
Os04g0528100009-090-G06GATCGGACGGCTNONE 
009-168-C11GATCGGACGGCTNONE 
AK065957GATCGGACGGCTConserved hypothetical protein. 
J013039G20GATCGGACGGCTNONE 
J013044D08GATCGGACGGCTNONE 
J065013L14GATCGGACGGCTNONE 
J065143H08GATCGGACGGCTNONE 
J065146C14GATCGGACGGCTNONE 
J065149K22GATCGGACGGCTNONE 
J065156B18GATCGGACGGCTNONE 
J065201A04GATCGGACGGCTNONE 
J065209A04GATCGGACGGCTNONE 
Os04g0529600Os04g0529600ATCGGACGGLanthionine synthetase C-like family protein. 
Os04g0532800AK107135TCCGTCCGATMyb, DNA-binding domain containing protein. 
J075026K21TCCGTCCGATNONE 
Os04g0566900AK072344AGCCGTCCGATCConserved hypothetical protein. 
Os04g0598000013-056-C01ATCGGACGGCNONE 
AK121673ATCGGACGGCConserved hypothetical protein. 
J013055M22ATCGGACGGCNONE 
J023038C06ATCGGACGGCNONE 
J033068C09ATCGGACGGCNONE 
J075026L16ATCGGACGGCNONE 
J075099K14ATCGGACGGCNONE 
J075121B18ATCGGACGGCNONE 
J075156K08ATCGGACGGCNONE 
J075190I04ATCGGACGGCNONE 
J080315E20ATCGGACGGCNONE 
J090049E09ATCGGACGGCNONE 
J100024F09ATCGGACGGCNONE 
J100041H21ATCGGACGGCNONE 
J100073L07ATCGGACGGCNONE 
J100077K04ATCGGACGGCNONE 
J100080P09ATCGGACGGCNONE 
J100087E22ATCGGACGGCNONE 
Os04g0602800AK100925GGCCGTCCGATCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0606800009-159-H11GATCGGACGGNONE 
AK072824GATCGGACGGConserved hypothetical protein. 
J033070J06GATCGGACGGNONE 
J033119D03GATCGGACGGNONE 
J100043F05GATCGGACGGNONE 
J100050A01GATCGGACGGNONE 
Os04g0644100AK106954GCCGTCCGATSterile alpha motif homology domain containing protein. 
Os04g0652900AK071125ATCCCCCATCGGACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03ATCCCCCATCGGACGGNONE 
J075142E01ATCCCCCATCGGACGGNONE 
Os04g0661300AK070723CGGATCGGACGGConserved hypothetical protein. 
AK103942CGGATCGGACGGNONE 
Os04g0667800009-032-B03GATCGGACGGTCCACGNONE 
009-175-C09GATCGGACGGTCCACGNONE 
AK119682GATCGGACGGTCCACGUbiquitin-conjugating enzyme (EC 6.3.2.19) (Ubiquitin carrier protein). 
AY083611GATCGGACGGTCCACGNONE 
D50574GATCGGACGGTCCACGNONE 
J013020D04GATCGGACGGTCCACGNONE 
J013126O03GATCGGACGGTCCACGNONE 
J023044K22GATCGGACGGTCCACGNONE 
J023054C17GATCGGACGGTCCACGNONE 
J023131A07GATCGGACGGTCCACGNONE 
J023138F02GATCGGACGGTCCACGNONE 
J033031L18GATCGGACGGTCCACGNONE 
J033092L17GATCGGACGGTCCACGNONE 
J033101J19GATCGGACGGTCCACGNONE 
J033129I17GATCGGACGGTCCACGNONE 
J033135F22GATCGGACGGTCCACGNONE 
J065005G02GATCGGACGGTCCACGNONE 
J065014I11GATCGGACGGTCCACGNONE 
J065026D12GATCGGACGGTCCACGNONE 
J065029D14GATCGGACGGTCCACGNONE 
J065036I19GATCGGACGGTCCACGNONE 
J065044A14GATCGGACGGTCCACGNONE 
J065044J17GATCGGACGGTCCACGNONE 
J065046F15GATCGGACGGTCCACGNONE 
J065061A14GATCGGACGGTCCACGNONE 
J065061I08GATCGGACGGTCCACGNONE 
J065079L11GATCGGACGGTCCACGNONE 
J065087A11GATCGGACGGTCCACGNONE 
J065093D04GATCGGACGGTCCACGNONE 
J065096I01GATCGGACGGTCCACGNONE 
J065096M23GATCGGACGGTCCACGNONE 
J065100K04GATCGGACGGTCCACGNONE 
J065106K02GATCGGACGGTCCACGNONE 
J065130J11GATCGGACGGTCCACGNONE 
J065146N23GATCGGACGGTCCACGNONE 
J065150M20GATCGGACGGTCCACGNONE 
J065160C01GATCGGACGGTCCACGNONE 
J065160M08GATCGGACGGTCCACGNONE 
J065185C17GATCGGACGGTCCACGNONE 
J065185L09GATCGGACGGTCCACGNONE 
J065199P04GATCGGACGGTCCACGNONE 
J065205K13GATCGGACGGTCCACGNONE 
J075007E03GATCGGACGGTCCACGNONE 
J075027H02GATCGGACGGTCCACGNONE 
J075031M24GATCGGACGGTCCACGNONE 
J075047H22GATCGGACGGTCCACGNONE 
J075055G17GATCGGACGGTCCACGNONE 
J075057G04GATCGGACGGTCCACGNONE 
J075060E23GATCGGACGGTCCACGNONE 
J075067G09GATCGGACGGTCCACGNONE 
J075071K19GATCGGACGGTCCACGNONE 
J075071L16GATCGGACGGTCCACGNONE 
J075126P16GATCGGACGGTCCACGNONE 
J075128N12GATCGGACGGTCCACGNONE 
J080006I16GATCGGACGGTCCACGNONE 
J080045P16GATCGGACGGTCCACGNONE 
J080057E18GATCGGACGGTCCACGNONE 
J080078I07GATCGGACGGTCCACGNONE 
J090032G07GATCGGACGGTCCACGNONE 
J090048G17GATCGGACGGTCCACGNONE 
J090092D14GATCGGACGGTCCACGNONE 
J100038E15GATCGGACGGTCCACGNONE 
J100039H02GATCGGACGGTCCACGNONE 
J100069P09GATCGGACGGTCCACGNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0112101J065141G20AGCCGTCCGATCEpsin, N-terminal domain containing protein. 
Os05g0148000AK066256CCGTCCGATNONE 
J013057C10CCGTCCGATNONE 
J065105L17CCGTCCGATNONE 
J065188E18CCGTCCGATNONE 
Os05g0150600011-043-D06CCGTCCGATCNONE 
AK072977CCGTCCGATCATP-dependent DNA helicase RecQ family protein. 
AY180331CCGTCCGATCNONE 
J090053A16CCGTCCGATCNONE 
Os05g0203000AK107744CGTCCGATConserved hypothetical protein. 
Os05g0214100AK100400GTCCGTCCGATCSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105GTCCGTCCGATCNONE 
J013073B12GTCCGTCCGATCNONE 
J013093B07GTCCGTCCGATCNONE 
J023086N14GTCCGTCCGATCNONE 
J065143B06GTCCGTCCGATCNONE 
J090009B02GTCCGTCCGATCNONE 
J090075A13GTCCGTCCGATCNONE 
Os05g0297900AK071238AGCCGTCCGATCSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03AGCCGTCCGATCNONE 
J023041J06AGCCGTCCGATCNONE 
J023085B09AGCCGTCCGATCNONE 
J033031J11AGCCGTCCGATCNONE 
J065010C22AGCCGTCCGATCNONE 
J065032E10AGCCGTCCGATCNONE 
J065141O18AGCCGTCCGATCNONE 
J065155K04AGCCGTCCGATCNONE 
Os05g0328000AK107977GATCGGACGGCCConserved hypothetical protein. 
AK107977GGCCGTCCGATCConserved hypothetical protein. 
J065005I02GATCGGACGGCCNONE 
J065005I02GGCCGTCCGATCNONE 
J065049M05GATCGGACGGCCNONE 
J065049M05GGCCGTCCGATCNONE 
J080005F01GATCGGACGGCCNONE 
J080005F01GGCCGTCCGATCNONE 
J080005H15GATCGGACGGCCNONE 
J080005H15GGCCGTCCGATCNONE 
J080005K23GATCGGACGGCCNONE 
J080005K23GGCCGTCCGATCNONE 
J080007O03GATCGGACGGCCNONE 
J080007O03GGCCGTCCGATCNONE 
J080013H09GATCGGACGGCCNONE 
J080013H09GGCCGTCCGATCNONE 
J080024C02GATCGGACGGCCNONE 
J080024C02GGCCGTCCGATCNONE 
J080026M22GATCGGACGGCCNONE 
J080026M22GGCCGTCCGATCNONE 
J080029K21GATCGGACGGCCNONE 
J080029K21GGCCGTCCGATCNONE 
J080032K04GATCGGACGGCCNONE 
J080032K04GGCCGTCCGATCNONE 
J080034M16GATCGGACGGCCNONE 
J080034M16GGCCGTCCGATCNONE 
J080037G11GATCGGACGGCCNONE 
J080037G11GGCCGTCCGATCNONE 
J080040L01GATCGGACGGCCNONE 
J080040L01GGCCGTCCGATCNONE 
J080041D13GATCGGACGGCCNONE 
J080041D13GGCCGTCCGATCNONE 
J080043G20GATCGGACGGCCNONE 
J080043G20GGCCGTCCGATCNONE 
J080046H17GATCGGACGGCCNONE 
J080046H17GGCCGTCCGATCNONE 
J080048A05GATCGGACGGCCNONE 
J080048A05GGCCGTCCGATCNONE 
J080064C21GATCGGACGGCCNONE 
J080064C21GGCCGTCCGATCNONE 
J080067E15GATCGGACGGCCNONE 
J080067E15GGCCGTCCGATCNONE 
J080071P05GATCGGACGGCCNONE 
J080071P05GGCCGTCCGATCNONE 
J080074H16GATCGGACGGCCNONE 
J080074H16GGCCGTCCGATCNONE 
J080076A18GATCGGACGGCCNONE 
J080076A18GGCCGTCCGATCNONE 
J080076D20GATCGGACGGCCNONE 
J080076D20GGCCGTCCGATCNONE 
J080077J15GATCGGACGGCCNONE 
J080077J15GGCCGTCCGATCNONE 
J080085J11GATCGGACGGCCNONE 
J080085J11GGCCGTCCGATCNONE 
J080086E08GATCGGACGGCCNONE 
J080086E08GGCCGTCCGATCNONE 
J080088I23GATCGGACGGCCNONE 
J080088I23GGCCGTCCGATCNONE 
J080088I24GATCGGACGGCCNONE 
J080088I24GGCCGTCCGATCNONE 
J080089D05GATCGGACGGCCNONE 
J080089D05GGCCGTCCGATCNONE 
J080093B04GATCGGACGGCCNONE 
J080093B04GGCCGTCCGATCNONE 
J080093D07GATCGGACGGCCNONE 
J080093D07GGCCGTCCGATCNONE 
J080094A09GATCGGACGGCCNONE 
J080094A09GGCCGTCCGATCNONE 
J080096I12GATCGGACGGCCNONE 
J080096I12GGCCGTCCGATCNONE 
J080097L23GATCGGACGGCCNONE 
J080097L23GGCCGTCCGATCNONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0350500013-071-D05ATCGGACGGANONE 
AF020787ATCGGACGGANONE 
AK061712ATCGGACGGANONE 
AK102897ATCGGACGGAProliferation-associated protein 1 family protein. 
J033060G23ATCGGACGGANONE 
J033112P14ATCGGACGGANONE 
J033127J04ATCGGACGGANONE 
J090015L18ATCGGACGGANONE 
J090047K03ATCGGACGGANONE 
J090097J17ATCGGACGGANONE 
Os05g0395300AK066212CCGTCCGATCProtein of unknown function DUF21 domain containing protein. 
Os05g0408300AK068553CGTCCGATConserved hypothetical protein. 
Os05g0413200006-067-C03CGCGTGGGACCGTCCGATCNONE 
006-067-C03GCCGTCCGATCCGNONE 
006-080-C03CGCGTGGGACCGTCCGATCNONE 
006-080-C03GCCGTCCGATCCGNONE 
006-095-G10CGCGTGGGACCGTCCGATCNONE 
006-095-G10GCCGTCCGATCCGNONE 
006-115-G11CGCGTGGGACCGTCCGATCNONE 
006-115-G11GCCGTCCGATCCGNONE 
013-040-E05CGCGTGGGACCGTCCGATCNONE 
013-040-E05GCCGTCCGATCCGNONE 
AB104732CGCGTGGGACCGTCCGATCNONE 
AB104732GCCGTCCGATCCGNONE 
AK122099CGCGTGGGACCGTCCGATCBeta-tubulin. 
AK122099GCCGTCCGATCCGBeta-tubulin. 
J033087H20CGCGTGGGACCGTCCGATCNONE 
J033087H20GCCGTCCGATCCGNONE 
J033117C18CGCGTGGGACCGTCCGATCNONE 
J033117C18GCCGTCCGATCCGNONE 
J033125G10CGCGTGGGACCGTCCGATCNONE 
J033125G10GCCGTCCGATCCGNONE 
Os05g0428600AK106696CCGTCCGATCSimilar to HSP70 precursor. 
Os05g0506900AK106697CGTGGACCGTCCGATCBrix domain containing protein. 
Os05g0510700AK070308GATCGGACGGCTCGGBSD domain containing protein. 
Os05g0547850009-102-F03CGGATCGGACGGCCNONE 
009-102-F03GATCGGACGNONE 
013-076-H08CGGATCGGACGGCCNONE 
013-076-H08GATCGGACGNONE 
AK058330CGGATCGGACGGCCNONE 
AK058330GATCGGACGNONE 
AK122158CGGATCGGACGGCCDNA-binding TFAR19-related protein family protein. 
AK122158GATCGGACGDNA-binding TFAR19-related protein family protein. 
AY626826CGGATCGGACGGCCNONE 
AY626826GATCGGACGNONE 
J043012O19CGGATCGGACGGCCNONE 
J043012O19GATCGGACGNONE 
J043038O15CGGATCGGACGGCCNONE 
J043038O15GATCGGACGNONE 
J053094L06CGGATCGGACGGCCNONE 
J053094L06GATCGGACGNONE 
Os05g0548100AK060333AGCCGTCCGATCCGConserved hypothetical protein. 
AK060333CGTCCGATCConserved hypothetical protein. 
AK100682AGCCGTCCGATCCGNONE 
AK100682CGTCCGATCNONE 
J013151E01AGCCGTCCGATCCGNONE 
J013151E01CGTCCGATCNONE 
J023113L22AGCCGTCCGATCCGNONE 
J023113L22CGTCCGATCNONE 
J043027A19AGCCGTCCGATCCGNONE 
J043027A19CGTCCGATCNONE 
J075093E06AGCCGTCCGATCCGNONE 
J075093E06CGTCCGATCNONE 
J090060D15AGCCGTCCGATCCGNONE 
J090060D15CGTCCGATCNONE 
J090082J03AGCCGTCCGATCCGNONE 
J090082J03CGTCCGATCNONE 
J100050E01AGCCGTCCGATCCGNONE 
J100050E01CGTCCGATCNONE 
Os05g0557200AK062090GATCGGACGGNONE 
AK102111GATCGGACGGArmadillo-like helical domain containing protein. 
J013047E13GATCGGACGGNONE 
J013089P04GATCGGACGGNONE 
J013130H17GATCGGACGGNONE 
J013132C20GATCGGACGGNONE 
J023001E06GATCGGACGGNONE 
J023108C09GATCGGACGGNONE 
J023125C12GATCGGACGGNONE 
J033023O10GATCGGACGGNONE 
J033033K16GATCGGACGGNONE 
J033064C11GATCGGACGGNONE 
J033071P07GATCGGACGGNONE 
J033072H14GATCGGACGGNONE 
J033084F06GATCGGACGGNONE 
J033084H11GATCGGACGGNONE 
J033097C05GATCGGACGGNONE 
J043009E20GATCGGACGGNONE 
J053035M10GATCGGACGGNONE 
J053043J22GATCGGACGGNONE 
J053082K10GATCGGACGGNONE 
J053094N13GATCGGACGGNONE 
Os05g0567100015-030-G11GATCGGACGGNONE 
AK066453GATCGGACGGNONE 
AK067742GATCGGACGGNONE 
AK098906GATCGGACGGNONE 
AK098911GATCGGACGGNONE 
AK103421GATCGGACGGNONE 
AK104838GATCGGACGGNONE 
D32144GATCGGACGGAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14GATCGGACGGNONE 
J013002H22GATCGGACGGNONE 
J013022G01GATCGGACGGNONE 
J013039N15GATCGGACGGNONE 
J023007F19GATCGGACGGNONE 
J023107B10GATCGGACGGNONE 
J033038D21GATCGGACGGNONE 
J033043E23GATCGGACGGNONE 
J033061A06GATCGGACGGNONE 
Os05g0586600AB096011CCGTCCGATCCGPlastid sigma factor SIG5. 
AB096011GGCCGTCCGATPlastid sigma factor SIG5. 
AB096071CCGTCCGATCCGNONE 
AB096071GGCCGTCCGATNONE 
AK105697CCGTCCGATCCGNONE 
AK105697GGCCGTCCGATNONE 
Os05g0597100011-044-C10ATCGGACGGCCNONE 
AF255711ATCGGACGGCCNONE 
AK072845ATCGGACGGCCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16ATCGGACGGCCNONE 
J023135M22ATCGGACGGCCNONE 
J023141B21ATCGGACGGCCNONE 
J023142J09ATCGGACGGCCNONE 
J033025E09ATCGGACGGCCNONE 
J033111A20ATCGGACGGCCNONE 
J033126I01ATCGGACGGCCNONE 
Os06g0107800009-133-F03GATCGGACGGNONE 
AK062921GATCGGACGGSimilar to RAV-like protein. 
Os06g0146300AK101052ATCGGACGGCConserved hypothetical protein. 
J075003H04ATCGGACGGCNONE 
J075039J08ATCGGACGGCNONE 
J075054H14ATCGGACGGCNONE 
J075091E08ATCGGACGGCNONE 
J075097L20ATCGGACGGCNONE 
J075179P07ATCGGACGGCNONE 
Os06g0157000009-109-H03ATCGGACGNONE 
009-109-H03CCGTCCGATNONE 
AK066113ATCGGACGLipolytic enzyme, G-D-S-L family protein. 
AK066113CCGTCCGATLipolytic enzyme, G-D-S-L family protein. 
Os06g0166900012-095-F08ATCGGACGGNONE 
AK058497ATCGGACGGProtein kinase-like domain containing protein. 
J023122G08ATCGGACGGNONE 
J033039B21ATCGGACGGNONE 
J090077C01ATCGGACGGNONE 
Os06g0184300AK102933CGTCCGATPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os06g0245800AK066714ATCGGACGGCSimilar to Alanyl-tRNA synthetase. 
Os06g0264700J100028B14CCGTCCGATCAcylphosphatase domain containing protein. 
Os06g0326700AK101908GATCGGACGDiacylglycerol acyltransferase family protein. 
Os06g0329350009-021-B05CGTCCGATNONE 
009-043-A04CGTCCGATNONE 
009-051-G06CGTCCGATNONE 
009-107-D02CGTCCGATNONE 
009-111-B11CGTCCGATNONE 
009-118-B02CGTCCGATNONE 
009-132-A11CGTCCGATNONE 
009-186-B06CGTCCGATNONE 
J065044N12CGTCCGATNONE 
J065097L15CGTCCGATNONE 
J065219N02CGTCCGATNONE 
J080009E03CGTCCGATNONE 
J080020P03CGTCCGATNONE 
J080024O15CGTCCGATNONE 
J080030B22CGTCCGATNONE 
J080032G04CGTCCGATNONE 
J080045B12CGTCCGATNONE 
J080048M05CGTCCGATNONE 
J080051M16CGTCCGATNONE 
J080053K12CGTCCGATNONE 
J080056G17CGTCCGATNONE 
J080068O22CGTCCGATNONE 
J080074K04CGTCCGATNONE 
J080075B20CGTCCGATNONE 
J080077I03CGTCCGATNONE 
J080081E17CGTCCGATNONE 
J080082B08CGTCCGATNONE 
J080084I03CGTCCGATNONE 
J080092F08CGTCCGATNONE 
J090086C01CGTCCGATConserved hypothetical protein. 
Os06g0360600004-004-E05GCCGTCCGATNONE 
AK059997GCCGTCCGATNONE 
Os06g0498400AK103463CGTCCGATSimilar to Alpha-glucan water dikinase, chloroplast precursor (EC 2.7.9.4) (Starch-related R1 protein). 
Os06g0499900J065053E01CCGTCCGATCNONE 
J065078C19CCGTCCGATCNONE 
J065122P11CCGTCCGATCNONE 
J065209B15CCGTCCGATCNONE 
J065218E19CCGTCCGATCNONE 
Os06g0505400AK068107ATCGGACGGCTAbortive infection protein family protein. 
J013074E10ATCGGACGGCTNONE 
J013130C21ATCGGACGGCTNONE 
J033070J05ATCGGACGGCTNONE 
J033139B07ATCGGACGGCTNONE 
J043040G03ATCGGACGGCTNONE 
J065169G13ATCGGACGGCTNONE 
J075005M22ATCGGACGGCTNONE 
J075021E02ATCGGACGGCTNONE 
J075038D02ATCGGACGGCTNONE 
J075076G19ATCGGACGGCTNONE 
Os06g0506100AK107403GATCGGACGGCTProtein prenyltransferase domain containing protein. 
Os06g0618000AK110866GGCCCCACATCGGACGConserved hypothetical protein. 
Os06g0622300012-053-G09CCGTCCGATNONE 
AK064549CCGTCCGATNONE 
AK073058CCGTCCGATNONE 
AK099075CCGTCCGATAT-rich interaction region domain containing protein. 
AK101550CCGTCCGATNONE 
J013130P12CCGTCCGATNONE 
J013170P10CCGTCCGATNONE 
J023064P06CCGTCCGATNONE 
J033126H02CCGTCCGATNONE 
J080315M12CCGTCCGATNONE 
J090078H02CCGTCCGATNONE 
Os06g0656800AK109762ATCGGACGBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0666400AK108002GATCGGACGGCTVQ domain containing protein. 
J065043C22GATCGGACGGCTNONE 
J065120O19GATCGGACGGCTNONE 
J075197D23GATCGGACGGCTNONE 
J100030E22GATCGGACGGCTNONE 
J100031I22GATCGGACGGCTNONE 
J100072I12GATCGGACGGCTNONE 
Os06g0667400AK065424CCGTCCGATCConserved hypothetical protein. 
AK065580CCGTCCGATCNONE 
Os06g0708600009-019-C12GATCGGACGGNONE 
009-019-C12GATCGGACGGNONE 
013-092-H09GATCGGACGGNONE 
013-092-H09GATCGGACGGNONE 
014-031-G05GATCGGACGGNONE 
014-031-G05GATCGGACGGNONE 
AK100915GATCGGACGGConserved hypothetical protein. 
AK100915GATCGGACGGConserved hypothetical protein. 
J065065F24GATCGGACGGNONE 
J065065F24GATCGGACGGNONE 
J065208J10GATCGGACGGNONE 
J065208J10GATCGGACGGNONE 
J100068H01GATCGGACGGNONE 
J100068H01GATCGGACGGNONE 
J100084D18GATCGGACGGNONE 
J100084D18GATCGGACGGNONE 
Os06g0713300J065143C11TCCGTCCGATCNONE 
Os06g0716100009-080-B12CGGATCGGACGGANONE 
009-192-E07CGGATCGGACGGANONE 
AK068387CGGATCGGACGGANONE 
AK071515CGGATCGGACGGASimilar to Chaperone protein dnaJ. 
J080018J01CGGATCGGACGGANONE 
J080039P07CGGATCGGACGGANONE 
J080068K20CGGATCGGACGGANONE 
Os06g0716700AB037681ATCGGACGGCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681CCGAGCCGTCCGATCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385ATCGGACGGCNONE 
AK063385CCGAGCCGTCCGATCNONE 
AK102478ATCGGACGGCNONE 
AK102478CCGAGCCGTCCGATCNONE 
J013030D18ATCGGACGGCNONE 
J013030D18CCGAGCCGTCCGATCNONE 
J090091L06ATCGGACGGCNONE 
J090091L06CCGAGCCGTCCGATCNONE 
Os07g0109600AK063942AATTGGGCGTCCGATLeo1-like protein family protein. 
Os07g0145250J075010B04ATCGGACGGCTNONE 
J075030M07ATCGGACGGCTNONE 
J075039C20ATCGGACGGCTNONE 
J075047G02ATCGGACGGCTNONE 
J075059C09ATCGGACGGCTNONE 
J075093A20ATCGGACGGCTNONE 
J075122B05ATCGGACGGCTNONE 
J075130K10ATCGGACGGCTConserved hypothetical protein. 
J075138D05ATCGGACGGCTNONE 
J075161C12ATCGGACGGCTNONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0213400003-104-B01GCCGTCCGATNONE 
AK062273GCCGTCCGATConserved hypothetical protein. 
J065122P17GCCGTCCGATNONE 
J065160A01GCCGTCCGATNONE 
J090065M11GCCGTCCGATNONE 
Os07g0224000009-060-E01ATCGGACGGCTNONE 
J065042D20ATCGGACGGCTNONE 
J065127D14ATCGGACGGCTNONE 
J065176C24ATCGGACGGCTNONE 
J065188M12ATCGGACGGCTNONE 
J065194L14ATCGGACGGCTNONE 
J075060P09ATCGGACGGCTNONE 
J075134C14ATCGGACGGCTRibosomal protein L24E family protein. 
J075192M12ATCGGACGGCTNONE 
J100032N01ATCGGACGGCTNONE 
Os07g0238700AK067680GCCGTCCGATCNONE 
AK101492GCCGTCCGATCSimilar to Glutamate dehydrogenase (EC 1.4.1.3) (GDH). 
J013114K24GCCGTCCGATCNONE 
J033042P14GCCGTCCGATCNONE 
J065021G13GCCGTCCGATCNONE 
J065121C20GCCGTCCGATCNONE 
J065124D06GCCGTCCGATCNONE 
J065157D02GCCGTCCGATCNONE 
J065157K12GCCGTCCGATCNONE 
J065212K07GCCGTCCGATCNONE 
J080301G13GCCGTCCGATCNONE 
J080308E14GCCGTCCGATCNONE 
J080311J11GCCGTCCGATCNONE 
J080313O06GCCGTCCGATCNONE 
Os07g0496900AK067389ATCGGACGGACNONE 
AK072937ATCGGACGGACConserved hypothetical protein. 
J065168M03ATCGGACGGACNONE 
J075020A18ATCGGACGGACNONE 
J075066N15ATCGGACGGACNONE 
J075108D15ATCGGACGGACNONE 
J075108L16ATCGGACGGACNONE 
J075145K18ATCGGACGGACNONE 
J075197M19ATCGGACGGACNONE 
J090050G21ATCGGACGGACNONE 
J090099P10ATCGGACGGACNONE 
Os07g0525400AK121393CGTCCGATCRabGAP/TBC domain containing protein. 
J023064H22CGTCCGATCNONE 
J023092K07CGTCCGATCNONE 
J023129N03CGTCCGATCNONE 
J023142K04CGTCCGATCNONE 
Os07g0557500AK101830CGTCCGATCZinc finger, RING-type domain containing protein. 
AK101830GATCGGACGGZinc finger, RING-type domain containing protein. 
J013075M04CGTCCGATCNONE 
J013075M04GATCGGACGGNONE 
J033068I24CGTCCGATCNONE 
J033068I24GATCGGACGGNONE 
Os07g0558400003-103-C02CCGTCCGATCNONE 
003-115-G05CCGTCCGATCNONE 
006-025-B09CCGTCCGATCNONE 
006-025-G10CCGTCCGATCNONE 
006-027-E03CCGTCCGATCNONE 
006-036-C06CCGTCCGATCNONE 
006-045-B10CCGTCCGATCNONE 
006-051-H11CCGTCCGATCNONE 
006-053-H03CCGTCCGATCNONE 
006-057-B09CCGTCCGATCNONE 
006-062-C10CCGTCCGATCNONE 
006-075-B12CCGTCCGATCNONE 
006-079-F01CCGTCCGATCNONE 
006-082-D08CCGTCCGATCNONE 
006-087-F04CCGTCCGATCNONE 
006-089-E09CCGTCCGATCNONE 
006-090-C04CCGTCCGATCNONE 
006-091-H05CCGTCCGATCNONE 
006-093-E02CCGTCCGATCNONE 
006-093-E06CCGTCCGATCNONE 
006-093-H05CCGTCCGATCNONE 
006-095-C05CCGTCCGATCNONE 
006-097-B04CCGTCCGATCNONE 
006-097-C07CCGTCCGATCNONE 
006-097-D02CCGTCCGATCNONE 
006-097-H10CCGTCCGATCNONE 
006-098-C05CCGTCCGATCNONE 
006-099-H09CCGTCCGATCNONE 
006-104-B06CCGTCCGATCNONE 
006-105-B11CCGTCCGATCNONE 
006-106-E12CCGTCCGATCNONE 
006-107-B06CCGTCCGATCNONE 
006-109-A09CCGTCCGATCNONE 
006-112-D05CCGTCCGATCNONE 
006-118-C12CCGTCCGATCNONE 
006-118-E10CCGTCCGATCNONE 
006-120-D05CCGTCCGATCNONE 
006-120-E08CCGTCCGATCNONE 
009-055-D12CCGTCCGATCNONE 
009-108-E05CCGTCCGATCNONE 
009-125-H05CCGTCCGATCNONE 
009-150-A07CCGTCCGATCNONE 
009-198-C07CCGTCCGATCNONE 
AF058796CCGTCCGATCNONE 
AK058293CCGTCCGATCNONE 
AK098992CCGTCCGATCNONE 
AK103924CCGTCCGATCNONE 
AK104309CCGTCCGATCNONE 
AK104619CCGTCCGATCNONE 
AK119534CCGTCCGATCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13CCGTCCGATCNONE 
J043039O11CCGTCCGATCNONE 
J065176D03CCGTCCGATCNONE 
J075022K10CCGTCCGATCNONE 
J075065A02CCGTCCGATCNONE 
J075077D23CCGTCCGATCNONE 
J075088P15CCGTCCGATCNONE 
J075125D24CCGTCCGATCNONE 
J075125H11CCGTCCGATCNONE 
J075192H21CCGTCCGATCNONE 
J090080H18CCGTCCGATCNONE 
Os07g0586000AK069212ATCGGACGGCCCConserved hypothetical protein. 
Os07g0594400J065137M02ATCGGACGConserved hypothetical protein. 
J065218E03ATCGGACGNONE 
Os07g0618600009-097-C03CGTCCGATNONE 
AK062041CGTCCGATNONE 
AK121137CGTCCGATZinc finger, FYVE-type domain containing protein. 
J013096I01CGTCCGATNONE 
J013110P12CGTCCGATNONE 
J023077F04CGTCCGATNONE 
J033122B21CGTCCGATNONE 
J053070M23CGTCCGATNONE 
J065045H14CGTCCGATNONE 
J065066C18CGTCCGATNONE 
J065066L06CGTCCGATNONE 
J065101G22CGTCCGATNONE 
J100039E01CGTCCGATNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os08g0102800AK120363CGTCCGATConserved hypothetical protein. 
J013068G21CGTCCGATNONE 
J065044O17CGTCCGATNONE 
J065048G16CGTCCGATNONE 
J065089P09CGTCCGATNONE 
J065111C11CGTCCGATNONE 
J075088I23CGTCCGATNONE 
Os08g0150800AK101530GATCGGACGGCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0169600012-007-C10ATCGGACGGNONE 
012-007-C10ATCGGACGGNONE 
AK067305ATCGGACGGRNA polymerase II transcription factor SIII subunit A family protein. 
AK067305ATCGGACGGRNA polymerase II transcription factor SIII subunit A family protein. 
J013100P11ATCGGACGGNONE 
J013100P11ATCGGACGGNONE 
J033132G12ATCGGACGGNONE 
J033132G12ATCGGACGGNONE 
J065005F08ATCGGACGGNONE 
J065005F08ATCGGACGGNONE 
J065020C20ATCGGACGGNONE 
J065020C20ATCGGACGGNONE 
J065029N08ATCGGACGGNONE 
J065029N08ATCGGACGGNONE 
J065091M07ATCGGACGGNONE 
J065091M07ATCGGACGGNONE 
J065123F14ATCGGACGGNONE 
J065123F14ATCGGACGGNONE 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0300700AK101762ATCGGACGGAProtein prenyltransferase domain containing protein. 
Os08g0435900003-113-D09GGCCGTCCGATCNONE 
003-131-A04GGCCGTCCGATCNONE 
006-021-D09GGCCGTCCGATCNONE 
006-023-F09GGCCGTCCGATCNONE 
006-024-H07GGCCGTCCGATCNONE 
006-025-F06GGCCGTCCGATCNONE 
006-025-H01GGCCGTCCGATCNONE 
006-025-H10GGCCGTCCGATCNONE 
006-026-A07GGCCGTCCGATCNONE 
006-026-E01GGCCGTCCGATCNONE 
006-026-F04GGCCGTCCGATCNONE 
006-027-A01GGCCGTCCGATCNONE 
006-029-H01GGCCGTCCGATCNONE 
006-030-D02GGCCGTCCGATCNONE 
006-032-C03GGCCGTCCGATCNONE 
006-034-C02GGCCGTCCGATCNONE 
006-035-H10GGCCGTCCGATCNONE 
006-039-C01GGCCGTCCGATCNONE 
006-039-H08GGCCGTCCGATCNONE 
006-040-D09GGCCGTCCGATCNONE 
006-040-F05GGCCGTCCGATCNONE 
006-044-D04GGCCGTCCGATCNONE 
006-044-F09GGCCGTCCGATCNONE 
006-044-G05GGCCGTCCGATCNONE 
006-045-C06GGCCGTCCGATCNONE 
006-046-B04GGCCGTCCGATCNONE 
006-047-D03GGCCGTCCGATCNONE 
006-048-C10GGCCGTCCGATCNONE 
006-048-D10GGCCGTCCGATCNONE 
006-050-H01GGCCGTCCGATCNONE 
006-051-D12GGCCGTCCGATCNONE 
006-053-B05GGCCGTCCGATCNONE 
006-054-B12GGCCGTCCGATCNONE 
006-054-E05GGCCGTCCGATCNONE 
006-054-H06GGCCGTCCGATCNONE 
006-056-H02GGCCGTCCGATCNONE 
006-059-A07GGCCGTCCGATCNONE 
006-059-G02GGCCGTCCGATCNONE 
006-059-G12GGCCGTCCGATCNONE 
006-061-F01GGCCGTCCGATCNONE 
006-061-H10GGCCGTCCGATCNONE 
006-063-B02GGCCGTCCGATCNONE 
006-064-H12GGCCGTCCGATCNONE 
006-068-D06GGCCGTCCGATCNONE 
006-071-H08GGCCGTCCGATCNONE 
006-072-E10GGCCGTCCGATCNONE 
006-074-C06GGCCGTCCGATCNONE 
006-074-D12GGCCGTCCGATCNONE 
006-076-H06GGCCGTCCGATCNONE 
006-077-E04GGCCGTCCGATCNONE 
006-081-H01GGCCGTCCGATCNONE 
006-082-E11GGCCGTCCGATCNONE 
006-083-G10GGCCGTCCGATCNONE 
006-084-B05GGCCGTCCGATCNONE 
006-085-C06GGCCGTCCGATCNONE 
006-088-C04GGCCGTCCGATCNONE 
006-088-F11GGCCGTCCGATCNONE 
006-088-H11GGCCGTCCGATCNONE 
006-090-F06GGCCGTCCGATCNONE 
006-091-B01GGCCGTCCGATCNONE 
006-091-C10GGCCGTCCGATCNONE 
006-091-G11GGCCGTCCGATCNONE 
006-092-A11GGCCGTCCGATCNONE 
006-092-F10GGCCGTCCGATCNONE 
006-093-D01GGCCGTCCGATCNONE 
006-093-E11GGCCGTCCGATCNONE 
006-095-F09GGCCGTCCGATCNONE 
006-096-B05GGCCGTCCGATCNONE 
006-096-B06GGCCGTCCGATCNONE 
006-096-B11GGCCGTCCGATCNONE 
006-099-E04GGCCGTCCGATCNONE 
006-100-A01GGCCGTCCGATCNONE 
006-100-E04GGCCGTCCGATCNONE 
006-104-B09GGCCGTCCGATCNONE 
006-106-A09GGCCGTCCGATCNONE 
006-107-C07GGCCGTCCGATCNONE 
006-107-H03GGCCGTCCGATCNONE 
006-109-B12GGCCGTCCGATCNONE 
006-109-F10GGCCGTCCGATCNONE 
006-110-C10GGCCGTCCGATCNONE 
006-110-E09GGCCGTCCGATCNONE 
006-114-H07GGCCGTCCGATCNONE 
006-115-A06GGCCGTCCGATCNONE 
006-115-A12GGCCGTCCGATCNONE 
006-115-C10GGCCGTCCGATCNONE 
006-115-D10GGCCGTCCGATCNONE 
006-116-D02GGCCGTCCGATCNONE 
006-117-C11GGCCGTCCGATCNONE 
006-119-H09GGCCGTCCGATCNONE 
009-008-B04GGCCGTCCGATCNONE 
009-021-A04GGCCGTCCGATCNONE 
009-026-H09GGCCGTCCGATCNONE 
009-027-D10GGCCGTCCGATCNONE 
009-030-B11GGCCGTCCGATCNONE 
009-040-E08GGCCGTCCGATCNONE 
009-049-E10GGCCGTCCGATCNONE 
009-058-C12GGCCGTCCGATCNONE 
009-061-G01GGCCGTCCGATCNONE 
009-079-G09GGCCGTCCGATCNONE 
009-081-F08GGCCGTCCGATCNONE 
009-096-F04GGCCGTCCGATCNONE 
009-103-D05GGCCGTCCGATCNONE 
009-119-F08GGCCGTCCGATCNONE 
009-123-B02GGCCGTCCGATCNONE 
009-128-H11GGCCGTCCGATCNONE 
009-131-B06GGCCGTCCGATCNONE 
009-142-H06GGCCGTCCGATCNONE 
009-156-C01GGCCGTCCGATCNONE 
009-165-D02GGCCGTCCGATCNONE 
009-168-G10GGCCGTCCGATCNONE 
009-175-F03GGCCGTCCGATCNONE 
009-178-E06GGCCGTCCGATCNONE 
009-179-G04GGCCGTCCGATCNONE 
009-181-C10GGCCGTCCGATCNONE 
009-182-D09GGCCGTCCGATCNONE 
009-183-D07GGCCGTCCGATCNONE 
AF094775GGCCGTCCGATCNONE 
AK060222GGCCGTCCGATCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK067712GGCCGTCCGATCNONE 
AK067809GGCCGTCCGATCNONE 
AK103921GGCCGTCCGATCNONE 
AK104416GGCCGTCCGATCNONE 
AK104499GGCCGTCCGATCNONE 
AY445626GGCCGTCCGATCNONE 
J013120H04GGCCGTCCGATCNONE 
J013121A03GGCCGTCCGATCNONE 
J013127D22GGCCGTCCGATCNONE 
J023088A04GGCCGTCCGATCNONE 
J023132O20GGCCGTCCGATCNONE 
J053026I18GGCCGTCCGATCNONE 
J053032G14GGCCGTCCGATCNONE 
J053055E21GGCCGTCCGATCNONE 
J053070F24GGCCGTCCGATCNONE 
J065034E08GGCCGTCCGATCNONE 
J065085O17GGCCGTCCGATCNONE 
J065156H20GGCCGTCCGATCNONE 
J065171C21GGCCGTCCGATCNONE 
J065173A20GGCCGTCCGATCNONE 
J065173C02GGCCGTCCGATCNONE 
J065182N01GGCCGTCCGATCNONE 
J075001K11GGCCGTCCGATCNONE 
J075002K18GGCCGTCCGATCNONE 
J075005P06GGCCGTCCGATCNONE 
J075006P21GGCCGTCCGATCNONE 
J075008G02GGCCGTCCGATCNONE 
J075009D08GGCCGTCCGATCNONE 
J075013D09GGCCGTCCGATCNONE 
J075013D15GGCCGTCCGATCNONE 
J075016F05GGCCGTCCGATCNONE 
J075016F18GGCCGTCCGATCNONE 
J075016K07GGCCGTCCGATCNONE 
J075016M08GGCCGTCCGATCNONE 
J075021G21GGCCGTCCGATCNONE 
J075025G06GGCCGTCCGATCNONE 
J075029M11GGCCGTCCGATCNONE 
J075035E01GGCCGTCCGATCNONE 
J075038M21GGCCGTCCGATCNONE 
J075039G20GGCCGTCCGATCNONE 
J075040K18GGCCGTCCGATCNONE 
J075041G13GGCCGTCCGATCNONE 
J075042O03GGCCGTCCGATCNONE 
J075047C01GGCCGTCCGATCNONE 
J075047M08GGCCGTCCGATCNONE 
J075052L02GGCCGTCCGATCNONE 
J075055E24GGCCGTCCGATCNONE 
J075056F22GGCCGTCCGATCNONE 
J075068B12GGCCGTCCGATCNONE 
J075068D01GGCCGTCCGATCNONE 
J075069H19GGCCGTCCGATCNONE 
J075071J21GGCCGTCCGATCNONE 
J075072O06GGCCGTCCGATCNONE 
J075075J05GGCCGTCCGATCNONE 
J075079E21GGCCGTCCGATCNONE 
J075079H05GGCCGTCCGATCNONE 
J075081L10GGCCGTCCGATCNONE 
J075087D17GGCCGTCCGATCNONE 
J075088B07GGCCGTCCGATCNONE 
J075088D22GGCCGTCCGATCNONE 
J075090E03GGCCGTCCGATCNONE 
J075095L09GGCCGTCCGATCNONE 
J075098G08GGCCGTCCGATCNONE 
J075099M10GGCCGTCCGATCNONE 
J075101D01GGCCGTCCGATCNONE 
J075102H24GGCCGTCCGATCNONE 
J075103A05GGCCGTCCGATCNONE 
J075106A15GGCCGTCCGATCNONE 
J075106L10GGCCGTCCGATCNONE 
J075108H11GGCCGTCCGATCNONE 
J075110D12GGCCGTCCGATCNONE 
J075114A06GGCCGTCCGATCNONE 
J075116G16GGCCGTCCGATCNONE 
J075118B13GGCCGTCCGATCNONE 
J075119C20GGCCGTCCGATCNONE 
J075122F24GGCCGTCCGATCNONE 
J075129D14GGCCGTCCGATCNONE 
J075132L06GGCCGTCCGATCNONE 
J075133E22GGCCGTCCGATCNONE 
J075140L09GGCCGTCCGATCNONE 
J075140L24GGCCGTCCGATCNONE 
J075146J17GGCCGTCCGATCNONE 
J075148A09GGCCGTCCGATCNONE 
J075152D01GGCCGTCCGATCNONE 
J075153L22GGCCGTCCGATCNONE 
J075156B08GGCCGTCCGATCNONE 
J075158D24GGCCGTCCGATCNONE 
J075158H14GGCCGTCCGATCNONE 
J075167M07GGCCGTCCGATCNONE 
J075172F21GGCCGTCCGATCNONE 
J075175J15GGCCGTCCGATCNONE 
J075183C13GGCCGTCCGATCNONE 
J075190A08GGCCGTCCGATCNONE 
J075190E08GGCCGTCCGATCNONE 
J075190H21GGCCGTCCGATCNONE 
J075194C13GGCCGTCCGATCNONE 
J075195E18GGCCGTCCGATCNONE 
J075197H09GGCCGTCCGATCNONE 
J075199J01GGCCGTCCGATCNONE 
J080310L13GGCCGTCCGATCNONE 
J080311F02GGCCGTCCGATCNONE 
J080311H17GGCCGTCCGATCNONE 
J080315M04GGCCGTCCGATCNONE 
J080316A09GGCCGTCCGATCNONE 
J080319D20GGCCGTCCGATCNONE 
J080319L04GGCCGTCCGATCNONE 
J090002C14GGCCGTCCGATCNONE 
J090031P04GGCCGTCCGATCNONE 
J090050E09GGCCGTCCGATCNONE 
J100048H01GGCCGTCCGATCNONE 
J100089C18GGCCGTCCGATCNONE 
Os08g0441500006-053-D04CGTCCGATCNONE 
006-120-F03CGTCCGATCNONE 
AK072872CGTCCGATCSimilar to Cinnamoyl-CoA reductase. 
AK102061CGTCCGATCNONE 
AK105802CGTCCGATCNONE 
AK105870CGTCCGATCNONE 
J023108K19CGTCCGATCNONE 
J023143B20CGTCCGATCNONE 
J033119I24CGTCCGATCNONE 
J043029L11CGTCCGATCNONE 
J065045L03CGTCCGATCNONE 
J065077B13CGTCCGATCNONE 
J065213C08CGTCCGATCNONE 
J075004B13CGTCCGATCNONE 
J075009D18CGTCCGATCNONE 
J075028F01CGTCCGATCNONE 
J075028F02CGTCCGATCNONE 
J075061I19CGTCCGATCNONE 
J075129B20CGTCCGATCNONE 
J075129I17CGTCCGATCNONE 
J075157E11CGTCCGATCNONE 
J080005B20CGTCCGATCNONE 
J080010G02CGTCCGATCNONE 
J080012F23CGTCCGATCNONE 
J080013H17CGTCCGATCNONE 
J080013O09CGTCCGATCNONE 
J080016J07CGTCCGATCNONE 
J080016J11CGTCCGATCNONE 
J080017C17CGTCCGATCNONE 
J080024D05CGTCCGATCNONE 
J080024D23CGTCCGATCNONE 
J080024N24CGTCCGATCNONE 
J080025J02CGTCCGATCNONE 
J080025M18CGTCCGATCNONE 
J080026G22CGTCCGATCNONE 
J080038O03CGTCCGATCNONE 
J080039A12CGTCCGATCNONE 
J080040A10CGTCCGATCNONE 
J080040B19CGTCCGATCNONE 
J080044L12CGTCCGATCNONE 
J080045L03CGTCCGATCNONE 
J080046E07CGTCCGATCNONE 
J080048I23CGTCCGATCNONE 
J080050D21CGTCCGATCNONE 
J080051F06CGTCCGATCNONE 
J080051O07CGTCCGATCNONE 
J080053H15CGTCCGATCNONE 
J080054G19CGTCCGATCNONE 
J080055G12CGTCCGATCNONE 
J080055M14CGTCCGATCNONE 
J080057A07CGTCCGATCNONE 
J080060F15CGTCCGATCNONE 
J080060I09CGTCCGATCNONE 
J080060L20CGTCCGATCNONE 
J080061G05CGTCCGATCNONE 
J080066C16CGTCCGATCNONE 
J080067E20CGTCCGATCNONE 
J080068F18CGTCCGATCNONE 
J080069D21CGTCCGATCNONE 
J080079D15CGTCCGATCNONE 
J080079M07CGTCCGATCNONE 
J080080D24CGTCCGATCNONE 
J080080P21CGTCCGATCNONE 
J080084G21CGTCCGATCNONE 
J080084L07CGTCCGATCNONE 
J080089L22CGTCCGATCNONE 
J080090P15CGTCCGATCNONE 
J080091G06CGTCCGATCNONE 
J080092H02CGTCCGATCNONE 
J080092O09CGTCCGATCNONE 
J080093D01CGTCCGATCNONE 
J090082D09CGTCCGATCNONE 
J100040B01CGTCCGATCNONE 
J100067F14CGTCCGATCNONE 
Os08g0481500J065054C23TCCGTCCGATConserved hypothetical protein. 
J065218E06TCCGTCCGATNONE 
Os08g0485700AK068131ATCGGACGGCNONE 
AK069097ATCGGACGGCMethyl-CpG binding domain containing protein. 
J013130L03ATCGGACGGCNONE 
Os08g0492500AK065316ATCGGACGRINGv domain containing protein. 
J013002P08ATCGGACGNONE 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0532200009-118-B03CCGTCCGATNONE 
AK062854CCGTCCGATNONE 
AK064826CCGTCCGATSimilar to Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GSA) (Glutamate-1-semialdehyde aminotransferase) (GSA- AT). 
AK104694CCGTCCGATNONE 
J013000F06CCGTCCGATNONE 
Os09g0281900AK121112CGGATCGGACGGCTThyroid hormone receptor-associated protein complex component TRAP170- like protein. 
J023073I01CGGATCGGACGGCTNONE 
Os09g0324000AK107774CGTCCGATCSimilar to Oleosin. 
AK119722CGTCCGATCNONE 
J065205O11CGTCCGATCNONE 
J075150L22CGTCCGATCNONE 
Os09g0325300011-005-H08CCGAGCCGTCCGATNONE 
AK068435CCGAGCCGTCCGATConserved hypothetical protein. 
AK073998CCGAGCCGTCCGATNONE 
J033071H21CCGAGCCGTCCGATNONE 
J065214H05CCGAGCCGTCCGATNONE 
Os09g0382400009-125-E12GATCGGACGGCTCGGNONE 
AK062891GATCGGACGGCTCGGConserved hypothetical protein. 
J065069H20GATCGGACGGCTCGGNONE 
J065137I22GATCGGACGGCTCGGNONE 
J065218O10GATCGGACGGCTCGGNONE 
Os09g0386500014-051-B12ATCGGACGGCNONE 
016-068-G02ATCGGACGGCNONE 
AK064072ATCGGACGGCBromo adjacent region domain containing protein. 
AK099307ATCGGACGGCNONE 
J023141K03ATCGGACGGCNONE 
J065166A18ATCGGACGGCNONE 
J080304I17ATCGGACGGCNONE 
J080309J05ATCGGACGGCNONE 
J080310J18ATCGGACGGCNONE 
J080313A02ATCGGACGGCNONE 
J080315M03ATCGGACGGCNONE 
J080316O03ATCGGACGGCNONE 
J080319C13ATCGGACGGCNONE 
J090009O16ATCGGACGGCNONE 
J090048C05ATCGGACGGCNONE 
J100081G18ATCGGACGGCNONE 
Os09g0462700AK060597ATCGGACGGCTNONE 
AK067260ATCGGACGGCTSimilar to RNA Binding Protein 47. 
Os09g0467700AK061600GGGCCGTCCGATCConserved hypothetical protein. 
Os09g0491756AK062560CGTCCGATNONE 
AK099481CGTCCGATU2 snRNP auxiliary factor, small subunit. 
J013025G09CGTCCGATNONE 
J013066F03CGTCCGATNONE 
J013098K17CGTCCGATNONE 
J013160C07CGTCCGATNONE 
J065136D24CGTCCGATNONE 
J075006K04CGTCCGATNONE 
J075033E12CGTCCGATNONE 
J075059E09CGTCCGATNONE 
J075123A16CGTCCGATNONE 
J075123G07CGTCCGATNONE 
J090025J23CGTCCGATNONE 
J090039O03CGTCCGATNONE 
J090051C07CGTCCGATNONE 
J090059B06CGTCCGATNONE 
J100032B02CGTCCGATNONE 
J100036F03CGTCCGATNONE 
J100062E16CGTCCGATNONE 
Y18349CGTCCGATNONE 
Os09g0567900006-026-B10GATCGGACGGCNONE 
AK061415GATCGGACGGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J075028A10GATCGGACGGCNONE 
J075065B13GATCGGACGGCNONE 
Os09g0569100009-133-D02ATCGGACGNONE 
AK071860ATCGGACGHaloacid dehalogenase-like hydrolase domain containing protein. 
J023117I03ATCGGACGNONE 
J065046H04ATCGGACGNONE 
J065051H17ATCGGACGNONE 
J065070C15ATCGGACGNONE 
J065088K22ATCGGACGNONE 
J065100H10ATCGGACGNONE 
J065110A06ATCGGACGNONE 
J100027K01ATCGGACGNONE 
J100079K16ATCGGACGNONE 
Os09g0570400AK065287GATCGGACGGCTMajor facilitator superfamily protein. 
J013002M15GATCGGACGGCTNONE 
J013030F15GATCGGACGGCTNONE 
J013055E11GATCGGACGGCTNONE 
J013071P13GATCGGACGGCTNONE 
J013072E15GATCGGACGGCTNONE 
J013072G14GATCGGACGGCTNONE 
J013075F17GATCGGACGGCTNONE 
J013089I20GATCGGACGGCTNONE 
J013092E05GATCGGACGGCTNONE 
J013121F02GATCGGACGGCTNONE 
J013122D22GATCGGACGGCTNONE 
J013156E24GATCGGACGGCTNONE 
J023042O15GATCGGACGGCTNONE 
J023104D22GATCGGACGGCTNONE 
J033065I08GATCGGACGGCTNONE 
J033131C03GATCGGACGGCTNONE 
J090064E11GATCGGACGGCTNONE 
J100063G18GATCGGACGGCTNONE 
Os11g0136800AK063731ATCGGACGSimilar to Dual specificity protein phosphatase 19 (EC 3.1.3.48) (EC 3.1.3.16) (Stress-activated protein kinase pathway-regulating phosphatase 1) (Protein phosphatase SKRP1). Splice isoform 2. 
Os11g0159000AK065738GATCGGACGConserved hypothetical protein. 
Os11g0176000AK105568GATCGGACGGWD40-like domain containing protein. 
Os11g0180300AK072438CGTCCGATCConserved hypothetical protein. 
J013092P11CGTCCGATCNONE 
J013092P13CGTCCGATCNONE 
J023107D15CGTCCGATCNONE 
J065191C20CGTCCGATCNONE 
J090082F02CGTCCGATCNONE 
Os11g0256900AK068035ATCGGACGSAM dependent carboxyl methyltransferase family protein. 
AY524975ATCGGACGNONE 
J013066A04ATCGGACGNONE 
J013124E06ATCGGACGNONE 
J013129H19ATCGGACGNONE 
J075058F22ATCGGACGNONE 
Os11g0267400AK069552AGCCGTCCGATCSimilar to ClpC. 
AK100126AGCCGTCCGATCNONE 
Os11g0503900006-092-E06CGTCCGATNONE 
AK061183CGTCCGATSulfotransferase family protein. 
Os11g0536900J100027G18CCGTCCGATCConserved hypothetical protein. 
J100073G12CCGTCCGATCNONE 
Os11g0537400003-126-A11AGCCGTCCGATCNONE 
Os11g0549620006-091-C11GATCGGACGNONE 
AK061321GATCGGACGSimilar to Purple acid phosphatase. 
AK106004GATCGGACGNONE 
Os11g0600700016-011-B06GCCGTCCGATCNONE 
AK061258GCCGTCCGATCNONE 
AK071098GCCGTCCGATCSimilar to RING domain protein. 
J023081C09GCCGTCCGATCNONE 
J065027B11GCCGTCCGATCNONE 
J075024M24GCCGTCCGATCNONE 
J100023I11GCCGTCCGATCNONE 
J100069G17GCCGTCCGATCNONE 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0660500009-031-D10GATCGGACGGCNONE 
009-031-D10GATCGGACGGCCNONE 
009-100-G09GATCGGACGGCNONE 
009-100-G09GATCGGACGGCCNONE 
009-162-G10GATCGGACGGCNONE 
009-162-G10GATCGGACGGCCNONE 
009-183-H11GATCGGACGGCNONE 
009-183-H11GATCGGACGGCCNONE 
013-010-B11GATCGGACGGCNONE 
013-010-B11GATCGGACGGCCNONE 
013-050-A05GATCGGACGGCNONE 
013-050-A05GATCGGACGGCCNONE 
013-070-E10GATCGGACGGCNONE 
013-070-E10GATCGGACGGCCNONE 
AK105453GATCGGACGGCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GATCGGACGGCCSimilar to Translationally controlled tumor protein (Fragment). 
D12626GATCGGACGGCNONE 
D12626GATCGGACGGCCNONE 
J013128M15GATCGGACGGCNONE 
J013128M15GATCGGACGGCCNONE 
J023004I19GATCGGACGGCNONE 
J023004I19GATCGGACGGCCNONE 
J033114F08GATCGGACGGCNONE 
J033114F08GATCGGACGGCCNONE 
J033147I20GATCGGACGGCNONE 
J033147I20GATCGGACGGCCNONE 
J065031M04GATCGGACGGCNONE 
J065031M04GATCGGACGGCCNONE 
J065033J03GATCGGACGGCNONE 
J065033J03GATCGGACGGCCNONE 
J065038E01GATCGGACGGCNONE 
J065038E01GATCGGACGGCCNONE 
J065048O06GATCGGACGGCNONE 
J065048O06GATCGGACGGCCNONE 
J065054E01GATCGGACGGCNONE 
J065054E01GATCGGACGGCCNONE 
J065075N08GATCGGACGGCNONE 
J065075N08GATCGGACGGCCNONE 
J065080C07GATCGGACGGCNONE 
J065080C07GATCGGACGGCCNONE 
J065096A12GATCGGACGGCNONE 
J065096A12GATCGGACGGCCNONE 
J065115P22GATCGGACGGCNONE 
J065115P22GATCGGACGGCCNONE 
J065122I21GATCGGACGGCNONE 
J065122I21GATCGGACGGCCNONE 
J065127A13GATCGGACGGCNONE 
J065127A13GATCGGACGGCCNONE 
J065158B06GATCGGACGGCNONE 
J065158B06GATCGGACGGCCNONE 
J065162E04GATCGGACGGCNONE 
J065162E04GATCGGACGGCCNONE 
J065162E05GATCGGACGGCNONE 
J065162E05GATCGGACGGCCNONE 
J065163L06GATCGGACGGCNONE 
J065163L06GATCGGACGGCCNONE 
J065177B16GATCGGACGGCNONE 
J065177B16GATCGGACGGCCNONE 
J065181M15GATCGGACGGCNONE 
J065181M15GATCGGACGGCCNONE 
J065201G15GATCGGACGGCNONE 
J065201G15GATCGGACGGCCNONE 
J065202J06GATCGGACGGCNONE 
J065202J06GATCGGACGGCCNONE 
J075002B19GATCGGACGGCNONE 
J075002B19GATCGGACGGCCNONE 
J075008G19GATCGGACGGCNONE 
J075008G19GATCGGACGGCCNONE 
J075010P05GATCGGACGGCNONE 
J075010P05GATCGGACGGCCNONE 
J075018H23GATCGGACGGCNONE 
J075018H23GATCGGACGGCCNONE 
J075051E18GATCGGACGGCNONE 
J075051E18GATCGGACGGCCNONE 
J075053C24GATCGGACGGCNONE 
J075053C24GATCGGACGGCCNONE 
J075077B06GATCGGACGGCNONE 
J075077B06GATCGGACGGCCNONE 
J075080B11GATCGGACGGCNONE 
J075080B11GATCGGACGGCCNONE 
J075083M04GATCGGACGGCNONE 
J075083M04GATCGGACGGCCNONE 
J075085H01GATCGGACGGCNONE 
J075085H01GATCGGACGGCCNONE 
J075109E11GATCGGACGGCNONE 
J075109E11GATCGGACGGCCNONE 
J075111O09GATCGGACGGCNONE 
J075111O09GATCGGACGGCCNONE 
J075130D13GATCGGACGGCNONE 
J075130D13GATCGGACGGCCNONE 
J075132H13GATCGGACGGCNONE 
J075132H13GATCGGACGGCCNONE 
J075147H19GATCGGACGGCNONE 
J075147H19GATCGGACGGCCNONE 
J075148J01GATCGGACGGCNONE 
J075148J01GATCGGACGGCCNONE 
J075159A18GATCGGACGGCNONE 
J075159A18GATCGGACGGCCNONE 
J075166F03GATCGGACGGCNONE 
J075166F03GATCGGACGGCCNONE 
J075191F09GATCGGACGGCNONE 
J075191F09GATCGGACGGCCNONE 
J075192K09GATCGGACGGCNONE 
J075192K09GATCGGACGGCCNONE 
J080006P15GATCGGACGGCNONE 
J080006P15GATCGGACGGCCNONE 
J080013J18GATCGGACGGCNONE 
J080013J18GATCGGACGGCCNONE 
J080023O06GATCGGACGGCNONE 
J080023O06GATCGGACGGCCNONE 
J080024I17GATCGGACGGCNONE 
J080024I17GATCGGACGGCCNONE 
J080029P03GATCGGACGGCNONE 
J080029P03GATCGGACGGCCNONE 
J080030C14GATCGGACGGCNONE 
J080030C14GATCGGACGGCCNONE 
J080038K15GATCGGACGGCNONE 
J080038K15GATCGGACGGCCNONE 
J080042I15GATCGGACGGCNONE 
J080042I15GATCGGACGGCCNONE 
J080053L07GATCGGACGGCNONE 
J080053L07GATCGGACGGCCNONE 
J080061H12GATCGGACGGCNONE 
J080061H12GATCGGACGGCCNONE 
J080064H24GATCGGACGGCNONE 
J080064H24GATCGGACGGCCNONE 
J080066J20GATCGGACGGCNONE 
J080066J20GATCGGACGGCCNONE 
J080074N07GATCGGACGGCNONE 
J080074N07GATCGGACGGCCNONE 
J080079F16GATCGGACGGCNONE 
J080079F16GATCGGACGGCCNONE 
J080079O07GATCGGACGGCNONE 
J080079O07GATCGGACGGCCNONE 
J080092E15GATCGGACGGCNONE 
J080092E15GATCGGACGGCCNONE 
J080301F19GATCGGACGGCNONE 
J080301F19GATCGGACGGCCNONE 
J080302O21GATCGGACGGCNONE 
J080302O21GATCGGACGGCCNONE 
J080306L02GATCGGACGGCNONE 
J080306L02GATCGGACGGCCNONE 
J080307F16GATCGGACGGCNONE 
J080307F16GATCGGACGGCCNONE 
J080307G01GATCGGACGGCNONE 
J080307G01GATCGGACGGCCNONE 
J080307K01GATCGGACGGCNONE 
J080307K01GATCGGACGGCCNONE 
J080309O22GATCGGACGGCNONE 
J080309O22GATCGGACGGCCNONE 
J080311E17GATCGGACGGCNONE 
J080311E17GATCGGACGGCCNONE 
J080311N08GATCGGACGGCNONE 
J080311N08GATCGGACGGCCNONE 
J080312O12GATCGGACGGCNONE 
J080312O12GATCGGACGGCCNONE 
J080315C08GATCGGACGGCNONE 
J080315C08GATCGGACGGCCNONE 
J080316D07GATCGGACGGCNONE 
J080316D07GATCGGACGGCCNONE 
J080318C17GATCGGACGGCNONE 
J080318C17GATCGGACGGCCNONE 
J090004B08GATCGGACGGCNONE 
J090004B08GATCGGACGGCCNONE 
J090009K02GATCGGACGGCNONE 
J090009K02GATCGGACGGCCNONE 
J090025O15GATCGGACGGCNONE 
J090025O15GATCGGACGGCCNONE 
J090026L03GATCGGACGGCNONE 
J090026L03GATCGGACGGCCNONE 
J090036P17GATCGGACGGCNONE 
J090036P17GATCGGACGGCCNONE 
J090047A21GATCGGACGGCNONE 
J090047A21GATCGGACGGCCNONE 
J090053O03GATCGGACGGCNONE 
J090053O03GATCGGACGGCCNONE 
J090059C04GATCGGACGGCNONE 
J090059C04GATCGGACGGCCNONE 
J090062O21GATCGGACGGCNONE 
J090062O21GATCGGACGGCCNONE 
J090064M11GATCGGACGGCNONE 
J090064M11GATCGGACGGCCNONE 
J090070C14GATCGGACGGCNONE 
J090070C14GATCGGACGGCCNONE 
J090075I03GATCGGACGGCNONE 
J090075I03GATCGGACGGCCNONE 
J090081G22GATCGGACGGCNONE 
J090081G22GATCGGACGGCCNONE 
J090083E18GATCGGACGGCNONE 
J090083E18GATCGGACGGCCNONE 
J090084A05GATCGGACGGCNONE 
J090084A05GATCGGACGGCCNONE 
J100019L11GATCGGACGGCNONE 
J100019L11GATCGGACGGCCNONE 
J100022D16GATCGGACGGCNONE 
J100022D16GATCGGACGGCCNONE 
J100042F09GATCGGACGGCNONE 
J100042F09GATCGGACGGCCNONE 
J100051J12GATCGGACGGCNONE 
J100051J12GATCGGACGGCCNONE 
J100065G21GATCGGACGGCNONE 
J100065G21GATCGGACGGCCNONE 
J100066D08GATCGGACGGCNONE 
J100066D08GATCGGACGGCCNONE 
J100069H04GATCGGACGGCNONE 
J100069H04GATCGGACGGCCNONE 
J100078I16GATCGGACGGCNONE 
J100078I16GATCGGACGGCCNONE 
J100090D15GATCGGACGGCNONE 
J100090D15GATCGGACGGCCNONE 
Os11g0689000AK067598GATCGGACGGHypothetical protein. 
Os11g0703900011-004-D05CCGTCCGATNONE 
011-014-C03CCGTCCGATNONE 
011-016-C01CCGTCCGATNONE 
011-017-B04CCGTCCGATNONE 
011-017-E09CCGTCCGATNONE 
011-019-E12CCGTCCGATNONE 
011-021-H12CCGTCCGATNONE 
011-025-H02CCGTCCGATNONE 
011-027-B09CCGTCCGATNONE 
011-039-G07CCGTCCGATNONE 
011-044-G07CCGTCCGATNONE 
011-046-F11CCGTCCGATNONE 
011-070-F02CCGTCCGATNONE 
011-071-A07CCGTCCGATNONE 
011-082-A03CCGTCCGATNONE 
011-086-B09CCGTCCGATNONE 
011-092-C04CCGTCCGATNONE 
012-006-F02CCGTCCGATNONE 
012-011-G08CCGTCCGATNONE 
012-026-C06CCGTCCGATNONE 
012-026-G06CCGTCCGATNONE 
012-028-E05CCGTCCGATNONE 
012-040-A05CCGTCCGATNONE 
012-045-C01CCGTCCGATNONE 
012-046-A10CCGTCCGATNONE 
012-047-H09CCGTCCGATNONE 
012-059-A12CCGTCCGATNONE 
012-072-D06CCGTCCGATNONE 
012-073-D05CCGTCCGATNONE 
012-076-D08CCGTCCGATNONE 
012-079-G05CCGTCCGATNONE 
012-080-A04CCGTCCGATNONE 
012-080-E01CCGTCCGATNONE 
012-083-C03CCGTCCGATNONE 
012-083-G06CCGTCCGATNONE 
012-086-G02CCGTCCGATNONE 
012-091-A07CCGTCCGATNONE 
012-094-G10CCGTCCGATNONE 
012-098-A07CCGTCCGATNONE 
012-100-G04CCGTCCGATNONE 
015-001-A11CCGTCCGATNONE 
015-033-E01CCGTCCGATNONE 
015-047-F12CCGTCCGATNONE 
015-054-E05CCGTCCGATNONE 
015-063-H02CCGTCCGATNONE 
015-075-E10CCGTCCGATNONE 
015-086-F05CCGTCCGATNONE 
016-031-A08CCGTCCGATNONE 
016-053-A03CCGTCCGATNONE 
016-054-C09CCGTCCGATNONE 
016-079-C08CCGTCCGATNONE 
AK065431CCGTCCGATHeat shock protein 70. 
AK119255CCGTCCGATNONE 
J013021C12CCGTCCGATNONE 
J013021C17CCGTCCGATNONE 
J023027B08CCGTCCGATNONE 
J023078A21CCGTCCGATNONE 
J023097M06CCGTCCGATNONE 
J023100O04CCGTCCGATNONE 
J023107B17CCGTCCGATNONE 
J023108L24CCGTCCGATNONE 
J023109L05CCGTCCGATNONE 
J033022M22CCGTCCGATNONE 
J033023K21CCGTCCGATNONE 
J033031L11CCGTCCGATNONE 
J033034H10CCGTCCGATNONE 
J033037B16CCGTCCGATNONE 
J033037F16CCGTCCGATNONE 
J033037H07CCGTCCGATNONE 
J033046E22CCGTCCGATNONE 
J033050N12CCGTCCGATNONE 
J033064F10CCGTCCGATNONE 
J033064N10CCGTCCGATNONE 
J033066O09CCGTCCGATNONE 
J033068H01CCGTCCGATNONE 
J033068J07CCGTCCGATNONE 
J033070B10CCGTCCGATNONE 
J033070G13CCGTCCGATNONE 
J033073O13CCGTCCGATNONE 
J033075B07CCGTCCGATNONE 
J033079L15CCGTCCGATNONE 
J033081J06CCGTCCGATNONE 
J033086G13CCGTCCGATNONE 
J033086N07CCGTCCGATNONE 
J033086O05CCGTCCGATNONE 
J033091A15CCGTCCGATNONE 
J033091D05CCGTCCGATNONE 
J033094C12CCGTCCGATNONE 
J033099P03CCGTCCGATNONE 
J033107L09CCGTCCGATNONE 
J033108D16CCGTCCGATNONE 
J033109E12CCGTCCGATNONE 
J033109K14CCGTCCGATNONE 
J033112P22CCGTCCGATNONE 
J033116F12CCGTCCGATNONE 
J033116K01CCGTCCGATNONE 
J033118F19CCGTCCGATNONE 
J033121J10CCGTCCGATNONE 
J033126H04CCGTCCGATNONE 
J033131G17CCGTCCGATNONE 
J033131L05CCGTCCGATNONE 
J033136A08CCGTCCGATNONE 
J033136H22CCGTCCGATNONE 
J033143F01CCGTCCGATNONE 
J065040M10CCGTCCGATNONE 
J065046F17CCGTCCGATNONE 
J065048G20CCGTCCGATNONE 
J065071N06CCGTCCGATNONE 
J065084I24CCGTCCGATNONE 
J065171B01CCGTCCGATNONE 
J065191J21CCGTCCGATNONE 
J065199I20CCGTCCGATNONE 
J075076C02CCGTCCGATNONE 
J090002P12CCGTCCGATNONE 
J090003A11CCGTCCGATNONE 
J090003H11CCGTCCGATNONE 
J090009M22CCGTCCGATNONE 
J090009O11CCGTCCGATNONE 
J090014N09CCGTCCGATNONE 
J090015A18CCGTCCGATNONE 
J090016E16CCGTCCGATNONE 
J090016I07CCGTCCGATNONE 
J090017O07CCGTCCGATNONE 
J090019E10CCGTCCGATNONE 
J090020D24CCGTCCGATNONE 
J090021M16CCGTCCGATNONE 
J090022F13CCGTCCGATNONE 
J090023H03CCGTCCGATNONE 
J090024E15CCGTCCGATNONE 
J090024G19CCGTCCGATNONE 
J090026J19CCGTCCGATNONE 
J090030E20CCGTCCGATNONE 
J090030I15CCGTCCGATNONE 
J090032F04CCGTCCGATNONE 
J090033N22CCGTCCGATNONE 
J090033O19CCGTCCGATNONE 
J090036F08CCGTCCGATNONE 
J090039A13CCGTCCGATNONE 
J090042N07CCGTCCGATNONE 
J090043C15CCGTCCGATNONE 
J090043N09CCGTCCGATNONE 
J090053J10CCGTCCGATNONE 
J090054F14CCGTCCGATNONE 
J090057N12CCGTCCGATNONE 
J090061P13CCGTCCGATNONE 
J090062F17CCGTCCGATNONE 
J090065H15CCGTCCGATNONE 
J090067P11CCGTCCGATNONE 
J090068M09CCGTCCGATNONE 
J090069E24CCGTCCGATNONE 
J090069K16CCGTCCGATNONE 
J090070N07CCGTCCGATNONE 
J090072M09CCGTCCGATNONE 
J090075I24CCGTCCGATNONE 
J090075M04CCGTCCGATNONE 
J090077D24CCGTCCGATNONE 
J090080M17CCGTCCGATNONE 
J090080O14CCGTCCGATNONE 
J090081C12CCGTCCGATNONE 
J090084N21CCGTCCGATNONE 
J090084O21CCGTCCGATNONE 
J090087J18CCGTCCGATNONE 
J090092L17CCGTCCGATNONE 
J090097A08CCGTCCGATNONE 
J100017E24CCGTCCGATNONE 
J100018K11CCGTCCGATNONE 
J100019A16CCGTCCGATNONE 
J100023I23CCGTCCGATNONE 
J100024D07CCGTCCGATNONE 
J100025H12CCGTCCGATNONE 
J100027K19CCGTCCGATNONE 
J100028C23CCGTCCGATNONE 
J100029A14CCGTCCGATNONE 
J100029O19CCGTCCGATNONE 
J100030I09CCGTCCGATNONE 
J100030J16CCGTCCGATNONE 
J100031C01CCGTCCGATNONE 
J100031N06CCGTCCGATNONE 
J100033H04CCGTCCGATNONE 
J100034L20CCGTCCGATNONE 
J100036K13CCGTCCGATNONE 
J100039M02CCGTCCGATNONE 
J100040J01CCGTCCGATNONE 
J100042O21CCGTCCGATNONE 
J100042P20CCGTCCGATNONE 
J100047K22CCGTCCGATNONE 
J100049B16CCGTCCGATNONE 
J100052M10CCGTCCGATNONE 
J100053B05CCGTCCGATNONE 
J100053B20CCGTCCGATNONE 
J100055I11CCGTCCGATNONE 
J100056A13CCGTCCGATNONE 
J100057C08CCGTCCGATNONE 
J100057N11CCGTCCGATNONE 
J100057P07CCGTCCGATNONE 
J100059E16CCGTCCGATNONE 
J100063N14CCGTCCGATNONE 
J100069H01CCGTCCGATNONE 
J100071C17CCGTCCGATNONE 
J100071K09CCGTCCGATNONE 
J100077D07CCGTCCGATNONE 
J100078P22CCGTCCGATNONE 
J100080F11CCGTCCGATNONE 
J100081L07CCGTCCGATNONE 
J100083B10CCGTCCGATNONE 
J100083K17CCGTCCGATNONE 
J100085B22CCGTCCGATNONE 
J100085L21CCGTCCGATNONE 
J100086B11CCGTCCGATNONE 
J100087E06CCGTCCGATNONE 
J100087P07CCGTCCGATNONE 
J100089H24CCGTCCGATNONE 
Os12g0104700AK067342GATCGGACGProtein of unknown function DUF231, plant domain containing protein. 
J013106M21GATCGGACGNONE 
J053037L07GATCGGACGNONE 
J053094I07GATCGGACGNONE 
J065167K17GATCGGACGNONE 
J065168N12GATCGGACGNONE 
J075029F14GATCGGACGNONE 
J075130H08GATCGGACGNONE 
J075190L10GATCGGACGNONE 
Os12g0118800011-036-G12GATCGGACGNONE 
012-061-G07GATCGGACGNONE 
012-091-B08GATCGGACGNONE 
015-009-H09GATCGGACGNONE 
016-011-C01GATCGGACGNONE 
AK063302GATCGGACGAnkyrin repeat containing protein. 
J013038D16GATCGGACGNONE 
J013045F18GATCGGACGNONE 
J023060C11GATCGGACGNONE 
J065036C05GATCGGACGNONE 
J065091H16GATCGGACGNONE 
J065094G12GATCGGACGNONE 
J065096C03GATCGGACGNONE 
J065112M13GATCGGACGNONE 
J065116D02GATCGGACGNONE 
J065182B11GATCGGACGNONE 
J100022K06GATCGGACGNONE 
J100040P12GATCGGACGNONE 
Os12g0128700AK072576CGTCCGATCSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
J013047N12CGTCCGATCNONE 
Os12g0500700AK073408ATCGGACGSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0502100Os12g0502100AGCCGTCCGATCConserved hypothetical protein. 
Os12g0554800AK105676CGTCCGATCSimilar to Polygalacturonase-like protein. 
Os12g0562100AK064831GATCGGACGGCCConserved hypothetical protein. 
AK065844GATCGGACGGCCNONE 
J013000F11GATCGGACGGCCNONE 
Os12g0578200AK105512GATCGGACGGTGGGGGATSimilar to Chorismate mutase, chloroplast precursor (EC 5.4.99.5) (CM-1). 
Os12g0583300Os12g0583300ATCGGACGGAPeptidase A1, pepsin family protein. 
Os12g0605300AK108664GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.