version

Summary of OsREG485 (All List)

OrganismOryza sativa  
IDOsREG485  
SequenceATCTCGGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count917  

Entry Sequences (917 entries)

LocusGene modelSequenceDescription
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0172400AK065102ATCTCGGCNONE 
AK100365ATCTCGGCNONE 
AK119523ATCTCGGCNONE 
D73411ATCTCGGCPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03ATCTCGGCNONE 
J013052B12ATCTCGGCNONE 
J013071F15ATCTCGGCNONE 
J013108F19ATCTCGGCNONE 
J023025E17ATCTCGGCNONE 
J023083O10ATCTCGGCNONE 
J023084M17ATCTCGGCNONE 
J023100D16ATCTCGGCNONE 
J023107O10ATCTCGGCNONE 
J023119F08ATCTCGGCNONE 
J033035B07ATCTCGGCNONE 
J033052C18ATCTCGGCNONE 
J033092H11ATCTCGGCNONE 
J033096D02ATCTCGGCNONE 
J033117A16ATCTCGGCNONE 
J043010E08ATCTCGGCNONE 
J043013C12ATCTCGGCNONE 
J065001M15ATCTCGGCNONE 
J065021O11ATCTCGGCNONE 
J065089O20ATCTCGGCNONE 
J065117N05ATCTCGGCNONE 
J065129L11ATCTCGGCNONE 
J065170F18ATCTCGGCNONE 
J090066E11ATCTCGGCNONE 
J090076N24ATCTCGGCNONE 
J090093G21ATCTCGGCNONE 
J100041H17ATCTCGGCNONE 
J100050D07ATCTCGGCNONE 
J100063A06ATCTCGGCNONE 
Os01g0179901J075009I05GCCGAGATNONE 
J075058D09GCCGAGATNONE 
J075153K16GCCGAGATConserved hypothetical protein. 
Os01g0248500006-085-B05GCCGAGATNONE 
AK059893GCCGAGATSimilar to Pathogen-related protein. 
J065017N24GCCGAGATNONE 
J065039J02GCCGAGATNONE 
J065050K09GCCGAGATNONE 
J065104A07GCCGAGATNONE 
J065110O08GCCGAGATNONE 
J065183K20GCCGAGATNONE 
J065185M12GCCGAGATNONE 
J065189L06GCCGAGATNONE 
J065194E05GCCGAGATNONE 
J100049J21GCCGAGATNONE 
J100052I09GCCGAGATNONE 
J100068N13GCCGAGATNONE 
J100078P07GCCGAGATNONE 
J100090J16GCCGAGATNONE 
Os01g0276300AK108165ATCTCGGCSimilar to Group 3 late embryogenesis abundant protein (Fragment). 
Os01g0368900AK107858ATCTCGGCSimilar to GLUTAREDOXIN. 
J065148B01ATCTCGGCNONE 
J065181F23ATCTCGGCNONE 
J065201I22ATCTCGGCNONE 
J065208K09ATCTCGGCNONE 
Os01g0369700009-013-D06GCCGAGATNONE 
009-046-G07GCCGAGATNONE 
AF309382GCCGAGATNONE 
AK063796GCCGAGATSimilar to Glutathione S-transferase GST 8 (EC 2.5.1.18). 
AK101436GCCGAGATNONE 
AK120046GCCGAGATNONE 
J033039A11GCCGAGATNONE 
J033124G11GCCGAGATNONE 
J065005L17GCCGAGATNONE 
J065007P13GCCGAGATNONE 
J065027O07GCCGAGATNONE 
J065035K05GCCGAGATNONE 
J065063K13GCCGAGATNONE 
J065097E04GCCGAGATNONE 
J065153H06GCCGAGATNONE 
J065170G15GCCGAGATNONE 
J065189H21GCCGAGATNONE 
J065194B21GCCGAGATNONE 
J065212M19GCCGAGATNONE 
J100043I21GCCGAGATNONE 
J100044M16GCCGAGATNONE 
J100071K22GCCGAGATNONE 
J100083O14GCCGAGATNONE 
J100090K11GCCGAGATNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0570500AK111703ATCTCGGCSimilar to Dual specificity kinase 1. 
AK111922ATCTCGGCNONE 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0612700AK065375GCCGAGATZinc finger, LSD1-type domain containing protein. 
Os01g0617500003-016-E07ATCTCGGCNONE 
AK111993ATCTCGGCNONE 
Os01g0673600AK122067ATCTCGGCCSimilar to Ubiquitin-conjugating enzyme E2. 
J013036H06ATCTCGGCCNONE 
J013110B18ATCTCGGCCNONE 
J013162K06ATCTCGGCCNONE 
J023121H14ATCTCGGCCNONE 
J033061M10ATCTCGGCCNONE 
J033117D10ATCTCGGCCNONE 
J033145L07ATCTCGGCCNONE 
J043027L23ATCTCGGCCNONE 
J053032D15ATCTCGGCCNONE 
J053046J22ATCTCGGCCNONE 
J065026F01ATCTCGGCCNONE 
J065160C17ATCTCGGCCNONE 
J065207H23ATCTCGGCCNONE 
J075019E11ATCTCGGCCNONE 
J075073M16ATCTCGGCCNONE 
J075101K09ATCTCGGCCNONE 
J075114I09ATCTCGGCCNONE 
J075165J18ATCTCGGCCNONE 
J075195P10ATCTCGGCCNONE 
J100049H06ATCTCGGCCNONE 
J100052A10ATCTCGGCCNONE 
J100066D15ATCTCGGCCNONE 
Os01g0687500AK069185ATCTCGGCCMethionyl-tRNA formyltransferase family protein. 
J023008N17ATCTCGGCCNONE 
J065001C09ATCTCGGCCNONE 
J065038M21ATCTCGGCCNONE 
Os01g0693900AK066034GGCCGAGATNONE 
AK099894GGCCGAGATPeptidyl-tRNA hydrolase family protein. 
J065165G19GGCCGAGATNONE 
J100042C04GGCCGAGATNONE 
Os01g0727400AK065692GCCGAGATConserved hypothetical protein. 
Os01g0831900011-058-G07ATCTCGGCNONE 
AK063959ATCTCGGCNONE 
AK102106ATCTCGGCSimilar to Ammonium transporter. 
J033084D13ATCTCGGCNONE 
Os01g0891300AK063674GCCGAGATSimilar to Allyl alcohol dehydrogenase. 
AK099151GCCGAGATNONE 
Os01g0916200AK101112GCCGAGATNONE 
Os01g0922100AK110737ATCTCGGCCConserved hypothetical protein. 
Os02g0115900AF006825ATCTCGGCCCGTTNONE 
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein. 
AK119653ATCTCGGCCCGTTNONE 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCGGACGGCCGAGATNONE 
D89802ATCGGACGGCCGAGATNONE 
J013042L22ATCGGACGGCCGAGATNONE 
J013056A14ATCGGACGGCCGAGATNONE 
J013120G13ATCGGACGGCCGAGATNONE 
J013155K19ATCGGACGGCCGAGATNONE 
J023002B10ATCGGACGGCCGAGATNONE 
J023080J19ATCGGACGGCCGAGATNONE 
J023081C08ATCGGACGGCCGAGATNONE 
J023090H05ATCGGACGGCCGAGATNONE 
J023091M07ATCGGACGGCCGAGATNONE 
J023115F09ATCGGACGGCCGAGATNONE 
J033025I23ATCGGACGGCCGAGATNONE 
J033026G12ATCGGACGGCCGAGATNONE 
J033035E15ATCGGACGGCCGAGATNONE 
J033040N13ATCGGACGGCCGAGATNONE 
J033046C17ATCGGACGGCCGAGATNONE 
J033069F02ATCGGACGGCCGAGATNONE 
J033071B16ATCGGACGGCCGAGATNONE 
J033071N22ATCGGACGGCCGAGATNONE 
J033088J02ATCGGACGGCCGAGATNONE 
J033092N24ATCGGACGGCCGAGATNONE 
J033093I09ATCGGACGGCCGAGATNONE 
J033126G06ATCGGACGGCCGAGATNONE 
J043003G15ATCGGACGGCCGAGATNONE 
J043010M11ATCGGACGGCCGAGATNONE 
J043024O20ATCGGACGGCCGAGATNONE 
J065092N03ATCGGACGGCCGAGATNONE 
J080004D17ATCGGACGGCCGAGATNONE 
J080010L09ATCGGACGGCCGAGATNONE 
J080021I11ATCGGACGGCCGAGATNONE 
J080022L01ATCGGACGGCCGAGATNONE 
J080029B01ATCGGACGGCCGAGATNONE 
J080032D11ATCGGACGGCCGAGATNONE 
J080039B11ATCGGACGGCCGAGATNONE 
J080040K17ATCGGACGGCCGAGATNONE 
J080041B21ATCGGACGGCCGAGATNONE 
J080052L24ATCGGACGGCCGAGATNONE 
J080054M12ATCGGACGGCCGAGATNONE 
J080057B15ATCGGACGGCCGAGATNONE 
J080078G15ATCGGACGGCCGAGATNONE 
J080078H06ATCGGACGGCCGAGATNONE 
J080079M03ATCGGACGGCCGAGATNONE 
J080088H16ATCGGACGGCCGAGATNONE 
J080093C11ATCGGACGGCCGAGATNONE 
J080095K09ATCGGACGGCCGAGATNONE 
J080095O20ATCGGACGGCCGAGATNONE 
J090009J19ATCGGACGGCCGAGATNONE 
J090040D04ATCGGACGGCCGAGATNONE 
J090052E14ATCGGACGGCCGAGATNONE 
J090063B14ATCGGACGGCCGAGATNONE 
J090071K04ATCGGACGGCCGAGATNONE 
J090075E12ATCGGACGGCCGAGATNONE 
J090087A06ATCGGACGGCCGAGATNONE 
J090094P03ATCGGACGGCCGAGATNONE 
J090098M14ATCGGACGGCCGAGATNONE 
Os02g0307800006-080-C10GCCGAGATNONE 
006-116-A02GCCGAGATNONE 
AK061868GCCGAGATNONE 
AK065304GCCGAGATConserved hypothetical protein. 
Os02g0327700016-077-C07GGCCGAGATNONE 
AK068019GGCCGAGATProtein of unknown function DUF563 family protein. 
AK072325GGCCGAGATNONE 
J075069A18GGCCGAGATNONE 
J075069F06GGCCGAGATNONE 
Os02g0527300AK101934TCCGGGCCCCGCCGAGATSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11TCCGGGCCCCGCCGAGATNONE 
J033073P11TCCGGGCCCCGCCGAGATNONE 
Os02g0582300AK101861ATCTCGGCProtein prenyltransferase domain containing protein. 
Os02g0614600AK058581GCCGAGATNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0641800AK066504ATCTCGGCSimilar to RNA helicase (Fragment). 
AK072124ATCTCGGCNONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0740500J053032K17GCCGAGATNONE 
J053037O20GCCGAGATNONE 
J065002N12GCCGAGATNONE 
J065063M14GCCGAGATNONE 
J065066O08GCCGAGATNONE 
J065101A01GCCGAGATNONE 
J065101L24GCCGAGATConserved hypothetical protein. 
J065105E15GCCGAGATNONE 
J065115C03GCCGAGATNONE 
J065139L09GCCGAGATNONE 
J065154E17GCCGAGATNONE 
J065156I21GCCGAGATNONE 
J065159A04GCCGAGATNONE 
J065160E18GCCGAGATNONE 
J065160F22GCCGAGATNONE 
J065169B10GCCGAGATNONE 
J065180C13GCCGAGATNONE 
J065215H02GCCGAGATNONE 
J075006C10GCCGAGATNONE 
J075092M13GCCGAGATNONE 
J080302F14GCCGAGATNONE 
Os02g0807750J075136J04CAACGGCCGAGATHypothetical protein. 
Os02g0831800009-150-D09ATCTCGGCNONE 
AK060519ATCTCGGCSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03ATCTCGGCNONE 
J100077H12ATCTCGGCNONE 
Os03g0132000AK105769GCCGAGATSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384GCCGAGATNONE 
Os03g0132800AK104997GCCGAGATNONE 
AK122069GCCGAGATSimilar to protein kinase-like protein [Oryza sativa (japonica cultivar-group)]. 
Os03g0259900AK069483GCCGAGATProtein of unknown function DUF593 family protein. 
Os03g0297800AK107121ATCTCGGCProtein kinase-like domain containing protein. 
Os03g0302700006-099-F12ATCTCGGCCCGNONE 
AK112010ATCTCGGCCCGZinc finger, RING-type domain containing protein. 
AK121656ATCTCGGCCCGNONE 
J075090A19ATCTCGGCCCGNONE 
J075148M06ATCTCGGCCCGNONE 
Os03g0306301J065212M16ATCTCGGCConserved hypothetical protein. 
Os03g0390600009-122-E09ATCTCGGCCGTCCGANONE 
J065165K04ATCTCGGCCGTCCGANONE 
Os03g0425100AK070206CAACGGCCGAGATHypothetical protein. 
J023042E01CAACGGCCGAGATNONE 
Os03g0687800AK106820GCCGAGATConserved hypothetical protein. 
Os03g0751100AK102404GCCGAGATSimilar to Isp4 protein-like. 
Os03g0762400AK071181ATCTCGGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20ATCTCGGCNONE 
J033039C18ATCTCGGCNONE 
J033108N03ATCTCGGCNONE 
J043017N16ATCTCGGCNONE 
J065026C13ATCTCGGCNONE 
J065045C01ATCTCGGCNONE 
J065045D11ATCTCGGCNONE 
J065050N09ATCTCGGCNONE 
J065058P21ATCTCGGCNONE 
J065075I20ATCTCGGCNONE 
J065077I17ATCTCGGCNONE 
J065081I20ATCTCGGCNONE 
J065085B14ATCTCGGCNONE 
J065101K21ATCTCGGCNONE 
J065112A17ATCTCGGCNONE 
J065112N13ATCTCGGCNONE 
J065118J02ATCTCGGCNONE 
J065123E01ATCTCGGCNONE 
J065134N12ATCTCGGCNONE 
J065139L04ATCTCGGCNONE 
J065141I11ATCTCGGCNONE 
J065161J24ATCTCGGCNONE 
J065164I10ATCTCGGCNONE 
J065171L01ATCTCGGCNONE 
J065178P21ATCTCGGCNONE 
J065185L24ATCTCGGCNONE 
J065219C04ATCTCGGCNONE 
J075029B07ATCTCGGCNONE 
J075033G20ATCTCGGCNONE 
J075054N01ATCTCGGCNONE 
J075068B22ATCTCGGCNONE 
J075096N11ATCTCGGCNONE 
J075098C11ATCTCGGCNONE 
J075115J22ATCTCGGCNONE 
J075127D11ATCTCGGCNONE 
J075156J21ATCTCGGCNONE 
J075166G08ATCTCGGCNONE 
J075166P17ATCTCGGCNONE 
J075170O18ATCTCGGCNONE 
J075181A16ATCTCGGCNONE 
J075195J11ATCTCGGCNONE 
Os03g0793700AK121667CCCATCCATCTCGGCCCCupin 1 domain containing protein. 
AY098743CCCATCCATCTCGGCCCNONE 
Os04g0175900006-100-F11ATCTCGGCCNONE 
AK061551ATCTCGGCCWinged helix repressor DNA-binding domain containing protein. 
AK104764ATCTCGGCCNONE 
J075039D12ATCTCGGCCNONE 
Os04g0316200AK110725GCCGAGATProtein of unknown function DUF26 domain containing protein. 
AY576676GCCGAGATNONE 
J100043J22GCCGAGATNONE 
J100049F15GCCGAGATNONE 
J100081M23GCCGAGATNONE 
Os04g0322100J075093H10GCCGAGATProtein of unknown function DUF26 domain containing protein. 
J100044L06GCCGAGATNONE 
J100048J12GCCGAGATNONE 
J100073D10GCCGAGATNONE 
Os04g0463700015-076-E11GGCCGAGATNONE 
AK064338GGCCGAGATNONE 
AK068918GGCCGAGATSimilar to ADL064Wp. 
AK102269GGCCGAGATNONE 
J013043H02GGCCGAGATNONE 
J013102E08GGCCGAGATNONE 
J013169C17GGCCGAGATNONE 
J033088P15GGCCGAGATNONE 
J065146O17GGCCGAGATNONE 
J075065M01GGCCGAGATNONE 
J075075C15GGCCGAGATNONE 
J075161L06GGCCGAGATNONE 
J075186B19GGCCGAGATNONE 
Os04g0484900AK122179GGGCCGAGATSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J023093A12GGGCCGAGATNONE 
J033024H07GGGCCGAGATNONE 
J033149C03GGGCCGAGATNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02ATCTCGGCCCAATNONE 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10ATCTCGGCCCAATNONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0558700AK110633GCCGAGATConserved hypothetical protein. 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0176100AF030052ATCCGACGGCCGAGATNONE 
AK067850ATCCGACGGCCGAGATNONE 
AK067967ATCCGACGGCCGAGATNONE 
AK098978ATCCGACGGCCGAGATNONE 
AK099228ATCCGACGGCCGAGATNONE 
AK099281ATCCGACGGCCGAGATNONE 
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140ATCCGACGGCCGAGATNONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0188500AK069089ATCTCGGCArmadillo-like helical domain containing protein. 
AK100219ATCTCGGCNONE 
Os05g0272900AK107093GCCGAGATB-cell receptor-associated 31-like family protein. 
J065214G16GCCGAGATNONE 
J100022C20GCCGAGATNONE 
J100040B08GCCGAGATNONE 
J100088C21GCCGAGATNONE 
Os05g0283600AK100359GGCCGAGATConserved hypothetical protein. 
AK106958GGCCGAGATNONE 
AK109539GGCCGAGATNONE 
J023083K23GGCCGAGATNONE 
Os05g0456000AK058420GGCCGAGATMitochondrial glycoprotein family protein. 
AK102036GGCCGAGATNONE 
J065066F02GGCCGAGATNONE 
Os05g0571800009-157-G07ATCTCGGCCNONE 
AK063033ATCTCGGCCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os06g0135340J065061D17ATCTCGGCCCNONE 
J065159A10ATCTCGGCCCConserved hypothetical protein. 
Os06g0156700AK107226GGCCGAGATLipolytic enzyme, G-D-S-L family protein. 
J075021O05GGCCGAGATNONE 
J075023M12GGCCGAGATNONE 
J075041C14GGCCGAGATNONE 
J075041C19GGCCGAGATNONE 
J075064F08GGCCGAGATNONE 
J075116I03GGCCGAGATNONE 
J075123I02GGCCGAGATNONE 
Os06g0542100AK111086GCCGAGATHypothetical protein. 
J090051D03GCCGAGATNONE 
Os06g0571400011-027-C01ATCTCGGCCGTCCNONE 
013-005-G03ATCTCGGCCGTCCNONE 
015-053-G02ATCTCGGCCGTCCNONE 
016-077-A05ATCTCGGCCGTCCNONE 
AK068226ATCTCGGCCGTCCSimilar to Elongation factor 1 gamma-like protein (Fragment). 
AK103928ATCTCGGCCGTCCNONE 
AK104931ATCTCGGCCGTCCNONE 
AY224444ATCTCGGCCGTCCNONE 
J013044F14ATCTCGGCCGTCCNONE 
J013092L16ATCTCGGCCGTCCNONE 
J033028B03ATCTCGGCCGTCCNONE 
J033048B03ATCTCGGCCGTCCNONE 
J033065D21ATCTCGGCCGTCCNONE 
J033087A07ATCTCGGCCGTCCNONE 
J033108N12ATCTCGGCCGTCCNONE 
J033111G07ATCTCGGCCGTCCNONE 
J043009P12ATCTCGGCCGTCCNONE 
J075079P19ATCTCGGCCGTCCNONE 
J090056J24ATCTCGGCCGTCCNONE 
J090071D10ATCTCGGCCGTCCNONE 
Os06g0649900AK122015ATCTCGGCPhospholipase D/Transphosphatidylase domain containing protein. 
J023121B16ATCTCGGCNONE 
J033111K04ATCTCGGCNONE 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0708900AK100402ATCTCGGCConserved hypothetical protein. 
Os07g0108100Os07g0108100ATCTCGGCCCPeptidase C1A, papain family protein. 
Os07g0110000AK066728ATCTCGGCHypothetical protein. 
Os07g0121500J100066O17ATCTCGGCCGTCCNONE 
Os07g0184200AK106871ATCTCGGCProtein of unknown function DUF295 family protein. 
Os07g0206700013-093-G04GCCGAGATNONE 
AK072893GCCGAGATCycloartenol-C-24-methyltransferase 1 (EC 2.1.1.41) (24-sterol C- methyltransferase 1) (Sterol C-methyltransferase 1). 
AK100653GCCGAGATNONE 
J013092K05GCCGAGATNONE 
J023030D07GCCGAGATNONE 
J023101M14GCCGAGATNONE 
J023111D19GCCGAGATNONE 
J023121P10GCCGAGATNONE 
J023149L23GCCGAGATNONE 
J033080A22GCCGAGATNONE 
J033088A07GCCGAGATNONE 
J100027J01GCCGAGATNONE 
J100035B02GCCGAGATNONE 
J100035G22GCCGAGATNONE 
J100078D10GCCGAGATNONE 
Os07g0211800AK065959GCCGAGATProtein of unknown function DUF1749 family protein. 
J013045P18GCCGAGATNONE 
J023054M01GCCGAGATNONE 
J053075O04GCCGAGATNONE 
J065041J23GCCGAGATNONE 
J065066E24GCCGAGATNONE 
J090007J10GCCGAGATNONE 
J100025A22GCCGAGATNONE 
J100042C19GCCGAGATNONE 
Os07g0217600AK065971ATCTCGGCCytochrome P450 family protein. 
Os07g0479100AK069812GCCGAGATNONE 
AK103576GCCGAGATZinc finger, RING-type domain containing protein. 
AY224527GCCGAGATNONE 
Os07g0483400AK108064GCCGAGATConserved hypothetical protein. 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0657200AB042102CAACGGCCGAGATNONE 
AB042102CCAACGGCCGAGATNONE 
AK072927CAACGGCCGAGATWD40-like domain containing protein. 
AK072927CCAACGGCCGAGATWD40-like domain containing protein. 
AK100911CAACGGCCGAGATNONE 
AK100911CCAACGGCCGAGATNONE 
Os07g0677300AK073616ATCTCGGCNONE 
D16442ATCTCGGCPeroxidase. 
J033051E10ATCTCGGCNONE 
J075007M03ATCTCGGCNONE 
J075018B13ATCTCGGCNONE 
J075051I02ATCTCGGCNONE 
J075074K03ATCTCGGCNONE 
J075091M06ATCTCGGCNONE 
J075145A19ATCTCGGCNONE 
J075182I12ATCTCGGCNONE 
J075182N18ATCTCGGCNONE 
J100021I06ATCTCGGCNONE 
Os07g0691100AK071728ATCTCGGCSimilar to Pectin methylesterase 6 (Fragment). 
J023108P03ATCTCGGCNONE 
J023112F11ATCTCGGCNONE 
J023143A10ATCTCGGCNONE 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
AK070034AGTGGGCCGAGATNONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J100062K14AGTGGGCCGAGATNONE 
Os08g0379400006-033-C10CGGGCCGAGATNONE 
006-112-H05CGGGCCGAGATNONE 
AK069608CGGGCCGAGATSimilar to Quinone oxidoreductase-like protein. 
AK104318CGGGCCGAGATNONE 
AK109433CGGGCCGAGATNONE 
AK112013CGGGCCGAGATNONE 
J065163C05CGGGCCGAGATNONE 
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein. 
Os08g0512700AK060545GCCGAGATSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0537900AK119425ATCTCGGCNONE 
AY341827ATCTCGGCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0538000015-055-H11GCCGAGATNONE 
AK068997GCCGAGATNONE 
Os09g0113000009-104-D11GCCGAGATNONE 
AK062770GCCGAGATHypothetical protein. 
Os09g0458100AK109625GTTGGGCCGAGATXyloglucan fucosyltransferase family protein. 
Os09g0495400013-038-E07GCCGAGATNONE 
AK063579GCCGAGATHypothetical protein. 
Os09g0539100AK071977ATCTCGGCCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ATCTCGGCCNONE 
Os11g0423200AK111297ATCTCGGCHypothetical protein. 
Os11g0444800AK061328ATCTCGGCCConserved hypothetical protein. 
Os11g0557700AK071694ATCTCGGCCGTCCNONE 
AK107593ATCTCGGCCGTCCSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23ATCTCGGCCGTCCNONE 
Os11g0602600006-046-H02ATCTCGGCCCATTTNONE 
006-056-H08ATCTCGGCCCATTTNONE 
009-116-D05ATCTCGGCCCATTTNONE 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK104660ATCTCGGCCCATTTNONE 
J023134P20ATCTCGGCCCATTTNONE 
J023141O13ATCTCGGCCCATTTNONE 
J033066I15ATCTCGGCCCATTTNONE 
J033076A08ATCTCGGCCCATTTNONE 
J033150J23ATCTCGGCCCATTTNONE 
J065114P19ATCTCGGCCCATTTNONE 
J065176B01ATCTCGGCCCATTTNONE 
J065207H21ATCTCGGCCCATTTNONE 
J080301L21ATCTCGGCCCATTTNONE 
J080308A08ATCTCGGCCCATTTNONE 
J080318K23ATCTCGGCCCATTTNONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319I10ATCTCGGCCCATTTNONE 
J090028C08ATCTCGGCCCATTTNONE 
J090051I24ATCTCGGCCCATTTNONE 
J090053L21ATCTCGGCCCATTTNONE 
J090069C20ATCTCGGCCCATTTNONE 
J100017G08ATCTCGGCCCATTTNONE 
J100042B06ATCTCGGCCCATTTNONE 
J100045G24ATCTCGGCCCATTTNONE 
J100050J19ATCTCGGCCCATTTNONE 
J100052D23ATCTCGGCCCATTTNONE 
J100053M03ATCTCGGCCCATTTNONE 
J100056D08ATCTCGGCCCATTTNONE 
J100066B19ATCTCGGCCCATTTNONE 
J100071N23ATCTCGGCCCATTTNONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H19ATCTCGGCCCATTTNONE 
J100077C06ATCTCGGCCCATTTNONE 
Os11g0707000003-106-C01GGCCGAGATNONE 
003-130-G06GGCCGAGATNONE 
005-012-E05GGCCGAGATNONE 
006-021-F04GGCCGAGATNONE 
006-031-E07GGCCGAGATNONE 
006-035-C03GGCCGAGATNONE 
006-038-D10GGCCGAGATNONE 
006-043-A10GGCCGAGATNONE 
006-043-G08GGCCGAGATNONE 
006-046-C03GGCCGAGATNONE 
006-055-G09GGCCGAGATNONE 
006-085-A03GGCCGAGATNONE 
006-118-E05GGCCGAGATNONE 
AB034698GGCCGAGATNONE 
AB034748GGCCGAGATNONE 
AB110180GGCCGAGATNONE 
AK060841GGCCGAGATNONE 
AK060847GGCCGAGATNONE 
AK064986GGCCGAGATNONE 
AK104332GGCCGAGATSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513GGCCGAGATNONE 
J013001C24GGCCGAGATNONE 
J013024I02GGCCGAGATNONE 
J013044O11GGCCGAGATNONE 
J013048O10GGCCGAGATNONE 
J013051A08GGCCGAGATNONE 
J013055H23GGCCGAGATNONE 
J013070N15GGCCGAGATNONE 
J013074C16GGCCGAGATNONE 
J013096P16GGCCGAGATNONE 
J013109A14GGCCGAGATNONE 
J013112C07GGCCGAGATNONE 
J013112N16GGCCGAGATNONE 
J013123B03GGCCGAGATNONE 
J013128G01GGCCGAGATNONE 
J013132L17GGCCGAGATNONE 
J013158I17GGCCGAGATNONE 
J013159L01GGCCGAGATNONE 
J023001H04GGCCGAGATNONE 
J023004L05GGCCGAGATNONE 
J023013G12GGCCGAGATNONE 
J023020K06GGCCGAGATNONE 
J023031J19GGCCGAGATNONE 
J023034A05GGCCGAGATNONE 
J023034E21GGCCGAGATNONE 
J023041M12GGCCGAGATNONE 
J023041P06GGCCGAGATNONE 
J023044C04GGCCGAGATNONE 
J023047H01GGCCGAGATNONE 
J023048D08GGCCGAGATNONE 
J023052H08GGCCGAGATNONE 
J023054D24GGCCGAGATNONE 
J023063G11GGCCGAGATNONE 
J023068O21GGCCGAGATNONE 
J023074C13GGCCGAGATNONE 
J023078O06GGCCGAGATNONE 
J023089K10GGCCGAGATNONE 
J023100O05GGCCGAGATNONE 
J023107N16GGCCGAGATNONE 
J023120L08GGCCGAGATNONE 
J023123N23GGCCGAGATNONE 
J023127M10GGCCGAGATNONE 
J023128C22GGCCGAGATNONE 
J023129C04GGCCGAGATNONE 
J023146H08GGCCGAGATNONE 
J053063N05GGCCGAGATNONE 
J053066F02GGCCGAGATNONE 
J053066N18GGCCGAGATNONE 
J053076G01GGCCGAGATNONE 
J065012O05GGCCGAGATNONE 
J065035L06GGCCGAGATNONE 
J065037M01GGCCGAGATNONE 
J065045N23GGCCGAGATNONE 
J065058F09GGCCGAGATNONE 
J065072E14GGCCGAGATNONE 
J065073I20GGCCGAGATNONE 
J065076B05GGCCGAGATNONE 
J065093B09GGCCGAGATNONE 
J065117A22GGCCGAGATNONE 
J065149J21GGCCGAGATNONE 
J065155M04GGCCGAGATNONE 
J065161J21GGCCGAGATNONE 
J065163H19GGCCGAGATNONE 
J065192A15GGCCGAGATNONE 
J065211L18GGCCGAGATNONE 
J075001K13GGCCGAGATNONE 
J075002J24GGCCGAGATNONE 
J075004N18GGCCGAGATNONE 
J075025H21GGCCGAGATNONE 
J075028F20GGCCGAGATNONE 
J075039F23GGCCGAGATNONE 
J075043M08GGCCGAGATNONE 
J075057D02GGCCGAGATNONE 
J075059I01GGCCGAGATNONE 
J075069P10GGCCGAGATNONE 
J075073D08GGCCGAGATNONE 
J075084I17GGCCGAGATNONE 
J075089I04GGCCGAGATNONE 
J075093O18GGCCGAGATNONE 
J075097N13GGCCGAGATNONE 
J075114B02GGCCGAGATNONE 
J075123E10GGCCGAGATNONE 
J075128C19GGCCGAGATNONE 
J075135F05GGCCGAGATNONE 
J075136A04GGCCGAGATNONE 
J075141B05GGCCGAGATNONE 
J075169H18GGCCGAGATNONE 
J075183L14GGCCGAGATNONE 
J075191N03GGCCGAGATNONE 
J080001C11GGCCGAGATNONE 
J080004F18GGCCGAGATNONE 
J080004H21GGCCGAGATNONE 
J080004O09GGCCGAGATNONE 
J080005J02GGCCGAGATNONE 
J080006I03GGCCGAGATNONE 
J080006J17GGCCGAGATNONE 
J080009I09GGCCGAGATNONE 
J080010I06GGCCGAGATNONE 
J080011A17GGCCGAGATNONE 
J080014N22GGCCGAGATNONE 
J080016E24GGCCGAGATNONE 
J080016P08GGCCGAGATNONE 
J080017G22GGCCGAGATNONE 
J080017P09GGCCGAGATNONE 
J080018D23GGCCGAGATNONE 
J080018E15GGCCGAGATNONE 
J080020K04GGCCGAGATNONE 
J080024P09GGCCGAGATNONE 
J080025G15GGCCGAGATNONE 
J080025N11GGCCGAGATNONE 
J080026H10GGCCGAGATNONE 
J080026N06GGCCGAGATNONE 
J080027C07GGCCGAGATNONE 
J080027M21GGCCGAGATNONE 
J080028I03GGCCGAGATNONE 
J080028K11GGCCGAGATNONE 
J080029B19GGCCGAGATNONE 
J080029G14GGCCGAGATNONE 
J080029G20GGCCGAGATNONE 
J080030A16GGCCGAGATNONE 
J080031C05GGCCGAGATNONE 
J080033M16GGCCGAGATNONE 
J080034C24GGCCGAGATNONE 
J080034F11GGCCGAGATNONE 
J080036B03GGCCGAGATNONE 
J080036C14GGCCGAGATNONE 
J080037C01GGCCGAGATNONE 
J080038M20GGCCGAGATNONE 
J080039K03GGCCGAGATNONE 
J080040M24GGCCGAGATNONE 
J080040P19GGCCGAGATNONE 
J080042L24GGCCGAGATNONE 
J080042O06GGCCGAGATNONE 
J080043A22GGCCGAGATNONE 
J080043N19GGCCGAGATNONE 
J080044A18GGCCGAGATNONE 
J080044P14GGCCGAGATNONE 
J080045K12GGCCGAGATNONE 
J080045N16GGCCGAGATNONE 
J080047A16GGCCGAGATNONE 
J080047B09GGCCGAGATNONE 
J080047E08GGCCGAGATNONE 
J080047G06GGCCGAGATNONE 
J080048H04GGCCGAGATNONE 
J080049B17GGCCGAGATNONE 
J080049D05GGCCGAGATNONE 
J080049G23GGCCGAGATNONE 
J080050D03GGCCGAGATNONE 
J080050J24GGCCGAGATNONE 
J080050O20GGCCGAGATNONE 
J080052E24GGCCGAGATNONE 
J080052K11GGCCGAGATNONE 
J080053B04GGCCGAGATNONE 
J080053D20GGCCGAGATNONE 
J080053E16GGCCGAGATNONE 
J080054H20GGCCGAGATNONE 
J080054H22GGCCGAGATNONE 
J080054N24GGCCGAGATNONE 
J080055H08GGCCGAGATNONE 
J080056H08GGCCGAGATNONE 
J080056H12GGCCGAGATNONE 
J080057N11GGCCGAGATNONE 
J080058D08GGCCGAGATNONE 
J080058D21GGCCGAGATNONE 
J080058E10GGCCGAGATNONE 
J080060J10GGCCGAGATNONE 
J080061O04GGCCGAGATNONE 
J080065M18GGCCGAGATNONE 
J080066D15GGCCGAGATNONE 
J080067E22GGCCGAGATNONE 
J080067N20GGCCGAGATNONE 
J080068F02GGCCGAGATNONE 
J080069G20GGCCGAGATNONE 
J080069O13GGCCGAGATNONE 
J080070I20GGCCGAGATNONE 
J080071H11GGCCGAGATNONE 
J080071H17GGCCGAGATNONE 
J080071O18GGCCGAGATNONE 
J080077G14GGCCGAGATNONE 
J080077H17GGCCGAGATNONE 
J080078B18GGCCGAGATNONE 
J080078D24GGCCGAGATNONE 
J080079H02GGCCGAGATNONE 
J080079J02GGCCGAGATNONE 
J080081O20GGCCGAGATNONE 
J080082E02GGCCGAGATNONE 
J080082N12GGCCGAGATNONE 
J080084E18GGCCGAGATNONE 
J080085P08GGCCGAGATNONE 
J080086B21GGCCGAGATNONE 
J080086L10GGCCGAGATNONE 
J080086L18GGCCGAGATNONE 
J080087D12GGCCGAGATNONE 
J080087E24GGCCGAGATNONE 
J080087G12GGCCGAGATNONE 
J080088J22GGCCGAGATNONE 
J080090C18GGCCGAGATNONE 
J080090L02GGCCGAGATNONE 
J080092N05GGCCGAGATNONE 
J080092P20GGCCGAGATNONE 
J080094D15GGCCGAGATNONE 
J080095A11GGCCGAGATNONE 
J080095K13GGCCGAGATNONE 
J080096L16GGCCGAGATNONE 
J080097F16GGCCGAGATNONE 
J080305J21GGCCGAGATNONE 
J080308I22GGCCGAGATNONE 
J080310E21GGCCGAGATNONE 
J080310G09GGCCGAGATNONE 
J090032M14GGCCGAGATNONE 
J090045I12GGCCGAGATNONE 
J090076M15GGCCGAGATNONE 
J090088C17GGCCGAGATNONE 
J090094B06GGCCGAGATNONE 
U74321GGCCGAGATNONE 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0615800AK073946CAACGGCCGAGATD111/G-patch domain containing protein. 
J033071N19CAACGGCCGAGATNONE 
Os12g0621500AK111785GGCCGAGATSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.