version

Summary of OsREG487 (All List)

OrganismOryza sativa  
IDOsREG487  
SequenceATGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1617  

Entry Sequences (1617 entries)

LocusGene modelSequenceDescription
Os01g0134800011-091-C12ATGGCCCACANONE 
AK063402ATGGCCCACASimilar to (1,4)-beta-xylan endohydrolase, isoenzyme X-II (EC 3.2.1.8) (Fragment). 
Os01g0160200AK073444ATGGCCCATGNONE 
AK102533ATGGCCCATGLeucine rich repeat, N-terminal domain containing protein. 
J033044L19ATGGCCCATGNONE 
J033096F04ATGGCCCATGNONE 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0222700012-011-E01ATGGCCCATTTNONE 
AK068883ATGGCCCATTTNONE 
AK101946ATGGCCCATTTZinc finger, BED-type predicted domain containing protein. 
J033075C16ATGGCCCATTTNONE 
J043013D08ATGGCCCATTTNONE 
J065089G19ATGGCCCATTTNONE 
J065197K19ATGGCCCATTTNONE 
J075161L21ATGGCCCATTTNONE 
Os01g0231700012-002-F11ATGGCCCATANONE 
013-082-F05ATGGCCCATANONE 
AK107453ATGGCCCATASimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATGGCCCATANONE 
J065023E21ATGGCCCATANONE 
J065036H21ATGGCCCATANONE 
J065037M24ATGGCCCATANONE 
J065049L04ATGGCCCATANONE 
J065072F17ATGGCCCATANONE 
J065085H10ATGGCCCATANONE 
J065109N19ATGGCCCATANONE 
J065117M19ATGGCCCATANONE 
J065144C15ATGGCCCATANONE 
J065159G24ATGGCCCATANONE 
J065164N14ATGGCCCATANONE 
J075025K16ATGGCCCATANONE 
J075057L05ATGGCCCATANONE 
J075070I16ATGGCCCATANONE 
J075089D10ATGGCCCATANONE 
J075138F10ATGGCCCATANONE 
J090018C11ATGGCCCATANONE 
J100018L19ATGGCCCATANONE 
J100024B14ATGGCCCATANONE 
J100048L02ATGGCCCATANONE 
J100055A22ATGGCCCATANONE 
J100069K01ATGGCCCATANONE 
Os01g0270100006-096-H09ATGGCCCAATANONE 
009-009-C10ATGGCCCAATANONE 
009-054-E06ATGGCCCAATANONE 
014-085-F09ATGGCCCAATANONE 
AK073275ATGGCCCAATANONE 
AK104155ATGGCCCAATANONE 
AK119511ATGGCCCAATASimilar to Cysteine protease inhibitor. 
J033025K21ATGGCCCAATANONE 
J075065H10ATGGCCCAATANONE 
J075143G10ATGGCCCAATANONE 
J100059J02ATGGCCCAATANONE 
Os01g0286600AB057749GGTGGGCCATSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0301100AK105556ATGGCCCAATConserved hypothetical protein. 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0392600J065002C11ATGGCCCACAANONE 
J065101G17ATGGCCCACAANONE 
J065104H18ATGGCCCACAANONE 
J100041A03ATGGCCCACAANONE 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK109776ATGGCCCACCACNONE 
J080037E03ATGGCCCACCACNONE 
J080041H13ATGGCCCACCACNONE 
J080046B15ATGGCCCACCACNONE 
J080058K14ATGGCCCACCACNONE 
J080065E14ATGGCCCACCACNONE 
J080079C08ATGGCCCACCACNONE 
J080088J12ATGGCCCACCACNONE 
J080088M19ATGGCCCACCACNONE 
J100043G11ATGGCCCACCACNONE 
J100059M22ATGGCCCACCACNONE 
Os01g0707300AK059962ATTTGGGCCATNONE 
AK104463ATTTGGGCCATSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0748100AK071261AATTGGGCCATHypothetical protein. 
J023084C08AATTGGGCCATNONE 
J065058A07AATTGGGCCATNONE 
Os01g0756400J065065A17ATGGCCCATTTNONE 
J075076N03ATGGCCCATTTNONE 
J075120O13ATGGCCCATTTNONE 
J075177C24ATGGCCCATTTNONE 
J080010J02ATGGCCCATTTNONE 
J080018F20ATGGCCCATTTNONE 
J080034I03ATGGCCCATTTNONE 
J080043P21ATGGCCCATTTNONE 
J080068B17ATGGCCCATTTNONE 
J080070F19ATGGCCCATTTNONE 
J080076D05ATGGCCCATTTNONE 
J080077E01ATGGCCCATTTNONE 
J080096C10ATGGCCCATTTNONE 
J080301B21ATGGCCCATTTNONE 
J080304K22ATGGCCCATTTNONE 
Os01g0764300J090053G03AGCCCAATGGGCCATProtein of unknown function DUF155 family protein. 
Os01g0765600AK108944TGATGGGCCATEF-Hand type domain containing protein. 
Os01g0767700AK122168ATGGCCCACACGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0800300006-097-C12ATGGCCCAACCNONE 
014-070-C12ATGGCCCAACCNONE 
AK072549ATGGCCCAACCNONE 
AK100942ATGGCCCAACCNONE 
AK100951ATGGCCCAACCConserved hypothetical protein. 
AK106023ATGGCCCAACCNONE 
J023138D05ATGGCCCAACCNONE 
J075097P16ATGGCCCAACCNONE 
J075099F23ATGGCCCAACCNONE 
Os01g0801000AK064082AGATGGGCCATNONE 
AK101426AGATGGGCCATSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
Os01g0825500AK060613CTTGGGCCATNONE 
AK072321CTTGGGCCATNONE 
AK103941CTTGGGCCATNodulin-like domain containing protein. 
J075053A14CTTGGGCCATNONE 
J075151J22CTTGGGCCATNONE 
J075174K14CTTGGGCCATNONE 
Os01g0863300014-030-D08ATGGCCCATGGNONE 
AK111571ATGGCCCATGGSimilar to MCB2 protein. 
J013071A13ATGGCCCATGGNONE 
J075060E09ATGGCCCATGGNONE 
J075138C14ATGGCCCATGGNONE 
J075150M17ATGGCCCATGGNONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0911100AK062123ATGGCCCAATTNONE 
J013000B12ATGGCCCAATTNONE 
J013071L21ATGGCCCAATTNONE 
J013072J22ATGGCCCAATTNONE 
J065152F12ATGGCCCAATTNONE 
J065191K04ATGGCCCAATTNONE 
J100034F15ATGGCCCAATTNONE 
J100035A02ATGGCCCAATTNONE 
J100040O20ATGGCCCAATTNONE 
J100045D02ATGGCCCAATTNONE 
J100070A17ATGGCCCAATTNONE 
J100089B06ATGGCCCAATTNONE 
Os01g0916700Os01g0916700ATTGGGCCATTGGGCCACConserved hypothetical protein. 
Os01g0949700AK069037ATGGCCCAAGNONE 
J023004F17ATGGCCCAAGNONE 
J065063D04ATGGCCCAAGNONE 
J065196H02ATGGCCCAAGNONE 
J075198A05ATGGCCCAAGNONE 
Os01g0954000009-097-H04CTTGGGCCATNONE 
AK062729CTTGGGCCATNADPH-dependent FMN reductase family protein. 
Os02g0110200009-041-B07ATGGCCCACGTNONE 
AK100012ATGGCCCACGTNONE 
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase. 
Os02g0158400006-048-F06ATGGCCCACTNONE 
AK061569ATGGCCCACTssDNA-binding transcriptional regulator family protein. 
AK099479ATGGCCCACTNONE 
AK104768ATGGCCCACTNONE 
J013025B22ATGGCCCACTNONE 
J023009C03ATGGCCCACTNONE 
J033115N14ATGGCCCACTNONE 
J065036F05ATGGCCCACTNONE 
J065191K17ATGGCCCACTNONE 
J065202K16ATGGCCCACTNONE 
J075053E14ATGGCCCACTNONE 
J075101E04ATGGCCCACTNONE 
J075111C06ATGGCCCACTNONE 
J075137O04ATGGCCCACTNONE 
J075139E07ATGGCCCACTNONE 
J075143K07ATGGCCCACTNONE 
J075144K15ATGGCCCACTNONE 
J075164L14ATGGCCCACTNONE 
J075199D06ATGGCCCACTNONE 
J090010G24ATGGCCCACTNONE 
J090017C18ATGGCCCACTNONE 
J090066F01ATGGCCCACTNONE 
J090088G01ATGGCCCACTNONE 
Os02g0186700AK064492ATGGCCCACGCConserved hypothetical protein. 
J065210K09ATGGCCCACGCNONE 
J075006A17ATGGCCCACGCNONE 
J075108C18ATGGCCCACGCNONE 
J075153E08ATGGCCCACGCNONE 
Os02g0235600009-009-H04ATTGGGCCATNONE 
009-165-G06ATTGGGCCATNONE 
AK120417ATTGGGCCATSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTGGGCCATNONE 
J023106P11ATTGGGCCATNONE 
J033080L09ATTGGGCCATNONE 
J033123O05ATTGGGCCATNONE 
J065197A18ATTGGGCCATNONE 
J065216P16ATTGGGCCATNONE 
J075017F02ATTGGGCCATNONE 
J075025L16ATTGGGCCATNONE 
J075027P04ATTGGGCCATNONE 
J075039N01ATTGGGCCATNONE 
J075101F24ATTGGGCCATNONE 
J075132J15ATTGGGCCATNONE 
J075164K16ATTGGGCCATNONE 
J075174E19ATTGGGCCATNONE 
J100043C23ATTGGGCCATNONE 
J100067B11ATTGGGCCATNONE 
Os02g0274000006-082-B11TCATGGGCCATNONE 
009-149-B01TCATGGGCCATNONE 
013-005-D02TCATGGGCCATNONE 
AK061802TCATGGGCCATNONE 
AK099750TCATGGGCCATConserved hypothetical protein. 
J013092A18TCATGGGCCATNONE 
J065205D02TCATGGGCCATNONE 
J080305A06TCATGGGCCATNONE 
J080306D13TCATGGGCCATNONE 
J090043E14TCATGGGCCATNONE 
J100023E14TCATGGGCCATNONE 
J100041A16TCATGGGCCATNONE 
J100078K21TCATGGGCCATNONE 
Os02g0498100009-180-H04ATGGCCCATCGNONE 
AK112058ATGGCCCATCGConserved hypothetical protein. 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0655700AK101068AATTGGGCCATAmino acid/polyamine transporter I family protein. 
J013026C06AATTGGGCCATNONE 
J033023I17AATTGGGCCATNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0681100AK100584GTTTGGGCCATProtein of unknown function DUF604 family protein. 
J023106A15GTTTGGGCCATNONE 
Os02g0688900AK066093ATTTGGGCCATGPI transamidase subunit PIG-U family protein. 
J065007D18ATTTGGGCCATNONE 
J065040G21ATTTGGGCCATNONE 
J065103G03ATTTGGGCCATNONE 
J065175F18ATTTGGGCCATNONE 
J065202A07ATTTGGGCCATNONE 
J075006C01ATTTGGGCCATNONE 
J075178F24ATTTGGGCCATNONE 
Os02g0689200011-024-D04ATGGCCCATAANONE 
AK071254ATGGCCCATAANONE 
AK072660ATGGCCCATAAProtein of unknown function DUF250 domain containing protein. 
J023087G23ATGGCCCATAANONE 
J023134O11ATGGCCCATAANONE 
J033095E21ATGGCCCATAANONE 
J033113F12ATGGCCCATAANONE 
J033124F02ATGGCCCATAANONE 
J065070A01ATGGCCCATAANONE 
J065129C05ATGGCCCATAANONE 
J065165M19ATGGCCCATAANONE 
J090015K07ATGGCCCATAANONE 
J090066D21ATGGCCCATAANONE 
J090075M20ATGGCCCATAANONE 
Os02g0732900AK065796TTTTGGGCCATProtein of unknown function DUF794, plant family protein. 
AK104342TTTTGGGCCATNONE 
Os02g0744700AF395537ATGGCCCACCCNONE 
AJ308110ATGGCCCACCCNONE 
AK066446ATGGCCCACCCSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0753300012-010-H04ATGGCCCATGGNONE 
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein. 
AK104930ATGGCCCATGGNONE 
J013038J04ATGGCCCATGGNONE 
J065041B21ATGGCCCATGGNONE 
J065162K13ATGGCCCATGGNONE 
J065187G18ATGGCCCATGGNONE 
J075051J11ATGGCCCATGGNONE 
J100027H02ATGGCCCATGGNONE 
Os02g0755200AK070699AGTTGGGCCATSimilar to FLOWERING LOCUS D (Fragment). 
J023056I20AGTTGGGCCATNONE 
J065048B13AGTTGGGCCATNONE 
J065128H21AGTTGGGCCATNONE 
J065201E09AGTTGGGCCATNONE 
Os02g0755900011-077-A03AGGTGGGCCATNONE 
015-066-D06AGGTGGGCCATNONE 
AK073587AGGTGGGCCATNONE 
AK104985AGGTGGGCCATSimilar to Glucosyltransferase (Fragment). 
J033052B15AGGTGGGCCATNONE 
Os02g0769700AK111328CATGGGCCATProtein kinase-like domain containing protein. 
Os02g0815200AK067252ATGGCCCATASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489ATGGCCCATANONE 
Os02g0815300AK061607TGTTGGGCCATConserved hypothetical protein. 
J075088I01TGTTGGGCCATNONE 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
U46758ATGGCCCACCTGTCNONE 
Os02g0820600AK066549TATGGGCTATGGGCCATConserved hypothetical protein. 
J013070F02TATGGGCTATGGGCCATNONE 
Os02g0820700006-025-E04ATGGCCCATAGCCCATANONE 
006-052-F06ATGGCCCATAGCCCATANONE 
006-082-A05ATGGCCCATAGCCCATANONE 
006-089-B06ATGGCCCATAGCCCATANONE 
AK060869ATGGCCCATAGCCCATASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365ATGGCCCATAGCCCATANONE 
AK103008ATGGCCCATAGCCCATANONE 
AK104724ATGGCCCATAGCCCATANONE 
J013049H21ATGGCCCATAGCCCATANONE 
J043027N22ATGGCCCATAGCCCATANONE 
J075031I15ATGGCCCATAGCCCATANONE 
J075132D23ATGGCCCATAGCCCATANONE 
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein. 
Os02g0830100AK059746TGATGGGCCATNONE 
Os02g0831800009-150-D09GTTGGTGGGCCATNONE 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03GTTGGTGGGCCATNONE 
J100077H12GTTGGTGGGCCATNONE 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0123300003-131-G09ATGGCCCAAACNONE 
AK058595ATGGCCCAAACNONE 
AK070642ATGGCCCAAACSimilar to Cell cycle switch protein. 
J075056B01ATGGCCCAAACNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0138600Os03g0138600AGATGGGCCATProtein of unknown function DUF810 family protein. 
Os03g0162200009-031-E05ATGGCCCAGTNONE 
013-049-D04ATGGCCCAGTNONE 
013-082-E03ATGGCCCAGTNONE 
014-039-G04ATGGCCCAGTNONE 
014-098-G11ATGGCCCAGTNONE 
AK061605ATGGCCCAGTNONE 
AK121533ATGGCCCAGTSimilar to Histone H2A. 
J033024D06ATGGCCCAGTNONE 
J033030P21ATGGCCCAGTNONE 
J065063C20ATGGCCCAGTNONE 
J065064A18ATGGCCCAGTNONE 
J065147G02ATGGCCCAGTNONE 
J065204K06ATGGCCCAGTNONE 
J090004C22ATGGCCCAGTNONE 
J090014K02ATGGCCCAGTNONE 
J090074E10ATGGCCCAGTNONE 
J090086L09ATGGCCCAGTNONE 
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein. 
Os03g0197400AK071413CCTGGGCCATSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905CCTGGGCCATNONE 
J053023D18CCTGGGCCATNONE 
Os03g0261500AK061995TTTGGGCCATNONE 
J013044K20TTTGGGCCATNONE 
J033113A11TTTGGGCCATNONE 
J100032O18TTTGGGCCATNONE 
J100037K21TTTGGGCCATNONE 
Os03g0266300006-027-H06ATGGCCCACANONE 
013-051-G08ATGGCCCACANONE 
014-002-C05ATGGCCCACANONE 
014-002-H02ATGGCCCACANONE 
014-005-A09ATGGCCCACANONE 
014-008-D02ATGGCCCACANONE 
014-008-G06ATGGCCCACANONE 
014-009-C12ATGGCCCACANONE 
014-010-A07ATGGCCCACANONE 
014-012-H03ATGGCCCACANONE 
014-013-E03ATGGCCCACANONE 
014-014-D03ATGGCCCACANONE 
014-028-C09ATGGCCCACANONE 
014-037-G05ATGGCCCACANONE 
014-038-E04ATGGCCCACANONE 
014-041-F08ATGGCCCACANONE 
014-049-E11ATGGCCCACANONE 
014-050-A05ATGGCCCACANONE 
014-053-F10ATGGCCCACANONE 
014-054-C04ATGGCCCACANONE 
014-056-A01ATGGCCCACANONE 
014-060-A08ATGGCCCACANONE 
014-072-C09ATGGCCCACANONE 
014-072-D02ATGGCCCACANONE 
014-077-G08ATGGCCCACANONE 
014-080-C10ATGGCCCACANONE 
014-098-E01ATGGCCCACANONE 
014-100-C02ATGGCCCACANONE 
014-100-E03ATGGCCCACANONE 
014-100-E10ATGGCCCACANONE 
015-061-D06ATGGCCCACANONE 
016-033-H10ATGGCCCACANONE 
AB110191ATGGCCCACANONE 
AF467729ATGGCCCACANONE 
AK073671ATGGCCCACANONE 
AK104129ATGGCCCACAClass I low-molecular-weight heat shock protein 17.9. 
AK119239ATGGCCCACANONE 
AK119616ATGGCCCACANONE 
AK119664ATGGCCCACANONE 
AK119675ATGGCCCACANONE 
D21285ATGGCCCACANONE 
J033051H23ATGGCCCACANONE 
J065036L24ATGGCCCACANONE 
J065045J20ATGGCCCACANONE 
J065104C03ATGGCCCACANONE 
J065109J20ATGGCCCACANONE 
J065116F24ATGGCCCACANONE 
J065146F06ATGGCCCACANONE 
J065146P18ATGGCCCACANONE 
J065167A09ATGGCCCACANONE 
J065183K12ATGGCCCACANONE 
J075019J15ATGGCCCACANONE 
J075112F10ATGGCCCACANONE 
J075150H04ATGGCCCACANONE 
J075159N20ATGGCCCACANONE 
J075164P19ATGGCCCACANONE 
J075185O05ATGGCCCACANONE 
J100030A19ATGGCCCACANONE 
J100044E07ATGGCCCACANONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
AK070169ATGGCCCATCTConserved hypothetical protein. 
Os03g0284000Os03g0284000CCTGGGCCATConserved hypothetical protein. 
Os03g0324800AK059868ACATGGGCCATNONE 
AK071431ACATGGGCCATHypothetical protein. 
Os03g0340500012-007-F10CACGTGGGCCATNONE 
AK099406CACGTGGGCCATNONE 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CACGTGGGCCATNONE 
J013063E02CACGTGGGCCATNONE 
J013063I02CACGTGGGCCATNONE 
J013157O07CACGTGGGCCATNONE 
J023131N05CACGTGGGCCATNONE 
J033033P05CACGTGGGCCATNONE 
J033040N16CACGTGGGCCATNONE 
J033044M19CACGTGGGCCATNONE 
J033086F24CACGTGGGCCATNONE 
J033097H01CACGTGGGCCATNONE 
J033106C22CACGTGGGCCATNONE 
J033128M13CACGTGGGCCATNONE 
J033133I15CACGTGGGCCATNONE 
J043027A21CACGTGGGCCATNONE 
J090028A09CACGTGGGCCATNONE 
J090053D06CACGTGGGCCATNONE 
J090083O17CACGTGGGCCATNONE 
J090099H10CACGTGGGCCATNONE 
J100036M05CACGTGGGCCATNONE 
Os03g0346500009-180-F12GTATGGGCCATNONE 
AK063139GTATGGGCCATHypothetical protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0364000J065042L07ATGGCCCATANONE 
J065061O16ATGGCCCATANONE 
J065075L02ATGGCCCATANONE 
J065138N02ATGGCCCATANONE 
J065209H20ATGGCCCATANONE 
J075019G03ATGGCCCATANONE 
J075086E23ATGGCCCATANONE 
J075094M12ATGGCCCATANONE 
J075139L07ATGGCCCATANONE 
J075162I16ATGGCCCATANONE 
J075199G20ATGGCCCATANONE 
Os03g0388100AK059680GCTGGGCCATHeavy metal transport/detoxification protein domain containing protein. 
AK099133GCTGGGCCATNONE 
Os03g0405500AK069583ATGGCCCAAGSimilar to PDI-like protein. 
AK104893ATGGCCCAGTANONE 
Os03g0565600J090030D24TGTGGGCCATNONE 
Os03g0566600011-071-A08ACATGGGCCATNONE 
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein. 
Os03g0566800AK103270CATGGGCCATSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CATGGGCCATNONE 
J023136P06CATGGGCCATNONE 
J033081A22CATGGGCCATNONE 
J033109N12CATGGGCCATNONE 
J033124H10CATGGGCCATNONE 
J033141B09CATGGGCCATNONE 
J090026G23CATGGGCCATNONE 
J090077J20CATGGGCCATNONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0681900006-042-F08ATGGCCCATTANONE 
009-043-F12ATGGCCCATTANONE 
AK061750ATGGCCCATTANONE 
AK062094ATGGCCCATTASimilar to RGP-3 (Fragment). 
J033034F01ATGGCCCATTANONE 
J033131F11ATGGCCCATTANONE 
J033143N03ATGGCCCATTANONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0725400015-060-D03ATGGCCCATCGNONE 
AK105499ATGGCCCATCGSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860ATGGCCCATCGNONE 
AK112085ATGGCCCATCGNONE 
J100068K06ATGGCCCATCGNONE 
J100073K24ATGGCCCATCGNONE 
J100084M24ATGGCCCATCGNONE 
Os03g0734400009-076-E05CTTGGGCCATNONE 
AK062628CTTGGGCCATRibosomal protein L7/L12 family protein. 
Os03g0736700006-022-F08ATGGCCCATGGNONE 
006-042-H09ATGGCCCATGGNONE 
006-053-H02ATGGCCCATGGNONE 
009-127-A06ATGGCCCATGGNONE 
013-089-C06ATGGCCCATGGNONE 
AK060947ATGGCCCATGGGRAM domain containing protein. 
AK073026ATGGCCCATGGNONE 
AK104415ATGGCCCATGGNONE 
AK104642ATGGCCCATGGNONE 
J065027H19ATGGCCCATGGNONE 
J065059K06ATGGCCCATGGNONE 
J065065I02ATGGCCCATGGNONE 
J065085E10ATGGCCCATGGNONE 
J065140M09ATGGCCCATGGNONE 
J075115M21ATGGCCCATGGNONE 
Os03g0741500AK110867ATGGCCCAATSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
Os03g0746400AK063445CCTGGGCCATProtein prenyltransferase domain containing protein. 
AK070923CCTGGGCCATNONE 
J065008K24CCTGGGCCATNONE 
Os03g0752800AB041020ATGGCCCACCCNONE 
AF058697ATGGCCCACCCMADS14 protein. 
AF139664ATGGCCCACCCNONE 
AK121171ATGGCCCACCCNONE 
AY332478ATGGCCCACCCNONE 
AY551916ATGGCCCACCCNONE 
J023081C04ATGGCCCACCCNONE 
Os03g0763000AK120812GGCTGGGCCATSimilar to Casein kinase II alpha subunit. 
Os03g0766000AK070596TTATGGGCCATNONE 
AK104743TTATGGGCCATNONE 
AK106079TTATGGGCCATNONE 
J013063M09TTATGGGCCATNONE 
J023056A03TTATGGGCCATNONE 
J043038L07TTATGGGCCATNONE 
J053067N16TTATGGGCCATNONE 
J053073G09TTATGGGCCATNONE 
J053075I19TTATGGGCCATNONE 
Os03g0771500AB028884AGATGGGCCATKnotted1-type homeobox protein OSH43. 
AK107296AGATGGGCCATNONE 
Os03g0791800013-037-A12CAGGTGGGCCATNONE 
AB079798CAGGTGGGCCATNONE 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK120251CAGGTGGGCCATNONE 
J013045G10CAGGTGGGCCATNONE 
J023102B18CAGGTGGGCCATNONE 
J065020J23CAGGTGGGCCATNONE 
J065127I21CAGGTGGGCCATNONE 
J065151E11CAGGTGGGCCATNONE 
J075076B05CAGGTGGGCCATNONE 
J075116C15CAGGTGGGCCATNONE 
J075136A07CAGGTGGGCCATNONE 
J100029G21CAGGTGGGCCATNONE 
J100030K01CAGGTGGGCCATNONE 
J100041J02CAGGTGGGCCATNONE 
J100049C22CAGGTGGGCCATNONE 
J100057G17CAGGTGGGCCATNONE 
J100086L12CAGGTGGGCCATNONE 
Os03g0801800AK067130ATGGCCCATTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17ATGGCCCATTNONE 
J090087F23ATGGCCCATTNONE 
Os03g0807800AK064984ATGGCCCATGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14ATGGCCCATGNONE 
J065015J20ATGGCCCATGNONE 
J065122L11ATGGCCCATGNONE 
J065217E10ATGGCCCATGNONE 
J075023C02ATGGCCCATGNONE 
J075102O04ATGGCCCATGNONE 
J080024G24ATGGCCCATGNONE 
J080033F02ATGGCCCATGNONE 
J080047M13ATGGCCCATGNONE 
J080048A22ATGGCCCATGNONE 
J080056E06ATGGCCCATGNONE 
J080064O11ATGGCCCATGNONE 
Os03g0820100011-030-A10ATGGCCCAATTNONE 
011-031-C01ATGGCCCAATTNONE 
AK111534ATGGCCCAATTSimilar to Auxin-resistance protein AXR1. 
J013033L14ATGGCCCAATTNONE 
J013034D14ATGGCCCAATTNONE 
J013065N20ATGGCCCAATTNONE 
J013127A04ATGGCCCAATTNONE 
J013146A11ATGGCCCAATTNONE 
J023025D19ATGGCCCAATTNONE 
J023083K15ATGGCCCAATTNONE 
J033037N01ATGGCCCAATTNONE 
J033041H02ATGGCCCAATTNONE 
J043009M22ATGGCCCAATTNONE 
J090039L03ATGGCCCAATTNONE 
J090050L08ATGGCCCAATTNONE 
J090053J21ATGGCCCAATTNONE 
J090088G07ATGGCCCAATTNONE 
Os03g0821900AK070847ATTTGGGCCATSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0829000AK071107TTGTGGGCCATFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTGTGGGCCATNONE 
AK121596TTGTGGGCCATNONE 
J065045C17TTGTGGGCCATNONE 
J065068E23TTGTGGGCCATNONE 
J065083N15TTGTGGGCCATNONE 
J065166P10TTGTGGGCCATNONE 
J065189B13TTGTGGGCCATNONE 
J090082J08TTGTGGGCCATNONE 
J100030P13TTGTGGGCCATNONE 
Os03g0832200AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0855700AK070400ATGGCCCAAATNucleic acid-binding, OB-fold domain containing protein. 
Os04g0195100AK107201GGTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0208500015-079-C10GTTTGGGCCATNONE 
AK106410GTTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0270100AK063713ATGGCCCAGTNONE 
AK107968ATGGCCCAGTNONE 
Os04g0282400AK120187ATGGCCCAAGSimilar to FPF1 protein-like (RAA1). 
J013034O10ATGGCCCAAGNONE 
J013071G20ATGGCCCAAGNONE 
Os04g0350000011-080-B03ATCTGGGCCATNONE 
AK063387ATCTGGGCCATNONE 
AK121263ATCTGGGCCATNONE 
Os04g0387600009-148-E01ATGGCCCACCCGNONE 
009-155-A11ATGGCCCACCCGNONE 
009-175-F04ATGGCCCACCCGNONE 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
J065035F12ATGGCCCACCCGNONE 
J065162C13ATGGCCCACCCGNONE 
J065169L19ATGGCCCACCCGNONE 
Os04g0390700AK107261ATGGCCCAGCGlucose/ribitol dehydrogenase family protein. 
Os04g0407300AK101793ATGGCCCATACNONE 
AK121980ATGGCCCATACHypothetical protein. 
J033065K23ATGGCCCATACNONE 
J033108L11ATGGCCCATACNONE 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein. 
Os04g0479800AK121430TGGTGGGCCATCyclin-like F-box domain containing protein. 
J033099N03TGGTGGGCCATNONE 
J090035E10TGGTGGGCCATNONE 
Os04g0486400AJ535489TATGGGCCATNONE 
AK103296TATGGGCCATRML1 protein. 
J013045L03TATGGGCCATNONE 
J013045M03TATGGGCCATNONE 
J033034L24TATGGGCCATNONE 
J033125B02TATGGGCCATNONE 
J075001G08TATGGGCCATNONE 
J075011I16TATGGGCCATNONE 
J075033M08TATGGGCCATNONE 
J075044G01TATGGGCCATNONE 
J075047D04TATGGGCCATNONE 
J075061J09TATGGGCCATNONE 
J075085L07TATGGGCCATNONE 
J075087D20TATGGGCCATNONE 
J075117A04TATGGGCCATNONE 
J075134H06TATGGGCCATNONE 
J075184J12TATGGGCCATNONE 
Os04g0521800006-043-D11ATGGCCCACTNONE 
AK061536ATGGCCCACTNONE 
AK102934ATGGCCCACTPeptidase M20 family protein. 
AK103369ATGGCCCACTNONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
009-171-H01ATGGCCCATAAGGCCCAACANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0658300AK067399GTTGGGCCATSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0659000009-172-A09ATGGCCCATTTNONE 
AK063095ATGGCCCATTTConserved hypothetical protein. 
J065062J07ATGGCCCATTTNONE 
Os04g0682100AK070539AGAGTGGGCCATEukaryotic phosphomannomutase family protein. 
J080303K19AGAGTGGGCCATNONE 
J100044E03AGAGTGGGCCATNONE 
J100063H09AGAGTGGGCCATNONE 
J100072L13AGAGTGGGCCATNONE 
J100089H15AGAGTGGGCCATNONE 
Os04g0685100AK065262ATGGCCCATCTRibosomal biogenesis regulatory protein family protein. 
J013002J24ATGGCCCATCTNONE 
J013030M11ATGGCCCATCTNONE 
J033139J12ATGGCCCATCTNONE 
J065013D12ATGGCCCATCTNONE 
J065117J01ATGGCCCATCTNONE 
J065143K20ATGGCCCATCTNONE 
J065181E12ATGGCCCATCTNONE 
J065184A17ATGGCCCATCTNONE 
J065193B13ATGGCCCATCTNONE 
J065196H01ATGGCCCATCTNONE 
J075072G17ATGGCCCATCTNONE 
J075077B02ATGGCCCATCTNONE 
J075088A06ATGGCCCATCTNONE 
J075099H13ATGGCCCATCTNONE 
J075111O04ATGGCCCATCTNONE 
J075131F20ATGGCCCATCTNONE 
J075139K01ATGGCCCATCTNONE 
J075194I16ATGGCCCATCTNONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
Os05g0103500AK060306ATGGCCCAAACHCH domain containing protein. 
AK102829ATGGCCCAAANONE 
J033109D16ATGGCCCAAANONE 
J043016E20ATGGCCCAAANONE 
J065001C14ATGGCCCAAANONE 
J065116L24ATGGCCCAAANONE 
J075018E04ATGGCCCAAANONE 
J075045E18ATGGCCCAAANONE 
J075093G20ATGGCCCAAANONE 
J075171A09ATGGCCCAAANONE 
J100029F18ATGGCCCAAANONE 
J100046I24ATGGCCCAAANONE 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0121500006-117-B10GGTTGGGCCATNONE 
009-059-D04GGTTGGGCCATNONE 
J065066C12GGTTGGGCCATConserved hypothetical protein. 
J075013I12GGTTGGGCCATNONE 
J090046D18GGTTGGGCCATNONE 
Os05g0144800AK099724ATGGCCCATAASimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
AK099724TATTGGGCCATSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
Os05g0215500AK070424ATTTGGGCCATHypothetical protein. 
J023050J01ATTTGGGCCATNONE 
Os05g0298500Os05g0298500ATGGCCCAATConserved hypothetical protein. 
Os05g0311000AK099633ATGGCCCACCANONE 
AK100201ATGGCCCACCANONE 
AK100520ATGGCCCACCAClathrin adaptor complex, medium chain family protein. 
J013047M12ATGGCCCACCANONE 
J013052M03ATGGCCCACCANONE 
J013059B15ATGGCCCACCANONE 
J023099C22ATGGCCCACCANONE 
J023100E05ATGGCCCACCANONE 
J023100J17ATGGCCCACCANONE 
J023101D04ATGGCCCACCANONE 
J023119B18ATGGCCCACCANONE 
J033024B03ATGGCCCACCANONE 
J033036M20ATGGCCCACCANONE 
J033071J05ATGGCCCACCANONE 
J033071O20ATGGCCCACCANONE 
J033111K10ATGGCCCACCANONE 
J033144C21ATGGCCCACCANONE 
J033145C21ATGGCCCACCANONE 
J100043L14ATGGCCCACCANONE 
J100079C01ATGGCCCACCANONE 
Os05g0317300AK064846ATGGCCCAGATFAR1 domain containing protein. 
AK122018ATGGCCCAGATNONE 
J013000G11ATGGCCCAGATNONE 
J023041M02ATGGCCCAGATNONE 
J023056G01ATGGCCCAGATNONE 
J023064M23ATGGCCCAGATNONE 
J023107F08ATGGCCCAGATNONE 
J033060K06ATGGCCCAGATNONE 
J033097H11ATGGCCCAGATNONE 
J065139C02ATGGCCCAGATNONE 
J090034K18ATGGCCCAGATNONE 
J090048K22ATGGCCCAGATNONE 
J090067G18ATGGCCCAGATNONE 
J090089F08ATGGCCCAGATNONE 
Os05g0327000014-005-A12CCTGGGCCATNONE 
AK064059CCTGGGCCATCyclin-like domain containing protein. 
AK101588CCTGGGCCATNONE 
J033051A05CCTGGGCCATNONE 
J065106E02CCTGGGCCATNONE 
J065183D01CCTGGGCCATNONE 
Os05g0378900AK103841ATGGCCCATCTConserved hypothetical protein. 
J033148I18ATGGCCCATCTNONE 
J065085F12ATGGCCCATCTNONE 
J075041H24ATGGCCCATCTNONE 
J075180P06ATGGCCCATCTNONE 
Os05g0382000AK072704ATGGCCCAGCNONE 
AK121203ATGGCCCAGCSimilar to ABL164Cp. 
Os05g0412800AF402803ATGGCCCAACASimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0424700AK107848TGTGGGCCATSimilar to Copper transporter 1. 
Os05g0456000AK058420ATGGCCCACAMitochondrial glycoprotein family protein. 
AK102036ATGGCCCACANONE 
J065066F02ATGGCCCACANONE 
Os05g0458100006-084-A05ATGGCCCACCACNONE 
009-091-H05ATGGCCCACCACNONE 
AJ557547ATGGCCCACCACNONE 
AK059467ATGGCCCACCACNONE 
AK061127ATGGCCCACCACNONE 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06ATGGCCCACCACNONE 
J033057B20ATGGCCCACCACNONE 
J033087A05ATGGCCCACCACNONE 
J043009C05ATGGCCCACCACNONE 
J090009E10ATGGCCCACCACNONE 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK065288CCCGTGGGCCATNONE 
J013002M22CCCGTGGGCCATNONE 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033143O14GAGGCCCATGGGCCATNONE 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0502800016-060-H05ATGGCCCAGTNONE 
AK064242ATGGCCCAGTNONE 
AK065486ATGGCCCAGTNAF1 domain containing protein. 
Os05g0526800016-054-G05ACATGGGCCATNONE 
016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ACATGGGCCATNONE 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ACATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ACATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0528200009-146-C01ATGGCCCATGNONE 
AK062985ATGGCCCATGSimilar to 50S ribosomal protein L20. 
Os05g0558900AK101679TCATGGGCCATSimilar to Frsb-prov protein. 
J013028M08TCATGGGCCATNONE 
J013074E16TCATGGGCCATNONE 
J013096L01TCATGGGCCATNONE 
J023085M19TCATGGGCCATNONE 
J033058I10TCATGGGCCATNONE 
J033091D18TCATGGGCCATNONE 
J033111H13TCATGGGCCATNONE 
J033114C18TCATGGGCCATNONE 
Os05g0576600AK107732CTTGGGCCATConserved hypothetical protein. 
Os05g0594800AK058332GGGCTTTTATATGGGCCATAdhesion regulating molecule family protein. 
AK068013GGGCTTTTATATGGGCCATNONE 
J013129L24GGGCTTTTATATGGGCCATNONE 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0114600015-077-E06ATGGCCCAAANONE 
AK067972ATGGCCCAAAConserved hypothetical protein. 
Os06g0116400006-082-G06ATGGCCCATCANONE 
AK058327ATGGCCCATCANONE 
AK105979ATGGCCCATCAHigh-affinity nickel-transporter family protein. 
J065083I24ATGGCCCATCANONE 
J100072O18ATGGCCCATCANONE 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0157800AK121504GGTGGGCCATSimilar to CG7224 (Fragment). 
J033022L20GGTGGGCCATNONE 
J075033D09GGTGGGCCATNONE 
Os06g0192500AK067746ATGGCCCATATATP-dependent helicase, DEAH-box family protein. 
J065023K06ATGGCCCATATNONE 
J100063P08ATGGCCCATATNONE 
J100065N03ATGGCCCATATNONE 
Os06g0225200005-009-B07ATGGCCCACCAACNONE 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK104692ATGGCCCACCAACNONE 
J013096A05ATGGCCCACCAACNONE 
J090092C03ATGGCCCACCAACNONE 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0495500AK109873GCGTGGGCCATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0547900AK100950ATTGGGCCATSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665ATTGGGCCATNONE 
J023139I22ATTGGGCCATNONE 
J090066J10ATTGGGCCATNONE 
Y13437ATTGGGCCATNONE 
Os06g0564700AK070508GCTGGGCCATSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCTGGGCCATNONE 
Os06g0568200AK060816ATGGCCCACCTNONE 
J013048K13ATGGCCCACCTNONE 
J013050A11ATGGCCCACCTNONE 
J013051L22ATGGCCCACCTNONE 
J013061N20ATGGCCCACCTNONE 
J013065H06ATGGCCCACCTNONE 
J013068P08ATGGCCCACCTNONE 
J013069C22ATGGCCCACCTNONE 
J013070P14ATGGCCCACCTNONE 
J013074I20ATGGCCCACCTNONE 
J013106C16ATGGCCCACCTNONE 
J013122H02ATGGCCCACCTNONE 
J013129N22ATGGCCCACCTNONE 
J013129P06ATGGCCCACCTNONE 
J013147C12ATGGCCCACCTNONE 
J013152K21ATGGCCCACCTNONE 
J013155C14ATGGCCCACCTNONE 
J023001M10ATGGCCCACCTNONE 
J023012G04ATGGCCCACCTNONE 
J023012H22ATGGCCCACCTNONE 
J023012N11ATGGCCCACCTNONE 
J023013I23ATGGCCCACCTNONE 
J023014L11ATGGCCCACCTNONE 
J023022G16ATGGCCCACCTNONE 
J023031K09ATGGCCCACCTNONE 
J023042N15ATGGCCCACCTNONE 
J023044D09ATGGCCCACCTNONE 
J023063L08ATGGCCCACCTNONE 
J023074C24ATGGCCCACCTNONE 
J023079O11ATGGCCCACCTNONE 
J023107B12ATGGCCCACCTNONE 
J023114B10ATGGCCCACCTNONE 
J023120P15ATGGCCCACCTNONE 
J023123D20ATGGCCCACCTNONE 
J023130G12ATGGCCCACCTNONE 
J023131L13ATGGCCCACCTNONE 
J023135O11ATGGCCCACCTNONE 
J023138M14ATGGCCCACCTNONE 
J023149G07ATGGCCCACCTNONE 
J033024F07ATGGCCCACCTNONE 
J033026C20ATGGCCCACCTNONE 
J033036M14ATGGCCCACCTNONE 
J033038A18ATGGCCCACCTNONE 
J033043B18ATGGCCCACCTNONE 
J033043L05ATGGCCCACCTNONE 
J033064A07ATGGCCCACCTNONE 
J033087H21ATGGCCCACCTNONE 
J033087P22ATGGCCCACCTNONE 
J033116O10ATGGCCCACCTNONE 
J033118G23ATGGCCCACCTNONE 
J033120L01ATGGCCCACCTNONE 
J033133F11ATGGCCCACCTNONE 
J033135H12ATGGCCCACCTNONE 
J033141O15ATGGCCCACCTNONE 
J043003A18ATGGCCCACCTNONE 
J043010C07ATGGCCCACCTNONE 
J043010G12ATGGCCCACCTNONE 
J043012A09ATGGCCCACCTNONE 
J043036K01ATGGCCCACCTNONE 
J065005D13ATGGCCCACCTNONE 
J065017L06ATGGCCCACCTNONE 
J065172I06ATGGCCCACCTNONE 
J090003B02ATGGCCCACCTNONE 
J090015L01ATGGCCCACCTNONE 
J090020I04ATGGCCCACCTNONE 
J090021I06ATGGCCCACCTNONE 
J090047D16ATGGCCCACCTNONE 
J090049J19ATGGCCCACCTNONE 
J090050C16ATGGCCCACCTNONE 
J090055L13ATGGCCCACCTNONE 
J090056J22ATGGCCCACCTNONE 
J090058K23ATGGCCCACCTNONE 
J090059N19ATGGCCCACCTNONE 
J090069A06ATGGCCCACCTNONE 
J090071C19ATGGCCCACCTNONE 
J100024L15ATGGCCCACCTNONE 
J100029O03ATGGCCCACCTNONE 
J100064M17ATGGCCCACCTNONE 
J100082D13ATGGCCCACCTNONE 
J100083P16ATGGCCCACCTNONE 
Os06g0607900AK070879TAATGGGCCATNONE 
Os06g0650100009-016-C02ATTGGGCCATNONE 
AK062354ATTGGGCCATSimilar to Polyubiquitin gene (Fragment). 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0709300AK108588ATGGCCCACTFAR1 domain containing protein. 
Os06g0710300AK121344ATGGCCCAATAUncharacterized protein UPF0114 family protein. 
J043016B12ATGGCCCAATANONE 
J065104H21ATGGCCCAATANONE 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0714500AK100047ATGGCCCAAGAAA ATPase domain containing protein. 
AK119628ATGGCCCAAGNONE 
J013120N13ATGGCCCAAGNONE 
J013154C19ATGGCCCAAGNONE 
J023031A09ATGGCCCAAGNONE 
J023073G20ATGGCCCAAGNONE 
J023086A06ATGGCCCAAGNONE 
J023086L11ATGGCCCAAGNONE 
J033045N11ATGGCCCAAGNONE 
J065124D11ATGGCCCAAGNONE 
J065135A15ATGGCCCAAGNONE 
J065146E06ATGGCCCAAGNONE 
J065175E12ATGGCCCAAGNONE 
J075004A21ATGGCCCAAGNONE 
J075072C20ATGGCCCAAGNONE 
J075078O21ATGGCCCAAGNONE 
J075145E13ATGGCCCAAGNONE 
J075196K08ATGGCCCAAGNONE 
J090095L18ATGGCCCAAGNONE 
Os07g0123000AK070836ATGGCCCAAAACyclin-like F-box domain containing protein. 
Os07g0124500012-092-F01ATGGCCCATATNONE 
AK070529ATGGCCCATATSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000ATGGCCCATATNONE 
J090007O11ATGGCCCATATNONE 
J090010E02ATGGCCCATATNONE 
J090078C04ATGGCCCATATNONE 
Os07g0142000AK059877ATGGCCCACCTReticulon family protein. 
AK099414ATGGCCCACCTNONE 
Os07g0150200009-152-C07AGGTGGGCCATNONE 
AK058680AGGTGGGCCATNONE 
AK121635AGGTGGGCCATSimilar to 40S ribosomal protein S12-1. 
J033051C16AGGTGGGCCATNONE 
J033123H15AGGTGGGCCATNONE 
J065093I01AGGTGGGCCATNONE 
J065197C05AGGTGGGCCATNONE 
J075037B11AGGTGGGCCATNONE 
J075114B08AGGTGGGCCATNONE 
J075123N01AGGTGGGCCATNONE 
J075129O04AGGTGGGCCATNONE 
J075160H17AGGTGGGCCATNONE 
J075166H17AGGTGGGCCATNONE 
J080310F11AGGTGGGCCATNONE 
J080315P11AGGTGGGCCATNONE 
J090025A22AGGTGGGCCATNONE 
Os07g0154300009-070-E08TAATGGGCCATNONE 
009-077-E01TAATGGGCCATNONE 
009-196-F05TAATGGGCCATNONE 
AK105386TAATGGGCCATConserved hypothetical protein. 
AK122093TAATGGGCCATNONE 
J033124K14TAATGGGCCATNONE 
J075006I22TAATGGGCCATNONE 
J075185G02TAATGGGCCATNONE 
J090039C02TAATGGGCCATNONE 
Os07g0171200AK071075ATGGCCCACTGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0290800AK071498ATGGCCCAAAATic22-like family protein. 
J075099P10ATGGCCCAAAANONE 
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein. 
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
Os07g0498900AK073263ATGGCCCAGCProtein of unknown function DUF231, plant domain containing protein. 
J033024K20ATGGCCCAGCNONE 
J065207I19ATGGCCCAGCNONE 
Os07g0546000AF188065ATGGCCCAGATNONE 
AK061800ATGGCCCAGATNONE 
AK065871ATGGCCCAGATSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02ATGGCCCAGATNONE 
J013035F03ATGGCCCAGATNONE 
J013044J20ATGGCCCAGATNONE 
Os07g0573800AK072835ATTTGGGCCATPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154ATTTGGGCCATNONE 
AK104308ATTTGGGCCATNONE 
AK107962ATTTGGGCCATNONE 
J023134F17ATTTGGGCCATNONE 
J043027A09ATTTGGGCCATNONE 
Os07g0598900015-040-C12GTATGGGCCATNONE 
015-040-C12TTTTGGGCCATNONE 
AK102627GTATGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK102627TTTTGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GTATGGGCCATNONE 
AK106521TTTTGGGCCATNONE 
J033087C18GTATGGGCCATNONE 
J033087C18TTTTGGGCCATNONE 
J033099K03GTATGGGCCATNONE 
J033099K03TTTTGGGCCATNONE 
J065054E02GTATGGGCCATNONE 
J065054E02TTTTGGGCCATNONE 
J090055O05GTATGGGCCATNONE 
J090055O05TTTTGGGCCATNONE 
Os07g0602600AK065696CTTGGGCCATSimilar to RNA binding protein. 
J013035K23CTTGGGCCATNONE 
Os07g0616800AK100306ATGGCCCACGCCTCSucrose synthase 3 (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase 3). 
J023081P20ATGGCCCACGCCTCNONE 
J023083F19ATGGCCCACGCCTCNONE 
J023131O18ATGGCCCACGCCTCNONE 
J075005A08ATGGCCCACGCCTCNONE 
J075014A17ATGGCCCACGCCTCNONE 
J075034L22ATGGCCCACGCCTCNONE 
J075042E03ATGGCCCACGCCTCNONE 
J075058F21ATGGCCCACGCCTCNONE 
J075068P20ATGGCCCACGCCTCNONE 
J075069D01ATGGCCCACGCCTCNONE 
J075081D21ATGGCCCACGCCTCNONE 
J075094N20ATGGCCCACGCCTCNONE 
J075141C12ATGGCCCACGCCTCNONE 
J075175I11ATGGCCCACGCCTCNONE 
J075177O15ATGGCCCACGCCTCNONE 
J075181B08ATGGCCCACGCCTCNONE 
J075181E16ATGGCCCACGCCTCNONE 
J075182M01ATGGCCCACGCCTCNONE 
J090002E09ATGGCCCACGCCTCNONE 
J090012C07ATGGCCCACGCCTCNONE 
J090016H23ATGGCCCACGCCTCNONE 
J090018C17ATGGCCCACGCCTCNONE 
J090023D12ATGGCCCACGCCTCNONE 
J090025B11ATGGCCCACGCCTCNONE 
J090026B16ATGGCCCACGCCTCNONE 
J090026D01ATGGCCCACGCCTCNONE 
J090026N17ATGGCCCACGCCTCNONE 
J090027G04ATGGCCCACGCCTCNONE 
J090027J17ATGGCCCACGCCTCNONE 
J090030L01ATGGCCCACGCCTCNONE 
J090032F19ATGGCCCACGCCTCNONE 
J090033C02ATGGCCCACGCCTCNONE 
J090041D05ATGGCCCACGCCTCNONE 
J090042O17ATGGCCCACGCCTCNONE 
J090048I02ATGGCCCACGCCTCNONE 
J090048K18ATGGCCCACGCCTCNONE 
J090054J02ATGGCCCACGCCTCNONE 
J090056K21ATGGCCCACGCCTCNONE 
J090057D16ATGGCCCACGCCTCNONE 
J090058F22ATGGCCCACGCCTCNONE 
J090062L16ATGGCCCACGCCTCNONE 
J090062L17ATGGCCCACGCCTCNONE 
J090063H10ATGGCCCACGCCTCNONE 
J090063L17ATGGCCCACGCCTCNONE 
J090069A12ATGGCCCACGCCTCNONE 
J090069I20ATGGCCCACGCCTCNONE 
J090069L03ATGGCCCACGCCTCNONE 
J090072F07ATGGCCCACGCCTCNONE 
J090074K19ATGGCCCACGCCTCNONE 
J090077E02ATGGCCCACGCCTCNONE 
J090078L13ATGGCCCACGCCTCNONE 
J090081C14ATGGCCCACGCCTCNONE 
J090081J18ATGGCCCACGCCTCNONE 
J090083E11ATGGCCCACGCCTCNONE 
J090083I21ATGGCCCACGCCTCNONE 
J090083P21ATGGCCCACGCCTCNONE 
J090088H09ATGGCCCACGCCTCNONE 
J090090I19ATGGCCCACGCCTCNONE 
J090090K03ATGGCCCACGCCTCNONE 
J090092L21ATGGCCCACGCCTCNONE 
J090094M21ATGGCCCACGCCTCNONE 
J090095E24ATGGCCCACGCCTCNONE 
J090095H06ATGGCCCACGCCTCNONE 
J090095P19ATGGCCCACGCCTCNONE 
J090096E13ATGGCCCACGCCTCNONE 
J090096G02ATGGCCCACGCCTCNONE 
J090096N12ATGGCCCACGCCTCNONE 
J090097C07ATGGCCCACGCCTCNONE 
Os07g0624600AK109902GTGGTGGGCCATSimilar to Trehalose-6-phosphate phosphatase. 
Os07g0635500011-089-H07ATGGCCCATGGNONE 
016-030-A09ATGGCCCATGGNONE 
AK106081ATGGCCCATGGNONE 
AK121733ATGGCCCATGGSimilar to Cytochrome P450. 
J043036I03ATGGCCCATGGNONE 
J065001N22ATGGCCCATGGNONE 
J065035I03ATGGCCCATGGNONE 
J065167G12ATGGCCCATGGNONE 
J075041E07ATGGCCCATGGNONE 
J090007D08ATGGCCCATGGNONE 
J090089I24ATGGCCCATGGNONE 
J100026I23ATGGCCCATGGNONE 
J100027H19ATGGCCCATGGNONE 
J100044G07ATGGCCCATGGNONE 
J100089H22ATGGCCCATGGNONE 
J100090D03ATGGCCCATGGNONE 
J100090D22ATGGCCCATGGNONE 
Os07g0668200AK059051ATGGCCCAAATNONE 
AK101682ATGGCCCAAATConserved hypothetical protein. 
AK102839ATGGCCCAAATNONE 
Os07g0686600AK108527TGGGTCCCATGGGCCATVQ domain containing protein. 
Os08g0110200AK068841ACATGGGCCATSimilar to Fertility restorer. 
J090071I18ACATGGGCCATNONE 
Os08g0116500009-007-E05ATGGCCCACANONE 
009-074-C07ATGGCCCACANONE 
009-098-A07ATGGCCCACANONE 
009-100-C03ATGGCCCACANONE 
009-136-E04ATGGCCCACANONE 
009-138-B08ATGGCCCACANONE 
009-144-B06ATGGCCCACANONE 
009-184-E04ATGGCCCACANONE 
009-189-F01ATGGCCCACANONE 
013-006-E05ATGGCCCACANONE 
013-015-C10ATGGCCCACANONE 
013-019-F09ATGGCCCACANONE 
013-020-C01ATGGCCCACANONE 
013-021-F05ATGGCCCACANONE 
013-035-D08ATGGCCCACANONE 
013-038-C09ATGGCCCACANONE 
013-054-B07ATGGCCCACANONE 
013-061-G10ATGGCCCACANONE 
013-074-B01ATGGCCCACANONE 
013-079-B06ATGGCCCACANONE 
013-099-B09ATGGCCCACANONE 
013-099-G11ATGGCCCACANONE 
014-023-F04ATGGCCCACANONE 
014-032-C07ATGGCCCACANONE 
014-045-E02ATGGCCCACANONE 
014-085-C02ATGGCCCACANONE 
014-087-F04ATGGCCCACANONE 
014-089-C04ATGGCCCACANONE 
014-090-E01ATGGCCCACANONE 
014-094-G11ATGGCCCACANONE 
014-097-B07ATGGCCCACANONE 
015-024-A12ATGGCCCACANONE 
015-032-C06ATGGCCCACANONE 
016-053-E09ATGGCCCACANONE 
016-081-F10ATGGCCCACANONE 
AK058240ATGGCCCACASimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09ATGGCCCACANONE 
J023107O19ATGGCCCACANONE 
J053029K21ATGGCCCACANONE 
J053073P11ATGGCCCACANONE 
J053074B04ATGGCCCACANONE 
J053078M14ATGGCCCACANONE 
J065001E12ATGGCCCACANONE 
J065006J12ATGGCCCACANONE 
J065015C06ATGGCCCACANONE 
J065025D13ATGGCCCACANONE 
J065029A04ATGGCCCACANONE 
J065031D23ATGGCCCACANONE 
J065032E24ATGGCCCACANONE 
J065034P16ATGGCCCACANONE 
J065043B04ATGGCCCACANONE 
J065044A15ATGGCCCACANONE 
J065062D18ATGGCCCACANONE 
J065079G13ATGGCCCACANONE 
J065080A19ATGGCCCACANONE 
J065080A20ATGGCCCACANONE 
J065089N19ATGGCCCACANONE 
J065111O07ATGGCCCACANONE 
J065115N15ATGGCCCACANONE 
J065131A04ATGGCCCACANONE 
J065138H02ATGGCCCACANONE 
J065139K10ATGGCCCACANONE 
J065144A02ATGGCCCACANONE 
J065155J17ATGGCCCACANONE 
J065159D18ATGGCCCACANONE 
J065159I18ATGGCCCACANONE 
J065167H12ATGGCCCACANONE 
J065174C22ATGGCCCACANONE 
J065184A05ATGGCCCACANONE 
J065188M15ATGGCCCACANONE 
J065191D23ATGGCCCACANONE 
J065203C07ATGGCCCACANONE 
J065207C23ATGGCCCACANONE 
J065207L16ATGGCCCACANONE 
J065212F01ATGGCCCACANONE 
J065212F05ATGGCCCACANONE 
J075037B07ATGGCCCACANONE 
J075042F15ATGGCCCACANONE 
J075059J03ATGGCCCACANONE 
J075068M18ATGGCCCACANONE 
J075079E13ATGGCCCACANONE 
J075081F12ATGGCCCACANONE 
J075083I05ATGGCCCACANONE 
J075123K23ATGGCCCACANONE 
J075142F16ATGGCCCACANONE 
J075156N03ATGGCCCACANONE 
J075162K05ATGGCCCACANONE 
J075171E08ATGGCCCACANONE 
J075177N03ATGGCCCACANONE 
J075182K17ATGGCCCACANONE 
J075186K02ATGGCCCACANONE 
J075191K05ATGGCCCACANONE 
J080011E10ATGGCCCACANONE 
J080016M21ATGGCCCACANONE 
J080017A17ATGGCCCACANONE 
J080031O09ATGGCCCACANONE 
J080039G21ATGGCCCACANONE 
J080041B01ATGGCCCACANONE 
J080050G20ATGGCCCACANONE 
J080054A12ATGGCCCACANONE 
J080058O08ATGGCCCACANONE 
J080061N04ATGGCCCACANONE 
J080064L23ATGGCCCACANONE 
J080064P05ATGGCCCACANONE 
J080069I17ATGGCCCACANONE 
J080070E07ATGGCCCACANONE 
J080071B20ATGGCCCACANONE 
J080074L08ATGGCCCACANONE 
J080076N08ATGGCCCACANONE 
J080081A14ATGGCCCACANONE 
J080081J17ATGGCCCACANONE 
J080085N14ATGGCCCACANONE 
J080090B09ATGGCCCACANONE 
J080097L11ATGGCCCACANONE 
J080306H13ATGGCCCACANONE 
J080307H13ATGGCCCACANONE 
J080311F12ATGGCCCACANONE 
J080316L23ATGGCCCACANONE 
J080318H02ATGGCCCACANONE 
J090016L15ATGGCCCACANONE 
J090019I02ATGGCCCACANONE 
J090031G21ATGGCCCACANONE 
J090066C15ATGGCCCACANONE 
J100032I02ATGGCCCACANONE 
J100032N07ATGGCCCACANONE 
J100032N16ATGGCCCACANONE 
J100041P21ATGGCCCACANONE 
J100048M04ATGGCCCACANONE 
J100048M14ATGGCCCACANONE 
J100063B08ATGGCCCACANONE 
J100088E20ATGGCCCACANONE 
J100090I08ATGGCCCACANONE 
Os08g0126500AK110941GCCCCACGTATGGCCCACTTGProtein of unknown function DUF295 family protein. 
Os08g0192800AK059490ATGGCCCACATGTCAGTGNONE 
AK101678ATGGCCCACATGTCAGTGNONE 
AK120613ATGGCCCACATGTCAGTGBromodomain containing protein. 
J080039B22ATGGCCCACATGTCAGTGNONE 
J080039I23ATGGCCCACATGTCAGTGNONE 
J080074D19ATGGCCCACATGTCAGTGNONE 
J080086N13ATGGCCCACATGTCAGTGNONE 
Os08g0196900J065042C13TGTGGGCCATNONE 
J065097A06TGTGGGCCATNONE 
J065164E04TGTGGGCCATNONE 
J075006N16TGTGGGCCATCyclin-like F-box domain containing protein. 
J075007K15TGTGGGCCATNONE 
J075025D24TGTGGGCCATNONE 
J075165A07TGTGGGCCATNONE 
J075176D05TGTGGGCCATNONE 
J075181K09TGTGGGCCATNONE 
J075199B15TGTGGGCCATNONE 
Os08g0411500J013050J08ATGGCCCAACANONE 
Os08g0412200006-028-H07CTTGGGCCATNONE 
AJ575234CTTGGGCCATNONE 
AK059631CTTGGGCCATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367CTTGGGCCATNONE 
AK104578CTTGGGCCATNONE 
J033071L08CTTGGGCCATNONE 
J065197K18CTTGGGCCATNONE 
Os08g0414300AK072217ATGGCCCAGCCConserved hypothetical protein. 
J065039C07ATGGCCCAGCCNONE 
J065098N11ATGGCCCAGCCNONE 
J065120J15ATGGCCCAGCCNONE 
J075076H12ATGGCCCAGCCNONE 
J075101N16ATGGCCCAGCCNONE 
J080010A07ATGGCCCAGCCNONE 
J080023C16ATGGCCCAGCCNONE 
J080027G22ATGGCCCAGCCNONE 
J080053D02ATGGCCCAGCCNONE 
J080065E17ATGGCCCAGCCNONE 
J080068C15ATGGCCCAGCCNONE 
J090061J10ATGGCCCAGCCNONE 
Os08g0433400AJ495796TCATGGGCCATSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
AK059468TCATGGGCCATNONE 
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE 
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein. 
J100048N11ACCGGCCCAATGGGCCATNONE 
Os08g0474750J075009C13CGTGTGGGCCATNONE 
J075122O14CGTGTGGGCCATHypothetical protein. 
Os08g0474800Os08g0474800CGTGTGGGCCATEsterase/lipase/thioesterase domain containing protein. 
Os08g0503800AK101954ATGGCCCACACGSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0521400006-047-C11AGATGGGCCATNONE 
016-014-E07AGATGGGCCATNONE 
AK070148AGATGGGCCATNONE 
AK101704AGATGGGCCATZinc finger, RanBP2-type domain containing protein. 
AK105045AGATGGGCCATNONE 
J013108K14AGATGGGCCATNONE 
J013129E16AGATGGGCCATNONE 
J013159M23AGATGGGCCATNONE 
J023041G22AGATGGGCCATNONE 
J033060G13AGATGGGCCATNONE 
J033060J15AGATGGGCCATNONE 
J065120J24AGATGGGCCATNONE 
J065160I01AGATGGGCCATNONE 
J065179A16AGATGGGCCATNONE 
J065189K04AGATGGGCCATNONE 
J090032O15AGATGGGCCATNONE 
J090045A18AGATGGGCCATNONE 
J090060B21AGATGGGCCATNONE 
J090086F23AGATGGGCCATNONE 
J090098O22AGATGGGCCATNONE 
J100018K20AGATGGGCCATNONE 
J100048P22AGATGGGCCATNONE 
J100052I06AGATGGGCCATNONE 
Os08g0529400J100040D07ATGGCCCAGCCyclin-like F-box domain containing protein. 
Os08g0535600AK121683ATGGCCCAATAZinc finger, Tim10/DDP-type family protein. 
J065077E05ATGGCCCAATANONE 
J075088M24ATGGCCCAATANONE 
J075140B03ATGGCCCAATANONE 
J090014B14ATGGCCCAATANONE 
Os08g0546300AK064717ATGGCCCATTAConserved hypothetical protein. 
AK119794ATGGCCCATTANONE 
D10982ATGGCCCATTANONE 
J080044B21ATGGCCCATTANONE 
Os08g0564100AK063258GTGTGGGCCATSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0251800006-100-E12AGCCCATGGCCCATGGNONE 
AK061218AGCCCATGGCCCATGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010AGCCCATGGCCCATGGNONE 
J065048A02AGCCCATGGCCCATGGNONE 
J065073P10AGCCCATGGCCCATGGNONE 
J065075B09AGCCCATGGCCCATGGNONE 
J065112B05AGCCCATGGCCCATGGNONE 
J090014H10AGCCCATGGCCCATGGNONE 
Os09g0319800AK066759AGTGGGCCATTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0325100J080009O19ATGGCCCAATNONE 
J080011H14ATGGCCCAATConserved hypothetical protein. 
J080014F14ATGGCCCAATNONE 
J080014M09ATGGCCCAATNONE 
J080014N20ATGGCCCAATNONE 
J080018K13ATGGCCCAATNONE 
J080023C08ATGGCCCAATNONE 
J080023C09ATGGCCCAATNONE 
J080023K14ATGGCCCAATNONE 
J080025I09ATGGCCCAATNONE 
J080030J04ATGGCCCAATNONE 
J080039D08ATGGCCCAATNONE 
J080039L17ATGGCCCAATNONE 
J080041B13ATGGCCCAATNONE 
J080041P21ATGGCCCAATNONE 
J080042J21ATGGCCCAATNONE 
J080042L19ATGGCCCAATNONE 
J080045F07ATGGCCCAATNONE 
J080047B10ATGGCCCAATNONE 
J080051F23ATGGCCCAATNONE 
J080053D15ATGGCCCAATNONE 
J080053K02ATGGCCCAATNONE 
J080058K18ATGGCCCAATNONE 
J080061M13ATGGCCCAATNONE 
J080064M24ATGGCCCAATNONE 
J080067H07ATGGCCCAATNONE 
J080080B21ATGGCCCAATNONE 
J080080D18ATGGCCCAATNONE 
J080082G07ATGGCCCAATNONE 
J080088B01ATGGCCCAATNONE 
J080088E09ATGGCCCAATNONE 
J080093L01ATGGCCCAATNONE 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0401200AK106846GTGTGGGCCATNONE 
Os09g0433650J075094M19TAATGGGCCATTobacco mosaic virus coat protein family protein. 
Os09g0453800AK119212ATGGCCCACTNONE 
J023081A04ATGGCCCACTNONE 
J065180G14ATGGCCCACTNONE 
J100024A17ATGGCCCACTNONE 
J100030A05ATGGCCCACTNONE 
J100042I11ATGGCCCACTNONE 
J100054N05ATGGCCCACTNONE 
J100075G23ATGGCCCACTNONE 
Os09g0467700AK061600ATGGCCCAATConserved hypothetical protein. 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0537600006-054-B05TAATGGGCCATNONE 
AK061004TAATGGGCCATSimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20TAATGGGCCATNONE 
J075029H16TAATGGGCCATNONE 
Os09g0545700009-127-C10TCTGGGCCATNONE 
AK062898TCTGGGCCATSimilar to Auxin induced protein. 
Os09g0554000J065123C23ATGGCCCAACTSimilar to Mitochondrial phosphate transporter. 
J065123C23CCTGGGCCATSimilar to Mitochondrial phosphate transporter. 
J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os11g0156401J100027N11ATGGCCCAACCProtein of unknown function DUF623, plant domain containing protein. 
J100042A10ATGGCCCAACCNONE 
J100063F10ATGGCCCAACCNONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE 
012-035-H04TCATGGGCTATGGCCCACGTNONE 
012-065-F08TCATGGGCTATGGCCCACGTNONE 
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70. 
AK103083TCATGGGCTATGGCCCACGTNONE 
J033118G15TCATGGGCTATGGCCCACGTNONE 
J065115E02TCATGGGCTATGGCCCACGTNONE 
J065178K04TCATGGGCTATGGCCCACGTNONE 
J065178L03TCATGGGCTATGGCCCACGTNONE 
J090064A22TCATGGGCTATGGCCCACGTNONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0233900J065063O08CCTGGGCCATHypothetical protein. 
Os11g0417700J075031P16CCTGGGCCATConserved hypothetical protein. 
J075034C16CCTGGGCCATNONE 
J075034J22CCTGGGCCATNONE 
J075042C07CCTGGGCCATNONE 
J075046O07CCTGGGCCATNONE 
J075062O13CCTGGGCCATNONE 
J075091G08CCTGGGCCATNONE 
J075135H20CCTGGGCCATNONE 
J075172B13CCTGGGCCATNONE 
J075179G14CCTGGGCCATNONE 
Os11g0423200AK111297ATGGCCCAGCHypothetical protein. 
Os11g0448400AB095094ATGGCCCACASimilar to Sigma factor SIG2A. 
J075053H03ATGGCCCACANONE 
J075062F23ATGGCCCACANONE 
J090029D08ATGGCCCACANONE 
Os11g0587100J065046D15GCTGGGCCATProtein prenyltransferase domain containing protein. 
Os11g0594000J033124N02ATGGCCCATTNONE 
J100054J17ATGGCCCATTGeneral substrate transporter family protein. 
Os11g0629200AK065196ATGGCCCACCTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0708000006-046-G03ATGGCCCATGGNONE 
AK072065ATGGCCCATGGNONE 
AK120102ATGGCCCATGGConserved hypothetical protein. 
J013022N13ATGGCCCATGGNONE 
J013062I09ATGGCCCATGGNONE 
J013066H01ATGGCCCATGGNONE 
J013067A19ATGGCCCATGGNONE 
J033107A16ATGGCCCATGGNONE 
J065068A18ATGGCCCATGGNONE 
J065118D08ATGGCCCATGGNONE 
J075056H13ATGGCCCATGGNONE 
J075156I15ATGGCCCATGGNONE 
J100045J12ATGGCCCATGGNONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0211000AK101792ATGGCCCATGConserved hypothetical protein. 
J033065K09ATGGCCCATGNONE 
Os12g0242500J065129F10GTGTGGGCCATNONE 
J090032G12GTGTGGGCCATConserved hypothetical protein. 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0408000AK109709ATGGCCCACAAProtein of unknown function DUF594 family protein. 
J075021B20ATGGCCCACAANONE 
J075034G20ATGGCCCACAANONE 
J075087F21ATGGCCCACAANONE 
J075177E12ATGGCCCACAANONE 
J075194D14ATGGCCCACAANONE 
Os12g0408800AK059660ATGGCCCACCTNONE 
AK068032ATGGCCCACCTNONE 
J013131D11ATGGCCCACCTNONE 
Os12g0550800006-091-A05ATGGCCCAGCNONE 
AK061828ATGGCCCAGCNONE 
AK098944ATGGCCCAGCNONE 
AK102550ATGGCCCAGCHypothetical protein. 
J013045G24ATGGCCCAGCNONE 
J065156K11ATGGCCCAGCNONE 
J065201E21ATGGCCCAGCNONE 
Os12g0572400016-084-F04ATGGCCCACAANONE 
AK065531ATGGCCCACAASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ATGGCCCACAANONE 
J013034H02ATGGCCCACAANONE 
J033117N05ATGGCCCACAANONE 
J065027L09ATGGCCCACAANONE 
J065037D09ATGGCCCACAANONE 
J065197I09ATGGCCCACAANONE 
J090045C01ATGGCCCACAANONE 
J100031E11ATGGCCCACAANONE 
Os12g0575000009-057-B12ATTGGGCCATNONE 
009-113-B05ATTGGGCCATNONE 
009-170-F09ATTGGGCCATNONE 
009-191-D05ATTGGGCCATNONE 
AK059885ATTGGGCCATNONE 
AK104945ATTGGGCCATProtein of unknown function DUF1118 family protein. 
J013124C09ATTGGGCCATNONE 
J013156G23ATTGGGCCATNONE 
J023033G18ATTGGGCCATNONE 
J065055H05ATTGGGCCATNONE 
J065129P17ATTGGGCCATNONE 
J065188E10ATTGGGCCATNONE 
J065195J24ATTGGGCCATNONE 
J075027I24ATTGGGCCATNONE 
J075028H07ATTGGGCCATNONE 
J075032A03ATTGGGCCATNONE 
J075057M10ATTGGGCCATNONE 
J075093K11ATTGGGCCATNONE 
J075098D20ATTGGGCCATNONE 
J075126N24ATTGGGCCATNONE 
J075140M14ATTGGGCCATNONE 
J075140M21ATTGGGCCATNONE 
J075147P07ATTGGGCCATNONE 
J075153F12ATTGGGCCATNONE 
J075157C13ATTGGGCCATNONE 
J075174K01ATTGGGCCATNONE 
J075194B17ATTGGGCCATNONE 
J075195E11ATTGGGCCATNONE 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 
Os12g0624800AK103828AGTTGGGCCATHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.