version

Summary of OsREG486 (All List)

OrganismOryza sativa  
IDOsREG486  
SequenceATCTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1193  

Entry Sequences (1193 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TTGGCCCAGATSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0141600016-051-A03ATCTGGGCTTTNONE 
AK066922ATCTGGGCTTTProtein of unknown function DUF647 family protein. 
Os01g0193400AK069948ATCTGGGCCGGANONE 
AK099271ATCTGGGCCGGANONE 
AK107005ATCTGGGCCGGAConserved hypothetical protein. 
Os01g0273300Os01g0273300TTGGCCCAGATBSD domain containing protein. 
Os01g0549400AK122104ATCTGGGCCCAGASimilar to RNA helicase-like protein DB10. 
Os01g0615100AJ601438ATCTGGGCSimilar to Substilin /chymotrypsin-like inhibitor (Proteinase inhibitor). 
AK062495ATCTGGGCNONE 
AY878694ATCTGGGCNONE 
J065049F01ATCTGGGCNONE 
J065119G11ATCTGGGCNONE 
J100090N15ATCTGGGCNONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0710000AK111794GCCCAGATSimilar to WD-repeat protein RBAP1. 
J023006D22GCCCAGATNONE 
J065106P04GCCCAGATNONE 
J100036G13GCCCAGATNONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0844800AK099801ATCTGGGCCGTCSimilar to Pumilio RBD (Fragment). 
AK102882ATCTGGGCCGTCNONE 
AK103686ATCTGGGCCGTCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
J090089O16CAAGGCCCAGATNONE 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0959100009-163-G12ATCTGGGCCGGCNONE 
AK063053ATCTGGGCCGGCSimilar to Abscisic stress ripening protein 1. 
Os01g0976200006-044-A09ATCTGGGCCGGCNONE 
AK061022ATCTGGGCCGGC11-S plant seed storage protein family protein. 
J023012H20ATCTGGGCCGGCNONE 
J023025O07ATCTGGGCCGGCNONE 
J023082A14ATCTGGGCCGGCNONE 
J023115H15ATCTGGGCCGGCNONE 
J023133H14ATCTGGGCCGGCNONE 
J023133L21ATCTGGGCCGGCNONE 
J023136B16ATCTGGGCCGGCNONE 
J023145P17ATCTGGGCCGGCNONE 
J023146N03ATCTGGGCCGGCNONE 
Os02g0100800009-070-H03GCCCAGATNONE 
AK062555GCCCAGATHypothetical protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0478700AK099723AAGGCCCAGATRibosomal protein S27. 
AK099723GACGGCCCAGATRibosomal protein S27. 
J013089A06AAGGCCCAGATNONE 
J013089A06GACGGCCCAGATNONE 
J065068E01AAGGCCCAGATNONE 
J065068E01GACGGCCCAGATNONE 
J065217F15AAGGCCCAGATNONE 
J065217F15GACGGCCCAGATNONE 
Os02g0510100AK058487ATCTGGGCCCGCNONE 
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06ATCTGGGCCCGCNONE 
J053077L04ATCTGGGCCCGCNONE 
J065010C11ATCTGGGCCCGCNONE 
J075104O14ATCTGGGCCCGCNONE 
J080003G03ATCTGGGCCCGCNONE 
J080014K05ATCTGGGCCCGCNONE 
J080026F03ATCTGGGCCCGCNONE 
J080027O05ATCTGGGCCCGCNONE 
J080037K15ATCTGGGCCCGCNONE 
J080039D24ATCTGGGCCCGCNONE 
J080043G19ATCTGGGCCCGCNONE 
J080047P05ATCTGGGCCCGCNONE 
J080048D22ATCTGGGCCCGCNONE 
J080049F23ATCTGGGCCCGCNONE 
J080062A21ATCTGGGCCCGCNONE 
J080063H20ATCTGGGCCCGCNONE 
J080067P15ATCTGGGCCCGCNONE 
J080068P19ATCTGGGCCCGCNONE 
J080079J15ATCTGGGCCCGCNONE 
J080092K19ATCTGGGCCCGCNONE 
J080096M04ATCTGGGCCCGCNONE 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0631000AK068667ATCTGGGCCGTGConserved hypothetical protein. 
J013159L03ATCTGGGCCGTGNONE 
J023119O20ATCTGGGCCGTGNONE 
J090098N20ATCTGGGCCGTGNONE 
Os02g0636300AK100670ATCTGGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11ATCTGGGCNONE 
J023022F15ATCTGGGCNONE 
J023112J15ATCTGGGCNONE 
J023145M22ATCTGGGCNONE 
J043017P16ATCTGGGCNONE 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0661900006-030-G12GCAGCCCAGATNONE 
AK061447GCAGCCCAGATSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2. 
AK068742GCAGCCCAGATNONE 
J075046K13GCAGCCCAGATNONE 
J075139O08GCAGCCCAGATNONE 
J075149I16GCAGCCCAGATNONE 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0767500005-017-F10ACAGCCCAGATNONE 
AB016065ACAGCCCAGATNONE 
AK069611ACAGCCCAGATMitochondrial phosphate transporter. 
J013020K11ACAGCCCAGATNONE 
J013066I18ACAGCCCAGATNONE 
J023012D02ACAGCCCAGATNONE 
J023020J16ACAGCCCAGATNONE 
J023022H13ACAGCCCAGATNONE 
J023044N15ACAGCCCAGATNONE 
J023067E15ACAGCCCAGATNONE 
J023079C06ACAGCCCAGATNONE 
J023080B07ACAGCCCAGATNONE 
J023081G11ACAGCCCAGATNONE 
J023091H22ACAGCCCAGATNONE 
J023092J03ACAGCCCAGATNONE 
J023114D02ACAGCCCAGATNONE 
J023121J15ACAGCCCAGATNONE 
J023128G10ACAGCCCAGATNONE 
J023132B15ACAGCCCAGATNONE 
J023140G10ACAGCCCAGATNONE 
J023142B10ACAGCCCAGATNONE 
J033026C15ACAGCCCAGATNONE 
J033029F21ACAGCCCAGATNONE 
J033037I09ACAGCCCAGATNONE 
J033046D11ACAGCCCAGATNONE 
J033081L20ACAGCCCAGATNONE 
J033097J19ACAGCCCAGATNONE 
J033125D19ACAGCCCAGATNONE 
J033125I04ACAGCCCAGATNONE 
J033141M21ACAGCCCAGATNONE 
J033143K08ACAGCCCAGATNONE 
J053091N01ACAGCCCAGATNONE 
J065093C20ACAGCCCAGATNONE 
J065104K11ACAGCCCAGATNONE 
J065143L16ACAGCCCAGATNONE 
J065205I23ACAGCCCAGATNONE 
J090057C12ACAGCCCAGATNONE 
J090075P11ACAGCCCAGATNONE 
Os02g0768300AK073339ATCTGGGCProtein of unknown function DUF6, transmembrane domain containing protein. 
Os02g0793400AK109835GCCCAGATProtein of unknown function DUF1618 domain containing protein. 
Os02g0805600006-054-D07ATCTGGGCCAANONE 
AK059822ATCTGGGCCAANONE 
AK099516ATCTGGGCCAASimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587ATCTGGGCCAANONE 
J065037H22ATCTGGGCCAANONE 
J090015P17ATCTGGGCCAANONE 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12ATCTGGGCCCACANONE 
J075104C12ATCTGGGCCCACANONE 
J075120E03ATCTGGGCCCACANONE 
J075126M18ATCTGGGCCCACANONE 
J075189P21ATCTGGGCCCACANONE 
Os03g0106200AK120128ATCTGGGCConserved hypothetical protein. 
Os03g0113700AK103835ATCTGGGCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0133000AK107090GCCCAGATSimilar to NAC-domain protein 14. 
J080306O09GCCCAGATNONE 
J080308J12GCCCAGATNONE 
J080309I21GCCCAGATNONE 
J080311P06GCCCAGATNONE 
J080315N18GCCCAGATNONE 
J080317H18GCCCAGATNONE 
J080319G12GCCCAGATNONE 
Os03g0160200AK064836GCCCAGATCCAACGGCTConserved hypothetical protein. 
AK071081GCCCAGATCCAACGGCTNONE 
AK100712GCCCAGATCCAACGGCTNONE 
AK104859GCCCAGATCCAACGGCTNONE 
J013000F21GCCCAGATCCAACGGCTNONE 
J013024G05GCCCAGATCCAACGGCTNONE 
J013035E12GCCCAGATCCAACGGCTNONE 
J013041A17GCCCAGATCCAACGGCTNONE 
J013045D10GCCCAGATCCAACGGCTNONE 
J013045F04GCCCAGATCCAACGGCTNONE 
J013046F04GCCCAGATCCAACGGCTNONE 
J013047F10GCCCAGATCCAACGGCTNONE 
J013051E10GCCCAGATCCAACGGCTNONE 
J013059J07GCCCAGATCCAACGGCTNONE 
J013059O17GCCCAGATCCAACGGCTNONE 
J013060A20GCCCAGATCCAACGGCTNONE 
J013063J23GCCCAGATCCAACGGCTNONE 
J013066D19GCCCAGATCCAACGGCTNONE 
J013069O08GCCCAGATCCAACGGCTNONE 
J013088K24GCCCAGATCCAACGGCTNONE 
J013098G04GCCCAGATCCAACGGCTNONE 
J013100I15GCCCAGATCCAACGGCTNONE 
J013102E18GCCCAGATCCAACGGCTNONE 
J013102O09GCCCAGATCCAACGGCTNONE 
J013119M18GCCCAGATCCAACGGCTNONE 
J013123I19GCCCAGATCCAACGGCTNONE 
J013146H15GCCCAGATCCAACGGCTNONE 
J013149A14GCCCAGATCCAACGGCTNONE 
J023003A05GCCCAGATCCAACGGCTNONE 
J023013O19GCCCAGATCCAACGGCTNONE 
J023044M05GCCCAGATCCAACGGCTNONE 
J023048O03GCCCAGATCCAACGGCTNONE 
J023049L17GCCCAGATCCAACGGCTNONE 
J023060D22GCCCAGATCCAACGGCTNONE 
J023060F20GCCCAGATCCAACGGCTNONE 
J023069G09GCCCAGATCCAACGGCTNONE 
J023086E11GCCCAGATCCAACGGCTNONE 
J023091I09GCCCAGATCCAACGGCTNONE 
J023091M19GCCCAGATCCAACGGCTNONE 
J023101D06GCCCAGATCCAACGGCTNONE 
J023109B03GCCCAGATCCAACGGCTNONE 
J023113B14GCCCAGATCCAACGGCTNONE 
J023114B19GCCCAGATCCAACGGCTNONE 
J023115H16GCCCAGATCCAACGGCTNONE 
J023134F22GCCCAGATCCAACGGCTNONE 
J023139I06GCCCAGATCCAACGGCTNONE 
J023150C02GCCCAGATCCAACGGCTNONE 
J033033A14GCCCAGATCCAACGGCTNONE 
J033058O11GCCCAGATCCAACGGCTNONE 
J033060H13GCCCAGATCCAACGGCTNONE 
J033075P14GCCCAGATCCAACGGCTNONE 
J033084O05GCCCAGATCCAACGGCTNONE 
J033087G04GCCCAGATCCAACGGCTNONE 
J033092E18GCCCAGATCCAACGGCTNONE 
J033101G23GCCCAGATCCAACGGCTNONE 
J033112I05GCCCAGATCCAACGGCTNONE 
J033118E14GCCCAGATCCAACGGCTNONE 
J033118P04GCCCAGATCCAACGGCTNONE 
J033123C07GCCCAGATCCAACGGCTNONE 
J043003C01GCCCAGATCCAACGGCTNONE 
J043024B21GCCCAGATCCAACGGCTNONE 
J043030N04GCCCAGATCCAACGGCTNONE 
J043039J02GCCCAGATCCAACGGCTNONE 
J043039N08GCCCAGATCCAACGGCTNONE 
J075006N21GCCCAGATCCAACGGCTNONE 
J075008A16GCCCAGATCCAACGGCTNONE 
J075018J16GCCCAGATCCAACGGCTNONE 
J075023G04GCCCAGATCCAACGGCTNONE 
J075134F18GCCCAGATCCAACGGCTNONE 
J075181B05GCCCAGATCCAACGGCTNONE 
J090014O14GCCCAGATCCAACGGCTNONE 
J090020H22GCCCAGATCCAACGGCTNONE 
J090022G17GCCCAGATCCAACGGCTNONE 
J090023J24GCCCAGATCCAACGGCTNONE 
J090033H01GCCCAGATCCAACGGCTNONE 
J090038A03GCCCAGATCCAACGGCTNONE 
J090041O22GCCCAGATCCAACGGCTNONE 
J090049E10GCCCAGATCCAACGGCTNONE 
J090063E24GCCCAGATCCAACGGCTNONE 
J090080N12GCCCAGATCCAACGGCTNONE 
J100021G23GCCCAGATCCAACGGCTNONE 
J100028P06GCCCAGATCCAACGGCTNONE 
J100060L21GCCCAGATCCAACGGCTNONE 
J100077D16GCCCAGATCCAACGGCTNONE 
J100088I09GCCCAGATCCAACGGCTNONE 
Os03g0168200AK099530TCAGCCCAGATConserved hypothetical protein. 
Os03g0176800AK103848ATCTGGGCCGCConserved hypothetical protein. 
J033148K19ATCTGGGCCGCNONE 
J090079G01ATCTGGGCCGCNONE 
Os03g0213800AK103114ATCTGGGCCTCMitochondrial substrate carrier family protein. 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0220300006-066-A07ATCTGGGCNONE 
AK061070ATCTGGGCNONE 
AK070005ATCTGGGCNONE 
AK120487ATCTGGGCConserved hypothetical protein. 
J013114B13ATCTGGGCNONE 
Os03g0246800AK070145CCCCCACGCCCAGATNONE 
AK102770CCCCCACGCCCAGATNONE 
Os03g0255000AK101625GCCCAGATFAR1 domain containing protein. 
J033052M07GCCCAGATNONE 
Os03g0261500AK061995ATCTGGGCTGANONE 
J013044K20ATCTGGGCTGANONE 
J033113A11ATCTGGGCTGANONE 
J100032O18ATCTGGGCTGANONE 
J100037K21ATCTGGGCTGANONE 
Os03g0268300AK102684ATCTGGGCCCTSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22ATCTGGGCCCTNONE 
J013057J23ATCTGGGCCCTNONE 
J013149I10ATCTGGGCCCTNONE 
J013149M20ATCTGGGCCCTNONE 
J013151D14ATCTGGGCCCTNONE 
J013162O11ATCTGGGCCCTNONE 
J023001F12ATCTGGGCCCTNONE 
J023031B21ATCTGGGCCCTNONE 
J023080A07ATCTGGGCCCTNONE 
J023081N04ATCTGGGCCCTNONE 
J023090C08ATCTGGGCCCTNONE 
J023134G05ATCTGGGCCCTNONE 
J023139G17ATCTGGGCCCTNONE 
J023143I10ATCTGGGCCCTNONE 
J023147D04ATCTGGGCCCTNONE 
J023147O15ATCTGGGCCCTNONE 
J033102K23ATCTGGGCCCTNONE 
J033106C17ATCTGGGCCCTNONE 
J075033G19ATCTGGGCCCTNONE 
J075039J18ATCTGGGCCCTNONE 
J075050K20ATCTGGGCCCTNONE 
J075075J03ATCTGGGCCCTNONE 
J075080E16ATCTGGGCCCTNONE 
J075086L08ATCTGGGCCCTNONE 
J075091K19ATCTGGGCCCTNONE 
J075099O20ATCTGGGCCCTNONE 
J075104I06ATCTGGGCCCTNONE 
J075137C16ATCTGGGCCCTNONE 
J075152G03ATCTGGGCCCTNONE 
J075176N12ATCTGGGCCCTNONE 
J100086K11ATCTGGGCCCTNONE 
Os03g0272300AK060183ATCTGGGCNONE 
AK060183ATCTGGGCNONE 
AK071865ATCTGGGCZinc finger, RING-type domain containing protein. 
AK071865ATCTGGGCZinc finger, RING-type domain containing protein. 
Os03g0288900AK100329GAGGCCCAGATConserved hypothetical protein. 
J023080H15GAGGCCCAGATNONE 
J033136I21GAGGCCCAGATNONE 
J065036A16GAGGCCCAGATNONE 
J065186A16GAGGCCCAGATNONE 
J065187B08GAGGCCCAGATNONE 
J065202E24GAGGCCCAGATNONE 
Os03g0292800012-077-B05ATCTGGGCCAANONE 
AK069970ATCTGGGCCAASimilar to Ran binding protein 1 homolog. 
J065138F22ATCTGGGCCAANONE 
Os03g0604600J090093K23CCAGCCCAGATGGGCTConserved hypothetical protein. 
Os03g0639700AK099587ATCTGGGCTGCSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0668300006-026-A03GCCCAGATNONE 
AK061413GCCCAGATNONE 
Os03g0681900006-042-F08ATCTGGGCCTTGNONE 
009-043-F12ATCTGGGCCTTGNONE 
AK061750ATCTGGGCCTTGNONE 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
J033034F01ATCTGGGCCTTGNONE 
J033131F11ATCTGGGCCTTGNONE 
J033143N03ATCTGGGCCTTGNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0708600AK069199ATCTGGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658ATCTGGGCNONE 
J023008E04ATCTGGGCNONE 
J023030D22ATCTGGGCNONE 
J033027E16ATCTGGGCNONE 
J033046D09ATCTGGGCNONE 
J033068I10ATCTGGGCNONE 
J033135A12ATCTGGGCNONE 
J065027E22ATCTGGGCNONE 
J065191K23ATCTGGGCNONE 
J090054D15ATCTGGGCNONE 
J090058J15ATCTGGGCNONE 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0747300006-120-B12GACGGCCCAGATNONE 
AK060347GACGGCCCAGATNONE 
AK071214GACGGCCCAGATProtein of unknown function DUF124 family protein. 
J023082F22GACGGCCCAGATNONE 
J043034I22GACGGCCCAGATNONE 
J053037D23GACGGCCCAGATNONE 
J053043C01GACGGCCCAGATNONE 
J053083D14GACGGCCCAGATNONE 
J053100J21GACGGCCCAGATNONE 
J065008H11GACGGCCCAGATNONE 
J065024G19GACGGCCCAGATNONE 
J065030G05GACGGCCCAGATNONE 
J065073N07GACGGCCCAGATNONE 
J065101N18GACGGCCCAGATNONE 
J065129O04GACGGCCCAGATNONE 
J065152M14GACGGCCCAGATNONE 
J065161L08GACGGCCCAGATNONE 
J065191G23GACGGCCCAGATNONE 
J090008A11GACGGCCCAGATNONE 
J090047J20GACGGCCCAGATNONE 
J090047J23GACGGCCCAGATNONE 
J090064C23GACGGCCCAGATNONE 
J090087H06GACGGCCCAGATNONE 
J100027M11GACGGCCCAGATNONE 
J100081M15GACGGCCCAGATNONE 
J100084C22GACGGCCCAGATNONE 
J100086C11GACGGCCCAGATNONE 
Os03g0774300AK099508ATCTGGGCNONE 
Os03g0785500AK067718GAGGCCCAGATProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCCCAGATNONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013108D19TATTGGGCCCAGATNONE 
J013124D15TATTGGGCCCAGATNONE 
J013128F17TATTGGGCCCAGATNONE 
J013146J06TATTGGGCCCAGATNONE 
J013149D12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCCCAGATNONE 
J013162N01TATTGGGCCCAGATNONE 
J013170G15TATTGGGCCCAGATNONE 
J013170H16TATTGGGCCCAGATNONE 
J023022I09TATTGGGCCCAGATNONE 
J023072B19TATTGGGCCCAGATNONE 
J023106H09TATTGGGCCCAGATNONE 
J023135C03TATTGGGCCCAGATNONE 
J023141C09TATTGGGCCCAGATNONE 
J033091K23TATTGGGCCCAGATNONE 
J033107I05TATTGGGCCCAGATNONE 
J033112M18TATTGGGCCCAGATNONE 
J033120G10TATTGGGCCCAGATNONE 
J033144G06TATTGGGCCCAGATNONE 
J043017L21TATTGGGCCCAGATNONE 
J043024O10TATTGGGCCCAGATNONE 
J053023K04TATTGGGCCCAGATNONE 
J053035D01TATTGGGCCCAGATNONE 
J053037P10TATTGGGCCCAGATNONE 
J053042K15TATTGGGCCCAGATNONE 
J053047C14TATTGGGCCCAGATNONE 
J053054A06TATTGGGCCCAGATNONE 
J053071H03TATTGGGCCCAGATNONE 
J053073G08TATTGGGCCCAGATNONE 
J053090D04TATTGGGCCCAGATNONE 
J053095E17TATTGGGCCCAGATNONE 
J090007O03TATTGGGCCCAGATNONE 
J090024G24TATTGGGCCCAGATNONE 
J090042M08TATTGGGCCCAGATNONE 
J090045I16TATTGGGCCCAGATNONE 
J090051E13TATTGGGCCCAGATNONE 
J090073B15TATTGGGCCCAGATNONE 
J090096F19TATTGGGCCCAGATNONE 
J100030M23TATTGGGCCCAGATNONE 
Os03g0823800AK058223ATCTGGGCTTGNONE 
Os03g0844800AK071813ATCTGGGCConserved hypothetical protein. 
J023114B14ATCTGGGCNONE 
Os03g0848300AK059137AGGGCCCAGATNONE 
AK102089AGGGCCCAGATSimilar to Actin-related protein 2/3 complex subunit 4 (ARP2/3 complex 20 kDa subunit) (p20-ARC). 
J033037E05AGGGCCCAGATNONE 
J033082P03AGGGCCCAGATNONE 
J065110J17AGGGCCCAGATNONE 
J075012L14AGGGCCCAGATNONE 
J075013G06AGGGCCCAGATNONE 
J075021D21AGGGCCCAGATNONE 
J075162K12AGGGCCCAGATNONE 
Os04g0350000011-080-B03ATCTGGGCCATNONE 
AK063387ATCTGGGCCATNONE 
AK121263ATCTGGGCCATNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0445200009-034-A06ATCTGGGCCACNONE 
AK062427ATCTGGGCCACProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ATCTGGGCCACNONE 
J065022E20ATCTGGGCCACNONE 
J065062D16ATCTGGGCCACNONE 
J065081I02ATCTGGGCCACNONE 
J065087C10ATCTGGGCCACNONE 
J065116N16ATCTGGGCCACNONE 
J065132F10ATCTGGGCCACNONE 
J065140F18ATCTGGGCCACNONE 
J065143M22ATCTGGGCCACNONE 
J065158K17ATCTGGGCCACNONE 
J065162D07ATCTGGGCCACNONE 
J065207H19ATCTGGGCCACNONE 
J075155B20ATCTGGGCCACNONE 
J075167E24ATCTGGGCCACNONE 
J075178B19ATCTGGGCCACNONE 
J080301D22ATCTGGGCCACNONE 
J080301J15ATCTGGGCCACNONE 
J080308J02ATCTGGGCCACNONE 
Os04g0447400AK070858ATCTGGGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09ATCTGGGCNONE 
J023003G16ATCTGGGCNONE 
J023006F16ATCTGGGCNONE 
J023008D10ATCTGGGCNONE 
J023010A01ATCTGGGCNONE 
J023012M16ATCTGGGCNONE 
J023023H17ATCTGGGCNONE 
J023029B12ATCTGGGCNONE 
J023030F09ATCTGGGCNONE 
J023034K03ATCTGGGCNONE 
J023045A16ATCTGGGCNONE 
J023048I04ATCTGGGCNONE 
J023056C09ATCTGGGCNONE 
J023056F05ATCTGGGCNONE 
J023058B21ATCTGGGCNONE 
J023058N06ATCTGGGCNONE 
J023059F03ATCTGGGCNONE 
J023059M19ATCTGGGCNONE 
J023060P05ATCTGGGCNONE 
J023062D07ATCTGGGCNONE 
J023063F16ATCTGGGCNONE 
J023068K15ATCTGGGCNONE 
J023069L04ATCTGGGCNONE 
J023075I24ATCTGGGCNONE 
J023086H01ATCTGGGCNONE 
J023086I24ATCTGGGCNONE 
J023091M08ATCTGGGCNONE 
J023095A07ATCTGGGCNONE 
J023110K06ATCTGGGCNONE 
J023113D07ATCTGGGCNONE 
J023126J05ATCTGGGCNONE 
J023140F04ATCTGGGCNONE 
J023141N19ATCTGGGCNONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0498600006-068-G08AGGGCCCAGATNONE 
006-095-H08AGGGCCCAGATNONE 
006-108-E12AGGGCCCAGATNONE 
009-194-E05AGGGCCCAGATNONE 
AK062001AGGGCCCAGATNONE 
Os04g0538400AK108230ATCTGGGCCCTSimilar to Nodulin 21 (N-21). 
J090006J20ATCTGGGCCCTNONE 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0585200AK073062ATCTGGGCNONE 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0625000J065157C10CCAGGCCCAGATNONE 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0659400AK070174ATCTGGGCTTTENT domain containing protein. 
Os04g0660600009-113-A11CAAGGCCCAGATNONE 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
J023030J05CAAGGCCCAGATNONE 
J065068M07CAAGGCCCAGATNONE 
J065120G22CAAGGCCCAGATNONE 
J065168J18CAAGGCCCAGATNONE 
J065211M10CAAGGCCCAGATNONE 
J075175E21CAAGGCCCAGATNONE 
J090021C06CAAGGCCCAGATNONE 
J090032P15CAAGGCCCAGATNONE 
J090082E05CAAGGCCCAGATNONE 
J100090O11CAAGGCCCAGATNONE 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0675300AK111982GCCCAGATNONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0125900009-168-E11TCGGCCCAGATGCCCACCTNONE 
AK063078TCGGCCCAGATGCCCACCTConserved hypothetical protein. 
AK119230TCGGCCCAGATGCCCACCTNONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0150600011-043-D06TACGGCCCAGATNONE 
AK072977TACGGCCCAGATATP-dependent DNA helicase RecQ family protein. 
AY180331TACGGCCCAGATNONE 
J090053A16TACGGCCCAGATNONE 
Os05g0317300AK064846ATGGCCCAGATFAR1 domain containing protein. 
AK122018ATGGCCCAGATNONE 
J013000G11ATGGCCCAGATNONE 
J023041M02ATGGCCCAGATNONE 
J023056G01ATGGCCCAGATNONE 
J023064M23ATGGCCCAGATNONE 
J023107F08ATGGCCCAGATNONE 
J033060K06ATGGCCCAGATNONE 
J033097H11ATGGCCCAGATNONE 
J065139C02ATGGCCCAGATNONE 
J090034K18ATGGCCCAGATNONE 
J090048K22ATGGCCCAGATNONE 
J090067G18ATGGCCCAGATNONE 
J090089F08ATGGCCCAGATNONE 
Os05g0411300014-098-D05TTGTGGGCCCAGATNONE 
015-093-F04TTGTGGGCCCAGATNONE 
AK071931TTGTGGGCCCAGATConserved hypothetical protein. 
AK073142TTGTGGGCCCAGATNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0512000AK102433GCCCAGATZinc finger, RING-type domain containing protein. 
Os05g0512500009-036-D05ATCTGGGCCTANONE 
AK062441ATCTGGGCCTACT20 family protein. 
J080003C10ATCTGGGCCTANONE 
J080046G11ATCTGGGCCTANONE 
Os05g0547850009-102-F03GAGGCCCAGATNONE 
013-076-H08GAGGCCCAGATNONE 
AK058330GAGGCCCAGATNONE 
AK122158GAGGCCCAGATDNA-binding TFAR19-related protein family protein. 
AY626826GAGGCCCAGATNONE 
J043012O19GAGGCCCAGATNONE 
J043038O15GAGGCCCAGATNONE 
J053094L06GAGGCCCAGATNONE 
Os05g0548100AK060333GCGGCCCAGATConserved hypothetical protein. 
AK100682GCGGCCCAGATNONE 
J013151E01GCGGCCCAGATNONE 
J023113L22GCGGCCCAGATNONE 
J043027A19GCGGCCCAGATNONE 
J075093E06GCGGCCCAGATNONE 
J090060D15GCGGCCCAGATNONE 
J090082J03GCGGCCCAGATNONE 
J100050E01GCGGCCCAGATNONE 
Os05g0552300AK062179GCCCAGATSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK065272GCCCAGATNONE 
AK121567GCCCAGATNONE 
J013002L07GCCCAGATNONE 
J013096F06GCCCAGATNONE 
J013111B06GCCCAGATNONE 
J023024K23GCCCAGATNONE 
J023036P19GCCCAGATNONE 
J033034A18GCCCAGATNONE 
J033034P13GCCCAGATNONE 
J033051E12GCCCAGATNONE 
J033087M05GCCCAGATNONE 
J033092G03GCCCAGATNONE 
J033098N21GCCCAGATNONE 
J033103B15GCCCAGATNONE 
J043038F23GCCCAGATNONE 
J065096K22GCCCAGATNONE 
J065167D17GCCCAGATNONE 
J100040H06GCCCAGATNONE 
J100048M06GCCCAGATNONE 
J100087G01GCCCAGATNONE 
Os05g0566800AK065748CAAGCCCAGATCold acclimation protein COR413-TM1. 
AY181210CAAGCCCAGATNONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0571400009-019-B04GTGGCCCAGATNONE 
009-043-H02GTGGCCCAGATNONE 
AK062369GTGGCCCAGATConserved hypothetical protein. 
Os05g0590000014-023-E12GCCCAGATNONE 
AK070159GCCCAGATPeptidase A1, pepsin family protein. 
AK103957GCCCAGATNONE 
J075049G06GCCCAGATNONE 
Os06g0128400AK064390AACGGGCCCAGATNONE 
AK121983AACGGGCCCAGATWD40-like domain containing protein. 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCCGACGGCCCAGATNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0246500AK105105ATCTGGGCCACSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein. 
AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17ACCGGCCCAGATNONE 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21ACCGGCCCAGATNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0656800AK109762ATCTGGGCCGTABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0667400AK065424GACGGCCCAGATConserved hypothetical protein. 
AK065580GACGGCCCAGATNONE 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0708600009-019-C12ATCTGGGCCGCNONE 
013-092-H09ATCTGGGCCGCNONE 
014-031-G05ATCTGGGCCGCNONE 
AK100915ATCTGGGCCGCConserved hypothetical protein. 
J065065F24ATCTGGGCCGCNONE 
J065208J10ATCTGGGCCGCNONE 
J100068H01ATCTGGGCCGCNONE 
J100084D18ATCTGGGCCGCNONE 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0101500AK059667ATCTGGGCCCCACNONE 
AK071749ATCTGGGCCCCACSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07ATCTGGGCCCCACNONE 
J065050F03ATCTGGGCCCCACNONE 
J090015C05ATCTGGGCCCCACNONE 
J090045C11ATCTGGGCCCCACNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0410300AK108503ATCTGGGCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0479200005-017-H08ATCTGGGCTTTNONE 
AK058326ATCTGGGCTTTSimilar to SL15-like (Fragment). 
J013092A08ATCTGGGCTTTNONE 
J033139E04ATCTGGGCTTTNONE 
J043016M16ATCTGGGCTTTNONE 
J053050O18ATCTGGGCTTTNONE 
J053098B03ATCTGGGCTTTNONE 
J065068G10ATCTGGGCTTTNONE 
J065091I17ATCTGGGCTTTNONE 
J065109A03ATCTGGGCTTTNONE 
J065168B17ATCTGGGCTTTNONE 
J065177A05ATCTGGGCTTTNONE 
J065180J01ATCTGGGCTTTNONE 
J075006F13ATCTGGGCTTTNONE 
J075022J03ATCTGGGCTTTNONE 
J075024N09ATCTGGGCTTTNONE 
J075114B12ATCTGGGCTTTNONE 
J080023M06ATCTGGGCTTTNONE 
J080081N24ATCTGGGCTTTNONE 
J090060N07ATCTGGGCTTTNONE 
Os07g0516900009-108-C10GCGGCCCAGATNONE 
AK062798GCGGCCCAGATNONE 
Os07g0546000AF188065ATGGCCCAGATNONE 
AK061800ATGGCCCAGATNONE 
AK065871ATGGCCCAGATSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02ATGGCCCAGATNONE 
J013035F03ATGGCCCAGATNONE 
J013044J20ATGGCCCAGATNONE 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0573600AK073925ATCTGGGCCTAREX1 DNA Repair family protein. 
J033072E11ATCTGGGCCTANONE 
Os07g0585800006-106-A05GCCGGCCCAGATNONE 
AK066419GCCGGCCCAGATNONE 
AK105064GCCGGCCCAGATSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GCCGGCCCAGATNONE 
J065085B08GCCGGCCCAGATNONE 
J065099I23GCCGGCCCAGATNONE 
J065169A01GCCGGCCCAGATNONE 
J065187N13GCCGGCCCAGATNONE 
J065191L18GCCGGCCCAGATNONE 
J065194D04GCCGGCCCAGATNONE 
J065211M09GCCGGCCCAGATNONE 
J065212I02GCCGGCCCAGATNONE 
J090003C10GCCGGCCCAGATNONE 
J090025O11GCCGGCCCAGATNONE 
J090092F10GCCGGCCCAGATNONE 
J100055A04GCCGGCCCAGATNONE 
J100064A01GCCGGCCCAGATNONE 
J100080L02GCCGGCCCAGATNONE 
Os07g0639800AK074012ATCTGGGCCTCSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592ATCTGGGCCTCNONE 
AK104739ATCTGGGCCTCNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os08g0162500AK121633ATCTGGGCCTGGConserved hypothetical protein. 
J033105E19ATCTGGGCCTGGNONE 
J080012K11ATCTGGGCCTGGNONE 
J080041I12ATCTGGGCCTGGNONE 
J080049G05ATCTGGGCCTGGNONE 
J080050P09ATCTGGGCCTGGNONE 
J080051A10ATCTGGGCCTGGNONE 
J080054G05ATCTGGGCCTGGNONE 
J080058M08ATCTGGGCCTGGNONE 
J080064N23ATCTGGGCCTGGNONE 
J080072L15ATCTGGGCCTGGNONE 
J080096H09ATCTGGGCCTGGNONE 
J100079I08ATCTGGGCCTGGNONE 
Os08g0175200AK072367TACGGCCCAGATProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16TACGGCCCAGATNONE 
J023075K04TACGGCCCAGATNONE 
J023082L15TACGGCCCAGATNONE 
J043015G07TACGGCCCAGATNONE 
J065052L17TACGGCCCAGATNONE 
J065202P07TACGGCCCAGATNONE 
J075061D17TACGGCCCAGATNONE 
J100088P13TACGGCCCAGATNONE 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0267900AK107040GCCCAGATConserved hypothetical protein. 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0435800AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0547000AK120698CCACGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK120698GCGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0281800AK105291GGACGGCCCAGATConserved hypothetical protein. 
Os09g0308900AK062084TCCACGCCCAGATNONE 
J013060K03TCCACGCCCAGATNONE 
J013064G04TCCACGCCCAGATNONE 
J013152G07TCCACGCCCAGATNONE 
J013159G16TCCACGCCCAGATNONE 
J033107G06TCCACGCCCAGATNONE 
J033114C08TCCACGCCCAGATNONE 
J043022I05TCCACGCCCAGATNONE 
J100029J12TCCACGCCCAGATNONE 
J100030N08TCCACGCCCAGATNONE 
J100063H20TCCACGCCCAGATNONE 
J100076I02TCCACGCCCAGATNONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
Os09g0480600AK107853ATCTGGGCCGTCCHypothetical protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0516300AK065222ATCTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0565200004-007-A08TACGGCCCAGATNONE 
006-045-E10TACGGCCCAGATNONE 
006-051-A01TACGGCCCAGATNONE 
006-079-G03TACGGCCCAGATNONE 
006-097-C05TACGGCCCAGATNONE 
006-097-E11TACGGCCCAGATNONE 
006-111-E07TACGGCCCAGATNONE 
AK069121TACGGCCCAGATSimilar to Nucleic acid-binding protein precursor. 
AK104354TACGGCCCAGATNONE 
J013090J23TACGGCCCAGATNONE 
J013093C19TACGGCCCAGATNONE 
J023007A14TACGGCCCAGATNONE 
J023099J21TACGGCCCAGATNONE 
J065023L09TACGGCCCAGATNONE 
J075060J06TACGGCCCAGATNONE 
J075092C03TACGGCCCAGATNONE 
Os09g0567700AK065913ATCTGGGCCGCWD40-like domain containing protein. 
Os11g0148600AK100066CAGGCCCAGATConserved hypothetical protein. 
AK102442CAGGCCCAGATNONE 
J065167F17CAGGCCCAGATNONE 
Os11g0153600AK065028CAAGCCCAGATGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13CAAGCCCAGATNONE 
Os11g0482400AK062180GCCCAGATNONE 
Os11g0660500009-031-D10ATCTGGGCCGTCCNONE 
009-031-D10GCGGCCCAGATNONE 
009-100-G09ATCTGGGCCGTCCNONE 
009-100-G09GCGGCCCAGATNONE 
009-162-G10ATCTGGGCCGTCCNONE 
009-162-G10GCGGCCCAGATNONE 
009-183-H11ATCTGGGCCGTCCNONE 
009-183-H11GCGGCCCAGATNONE 
013-010-B11ATCTGGGCCGTCCNONE 
013-010-B11GCGGCCCAGATNONE 
013-050-A05ATCTGGGCCGTCCNONE 
013-050-A05GCGGCCCAGATNONE 
013-070-E10ATCTGGGCCGTCCNONE 
013-070-E10GCGGCCCAGATNONE 
AK105453ATCTGGGCCGTCCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GCGGCCCAGATSimilar to Translationally controlled tumor protein (Fragment). 
D12626ATCTGGGCCGTCCNONE 
D12626GCGGCCCAGATNONE 
J013128M15ATCTGGGCCGTCCNONE 
J013128M15GCGGCCCAGATNONE 
J023004I19ATCTGGGCCGTCCNONE 
J023004I19GCGGCCCAGATNONE 
J033114F08ATCTGGGCCGTCCNONE 
J033114F08GCGGCCCAGATNONE 
J033147I20ATCTGGGCCGTCCNONE 
J033147I20GCGGCCCAGATNONE 
J065031M04ATCTGGGCCGTCCNONE 
J065031M04GCGGCCCAGATNONE 
J065033J03ATCTGGGCCGTCCNONE 
J065033J03GCGGCCCAGATNONE 
J065038E01ATCTGGGCCGTCCNONE 
J065038E01GCGGCCCAGATNONE 
J065048O06ATCTGGGCCGTCCNONE 
J065048O06GCGGCCCAGATNONE 
J065054E01ATCTGGGCCGTCCNONE 
J065054E01GCGGCCCAGATNONE 
J065075N08ATCTGGGCCGTCCNONE 
J065075N08GCGGCCCAGATNONE 
J065080C07ATCTGGGCCGTCCNONE 
J065080C07GCGGCCCAGATNONE 
J065096A12ATCTGGGCCGTCCNONE 
J065096A12GCGGCCCAGATNONE 
J065115P22ATCTGGGCCGTCCNONE 
J065115P22GCGGCCCAGATNONE 
J065122I21ATCTGGGCCGTCCNONE 
J065122I21GCGGCCCAGATNONE 
J065127A13ATCTGGGCCGTCCNONE 
J065127A13GCGGCCCAGATNONE 
J065158B06ATCTGGGCCGTCCNONE 
J065158B06GCGGCCCAGATNONE 
J065162E04ATCTGGGCCGTCCNONE 
J065162E04GCGGCCCAGATNONE 
J065162E05ATCTGGGCCGTCCNONE 
J065162E05GCGGCCCAGATNONE 
J065163L06ATCTGGGCCGTCCNONE 
J065163L06GCGGCCCAGATNONE 
J065177B16ATCTGGGCCGTCCNONE 
J065177B16GCGGCCCAGATNONE 
J065181M15ATCTGGGCCGTCCNONE 
J065181M15GCGGCCCAGATNONE 
J065201G15ATCTGGGCCGTCCNONE 
J065201G15GCGGCCCAGATNONE 
J065202J06ATCTGGGCCGTCCNONE 
J065202J06GCGGCCCAGATNONE 
J075002B19ATCTGGGCCGTCCNONE 
J075002B19GCGGCCCAGATNONE 
J075008G19ATCTGGGCCGTCCNONE 
J075008G19GCGGCCCAGATNONE 
J075010P05ATCTGGGCCGTCCNONE 
J075010P05GCGGCCCAGATNONE 
J075018H23ATCTGGGCCGTCCNONE 
J075018H23GCGGCCCAGATNONE 
J075051E18ATCTGGGCCGTCCNONE 
J075051E18GCGGCCCAGATNONE 
J075053C24ATCTGGGCCGTCCNONE 
J075053C24GCGGCCCAGATNONE 
J075077B06ATCTGGGCCGTCCNONE 
J075077B06GCGGCCCAGATNONE 
J075080B11ATCTGGGCCGTCCNONE 
J075080B11GCGGCCCAGATNONE 
J075083M04ATCTGGGCCGTCCNONE 
J075083M04GCGGCCCAGATNONE 
J075085H01ATCTGGGCCGTCCNONE 
J075085H01GCGGCCCAGATNONE 
J075109E11ATCTGGGCCGTCCNONE 
J075109E11GCGGCCCAGATNONE 
J075111O09ATCTGGGCCGTCCNONE 
J075111O09GCGGCCCAGATNONE 
J075130D13ATCTGGGCCGTCCNONE 
J075130D13GCGGCCCAGATNONE 
J075132H13ATCTGGGCCGTCCNONE 
J075132H13GCGGCCCAGATNONE 
J075147H19ATCTGGGCCGTCCNONE 
J075147H19GCGGCCCAGATNONE 
J075148J01ATCTGGGCCGTCCNONE 
J075148J01GCGGCCCAGATNONE 
J075159A18ATCTGGGCCGTCCNONE 
J075159A18GCGGCCCAGATNONE 
J075166F03ATCTGGGCCGTCCNONE 
J075166F03GCGGCCCAGATNONE 
J075191F09ATCTGGGCCGTCCNONE 
J075191F09GCGGCCCAGATNONE 
J075192K09ATCTGGGCCGTCCNONE 
J075192K09GCGGCCCAGATNONE 
J080006P15ATCTGGGCCGTCCNONE 
J080006P15GCGGCCCAGATNONE 
J080013J18ATCTGGGCCGTCCNONE 
J080013J18GCGGCCCAGATNONE 
J080023O06ATCTGGGCCGTCCNONE 
J080023O06GCGGCCCAGATNONE 
J080024I17ATCTGGGCCGTCCNONE 
J080024I17GCGGCCCAGATNONE 
J080029P03ATCTGGGCCGTCCNONE 
J080029P03GCGGCCCAGATNONE 
J080030C14ATCTGGGCCGTCCNONE 
J080030C14GCGGCCCAGATNONE 
J080038K15ATCTGGGCCGTCCNONE 
J080038K15GCGGCCCAGATNONE 
J080042I15ATCTGGGCCGTCCNONE 
J080042I15GCGGCCCAGATNONE 
J080053L07ATCTGGGCCGTCCNONE 
J080053L07GCGGCCCAGATNONE 
J080061H12ATCTGGGCCGTCCNONE 
J080061H12GCGGCCCAGATNONE 
J080064H24ATCTGGGCCGTCCNONE 
J080064H24GCGGCCCAGATNONE 
J080066J20ATCTGGGCCGTCCNONE 
J080066J20GCGGCCCAGATNONE 
J080074N07ATCTGGGCCGTCCNONE 
J080074N07GCGGCCCAGATNONE 
J080079F16ATCTGGGCCGTCCNONE 
J080079F16GCGGCCCAGATNONE 
J080079O07ATCTGGGCCGTCCNONE 
J080079O07GCGGCCCAGATNONE 
J080092E15ATCTGGGCCGTCCNONE 
J080092E15GCGGCCCAGATNONE 
J080301F19ATCTGGGCCGTCCNONE 
J080301F19GCGGCCCAGATNONE 
J080302O21ATCTGGGCCGTCCNONE 
J080302O21GCGGCCCAGATNONE 
J080306L02ATCTGGGCCGTCCNONE 
J080306L02GCGGCCCAGATNONE 
J080307F16ATCTGGGCCGTCCNONE 
J080307F16GCGGCCCAGATNONE 
J080307G01ATCTGGGCCGTCCNONE 
J080307G01GCGGCCCAGATNONE 
J080307K01ATCTGGGCCGTCCNONE 
J080307K01GCGGCCCAGATNONE 
J080309O22ATCTGGGCCGTCCNONE 
J080309O22GCGGCCCAGATNONE 
J080311E17ATCTGGGCCGTCCNONE 
J080311E17GCGGCCCAGATNONE 
J080311N08ATCTGGGCCGTCCNONE 
J080311N08GCGGCCCAGATNONE 
J080312O12ATCTGGGCCGTCCNONE 
J080312O12GCGGCCCAGATNONE 
J080315C08ATCTGGGCCGTCCNONE 
J080315C08GCGGCCCAGATNONE 
J080316D07ATCTGGGCCGTCCNONE 
J080316D07GCGGCCCAGATNONE 
J080318C17ATCTGGGCCGTCCNONE 
J080318C17GCGGCCCAGATNONE 
J090004B08ATCTGGGCCGTCCNONE 
J090004B08GCGGCCCAGATNONE 
J090009K02ATCTGGGCCGTCCNONE 
J090009K02GCGGCCCAGATNONE 
J090025O15ATCTGGGCCGTCCNONE 
J090025O15GCGGCCCAGATNONE 
J090026L03ATCTGGGCCGTCCNONE 
J090026L03GCGGCCCAGATNONE 
J090036P17ATCTGGGCCGTCCNONE 
J090036P17GCGGCCCAGATNONE 
J090047A21ATCTGGGCCGTCCNONE 
J090047A21GCGGCCCAGATNONE 
J090053O03ATCTGGGCCGTCCNONE 
J090053O03GCGGCCCAGATNONE 
J090059C04ATCTGGGCCGTCCNONE 
J090059C04GCGGCCCAGATNONE 
J090062O21ATCTGGGCCGTCCNONE 
J090062O21GCGGCCCAGATNONE 
J090064M11ATCTGGGCCGTCCNONE 
J090064M11GCGGCCCAGATNONE 
J090070C14ATCTGGGCCGTCCNONE 
J090070C14GCGGCCCAGATNONE 
J090075I03ATCTGGGCCGTCCNONE 
J090075I03GCGGCCCAGATNONE 
J090081G22ATCTGGGCCGTCCNONE 
J090081G22GCGGCCCAGATNONE 
J090083E18ATCTGGGCCGTCCNONE 
J090083E18GCGGCCCAGATNONE 
J090084A05ATCTGGGCCGTCCNONE 
J090084A05GCGGCCCAGATNONE 
J100019L11ATCTGGGCCGTCCNONE 
J100019L11GCGGCCCAGATNONE 
J100022D16ATCTGGGCCGTCCNONE 
J100022D16GCGGCCCAGATNONE 
J100042F09ATCTGGGCCGTCCNONE 
J100042F09GCGGCCCAGATNONE 
J100051J12ATCTGGGCCGTCCNONE 
J100051J12GCGGCCCAGATNONE 
J100065G21ATCTGGGCCGTCCNONE 
J100065G21GCGGCCCAGATNONE 
J100066D08ATCTGGGCCGTCCNONE 
J100066D08GCGGCCCAGATNONE 
J100069H04ATCTGGGCCGTCCNONE 
J100069H04GCGGCCCAGATNONE 
J100078I16ATCTGGGCCGTCCNONE 
J100078I16GCGGCCCAGATNONE 
J100090D15ATCTGGGCCGTCCNONE 
J100090D15GCGGCCCAGATNONE 
Os12g0194700AK121912AACGGCCCAGATDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein. 
J033106A07AACGGCCCAGATNONE 
Os12g0194800011-016-B07ATCTGGGCCGTTNONE 
AK101810ATCTGGGCCGTTtRNA pseudouridine synthase family protein. 
AK107780ATCTGGGCCGTTNONE 
J043034C07ATCTGGGCCGTTNONE 
Os12g0502100Os12g0502100GCCGTTGGATCTGGGCConserved hypothetical protein. 
Os12g0516300AK065092ATCTGGGCCAGNONE 
J013001M05ATCTGGGCCAGNONE 
Os12g0517100012-071-A03CAAGCCCAGATNONE 
AK073020CAAGCCCAGATCyclin-like F-box domain containing protein. 
J023149K21CAAGCCCAGATNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.