version

Summary of OsREG488 (All List)

OrganismOryza sativa  
IDOsREG488  
SequenceATGGGCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2219  

Entry Sequences (2219 entries)

LocusGene modelSequenceDescription
Os01g0160200AK073444ATGGCCCATGNONE 
AK102533ATGGCCCATGLeucine rich repeat, N-terminal domain containing protein. 
J033044L19ATGGCCCATGNONE 
J033096F04ATGGCCCATGNONE 
Os01g0175400AK102191AATGGGCCACAnkyrin repeat containing protein. 
Os01g0191800AK061360GTGGCCCATGNONE 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0222700012-011-E01ATGGCCCATTTNONE 
AK068883ATGGCCCATTTNONE 
AK101946ATGGCCCATTTZinc finger, BED-type predicted domain containing protein. 
J033075C16ATGGCCCATTTNONE 
J043013D08ATGGCCCATTTNONE 
J065089G19ATGGCCCATTTNONE 
J065197K19ATGGCCCATTTNONE 
J075161L21ATGGCCCATTTNONE 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0231700012-002-F11ATGGCCCATANONE 
013-082-F05ATGGCCCATANONE 
AK107453ATGGCCCATASimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATGGCCCATANONE 
J065023E21ATGGCCCATANONE 
J065036H21ATGGCCCATANONE 
J065037M24ATGGCCCATANONE 
J065049L04ATGGCCCATANONE 
J065072F17ATGGCCCATANONE 
J065085H10ATGGCCCATANONE 
J065109N19ATGGCCCATANONE 
J065117M19ATGGCCCATANONE 
J065144C15ATGGCCCATANONE 
J065159G24ATGGCCCATANONE 
J065164N14ATGGCCCATANONE 
J075025K16ATGGCCCATANONE 
J075057L05ATGGCCCATANONE 
J075070I16ATGGCCCATANONE 
J075089D10ATGGCCCATANONE 
J075138F10ATGGCCCATANONE 
J090018C11ATGGCCCATANONE 
J100018L19ATGGCCCATANONE 
J100024B14ATGGCCCATANONE 
J100048L02ATGGCCCATANONE 
J100055A22ATGGCCCATANONE 
J100069K01ATGGCCCATANONE 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0270100006-096-H09ATATGGGCCACNONE 
009-009-C10ATATGGGCCACNONE 
009-054-E06ATATGGGCCACNONE 
014-085-F09ATATGGGCCACNONE 
AK073275ATATGGGCCACNONE 
AK104155ATATGGGCCACNONE 
AK119511ATATGGGCCACSimilar to Cysteine protease inhibitor. 
J033025K21ATATGGGCCACNONE 
J075065H10ATATGGGCCACNONE 
J075143G10ATATGGGCCACNONE 
J100059J02ATATGGGCCACNONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
AK073165GTATGGGCCAGConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
J033023G08GTATGGGCCAGNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
004-018-B01CTGGCCCATACNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK060908CTGGCCCATACNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK071713CTGGCCCATACSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK104205CTGGCCCATACNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
AK122051CTGGCCCATACNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19CTGGCCCATACNONE 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0369000AK064940AAATGGGCCAGSimilar to Cullin-1. 
AK104340AAATGGGCCAGNONE 
AY336990AAATGGGCCAGNONE 
J013000P07AAATGGGCCAGNONE 
J013056B18AAATGGGCCAGNONE 
J013056B20AAATGGGCCAGNONE 
J013098C09AAATGGGCCAGNONE 
J013099E23AAATGGGCCAGNONE 
J023007E10AAATGGGCCAGNONE 
J023064L04AAATGGGCCAGNONE 
J023119B15AAATGGGCCAGNONE 
J023126O19AAATGGGCCAGNONE 
J033120G16AAATGGGCCAGNONE 
J043007K19AAATGGGCCAGNONE 
J065037I22AAATGGGCCAGNONE 
J065051D18AAATGGGCCAGNONE 
J065073N09AAATGGGCCAGNONE 
J065084K20AAATGGGCCAGNONE 
J065115C15AAATGGGCCAGNONE 
J065115M01AAATGGGCCAGNONE 
J065121O10AAATGGGCCAGNONE 
J065197H21AAATGGGCCAGNONE 
J065211L23AAATGGGCCAGNONE 
J065214M19AAATGGGCCAGNONE 
J090006F13AAATGGGCCAGNONE 
J090012M21AAATGGGCCAGNONE 
J090029M05AAATGGGCCAGNONE 
J090048P16AAATGGGCCAGNONE 
J090051H13AAATGGGCCAGNONE 
J090062C14AAATGGGCCAGNONE 
J090072F21AAATGGGCCAGNONE 
J090085D11AAATGGGCCAGNONE 
J090090N24AAATGGGCCAGNONE 
J090095K17AAATGGGCCAGNONE 
J090099H12AAATGGGCCAGNONE 
J100031B11AAATGGGCCAGNONE 
J100053C15AAATGGGCCAGNONE 
J100075F19AAATGGGCCAGNONE 
J100087L22AAATGGGCCAGNONE 
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023121K24CCATGGGCCACNONE 
Os01g0517800J075194B21TCTGGCCCATAProtein of unknown function DUF597 family protein. 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0672700AK121375AAATGGGCCAGDNA polymerase, beta-like region domain containing protein. 
J023127C22AAATGGGCCAGNONE 
J033092B05AAATGGGCCAGNONE 
J033129P21AAATGGGCCAGNONE 
J065079H18AAATGGGCCAGNONE 
Os01g0738600AK073479TTGGCCCATGGENTH/VHS domain containing protein. 
AK120616TTGGCCCATGGNONE 
J013046M12TTGGCCCATGGNONE 
J013152B11TTGGCCCATGGNONE 
J023007A09TTGGCCCATGGNONE 
J023007N03TTGGCCCATGGNONE 
J023042A01TTGGCCCATGGNONE 
J023059P06TTGGCCCATGGNONE 
J023113A05TTGGCCCATGGNONE 
J033044K11TTGGCCCATGGNONE 
J033082E04TTGGCCCATGGNONE 
J090033B13TTGGCCCATGGNONE 
J090062H08TTGGCCCATGGNONE 
J100086G23TTGGCCCATGGNONE 
Os01g0756400J065065A17ATGGCCCATTTNONE 
J075076N03ATGGCCCATTTNONE 
J075120O13ATGGCCCATTTNONE 
J075177C24ATGGCCCATTTNONE 
J080010J02ATGGCCCATTTNONE 
J080018F20ATGGCCCATTTNONE 
J080034I03ATGGCCCATTTNONE 
J080043P21ATGGCCCATTTNONE 
J080068B17ATGGCCCATTTNONE 
J080070F19ATGGCCCATTTNONE 
J080076D05ATGGCCCATTTNONE 
J080077E01ATGGCCCATTTNONE 
J080096C10ATGGCCCATTTNONE 
J080301B21ATGGCCCATTTNONE 
J080304K22ATGGCCCATTTNONE 
Os01g0764300J090053G03AGCCCAATGGGCCATProtein of unknown function DUF155 family protein. 
J090053G03CTGGCCCATTTProtein of unknown function DUF155 family protein. 
Os01g0765600AK108944TGATGGGCCATEF-Hand type domain containing protein. 
Os01g0794900AK106644CTGGCCCATTTConserved hypothetical protein. 
Os01g0801000AK064082AGATGGGCCATNONE 
AK101426AGATGGGCCATSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
Os01g0831900011-058-G07CCATGGGCCAGANONE 
AK063959CCATGGGCCAGANONE 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
J033084D13CCATGGGCCAGANONE 
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH. 
Os01g0851000AK065338TTGGCCCATATPfkB domain containing protein. 
Os01g0863300014-030-D08ATGGCCCATGGNONE 
AK111571ATGGCCCATGGSimilar to MCB2 protein. 
J013071A13ATGGCCCATGGNONE 
J075060E09ATGGCCCATGGNONE 
J075138C14ATGGCCCATGGNONE 
J075150M17ATGGCCCATGGNONE 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0895100AK058611TTGGCCCATTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TTGGCCCATTNONE 
AK099166TTGGCCCATTNONE 
J023065I03TTGGCCCATTNONE 
J023081J06TTGGCCCATTNONE 
J023126H17TTGGCCCATTNONE 
J023126O09TTGGCCCATTNONE 
J033035I06TTGGCCCATTNONE 
J090065C10TTGGCCCATTNONE 
J090095O16TTGGCCCATTNONE 
Os01g0916300011-018-B12TATGGGCCACNONE 
AK063922TATGGGCCACSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TATGGGCCACNONE 
AK121061TATGGGCCACNONE 
AK121997TATGGGCCACNONE 
J033118P14TATGGGCCACNONE 
J065002N16TATGGGCCACNONE 
J065079B04TATGGGCCACNONE 
J065102J07TATGGGCCACNONE 
J065128F16TATGGGCCACNONE 
J065184D11TATGGGCCACNONE 
J065186A07TATGGGCCACNONE 
J075115C07TATGGGCCACNONE 
J075147C04TATGGGCCACNONE 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0937300AK062872CCATGGGCCACNONE 
J033136K12CCATGGGCCACNONE 
J053048E20CCATGGGCCACNONE 
J053088K08CCATGGGCCACNONE 
J065011G23CCATGGGCCACNONE 
J065202J09CCATGGGCCACNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0953100AK064981TTGGCCCATTTNONE 
AK068882TTGGCCCATTTProtein of unknown function DUF594 family protein. 
J013001C07TTGGCCCATTTNONE 
J013169K14TTGGCCCATTTNONE 
J033114G07TTGGCCCATTTNONE 
J065035K15TTGGCCCATTTNONE 
J065082E12TTGGCCCATTTNONE 
Os01g0954400003-009-F12CGATGGGCCAGNONE 
012-080-B09CGATGGGCCAGNONE 
AK065709CGATGGGCCAGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGATGGGCCAGNONE 
J013039J02CGATGGGCCAGNONE 
J033081E17CGATGGGCCAGNONE 
J075058B02CGATGGGCCAGNONE 
J075067K19CGATGGGCCAGNONE 
J075120E23CGATGGGCCAGNONE 
J075147I16CGATGGGCCAGNONE 
Os01g0960300AK100099TTGGCCCATATSimilar to Glucose inhibited division protein A. 
Os02g0103800006-046-H11GTGGCCCATGANONE 
006-060-B05GTGGCCCATGANONE 
006-097-A09GTGGCCCATGANONE 
006-102-A10GTGGCCCATGANONE 
006-104-E11GTGGCCCATGANONE 
006-112-D09GTGGCCCATGANONE 
AK061774GTGGCCCATGANONE 
AK065309GTGGCCCATGANONE 
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGCCCATGANONE 
J013026F06GTGGCCCATGANONE 
J013037O14GTGGCCCATGANONE 
J013066N06GTGGCCCATGANONE 
J013108G22GTGGCCCATGANONE 
J023050M15GTGGCCCATGANONE 
J023054B21GTGGCCCATGANONE 
J023073C23GTGGCCCATGANONE 
J023086H17GTGGCCCATGANONE 
J023105A20GTGGCCCATGANONE 
J065019E16GTGGCCCATGANONE 
J065064G10GTGGCCCATGANONE 
J065071C18GTGGCCCATGANONE 
J065103B02GTGGCCCATGANONE 
J065153G06GTGGCCCATGANONE 
J075152G24GTGGCCCATGANONE 
J075166P04GTGGCCCATGANONE 
J080001F02GTGGCCCATGANONE 
J080001M07GTGGCCCATGANONE 
J080001O05GTGGCCCATGANONE 
J080003I19GTGGCCCATGANONE 
J080004C12GTGGCCCATGANONE 
J080008E17GTGGCCCATGANONE 
J080008M08GTGGCCCATGANONE 
J080010H21GTGGCCCATGANONE 
J080011F22GTGGCCCATGANONE 
J080012C16GTGGCCCATGANONE 
J080013D20GTGGCCCATGANONE 
J080018K15GTGGCCCATGANONE 
J080020O14GTGGCCCATGANONE 
J080020P21GTGGCCCATGANONE 
J080021A07GTGGCCCATGANONE 
J080021B06GTGGCCCATGANONE 
J080022G21GTGGCCCATGANONE 
J080022P14GTGGCCCATGANONE 
J080023H24GTGGCCCATGANONE 
J080023M08GTGGCCCATGANONE 
J080027E08GTGGCCCATGANONE 
J080027E18GTGGCCCATGANONE 
J080027O16GTGGCCCATGANONE 
J080029M22GTGGCCCATGANONE 
J080034A17GTGGCCCATGANONE 
J080038G04GTGGCCCATGANONE 
J080040F13GTGGCCCATGANONE 
J080040F22GTGGCCCATGANONE 
J080041L15GTGGCCCATGANONE 
J080042L04GTGGCCCATGANONE 
J080042M14GTGGCCCATGANONE 
J080043C22GTGGCCCATGANONE 
J080043O09GTGGCCCATGANONE 
J080045N17GTGGCCCATGANONE 
J080046N08GTGGCCCATGANONE 
J080047K11GTGGCCCATGANONE 
J080047O06GTGGCCCATGANONE 
J080048H10GTGGCCCATGANONE 
J080048N03GTGGCCCATGANONE 
J080050N02GTGGCCCATGANONE 
J080051A05GTGGCCCATGANONE 
J080052I20GTGGCCCATGANONE 
J080053E08GTGGCCCATGANONE 
J080055P05GTGGCCCATGANONE 
J080056F15GTGGCCCATGANONE 
J080056H07GTGGCCCATGANONE 
J080057M20GTGGCCCATGANONE 
J080059K09GTGGCCCATGANONE 
J080059M10GTGGCCCATGANONE 
J080060B12GTGGCCCATGANONE 
J080061N09GTGGCCCATGANONE 
J080062H11GTGGCCCATGANONE 
J080062M13GTGGCCCATGANONE 
J080063D14GTGGCCCATGANONE 
J080063G10GTGGCCCATGANONE 
J080063H18GTGGCCCATGANONE 
J080066J23GTGGCCCATGANONE 
J080067J06GTGGCCCATGANONE 
J080069I11GTGGCCCATGANONE 
J080069O22GTGGCCCATGANONE 
J080070P11GTGGCCCATGANONE 
J080072D06GTGGCCCATGANONE 
J080072J22GTGGCCCATGANONE 
J080075A20GTGGCCCATGANONE 
J080076F11GTGGCCCATGANONE 
J080076J24GTGGCCCATGANONE 
J080076K05GTGGCCCATGANONE 
J080077O10GTGGCCCATGANONE 
J080078L19GTGGCCCATGANONE 
J080080I08GTGGCCCATGANONE 
J080081J23GTGGCCCATGANONE 
J080083A17GTGGCCCATGANONE 
J080085C05GTGGCCCATGANONE 
J080086G24GTGGCCCATGANONE 
J080087H02GTGGCCCATGANONE 
J080089A13GTGGCCCATGANONE 
J080090K08GTGGCCCATGANONE 
J080092M01GTGGCCCATGANONE 
J080095A19GTGGCCCATGANONE 
J080095B20GTGGCCCATGANONE 
J100028F13GTGGCCCATGANONE 
J100040G22GTGGCCCATGANONE 
Os02g0162500009-181-F03TTGGCCCATCCNONE 
AK058907TTGGCCCATCCNONE 
AK121223TTGGCCCATCCSimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCATCCNONE 
J023136J11TTGGCCCATCCNONE 
J053097J20TTGGCCCATCCNONE 
J053098F01TTGGCCCATCCNONE 
J065065B09TTGGCCCATCCNONE 
J065082M04TTGGCCCATCCNONE 
J065188O05TTGGCCCATCCNONE 
J075057P15TTGGCCCATCCNONE 
J075061J08TTGGCCCATCCNONE 
J075061N15TTGGCCCATCCNONE 
J075131I08TTGGCCCATCCNONE 
J075141H13TTGGCCCATCCNONE 
J080062E14TTGGCCCATCCNONE 
J080062P15TTGGCCCATCCNONE 
J080318G17TTGGCCCATCCNONE 
J080319G19TTGGCCCATCCNONE 
J090001L10TTGGCCCATCCNONE 
J090024I18TTGGCCCATCCNONE 
J090033F24TTGGCCCATCCNONE 
J090036M16TTGGCCCATCCNONE 
J090040I24TTGGCCCATCCNONE 
J090048P06TTGGCCCATCCNONE 
J090049B12TTGGCCCATCCNONE 
J090068C02TTGGCCCATCCNONE 
J090069O04TTGGCCCATCCNONE 
J090084H22TTGGCCCATCCNONE 
J100022L03TTGGCCCATCCNONE 
J100028O14TTGGCCCATCCNONE 
J100028O18TTGGCCCATCCNONE 
J100032A15TTGGCCCATCCNONE 
J100033D21TTGGCCCATCCNONE 
J100034J23TTGGCCCATCCNONE 
J100043K22TTGGCCCATCCNONE 
J100052M22TTGGCCCATCCNONE 
J100053N03TTGGCCCATCCNONE 
J100074N24TTGGCCCATCCNONE 
J100082J10TTGGCCCATCCNONE 
Os02g0169000AK101628AGATGGGCCAAConserved hypothetical protein. 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0186700AK064492CTGGCCCATCAConserved hypothetical protein. 
J065210K09CTGGCCCATCANONE 
J075006A17CTGGCCCATCANONE 
J075108C18CTGGCCCATCANONE 
J075153E08CTGGCCCATCANONE 
Os02g0192500AK059580TTGGCCCATGNONE 
Os02g0198000AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0274000006-082-B11TCATGGGCCATNONE 
009-149-B01TCATGGGCCATNONE 
013-005-D02TCATGGGCCATNONE 
AK061802TCATGGGCCATNONE 
AK099750TCATGGGCCATConserved hypothetical protein. 
J013092A18TCATGGGCCATNONE 
J065205D02TCATGGGCCATNONE 
J080305A06TCATGGGCCATNONE 
J080306D13TCATGGGCCATNONE 
J090043E14TCATGGGCCATNONE 
J100023E14TCATGGGCCATNONE 
J100041A16TCATGGGCCATNONE 
J100078K21TCATGGGCCATNONE 
Os02g0288200AK073147GTGGCCCATTTNONE 
Os02g0467200014-053-H06GTGGCCCATTNONE 
AK063704GTGGCCCATTConserved hypothetical protein. 
J065197J05GTGGCCCATTNONE 
Os02g0498100009-180-H04ATGGCCCATCGNONE 
AK112058ATGGCCCATCGConserved hypothetical protein. 
Os02g0527300AK101934CTGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11CTGGCCCATCCNONE 
J033073P11CTGGCCCATCCNONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0595400AK069935CTGGCCCATATConserved hypothetical protein. 
AK099175CTGGCCCATATNONE 
AK103993CTGGCCCATATNONE 
J065021M23CTGGCCCATATNONE 
J065021M24CTGGCCCATATNONE 
J065205M09CTGGCCCATATNONE 
J100082C06CTGGCCCATATNONE 
Os02g0601500016-057-F12GTGGCCCATTANONE 
J075091F02GTGGCCCATTACytochrome P450 family protein. 
Os02g0634800003-004-F03TCTGGCCCATCTNONE 
AK059694TCTGGCCCATCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCTGGCCCATCTNONE 
J053077G20TCTGGCCCATCTNONE 
J075195F14TCTGGCCCATCTNONE 
Os02g0634900006-032-G12AGATGGGCCAGANONE 
006-033-E09AGATGGGCCAGANONE 
006-117-F10AGATGGGCCAGANONE 
006-118-E01AGATGGGCCAGANONE 
013-056-G08AGATGGGCCAGANONE 
AK059769AGATGGGCCAGANONE 
AK068583AGATGGGCCAGANONE 
AK072855AGATGGGCCAGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGATGGGCCAGANONE 
J023138P05AGATGGGCCAGANONE 
J023143J07AGATGGGCCAGANONE 
J033022O09AGATGGGCCAGANONE 
J033111L02AGATGGGCCAGANONE 
J033135O03AGATGGGCCAGANONE 
J065005K19AGATGGGCCAGANONE 
J065044C17AGATGGGCCAGANONE 
J065116K09AGATGGGCCAGANONE 
J065119O21AGATGGGCCAGANONE 
J075014L05AGATGGGCCAGANONE 
J075109H16AGATGGGCCAGANONE 
J075117D04AGATGGGCCAGANONE 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0643500AK068423TCATGGGCCAAPentapeptide repeat containing protein. 
Os02g0655300006-024-H05CCATGGGCCACNONE 
006-032-G04CCATGGGCCACNONE 
006-045-F03CCATGGGCCACNONE 
006-076-D04CCATGGGCCACNONE 
006-086-C09CCATGGGCCACNONE 
006-104-C07CCATGGGCCACNONE 
AK061544CCATGGGCCACNONE 
AK103778CCATGGGCCACNONE 
AK106107CCATGGGCCACNONE 
AK120006CCATGGGCCACNONE 
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21CCATGGGCCACNONE 
J065021C16CCATGGGCCACNONE 
J065182F01CCATGGGCCACNONE 
J075063I18CCATGGGCCACNONE 
J075151E01CCATGGGCCACNONE 
J075198K18CCATGGGCCACNONE 
J090026M06CCATGGGCCACNONE 
J090081H02CCATGGGCCACNONE 
J100061E20CCATGGGCCACNONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0665400AK073914TCATGGGCCACNONE 
AK109787TCATGGGCCACNONE 
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TCATGGGCCACNONE 
J075165B08TCATGGGCCACNONE 
J075177B03TCATGGGCCACNONE 
J075191K02TCATGGGCCACNONE 
J090051I12TCATGGGCCACNONE 
J090057E21TCATGGGCCACNONE 
J090058E01TCATGGGCCACNONE 
J090087C06TCATGGGCCACNONE 
J100025K07TCATGGGCCACNONE 
J100026I21TCATGGGCCACNONE 
J100041E12TCATGGGCCACNONE 
J100083B01TCATGGGCCACNONE 
Os02g0686300AK066567GTGGCCCATCTConserved hypothetical protein. 
Os02g0689200011-024-D04ATGGCCCATAANONE 
AK071254ATGGCCCATAANONE 
AK072660ATGGCCCATAAProtein of unknown function DUF250 domain containing protein. 
J023087G23ATGGCCCATAANONE 
J023134O11ATGGCCCATAANONE 
J033095E21ATGGCCCATAANONE 
J033113F12ATGGCCCATAANONE 
J033124F02ATGGCCCATAANONE 
J065070A01ATGGCCCATAANONE 
J065129C05ATGGCCCATAANONE 
J065165M19ATGGCCCATAANONE 
J090015K07ATGGCCCATAANONE 
J090066D21ATGGCCCATAANONE 
J090075M20ATGGCCCATAANONE 
Os02g0753200AK067176TTGGCCCATATConserved hypothetical protein. 
AK067176TTGGCCCATATConserved hypothetical protein. 
J013097D23TTGGCCCATATNONE 
J013097D23TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
Os02g0753300012-010-H04ATGGCCCATGGNONE 
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein. 
AK104930ATGGCCCATGGNONE 
J013038J04ATGGCCCATGGNONE 
J065041B21ATGGCCCATGGNONE 
J065162K13ATGGCCCATGGNONE 
J065187G18ATGGCCCATGGNONE 
J075051J11ATGGCCCATGGNONE 
J100027H02ATGGCCCATGGNONE 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J100032C19ATATGGGCCAACGGCCNONE 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0769700AK111328CATGGGCCATProtein kinase-like domain containing protein. 
Os02g0782200AK070439TCTGGCCCATCANONE 
AK101869TCTGGCCCATCANOT2/NOT3/NOT5 domain containing protein. 
Os02g0795900012-075-B04AATGGGCCACCGCACNONE 
AK105305AATGGGCCACCGCACSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21AATGGGCCACCGCACNONE 
Os02g0796900009-121-E06AAATGGGCCACNONE 
D29725AAATGGGCCACSimilar to 60S ribosomal protein L39. 
J075016N24AAATGGGCCACNONE 
J075085F03AAATGGGCCACNONE 
J075147P11AAATGGGCCACNONE 
J075180E16AAATGGGCCACNONE 
J075182A19AAATGGGCCACNONE 
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein. 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0815200AK067252ATGGCCCATASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489ATGGCCCATANONE 
Os02g0819500AK058926TGATGGGCCAANONE 
Os02g0820600AK066549TATGGGCTATGGGCCATConserved hypothetical protein. 
J013070F02TATGGGCTATGGGCCATNONE 
Os02g0820700006-025-E04ATGGCCCATAGCCCATANONE 
006-052-F06ATGGCCCATAGCCCATANONE 
006-082-A05ATGGCCCATAGCCCATANONE 
006-089-B06ATGGCCCATAGCCCATANONE 
AK060869ATGGCCCATAGCCCATASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365ATGGCCCATAGCCCATANONE 
AK103008ATGGCCCATAGCCCATANONE 
AK104724ATGGCCCATAGCCCATANONE 
J013049H21ATGGCCCATAGCCCATANONE 
J043027N22ATGGCCCATAGCCCATANONE 
J075031I15ATGGCCCATAGCCCATANONE 
J075132D23ATGGCCCATAGCCCATANONE 
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein. 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0830100AK059746TGATGGGCCATNONE 
J013032G02TTGGCCCATGANONE 
J013052O21TTGGCCCATGANONE 
J023078A05TTGGCCCATGANONE 
J033114C07TTGGCCCATGANONE 
J033125M07TTGGCCCATGANONE 
J053045C11TTGGCCCATGANONE 
J100055G05TTGGCCCATGANONE 
J100080J22TTGGCCCATGANONE 
Os02g0832200AK108268TTGGCCCATCTConserved hypothetical protein. 
J065053F07TTGGCCCATCTNONE 
J065095B09TTGGCCCATCTNONE 
J065137I11TTGGCCCATCTNONE 
J065187O12TTGGCCCATCTNONE 
J075193O05TTGGCCCATCTNONE 
Os03g0108500AK108704CTGGCCCATCGSimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0138600Os03g0138600AGATGGGCCATProtein of unknown function DUF810 family protein. 
Os03g0139000006-059-C06GTATGGGCCACNONE 
006-059-C06TTGGCCCATANONE 
009-055-F07GTATGGGCCACNONE 
009-055-F07TTGGCCCATANONE 
AK060973GTATGGGCCACConserved hypothetical protein. 
AK060973TTGGCCCATAConserved hypothetical protein. 
AK103850GTATGGGCCACNONE 
AK103850TTGGCCCATANONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein. 
Os03g0225600AK058500TGATGGGCCAAConserved oligomeric complex COG6 family protein. 
Os03g0249900AK058379ATATGGGCCACConserved hypothetical protein. 
Os03g0279200009-097-C06TTGGCCCATCCNONE 
013-007-B07TTGGCCCATCCNONE 
AK121750TTGGCCCATCCSimilar to Histone H2A. 
J033087I02TTGGCCCATCCNONE 
J065002G20TTGGCCCATCCNONE 
J065102M04TTGGCCCATCCNONE 
J065139A02TTGGCCCATCCNONE 
J075109D21TTGGCCCATCCNONE 
J075191L12TTGGCCCATCCNONE 
J090096C03TTGGCCCATCCNONE 
J100036C23TTGGCCCATCCNONE 
Os03g0283300AK070169ATGGCCCATCTConserved hypothetical protein. 
Os03g0294200AK069285TTGGCCCATTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0312600AK073391TGATGGGCCAGSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0321800006-065-G02GTGGCCCATTTNONE 
AK061075GTGGCCCATTTNONE 
AK111447GTGGCCCATTTSimilar to WRKY transcription factor 55. 
J065122E07GTGGCCCATTTNONE 
J065187N05GTGGCCCATTTNONE 
J065214K09GTGGCCCATTTNONE 
J090050M01GTGGCCCATTTNONE 
Os03g0324800AK059868ACATGGGCCATNONE 
AK071431ACATGGGCCATHypothetical protein. 
Os03g0324900014-018-F11GTGGCCCATGANONE 
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein. 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
AK102274ACATGGGCCAGANONE 
J033089C06ACATGGGCCAGANONE 
J090089A17ACATGGGCCAGANONE 
Os03g0346500009-180-F12GTATGGGCCATNONE 
AK063139GTATGGGCCATHypothetical protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0364000J065042L07ATGGCCCATANONE 
J065061O16ATGGCCCATANONE 
J065075L02ATGGCCCATANONE 
J065138N02ATGGCCCATANONE 
J065209H20ATGGCCCATANONE 
J075019G03ATGGCCCATANONE 
J075086E23ATGGCCCATANONE 
J075094M12ATGGCCCATANONE 
J075139L07ATGGCCCATANONE 
J075162I16ATGGCCCATANONE 
J075199G20ATGGCCCATANONE 
Os03g0381000AK069332AATGGGCCAASimilar to Aldose 1-epimerase-like protein. 
J023010L17AATGGGCCAANONE 
Os03g0383100AK107106AGCCCAATGGGCCAGAConserved hypothetical protein. 
AK107106CTGGCCCATGAConserved hypothetical protein. 
Os03g0395000AK073283TTGGCCCATCASimilar to Heme oxygenase 2 (Fragment). 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0566600011-071-A08ACATGGGCCATNONE 
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein. 
Os03g0566800AK103270CATGGGCCATSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CATGGGCCATNONE 
J023136P06CATGGGCCATNONE 
J033081A22CATGGGCCATNONE 
J033109N12CATGGGCCATNONE 
J033124H10CATGGGCCATNONE 
J033141B09CATGGGCCATNONE 
J090026G23CATGGGCCATNONE 
J090077J20CATGGGCCATNONE 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0586800003-114-H11TCATGGGCCAGGCCCNONE 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TCATGGGCCAGGCCCNONE 
J090004H06TCATGGGCCAGGCCCNONE 
J090022N15TCATGGGCCAGGCCCNONE 
J100035E05TCATGGGCCAGGCCCNONE 
J100041L05TCATGGGCCAGGCCCNONE 
J100041M18TCATGGGCCAGGCCCNONE 
J100057P04TCATGGGCCAGGCCCNONE 
J100089H06TCATGGGCCAGGCCCNONE 
J100090C23TCATGGGCCAGGCCCNONE 
Os03g0626250J075100A11TTGGCCCATCANONE 
J075134H15TTGGCCCATCANONE 
J075142J02TTGGCCCATCANONE 
J075181A14TTGGCCCATCANONE 
J075192K17TTGGCCCATCANONE 
J090046B06TTGGCCCATCANONE 
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0681900006-042-F08ATGGCCCATTANONE 
009-043-F12ATGGCCCATTANONE 
AK061750ATGGCCCATTANONE 
AK062094ATGGCCCATTASimilar to RGP-3 (Fragment). 
J033034F01ATGGCCCATTANONE 
J033131F11ATGGCCCATTANONE 
J033143N03ATGGCCCATTANONE 
Os03g0683700AK065067AGATGGGCCAAProtein of unknown function DUF810 family protein. 
Os03g0685900009-026-A09CTGGCCCATCANONE 
009-145-C09CTGGCCCATCANONE 
AK062981CTGGCCCATCAConserved hypothetical protein. 
J065001D12CTGGCCCATCANONE 
J065023B10CTGGCCCATCANONE 
J065041E10CTGGCCCATCANONE 
J065046C01CTGGCCCATCANONE 
J065146I22CTGGCCCATCANONE 
J065184F20CTGGCCCATCANONE 
J075011E15CTGGCCCATCANONE 
J075048H17CTGGCCCATCANONE 
J075070H15CTGGCCCATCANONE 
J075133C01CTGGCCCATCANONE 
J075170D02CTGGCCCATCANONE 
J090001G08CTGGCCCATCANONE 
J090026B09CTGGCCCATCANONE 
J100055M03CTGGCCCATCANONE 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0725300011-085-E09GTATGGGCCAANONE 
AK063969GTATGGGCCAASimilar to Dbr1-prov protein. 
AK073636GTATGGGCCAANONE 
J033050L15GTATGGGCCAANONE 
J053082G03GTATGGGCCAANONE 
Os03g0725400015-060-D03ATGGCCCATCGNONE 
AK105499ATGGCCCATCGSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860ATGGCCCATCGNONE 
AK112085ATGGCCCATCGNONE 
J100068K06ATGGCCCATCGNONE 
J100073K24ATGGCCCATCGNONE 
J100084M24ATGGCCCATCGNONE 
Os03g0736700006-022-F08ATGGCCCATGGNONE 
006-042-H09ATGGCCCATGGNONE 
006-053-H02ATGGCCCATGGNONE 
009-127-A06ATGGCCCATGGNONE 
013-089-C06ATGGCCCATGGNONE 
AK060947ATGGCCCATGGGRAM domain containing protein. 
AK073026ATGGCCCATGGNONE 
AK104415ATGGCCCATGGNONE 
AK104642ATGGCCCATGGNONE 
J065027H19ATGGCCCATGGNONE 
J065059K06ATGGCCCATGGNONE 
J065065I02ATGGCCCATGGNONE 
J065085E10ATGGCCCATGGNONE 
J065140M09ATGGCCCATGGNONE 
J075115M21ATGGCCCATGGNONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0746400AK063445TTGGCCCATATProtein prenyltransferase domain containing protein. 
AK070923TTGGCCCATATNONE 
J065008K24TTGGCCCATATNONE 
Os03g0746600AK069559TAATGGGCCACWD40-like domain containing protein. 
J023141K22TAATGGGCCACNONE 
Os03g0757900011-060-H04GTGGCCCATGGNONE 
011-082-B10GTGGCCCATGGNONE 
012-053-F12GTGGCCCATGGNONE 
013-029-C07GTGGCCCATGGNONE 
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
J023009B02GTGGCCCATGGNONE 
J023085H11GTGGCCCATGGNONE 
J023135M18GTGGCCCATGGNONE 
J023147P04GTGGCCCATGGNONE 
J033072J22GTGGCCCATGGNONE 
J033128J06GTGGCCCATGGNONE 
Os03g0766000AK070596TTATGGGCCATNONE 
AK104743TTATGGGCCATNONE 
AK106079TTATGGGCCATNONE 
J013063M09TTATGGGCCATNONE 
J023056A03TTATGGGCCATNONE 
J043038L07TTATGGGCCATNONE 
J053067N16TTATGGGCCATNONE 
J053073G09TTATGGGCCATNONE 
J053075I19TTATGGGCCATNONE 
Os03g0766900AK066137TAATGGGCCAGAllene oxide synthase. 
AK071361TAATGGGCCAGNONE 
AK103989TAATGGGCCAGNONE 
J023090K09TAATGGGCCAGNONE 
J043022H11TAATGGGCCAGNONE 
J053078F12TAATGGGCCAGNONE 
Os03g0769600AK100054CCATGGGCCACResB-like family protein. 
Os03g0771500AB028884AGATGGGCCATKnotted1-type homeobox protein OSH43. 
AK107296AGATGGGCCATNONE 
Os03g0774200AK065851AGATGGGCCAGANONE 
AK119532AGATGGGCCAGASimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AGATGGGCCAGANONE 
J023107I03AGATGGGCCAGANONE 
J065156I19AGATGGGCCAGANONE 
J065176L07AGATGGGCCAGANONE 
J100066F15AGATGGGCCAGANONE 
Os03g0784000AK067337TTATGGGCCAANONE 
AK100003TTATGGGCCAAFAD dependent oxidoreductase family protein. 
J013102O14TTATGGGCCAANONE 
J013135F18TTATGGGCCAANONE 
Os03g0798600AK121716AAATGGGCCAGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18AAATGGGCCAGNONE 
J033079G18AAATGGGCCAGNONE 
J043038B19AAATGGGCCAGNONE 
J065091E15AAATGGGCCAGNONE 
J065092P10AAATGGGCCAGNONE 
J065189F18AAATGGGCCAGNONE 
J065189L12AAATGGGCCAGNONE 
J075021B11AAATGGGCCAGNONE 
J075022L15AAATGGGCCAGNONE 
J075046G12AAATGGGCCAGNONE 
J075080H15AAATGGGCCAGNONE 
J090045H01AAATGGGCCAGNONE 
J090077H16AAATGGGCCAGNONE 
J090083D22AAATGGGCCAGNONE 
J100021D24AAATGGGCCAGNONE 
J100023G04AAATGGGCCAGNONE 
J100049J23AAATGGGCCAGNONE 
J100075K23AAATGGGCCAGNONE 
J100077G22AAATGGGCCAGNONE 
Os03g0801800AK067130ATGGCCCATTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17ATGGCCCATTNONE 
J090087F23ATGGCCCATTNONE 
Os03g0807800AK064984ATGGCCCATGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14ATGGCCCATGNONE 
J065015J20ATGGCCCATGNONE 
J065122L11ATGGCCCATGNONE 
J065217E10ATGGCCCATGNONE 
J075023C02ATGGCCCATGNONE 
J075102O04ATGGCCCATGNONE 
J080024G24ATGGCCCATGNONE 
J080033F02ATGGCCCATGNONE 
J080047M13ATGGCCCATGNONE 
J080048A22ATGGCCCATGNONE 
J080056E06ATGGCCCATGNONE 
J080064O11ATGGCCCATGNONE 
Os03g0809700J023093B03AAATGGGCCAANONE 
Os03g0828100009-088-D04AAATGGGCCAANONE 
009-088-D04CTGGCCCATCANONE 
009-125-F01AAATGGGCCAANONE 
009-125-F01CTGGCCCATCANONE 
009-169-C06AAATGGGCCAANONE 
009-169-C06CTGGCCCATCANONE 
AK059132AAATGGGCCAANONE 
AK059132CTGGCCCATCANONE 
AK062799AAATGGGCCAANONE 
AK062799CTGGCCCATCANONE 
AK099043AAATGGGCCAASimilar to 50S ribosomal protein L18. 
AK099043CTGGCCCATCASimilar to 50S ribosomal protein L18. 
J013146D01AAATGGGCCAANONE 
J013146D01CTGGCCCATCANONE 
J065057J16AAATGGGCCAANONE 
J065057J16CTGGCCCATCANONE 
Os03g0834000AB080084AATGGGCCAAFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391AATGGGCCAANONE 
AK062149AATGGGCCAANONE 
AK069540AATGGGCCAANONE 
J013047J01AATGGGCCAANONE 
J023019F12AATGGGCCAANONE 
J043004H21AATGGGCCAANONE 
Os03g0837300AK111243TTGGCCCATCANONE 
AK121140TTGGCCCATCANicotinate phosphoribosyltransferase and related family protein. 
AY214337TTGGCCCATCANONE 
J023077G12TTGGCCCATCANONE 
J023078M10TTGGCCCATCANONE 
J033031B10TTGGCCCATCANONE 
J033067L18TTGGCCCATCANONE 
J043005P09TTGGCCCATCANONE 
J090013J15TTGGCCCATCANONE 
J090042E10TTGGCCCATCANONE 
J090045A20TTGGCCCATCANONE 
J100022H02TTGGCCCATCANONE 
Os03g0844600AK059168TTGGCCCATTTLipolytic enzyme, G-D-S-L family protein. 
Os03g0846400AK067706CGATGGGCCACNONE 
AK070549CGATGGGCCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0852600009-174-G04TTGGCCCATTANONE 
AK063101TTGGCCCATTAProtein of unknown function DUF565 family protein. 
J065131H12TTGGCCCATTANONE 
J090046K24TTGGCCCATTANONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os03g0855600006-029-G09GTGGCCCATGGNONE 
006-033-E02GTGGCCCATGGNONE 
006-069-G07GTGGCCCATGGNONE 
006-083-A02GTGGCCCATGGNONE 
006-098-H04GTGGCCCATGGNONE 
009-054-C04GTGGCCCATGGNONE 
AK060030GTGGCCCATGGNONE 
AK061467GTGGCCCATGGConserved hypothetical protein. 
AK067858GTGGCCCATGGNONE 
AK106030GTGGCCCATGGNONE 
J013123A10GTGGCCCATGGNONE 
J065001I24GTGGCCCATGGNONE 
J065015N21GTGGCCCATGGNONE 
J065016H07GTGGCCCATGGNONE 
J065040A05GTGGCCCATGGNONE 
J065040F01GTGGCCCATGGNONE 
J065066G17GTGGCCCATGGNONE 
J065077I09GTGGCCCATGGNONE 
J065099M22GTGGCCCATGGNONE 
J065135B13GTGGCCCATGGNONE 
J065144H19GTGGCCCATGGNONE 
J065146I03GTGGCCCATGGNONE 
J065169E02GTGGCCCATGGNONE 
J065177D21GTGGCCCATGGNONE 
J065189L20GTGGCCCATGGNONE 
J065207H13GTGGCCCATGGNONE 
J065210D24GTGGCCCATGGNONE 
J065212I03GTGGCCCATGGNONE 
J075007E21GTGGCCCATGGNONE 
J075013H07GTGGCCCATGGNONE 
J075023K06GTGGCCCATGGNONE 
J075031D23GTGGCCCATGGNONE 
J075038K09GTGGCCCATGGNONE 
J075084C08GTGGCCCATGGNONE 
J075098K20GTGGCCCATGGNONE 
J090028E04GTGGCCCATGGNONE 
J090031E20GTGGCCCATGGNONE 
J090042F06GTGGCCCATGGNONE 
J090049L05GTGGCCCATGGNONE 
J090086G03GTGGCCCATGGNONE 
J090096J04GTGGCCCATGGNONE 
J100035O03GTGGCCCATGGNONE 
J100053H24GTGGCCCATGGNONE 
J100056L17GTGGCCCATGGNONE 
J100058K06GTGGCCCATGGNONE 
J100059G09GTGGCCCATGGNONE 
J100081C15GTGGCCCATGGNONE 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0407300AK101793ATGGCCCATACNONE 
AK121980ATGGCCCATACHypothetical protein. 
J033065K23ATGGCCCATACNONE 
J033108L11ATGGCCCATACNONE 
Os04g0428900009-068-A06AGATGGGCCAGANONE 
AK061355AGATGGGCCAGASimilar to CSN8. 
AK099153AGATGGGCCAGANONE 
AY336991AGATGGGCCAGANONE 
J023069F08AGATGGGCCAGANONE 
J065112H12AGATGGGCCAGANONE 
J075022F23AGATGGGCCAGANONE 
J090045D23AGATGGGCCAGANONE 
J090067E18AGATGGGCCAGANONE 
J090099H14AGATGGGCCAGANONE 
Os04g0462900006-094-A02AATGGGCCACCACCTGTCNONE 
006-097-F05AATGGGCCACCACCTGTCNONE 
009-129-A10AATGGGCCACCACCTGTCNONE 
015-042-F07AATGGGCCACCACCTGTCNONE 
AK058481AATGGGCCACCACCTGTCNONE 
AK059483AATGGGCCACCACCTGTCNONE 
AK061324AATGGGCCACCACCTGTCNONE 
AK099100AATGGGCCACCACCTGTCNONE 
AK102579AATGGGCCACCACCTGTCNONE 
AK106322AATGGGCCACCACCTGTCSimilar to Prohibitin. 
J065059J20AATGGGCCACCACCTGTCNONE 
J065085I02AATGGGCCACCACCTGTCNONE 
J065118N23AATGGGCCACCACCTGTCNONE 
J065208K24AATGGGCCACCACCTGTCNONE 
J075053B14AATGGGCCACCACCTGTCNONE 
J075097M22AATGGGCCACCACCTGTCNONE 
J075184B07AATGGGCCACCACCTGTCNONE 
J075194A15AATGGGCCACCACCTGTCNONE 
J080315G03AATGGGCCACCACCTGTCNONE 
J090088H19AATGGGCCACCACCTGTCNONE 
Os04g0473400AK067896AAATGGGCCAASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20AAATGGGCCAANONE 
J033108A09AAATGGGCCAANONE 
J065196E24AAATGGGCCAANONE 
J100066B16AAATGGGCCAANONE 
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein. 
Os04g0486400AJ535489TATGGGCCATNONE 
AK103296TATGGGCCATRML1 protein. 
J013045L03TATGGGCCATNONE 
J013045M03TATGGGCCATNONE 
J033034L24TATGGGCCATNONE 
J033125B02TATGGGCCATNONE 
J075001G08TATGGGCCATNONE 
J075011I16TATGGGCCATNONE 
J075033M08TATGGGCCATNONE 
J075044G01TATGGGCCATNONE 
J075047D04TATGGGCCATNONE 
J075061J09TATGGGCCATNONE 
J075085L07TATGGGCCATNONE 
J075087D20TATGGGCCATNONE 
J075117A04TATGGGCCATNONE 
J075134H06TATGGGCCATNONE 
J075184J12TATGGGCCATNONE 
Os04g0551300AK103502TGATGGGCCAASimilar to Growth regulator like protein. 
Os04g0570600AK106747AGATGGGCCAGACytochrome P450 family protein. 
J080319G08AGATGGGCCAGANONE 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0577000AK073711CTGGCCCATATUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CTGGCCCATATNONE 
J013127H04CTGGCCCATATNONE 
J033035G06CTGGCCCATATNONE 
J033061G23CTGGCCCATATNONE 
J033127L07CTGGCCCATATNONE 
J065015F17CTGGCCCATATNONE 
J065062G08CTGGCCCATATNONE 
J065132M07CTGGCCCATATNONE 
J065155C12CTGGCCCATATNONE 
J075055I08CTGGCCCATATNONE 
J075140D07CTGGCCCATATNONE 
J090055B21CTGGCCCATATNONE 
J100031D23CTGGCCCATATNONE 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0592500AK066893TAATGGGCCAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TAATGGGCCAANONE 
Os04g0610500006-115-C07AATGGGCCACNONE 
AK066289AATGGGCCACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AATGGGCCACNONE 
J013096N09AATGGGCCACNONE 
J023054I11AATGGGCCACNONE 
J023121P20AATGGGCCACNONE 
J053039O20AATGGGCCACNONE 
J053071L20AATGGGCCACNONE 
J053088H23AATGGGCCACNONE 
J053096J03AATGGGCCACNONE 
Os04g0611300009-006-G08TTGGCCCATCCANONE 
009-011-C01TTGGCCCATCCANONE 
009-036-B09TTGGCCCATCCANONE 
009-116-G09TTGGCCCATCCANONE 
009-126-E09TTGGCCCATCCANONE 
009-132-F09TTGGCCCATCCANONE 
009-151-G07TTGGCCCATCCANONE 
009-155-C07TTGGCCCATCCANONE 
009-163-G01TTGGCCCATCCANONE 
009-169-G08TTGGCCCATCCANONE 
009-191-B02TTGGCCCATCCANONE 
009-196-A08TTGGCCCATCCANONE 
009-198-E07TTGGCCCATCCANONE 
014-015-F04TTGGCCCATCCANONE 
015-087-H04TTGGCCCATCCANONE 
AK062605TTGGCCCATCCANONE 
AK063022TTGGCCCATCCAConserved hypothetical protein. 
AK066749TTGGCCCATCCANONE 
AK104924TTGGCCCATCCANONE 
J065002M20TTGGCCCATCCANONE 
J065045L23TTGGCCCATCCANONE 
J065101E05TTGGCCCATCCANONE 
J065140J23TTGGCCCATCCANONE 
J065179G11TTGGCCCATCCANONE 
J065191B18TTGGCCCATCCANONE 
J065192E03TTGGCCCATCCANONE 
J065199H21TTGGCCCATCCANONE 
J075067F01TTGGCCCATCCANONE 
J075089L01TTGGCCCATCCANONE 
J075147K22TTGGCCCATCCANONE 
J080069G23TTGGCCCATCCANONE 
J100053D10TTGGCCCATCCANONE 
J100078C10TTGGCCCATCCANONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0658800AK111108CTGGCCCATCCConserved hypothetical protein. 
Os04g0659000009-172-A09ATGGCCCATTTNONE 
AK063095ATGGCCCATTTConserved hypothetical protein. 
J065062J07ATGGCCCATTTNONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0678800AK072212CTGGCCCATTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CTGGCCCATTANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0685100AK065262ATGGCCCATCTRibosomal biogenesis regulatory protein family protein. 
J013002J24ATGGCCCATCTNONE 
J013030M11ATGGCCCATCTNONE 
J033139J12ATGGCCCATCTNONE 
J065013D12ATGGCCCATCTNONE 
J065117J01ATGGCCCATCTNONE 
J065143K20ATGGCCCATCTNONE 
J065181E12ATGGCCCATCTNONE 
J065184A17ATGGCCCATCTNONE 
J065193B13ATGGCCCATCTNONE 
J065196H01ATGGCCCATCTNONE 
J075072G17ATGGCCCATCTNONE 
J075077B02ATGGCCCATCTNONE 
J075088A06ATGGCCCATCTNONE 
J075099H13ATGGCCCATCTNONE 
J075111O04ATGGCCCATCTNONE 
J075131F20ATGGCCCATCTNONE 
J075139K01ATGGCCCATCTNONE 
J075194I16ATGGCCCATCTNONE 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04ACATGGGCCAGANONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0118000AK110694TCTGGCCCATCTSRR1 domain containing protein. 
Os05g0144800AK099724ATGGCCCATAASimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0152400Os05g0152400AAATGGGCCACGlycosyl transferase, family 14 protein. 
Os05g0161400AK105485TGATGGGCCAAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0168400006-039-A06TAATGGGCCAANONE 
AK069800TAATGGGCCAANONE 
AK106195TAATGGGCCAAConserved hypothetical protein. 
J065086N09TAATGGGCCAANONE 
J065137B10TAATGGGCCAANONE 
J075062B04TAATGGGCCAANONE 
J075193I07TAATGGGCCAANONE 
J075193K24TAATGGGCCAANONE 
J075194D10TAATGGGCCAANONE 
J100037F01TAATGGGCCAANONE 
J100071E09TAATGGGCCAANONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0194550J075140P14GGATGGGCCAGAConserved hypothetical protein. 
Os05g0378900AK103841ATGGCCCATCTConserved hypothetical protein. 
AK103841TTGGCCCATTConserved hypothetical protein. 
J033148I18ATGGCCCATCTNONE 
J033148I18TTGGCCCATTNONE 
J065085F12ATGGCCCATCTNONE 
J065085F12TTGGCCCATTNONE 
J075041H24ATGGCCCATCTNONE 
J075041H24TTGGCCCATTNONE 
J075180P06ATGGCCCATCTNONE 
J075180P06TTGGCCCATTNONE 
Os05g0417200AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0445500009-021-C05TCTGGCCCATTNONE 
009-129-D11TCTGGCCCATTNONE 
009-147-E04TCTGGCCCATTNONE 
009-169-C11TCTGGCCCATTNONE 
AK121459TCTGGCCCATTSimilar to 60S acidic ribosomal protein P2B. 
D21114TCTGGCCCATTNONE 
J023001K23TCTGGCCCATTNONE 
J023107J19TCTGGCCCATTNONE 
J023143J09TCTGGCCCATTNONE 
J065049D04TCTGGCCCATTNONE 
J065092I06TCTGGCCCATTNONE 
J065188H04TCTGGCCCATTNONE 
Os05g0456300006-096-G05GTGGCCCATGGNONE 
006-108-F09GTGGCCCATGGNONE 
AK061843GTGGCCCATGGNONE 
AK068616GTGGCCCATGGSimilar to Aldose reductase. 
J013156J23GTGGCCCATGGNONE 
J023080O21GTGGCCCATGGNONE 
J043031L21GTGGCCCATGGNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033143O14GAGGCCCATGGGCCATNONE 
Os05g0488900AK071883CTGGCCCATGSimilar to Cytochrome b5 reductase. 
AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699CTGGCCCATGNONE 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459CTGGCCCATGNONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06CTGGCCCATGNONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09CTGGCCCATGNONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24CTGGCCCATGNONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15CTGGCCCATGNONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06CTGGCCCATGNONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16CTGGCCCATGNONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0499300009-151-H01GGATGGGCCAGNONE 
013-049-G05GGATGGGCCAGNONE 
AK066855GGATGGGCCAGNONE 
AK104950GGATGGGCCAGSimilar to Peroxidase (EC 1.11.1.7). 
D14997GGATGGGCCAGNONE 
Os05g0506000AF031609CGTGTGGCCCATCGNONE 
AK062012CGTGTGGCCCATCGNONE 
AK098900CGTGTGGCCCATCGNONE 
AK122090CGTGTGGCCCATCGSimilar to MS5-like protein (Fragment). 
J013002B13CGTGTGGCCCATCGNONE 
J023149G13CGTGTGGCCCATCGNONE 
J033123O20CGTGTGGCCCATCGNONE 
J080315O17CGTGTGGCCCATCGNONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0526800016-054-G05ACATGGGCCATNONE 
016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ACATGGGCCATNONE 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ACATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ACATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0528200009-146-C01ATGGCCCATGNONE 
009-146-C01TTGGCCCATGANONE 
AK062985ATGGCCCATGSimilar to 50S ribosomal protein L20. 
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20. 
Os05g0541900009-130-F05ACATGGGCCAANONE 
009-200-E07ACATGGGCCAANONE 
013-057-G09ACATGGGCCAANONE 
Os05g0558900AK101679TCATGGGCCATSimilar to Frsb-prov protein. 
J013028M08TCATGGGCCATNONE 
J013074E16TCATGGGCCATNONE 
J013096L01TCATGGGCCATNONE 
J023085M19TCATGGGCCATNONE 
J033058I10TCATGGGCCATNONE 
J033091D18TCATGGGCCATNONE 
J033111H13TCATGGGCCATNONE 
J033114C18TCATGGGCCATNONE 
Os05g0565200004-015-E06ATATGGGCCAGNONE 
AK067090ATATGGGCCAGSimilar to Urease accessory protein G. 
AK104200ATATGGGCCAGNONE 
AK104368ATATGGGCCAGNONE 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0577900016-028-C02CTGGCCCATANONE 
AK064201CTGGCCCATAConserved hypothetical protein. 
Os05g0578000AK065040TATGGGCCAGSimilar to PEX14 protein. 
J013001H17TATGGGCCAGNONE 
J013036A06TATGGGCCAGNONE 
J033122K08TATGGGCCAGNONE 
Os05g0580500AK102000TTGGCCCATGANONE 
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein. 
Os05g0588200AK109323TCTGGCCCATCCRuvA domain 2-like containing protein. 
AK109323TTGGCCCATAARuvA domain 2-like containing protein. 
AK109323TTGGCCCATTTRuvA domain 2-like containing protein. 
Os05g0594800AK058332GGGCTTTTATATGGGCCATAdhesion regulating molecule family protein. 
AK068013GGGCTTTTATATGGGCCATNONE 
J013129L24GGGCTTTTATATGGGCCATNONE 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0116400006-082-G06ATGGCCCATCANONE 
AK058327ATGGCCCATCANONE 
AK105979ATGGCCCATCAHigh-affinity nickel-transporter family protein. 
J065083I24ATGGCCCATCANONE 
J100072O18ATGGCCCATCANONE 
Os06g0134000AK102796CCATGGGCCAGNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0192500AK067746ATGGCCCATATATP-dependent helicase, DEAH-box family protein. 
J065023K06ATGGCCCATATNONE 
J100063P08ATGGCCCATATNONE 
J100065N03ATGGCCCATATNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0220800AK059876GTATGGGCCAANONE 
AY739306GTATGGGCCAAThioredoxin domain 2 containing protein. 
J075093C09GTATGGGCCAANONE 
J100026J18GTATGGGCCAANONE 
J100041O16GTATGGGCCAANONE 
J100089K16GTATGGGCCAANONE 
Os06g0316100011-089-C01TTGGCCCATGNONE 
015-030-D11TTGGCCCATGNONE 
015-044-H10TTGGCCCATGNONE 
AK105260TTGGCCCATGConserved hypothetical protein. 
AK119646TTGGCCCATGNONE 
Os06g0325500011-037-D06TAATGGGCCAGNONE 
011-093-G07TAATGGGCCAGNONE 
AK063974TAATGGGCCAGProtein of unknown function DUF89 family protein. 
AK099286TAATGGGCCAGNONE 
J065124G18TAATGGGCCAGNONE 
J065160K08TAATGGGCCAGNONE 
J065207O08TAATGGGCCAGNONE 
J075011D18TAATGGGCCAGNONE 
J075012D02TAATGGGCCAGNONE 
J075090F13TAATGGGCCAGNONE 
J075164A04TAATGGGCCAGNONE 
J075198I19TAATGGGCCAGNONE 
Os06g0542300J100050D16TTGGCCCATCAHeavy metal transport/detoxification protein domain containing protein. 
J100052L04TTGGCCCATCANONE 
Os06g0545800J023014L13CATGGGCCACNONE 
J023019D15CATGGGCCACNONE 
J023031O10CATGGGCCACNONE 
J023041K05CATGGGCCACNONE 
J023044D07CATGGGCCACNONE 
J023054D06CATGGGCCACNONE 
J023088I12CATGGGCCACNONE 
J023093O06CATGGGCCACNONE 
J023105M09CATGGGCCACNONE 
J023109C07CATGGGCCACSimilar to Exopolygalacturonase precursor (EC 3.2.1.67) (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase). 
J023135P03CATGGGCCACNONE 
Os06g0573700015-015-F02GGATGGGCCAGNONE 
AK106254GGATGGGCCAGConserved hypothetical protein. 
J065172G24GGATGGGCCAGNONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0607800012-010-G03AAATGGGCCAANONE 
AB070254AAATGGGCCAANONE 
AK063158AAATGGGCCAASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCCAANONE 
J013074G13AAATGGGCCAANONE 
J090015C16AAATGGGCCAANONE 
J090069H10AAATGGGCCAANONE 
Os06g0607900AK070879TAATGGGCCATNONE 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0663600AK100787GTGGCCCATCCEndonuclease V family protein. 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0670100AK102577CTGGCCCATCAHypothetical protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0702800009-039-E05ACATGGGCCAGNONE 
009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGHypothetical protein. 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGNONE 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0727400AK069558AGATGGGCCAGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os06g0730900AK062118GTGGCCCATGGNONE 
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
AK065172GTGGCCCATGGNONE 
AK099361GTGGCCCATGGNONE 
Os07g0124500012-092-F01ATGGCCCATATNONE 
AK070529ATGGCCCATATSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000ATGGCCCATATNONE 
J090007O11ATGGCCCATATNONE 
J090010E02ATGGCCCATATNONE 
J090078C04ATGGCCCATATNONE 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0154300009-070-E08TAATGGGCCATNONE 
009-077-E01TAATGGGCCATNONE 
009-196-F05TAATGGGCCATNONE 
AK105386TAATGGGCCATConserved hypothetical protein. 
AK122093TAATGGGCCATNONE 
J033124K14TAATGGGCCATNONE 
J075006I22TAATGGGCCATNONE 
J075185G02TAATGGGCCATNONE 
J090039C02TAATGGGCCATNONE 
Os07g0180900006-055-B11ATATGGGCCAANONE 
006-103-F09ATATGGGCCAANONE 
011-009-E03ATATGGGCCAANONE 
011-035-H08ATATGGGCCAANONE 
014-043-F08ATATGGGCCAANONE 
AK060711ATATGGGCCAARibosomal protein L4/L1e family protein. 
AK060963ATATGGGCCAANONE 
AK104447ATATGGGCCAANONE 
AK104504ATATGGGCCAANONE 
AK104629ATATGGGCCAANONE 
J023003P15ATATGGGCCAANONE 
J023075H14ATATGGGCCAANONE 
J033101N17ATATGGGCCAANONE 
J033132M11ATATGGGCCAANONE 
J065081C24ATATGGGCCAANONE 
J080004L10ATATGGGCCAANONE 
J080009H21ATATGGGCCAANONE 
J080013F01ATATGGGCCAANONE 
J080022K24ATATGGGCCAANONE 
J080023C22ATATGGGCCAANONE 
J080024M16ATATGGGCCAANONE 
J080026K06ATATGGGCCAANONE 
J080030J23ATATGGGCCAANONE 
J080030L05ATATGGGCCAANONE 
J080031G03ATATGGGCCAANONE 
J080033C03ATATGGGCCAANONE 
J080033D02ATATGGGCCAANONE 
J080035A11ATATGGGCCAANONE 
J080035A14ATATGGGCCAANONE 
J080039E08ATATGGGCCAANONE 
J080040L15ATATGGGCCAANONE 
J080040M03ATATGGGCCAANONE 
J080041L21ATATGGGCCAANONE 
J080043E09ATATGGGCCAANONE 
J080048B14ATATGGGCCAANONE 
J080048O09ATATGGGCCAANONE 
J080051H01ATATGGGCCAANONE 
J080052H06ATATGGGCCAANONE 
J080065K05ATATGGGCCAANONE 
J080066D10ATATGGGCCAANONE 
J080066E23ATATGGGCCAANONE 
J080069F10ATATGGGCCAANONE 
J080074M06ATATGGGCCAANONE 
J080075D13ATATGGGCCAANONE 
J080076G02ATATGGGCCAANONE 
J080082G15ATATGGGCCAANONE 
J080082K06ATATGGGCCAANONE 
J080082P12ATATGGGCCAANONE 
J080085F01ATATGGGCCAANONE 
J080090H22ATATGGGCCAANONE 
J080092D07ATATGGGCCAANONE 
J080094M03ATATGGGCCAANONE 
J080094O10ATATGGGCCAANONE 
J090008I06ATATGGGCCAANONE 
J100058N20ATATGGGCCAANONE 
J100060M07ATATGGGCCAANONE 
J100062M08ATATGGGCCAANONE 
J100064L07ATATGGGCCAANONE 
J100073H16ATATGGGCCAANONE 
J100074C10ATATGGGCCAANONE 
J100075N06ATATGGGCCAANONE 
J100087P11ATATGGGCCAANONE 
J100088B13ATATGGGCCAANONE 
J100088J16ATATGGGCCAANONE 
J100088L17ATATGGGCCAANONE 
J100088O12ATATGGGCCAANONE 
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein. 
Os07g0435400AK111603AAATGGGCCAASimilar to WD40. 
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
Os07g0486000AK069343GGATGGGCCAGASimilar to MSH4. 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0513200015-004-B02TATGGGCCACNONE 
015-004-B02TTGGCCCATCANONE 
AK101410TATGGGCCACNONE 
AK101410TTGGCCCATCANONE 
AK106227TATGGGCCACNONE 
AK106227TTGGCCCATCANONE 
AK119451TATGGGCCACProtein prenyltransferase domain containing protein. 
AK119451TTGGCCCATCAProtein prenyltransferase domain containing protein. 
Os07g0558200AK065243TAATGGGCCAAInositol monophosphatase family protein. 
Os07g0595700003-103-G05CGATGGGCCACACGNONE 
AK108488CGATGGGCCACACGConserved hypothetical protein. 
J065136O05CGATGGGCCACACGNONE 
Os07g0595800011-069-G09CGTGTGGCCCATCGNONE 
AK066349CGTGTGGCCCATCGPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CGTGTGGCCCATCGNONE 
Os07g0598900015-040-C12GTATGGGCCATNONE 
AK102627GTATGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GTATGGGCCATNONE 
J033087C18GTATGGGCCATNONE 
J033099K03GTATGGGCCATNONE 
J065054E02GTATGGGCCATNONE 
J090055O05GTATGGGCCATNONE 
Os07g0616900AK071047TGGATGGGCCAAProtein of unknown function DUF500 family protein. 
J013106G03TGGATGGGCCAANONE 
J013124C20TGGATGGGCCAANONE 
J033096D16TGGATGGGCCAANONE 
J043005E08TGGATGGGCCAANONE 
J065197K12TGGATGGGCCAANONE 
J065211I03TGGATGGGCCAANONE 
Os07g0626100009-127-G03AATGGGCCAANONE 
AK062899AATGGGCCAASimilar to 50S ribosomal protein L7/L12. 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0635500011-089-H07ATGGCCCATGGNONE 
016-030-A09ATGGCCCATGGNONE 
AK106081ATGGCCCATGGNONE 
AK121733ATGGCCCATGGSimilar to Cytochrome P450. 
J043036I03ATGGCCCATGGNONE 
J065001N22ATGGCCCATGGNONE 
J065035I03ATGGCCCATGGNONE 
J065167G12ATGGCCCATGGNONE 
J075041E07ATGGCCCATGGNONE 
J090007D08ATGGCCCATGGNONE 
J090089I24ATGGCCCATGGNONE 
J100026I23ATGGCCCATGGNONE 
J100027H19ATGGCCCATGGNONE 
J100044G07ATGGCCCATGGNONE 
J100089H22ATGGCCCATGGNONE 
J100090D03ATGGCCCATGGNONE 
J100090D22ATGGCCCATGGNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0681500AK100010TGATGGGCCAANONE 
Os07g0686600AK108527TGGGTCCCATGGGCCATVQ domain containing protein. 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0105800AK065355AATGGGCCAGANONE 
AK067200AATGGGCCAGACytochrome P450 family protein. 
Os08g0110200AK068841ACATGGGCCATSimilar to Fertility restorer. 
J090071I18ACATGGGCCATNONE 
Os08g0124000011-023-G08TGATGGGCCACNONE 
AK063293TGATGGGCCACSimilar to Resistance protein candidate (Fragment). 
AK067378TGATGGGCCACNONE 
J090067O21TGATGGGCCACNONE 
Os08g0137250J075030L12GTGGCCCATCTNONE 
J075037O21GTGGCCCATCTNONE 
J075078E23GTGGCCCATCTNONE 
J075079C23GTGGCCCATCTNONE 
J075092K02GTGGCCCATCTNONE 
J075108M04GTGGCCCATCTNONE 
J075112N13GTGGCCCATCTNONE 
J075132M13GTGGCCCATCTNONE 
J075146E07GTGGCCCATCTNONE 
J075159F16GTGGCCCATCTNONE 
J075166M12GTGGCCCATCTNONE 
J075185B10GTGGCCCATCTNONE 
J075193J10GTGGCCCATCTNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0178100AK101717TAATGGGCCAGAPep3/Vps18/deep orange domain containing protein. 
Os08g0206600AK064336TTGGCCCATCTAICARFT/IMPCHase bienzyme family protein. 
AK102764TTGGCCCATCTNONE 
Os08g0375800AK101199TAATGGGCCACProtein prenyltransferase domain containing protein. 
J033030L22TAATGGGCCACNONE 
Os08g0387050J043038F21TTGGCCCATTConserved hypothetical protein. 
Os08g0412200006-028-H07AAATGGGCCAANONE 
AJ575234AAATGGGCCAANONE 
AK059631AAATGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAATGGGCCAANONE 
AK104578AAATGGGCCAANONE 
J033071L08AAATGGGCCAANONE 
J065197K18AAATGGGCCAANONE 
Os08g0433400AJ495796TCATGGGCCATSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
AK059468TCATGGGCCATNONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0461300AK065651GTGGCCCATGTCyclin-like F-box domain containing protein. 
Os08g0465000J065121H01CTGGCCCATGHomeobox domain containing protein. 
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE 
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein. 
J100048N11ACCGGCCCAATGGGCCATNONE 
Os08g0469500AK109599ATATGGGCCAAConserved hypothetical protein. 
Os08g0471900015-099-E10TCTGGCCCATCANONE 
AK069434TCTGGCCCATCAZinc finger, ZPR1-type domain containing protein. 
Os08g0521400006-047-C11AGATGGGCCATNONE 
016-014-E07AGATGGGCCATNONE 
AK070148AGATGGGCCATNONE 
AK101704AGATGGGCCATZinc finger, RanBP2-type domain containing protein. 
AK105045AGATGGGCCATNONE 
J013108K14AGATGGGCCATNONE 
J013129E16AGATGGGCCATNONE 
J013159M23AGATGGGCCATNONE 
J023041G22AGATGGGCCATNONE 
J033060G13AGATGGGCCATNONE 
J033060J15AGATGGGCCATNONE 
J065120J24AGATGGGCCATNONE 
J065160I01AGATGGGCCATNONE 
J065179A16AGATGGGCCATNONE 
J065189K04AGATGGGCCATNONE 
J090032O15AGATGGGCCATNONE 
J090045A18AGATGGGCCATNONE 
J090060B21AGATGGGCCATNONE 
J090086F23AGATGGGCCATNONE 
J090098O22AGATGGGCCATNONE 
J100018K20AGATGGGCCATNONE 
J100048P22AGATGGGCCATNONE 
J100052I06AGATGGGCCATNONE 
Os08g0527400AK119389TTGGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
AK119389TTGGCCCATCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0530200009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0546300AK064717ATGGCCCATTAConserved hypothetical protein. 
AK119794ATGGCCCATTANONE 
D10982ATGGCCCATTANONE 
J080044B21ATGGCCCATTANONE 
Os08g0548900006-043-D07TCCGGCCCATGGGCCAANONE 
006-043-H11TCCGGCCCATGGGCCAANONE 
006-081-G06TCCGGCCCATGGGCCAANONE 
006-109-E04TCCGGCCCATGGGCCAANONE 
011-033-E04TCCGGCCCATGGGCCAANONE 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875TCCGGCCCATGGGCCAANONE 
J013001D12TCCGGCCCATGGGCCAANONE 
J033126N14TCCGGCCCATGGGCCAANONE 
J053069M09TCCGGCCCATGGGCCAANONE 
J053098E10TCCGGCCCATGGGCCAANONE 
J053101C24TCCGGCCCATGGGCCAANONE 
J065002F21TCCGGCCCATGGGCCAANONE 
J065006C22TCCGGCCCATGGGCCAANONE 
J065076J02TCCGGCCCATGGGCCAANONE 
J065134M22TCCGGCCCATGGGCCAANONE 
J075007M19TCCGGCCCATGGGCCAANONE 
J075040I11TCCGGCCCATGGGCCAANONE 
J075047E20TCCGGCCCATGGGCCAANONE 
J075052D22TCCGGCCCATGGGCCAANONE 
J075076L13TCCGGCCCATGGGCCAANONE 
J075157P22TCCGGCCCATGGGCCAANONE 
J075161M18TCCGGCCCATGGGCCAANONE 
J075168P22TCCGGCCCATGGGCCAANONE 
J075181E04TCCGGCCCATGGGCCAANONE 
U92540TCCGGCCCATGGGCCAANONE 
Os08g0553450Os08g0553450TCATGGGCCAAHypothetical protein. 
Os08g0558000J080005K14ACATGGGCCACNONE 
Os08g0564100AK063258GTGGCCCATGASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0120033AK069069TCTGGCCCATCTConserved hypothetical protein. 
Os09g0251800006-100-E12AGCCCATGGCCCATGGNONE 
AK061218AGCCCATGGCCCATGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010AGCCCATGGCCCATGGNONE 
J065048A02AGCCCATGGCCCATGGNONE 
J065073P10AGCCCATGGCCCATGGNONE 
J065075B09AGCCCATGGCCCATGGNONE 
J065112B05AGCCCATGGCCCATGGNONE 
J090014H10AGCCCATGGCCCATGGNONE 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0370300AK108199AAATGGGCCAGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0385300AK073247GTGGCCCATGTHypothetical protein. 
AK120455GTGGCCCATGTNONE 
J013104G23GTGGCCCATGTNONE 
J023110A14GTGGCCCATGTNONE 
J033143F07GTGGCCCATGTNONE 
J065036P14GTGGCCCATGTNONE 
J065041I11GTGGCCCATGTNONE 
J065103K11GTGGCCCATGTNONE 
J065138M15GTGGCCCATGTNONE 
J065138P09GTGGCCCATGTNONE 
J065141J20GTGGCCCATGTNONE 
J075063J16GTGGCCCATGTNONE 
J075063K19GTGGCCCATGTNONE 
J075085H08GTGGCCCATGTNONE 
J075093C12GTGGCCCATGTNONE 
J075127N08GTGGCCCATGTNONE 
J075134E09GTGGCCCATGTNONE 
J075166D06GTGGCCCATGTNONE 
J075168K24GTGGCCCATGTNONE 
J075197G05GTGGCCCATGTNONE 
J080034J24GTGGCCCATGTNONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0411700005-017-C05TCTGGCCCATTANONE 
009-163-B01TCTGGCCCATTANONE 
AK058290TCTGGCCCATTAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TCTGGCCCATTANONE 
AK121091TCTGGCCCATTANONE 
J013039D20TCTGGCCCATTANONE 
J023066F16TCTGGCCCATTANONE 
J023082H09TCTGGCCCATTANONE 
J023088H05TCTGGCCCATTANONE 
J065013G09TCTGGCCCATTANONE 
J065065C12TCTGGCCCATTANONE 
J065111I04TCTGGCCCATTANONE 
J065179H22TCTGGCCCATTANONE 
J075023N14TCTGGCCCATTANONE 
J090041J17TCTGGCCCATTANONE 
J100031J21TCTGGCCCATTANONE 
J100057A18TCTGGCCCATTANONE 
J100068P22TCTGGCCCATTANONE 
Os09g0419500016-067-D11TTGGCCCATGTNONE 
AK064394TTGGCCCATGTZinc finger, RING-type domain containing protein. 
AK073786TTGGCCCATGTNONE 
J033067G01TTGGCCCATGTNONE 
Os09g0433650J075094M19TAATGGGCCATTobacco mosaic virus coat protein family protein. 
Os09g0437900AK107833TTGGCCCATTTSimilar to Adrenodoxin. 
Os09g0458700J065112J22TCTGGCCCATCTCalcium-binding EF-hand domain containing protein. 
J065207F05TCTGGCCCATCTNONE 
Os09g0459800AK060764ATATGGGCCACNONE 
AK100324ATATGGGCCACSimilar to ARP protein. 
AK102736ATATGGGCCACNONE 
Os09g0485800AK108749TTGGCCCATTAConserved hypothetical protein. 
J065137H03TTGGCCCATTANONE 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0537600006-054-B05TAATGGGCCATNONE 
AK061004TAATGGGCCATSimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20TAATGGGCCATNONE 
J075029H16TAATGGGCCATNONE 
Os09g0542200006-092-A09ATATGGGCCAGANONE 
AK064887ATATGGGCCAGAThioredoxin fold domain containing protein. 
AK104804ATATGGGCCAGANONE 
J013000K12ATATGGGCCAGANONE 
J013170A19ATATGGGCCAGANONE 
J033103B02ATATGGGCCAGANONE 
J065196J20ATATGGGCCAGANONE 
J075037H17ATATGGGCCAGANONE 
J075069H14ATATGGGCCAGANONE 
J075071C16ATATGGGCCAGANONE 
J075095N02ATATGGGCCAGANONE 
J075136N03ATATGGGCCAGANONE 
J075192L16ATATGGGCCAGANONE 
J100057N23ATATGGGCCAGANONE 
J100060O07ATATGGGCCAGANONE 
J100062F10ATATGGGCCAGANONE 
J100077I08ATATGGGCCAGANONE 
J100086B07ATATGGGCCAGANONE 
J100088L14ATATGGGCCAGANONE 
Os09g0552300AK111721CTGGCCCATCTProtein kinase-like domain containing protein. 
J043013E21CTGGCCCATCTNONE 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0148000AK108267CTGGCCCATGGSodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTGGCCCATGGNONE 
J065110G12CTGGCCCATGGNONE 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0298400AK068577TTGGCCCATCARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0425800AK066603TTGGCCCATTASimilar to 60S ribosomal protein L13a. 
J065063A20TTGGCCCATTANONE 
J075021H08TTGGCCCATTANONE 
J075058J10TTGGCCCATTANONE 
J075088B15TTGGCCCATTANONE 
J075099E15TTGGCCCATTANONE 
J075110F13TTGGCCCATTANONE 
J075150G18TTGGCCCATTANONE 
J080312E14TTGGCCCATTANONE 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0594000J033124N02ATGGCCCATTNONE 
J100054J17ATGGCCCATTGeneral substrate transporter family protein. 
Os11g0620300AJ704770TCTGGCCCATGNONE 
AK107901TCTGGCCCATGSimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12TCTGGCCCATGNONE 
J075046J22TCTGGCCCATGNONE 
Os11g0629200AK065196ACATGGGCCAASimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0708000006-046-G03ATGGCCCATGGNONE 
AK072065ATGGCCCATGGNONE 
AK120102ATGGCCCATGGConserved hypothetical protein. 
J013022N13ATGGCCCATGGNONE 
J013062I09ATGGCCCATGGNONE 
J013066H01ATGGCCCATGGNONE 
J013067A19ATGGCCCATGGNONE 
J033107A16ATGGCCCATGGNONE 
J065068A18ATGGCCCATGGNONE 
J065118D08ATGGCCCATGGNONE 
J075056H13ATGGCCCATGGNONE 
J075156I15ATGGCCCATGGNONE 
J100045J12ATGGCCCATGGNONE 
Os12g0106000AF370029CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CCACGTGTGGCCCATCCNONE 
AK102242CCACGTGTGGCCCATCCNONE 
AY324879CCACGTGTGGCCCATCCNONE 
J053063M21CCACGTGTGGCCCATCCNONE 
J090080A16CCACGTGTGGCCCATCCNONE 
Os12g0211000AK101792ATGGCCCATGConserved hypothetical protein. 
J033065K09ATGGCCCATGNONE 
Os12g0299700AK071145ACATGGGCCACConserved hypothetical protein. 
AK071145TTGGCCCATTConserved hypothetical protein. 
J023082N05ACATGGGCCACNONE 
J023082N05TTGGCCCATTNONE 
Os12g0405700AK061920TGATGGGCCAGASimilar to Wound-induced basic protein. 
AK120436TGATGGGCCAGANONE 
Os12g0431100014-071-A04TCTGGCCCATGNONE 
AK063710TCTGGCCCATGAAA ATPase domain containing protein. 
Os12g0517100012-071-A03AAATGGGCCAGNONE 
012-071-A03GTGGCCCATCANONE 
AK073020AAATGGGCCAGCyclin-like F-box domain containing protein. 
AK073020GTGGCCCATCACyclin-like F-box domain containing protein. 
J023149K21AAATGGGCCAGNONE 
J023149K21GTGGCCCATCANONE 
Os12g0540000AK108630TCATGGGCCAGAConserved hypothetical protein. 
J065046N02TCATGGGCCAGANONE 
J065100H24TCATGGGCCAGANONE 
J065142M24TCATGGGCCAGANONE 
Os12g0548700J065076A08CATGGGCCAGNONE 
Os12g0569900Os12g0569900TATGGGCCAGASimilar to Zn finger protein (Fragment). 
Os12g0573000AK067552TTGGCCCATCCHypothetical protein. 
AK069292TTGGCCCATCCNONE 
Os12g0574800AK073004TTGGCCCATAANONE 
AK102465TTGGCCCATAABromodomain transcription factor containing protein. 
AK121687TTGGCCCATAANONE 
J033070O18TTGGCCCATAANONE 
J075097O17TTGGCCCATAANONE 
J080069F02TTGGCCCATAANONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0609800AK101303CTGGCCCATGGAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01CTGGCCCATGGAGCCCATCANONE 
J033033K21CTGGCCCATGGAGCCCATCANONE 
J033082L13CTGGCCCATGGAGCCCATCANONE 
J043034M20CTGGCCCATGGAGCCCATCANONE 
J065137J24CTGGCCCATGGAGCCCATCANONE 
J065141A11CTGGCCCATGGAGCCCATCANONE 
J065217H09CTGGCCCATGGAGCCCATCANONE 
Os12g0623700009-168-F09GTGGCCCATTTNONE 
AK063876GTGGCCCATTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.