version

Summary of OsREG489 (All List)

OrganismOryza sativa  
IDOsREG489  
SequenceATGGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1815  

Entry Sequences (1815 entries)

LocusGene modelSequenceDescription
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0191800AK061360GGGGCCCATACNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0203300015-045-F03AATGGGCCCTNONE 
AK106329AATGGGCCCTConserved hypothetical protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0530400016-019-E07AAATGGGCCCCAGNONE 
AK103724AAATGGGCCCCAGNONE 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
J023108F14AAATGGGCCCCAGNONE 
J033138C10AAATGGGCCCCAGNONE 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
J033133B01TCATGGGCCCAAATNONE 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0596700AK107371AAATGGGCCCCAFBD domain containing protein. 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0633200AK069077AGATGGGCCCTSimilar to X1 (Fragment). 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0700500AK072715CGGGCCCATCCCytochrome P450 family protein. 
AK119264CGGGCCCATCCNONE 
Os01g0707300AK059962AGATGGGCCCTNONE 
AK104463AGATGGGCCCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0727400AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0829266J065010C18TGTTGGGCCCATTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10TGTTGGGCCCATTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0832200004-009-E08GGTGGGCCCATCANONE 
009-103-F06GGTGGGCCCATCANONE 
AK060017GGTGGGCCCATCANONE 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
J023085I24GGTGGGCCCATCANONE 
J090016I03GGTGGGCCCATCANONE 
J090078K06GGTGGGCCCATCANONE 
Os01g0834200AK069188CATGGGCCCACANONE 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0842500011-030-F11CATGGGCCCCNONE 
AK066513CATGGGCCCCSimilar to Laccase (EC 1.10.3.2). 
Os01g0884400AK072566AGATGGGCCCTU box domain containing protein. 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0895100AK058611TAATGGGCCCATTTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TAATGGGCCCATTTNONE 
AK099166TAATGGGCCCATTTNONE 
J023065I03TAATGGGCCCATTTNONE 
J023081J06TAATGGGCCCATTTNONE 
J023126H17TAATGGGCCCATTTNONE 
J023126O09TAATGGGCCCATTTNONE 
J033035I06TAATGGGCCCATTTNONE 
J090065C10TAATGGGCCCATTTNONE 
J090095O16TAATGGGCCCATTTNONE 
Os01g0916700Os01g0916700AATGGGCCCTConserved hypothetical protein. 
Os01g0929500AK111399AATGGGCCCTSimilar to Carbonyl reductase-like protein. 
AK120263AATGGGCCCTNONE 
Os01g0952600AK067525CTTGGGCCCATACNONE 
AK070047CTTGGGCCCATACSimilar to LacZ (Fragment). 
Os01g0953100AK064981CGGGCCCATCTNONE 
AK068882CGGGCCCATCTProtein of unknown function DUF594 family protein. 
J013001C07CGGGCCCATCTNONE 
J013169K14CGGGCCCATCTNONE 
J033114G07CGGGCCCATCTNONE 
J065035K15CGGGCCCATCTNONE 
J065082E12CGGGCCCATCTNONE 
Os01g0964000AK073599GTATGGGCCCTSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012GTATGGGCCCTNONE 
AK104190GTATGGGCCCTNONE 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os01g0970900011-018-A07TGATGGGCCCATTNONE 
011-022-E12TGATGGGCCCATTNONE 
AK063285TGATGGGCCCATTNONE 
AK101688TGATGGGCCCATTProtein prenyltransferase domain containing protein. 
J100042L01TGATGGGCCCATTNONE 
J100053B11TGATGGGCCCATTNONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
AK062502ATTGGGCCCATCCANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J065161I07ATTGGGCCCATCCANONE 
J065184G15ATTGGGCCCATCCANONE 
J075123E02ATTGGGCCCATCCANONE 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0130300011-005-D07CATGGGCCCACCTNONE 
011-041-B06CATGGGCCCACCTNONE 
015-099-D11CATGGGCCCACCTNONE 
016-049-D06CATGGGCCCACCTNONE 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0165500AK060547TGATGGGCCCCConserved hypothetical protein. 
Os02g0180100005-013-B11TCATGGGCCCGNONE 
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700TCATGGGCCCGNONE 
J013090O22TCATGGGCCCGNONE 
J013099P19TCATGGGCCCGNONE 
J090041M21TCATGGGCCCGNONE 
J090049C14TCATGGGCCCGNONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0226600AK109849AGGGCCCATTPOX domain containing protein. 
Os02g0226900AK064279AGGGCCCATACProtein prenyltransferase domain containing protein. 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0549600009-119-C10ATATGGGCCCATCANONE 
AK066564ATATGGGCCCATCASimilar to 40S ribosomal protein S10-1. 
J013073I17ATATGGGCCCATCANONE 
J013104F19ATATGGGCCCATCANONE 
J013104K21ATATGGGCCCATCANONE 
J013110E05ATATGGGCCCATCANONE 
J023020L11ATATGGGCCCATCANONE 
J023130D08ATATGGGCCCATCANONE 
J033041D03ATATGGGCCCATCANONE 
J033105K14ATATGGGCCCATCANONE 
J065040N14ATATGGGCCCATCANONE 
J065157A09ATATGGGCCCATCANONE 
J075123A20ATATGGGCCCATCANONE 
J075129F06ATATGGGCCCATCANONE 
J075135E04ATATGGGCCCATCANONE 
J075173A10ATATGGGCCCATCANONE 
J080301E09ATATGGGCCCATCANONE 
J080306D10ATATGGGCCCATCANONE 
J080310M21ATATGGGCCCATCANONE 
J080312M09ATATGGGCCCATCANONE 
J080319J08ATATGGGCCCATCANONE 
J090036L14ATATGGGCCCATCANONE 
J090051D01ATATGGGCCCATCANONE 
J090066K07ATATGGGCCCATCANONE 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075129I09GTGTGGGCCCATGANONE 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0575900AK102188CGGGCCCATTExo70 exocyst complex subunit family protein. 
J033032M01CGGGCCCATTNONE 
J033086P19CGGGCCCATTNONE 
J033148L20CGGGCCCATTNONE 
J100040L08CGGGCCCATTNONE 
Os02g0638000AK103830AGATGGGCCCAGCNONE 
AK106548AGATGGGCCCAGCConserved hypothetical protein. 
Os02g0646400AK067828AATGGGCCCAAGSimilar to Glutaredoxin. 
J013120N01AATGGGCCCAAGNONE 
J065021N01AATGGGCCCAAGNONE 
J065021N02AATGGGCCCAAGNONE 
J065053O18AATGGGCCCAAGNONE 
J090067J17AATGGGCCCAAGNONE 
Os02g0667300009-057-D01GTATGGGCCCAAGNONE 
AK058228GTATGGGCCCAAGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GTATGGGCCCAAGNONE 
Os02g0670900003-115-B09TGTGGGCCCATGANONE 
005-004-F12TGTGGGCCCATGANONE 
006-037-B11TGTGGGCCCATGANONE 
006-094-B07TGTGGGCCCATGANONE 
011-020-A12TGTGGGCCCATGANONE 
AK061649TGTGGGCCCATGANONE 
AK061743TGTGGGCCCATGANONE 
AK064827TGTGGGCCCATGANONE 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
AK119517TGTGGGCCCATGANONE 
J013000F07TGTGGGCCCATGANONE 
J013027M02TGTGGGCCCATGANONE 
J013027M22TGTGGGCCCATGANONE 
J013031G16TGTGGGCCCATGANONE 
J013044H17TGTGGGCCCATGANONE 
J013045G22TGTGGGCCCATGANONE 
J013059N20TGTGGGCCCATGANONE 
J013063G15TGTGGGCCCATGANONE 
J013064J09TGTGGGCCCATGANONE 
J013089F14TGTGGGCCCATGANONE 
J013099L15TGTGGGCCCATGANONE 
J013119A08TGTGGGCCCATGANONE 
J013119B13TGTGGGCCCATGANONE 
J013126K07TGTGGGCCCATGANONE 
J023019J06TGTGGGCCCATGANONE 
J023019K19TGTGGGCCCATGANONE 
J023038I17TGTGGGCCCATGANONE 
J023042O17TGTGGGCCCATGANONE 
J023060G23TGTGGGCCCATGANONE 
J023064A12TGTGGGCCCATGANONE 
J023072G01TGTGGGCCCATGANONE 
J023108K16TGTGGGCCCATGANONE 
J023111D04TGTGGGCCCATGANONE 
J023134O14TGTGGGCCCATGANONE 
J023142P09TGTGGGCCCATGANONE 
J033039F01TGTGGGCCCATGANONE 
J033068J18TGTGGGCCCATGANONE 
J033117B05TGTGGGCCCATGANONE 
J033118I01TGTGGGCCCATGANONE 
J033136E10TGTGGGCCCATGANONE 
J033140C15TGTGGGCCCATGANONE 
J043024E09TGTGGGCCCATGANONE 
J043038B21TGTGGGCCCATGANONE 
J090005F19TGTGGGCCCATGANONE 
J090022N04TGTGGGCCCATGANONE 
J090023F15TGTGGGCCCATGANONE 
J090038O19TGTGGGCCCATGANONE 
J090042N22TGTGGGCCCATGANONE 
J090051C06TGTGGGCCCATGANONE 
J090063O09TGTGGGCCCATGANONE 
J090079N05TGTGGGCCCATGANONE 
J090096L17TGTGGGCCCATGANONE 
J100038G08TGTGGGCCCATGANONE 
J100041F17TGTGGGCCCATGANONE 
J100042G15TGTGGGCCCATGANONE 
J100042N11TGTGGGCCCATGANONE 
J100048B10TGTGGGCCCATGANONE 
J100056C24TGTGGGCCCATGANONE 
J100059K07TGTGGGCCCATGANONE 
J100069A06TGTGGGCCCATGANONE 
J100077B01TGTGGGCCCATGANONE 
J100089D17TGTGGGCCCATGANONE 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0756200AK063454CGGGCCCATGGNONE 
AK101655CGGGCCCATGGSimilar to Phi-1 protein. 
J065104L21CGGGCCCATGGNONE 
J065141A07CGGGCCCATGGNONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0794400AK065845AGATGGGCCCCAInitiation factor 3 family protein. 
J013042M03AGATGGGCCCCANONE 
Os02g0796500AK065276AAATGGGCCCCASimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK099581AAATGGGCCCCANONE 
AK120648AAATGGGCCCCANONE 
Os02g0824900AK073217AGTGGGCCCATTTNONE 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
J090069J01AGTGGGCCCATTTNONE 
J090081B04AGTGGGCCCATTTNONE 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0131400015-012-D11TCTGGGCCCATGANONE 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0145700AK065716AGGGCCCATGNONE 
J013039F14AGGGCCCATGNONE 
J013091M20AGGGCCCATGNONE 
J065059P20AGGGCCCATGNONE 
J065128M07AGGGCCCATGNONE 
J065136N23AGGGCCCATGNONE 
J065163H21AGGGCCCATGNONE 
J065176B18AGGGCCCATGNONE 
J065177A17AGGGCCCATGNONE 
J065201F24AGGGCCCATGNONE 
Os03g0171700J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
J013114N10TATGGGCCCACCTNONE 
J013146E12TATGGGCCCACCTNONE 
J023034C23TATGGGCCCACCTNONE 
J033030J03TATGGGCCCACCTNONE 
J033050L03TATGGGCCCACCTNONE 
J033122E16TATGGGCCCACCTNONE 
J090018C20TATGGGCCCACCTNONE 
J090053P15TATGGGCCCACCTNONE 
J090096C17TATGGGCCCACCTNONE 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
AK066143TGATGGGCCCACAConserved hypothetical protein. 
Os03g0266100AK058507GGGGCCCATCGLIM, zinc-binding domain containing protein. 
J033099G10GGGGCCCATCGNONE 
J065196N19GGGGCCCATCGNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0324800AK059868AATGGGCCCAAACNONE 
AK071431AATGGGCCCAAACHypothetical protein. 
Os03g0337600AF119232AGGGCCCATAANONE 
AK070859AGGGCCCATAASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18AGGGCCCATAANONE 
J013147M17AGGGCCCATAANONE 
J065083M01AGGGCCCATAANONE 
J065199H24AGGGCCCATAANONE 
Os03g0344100009-166-F10TATGGGCCCGNONE 
AK061903TATGGGCCCGNONE 
AK065547TATGGGCCCGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24TATGGGCCCGNONE 
J033087C06TATGGGCCCGNONE 
J053073I09TATGGGCCCGNONE 
J065189D11TATGGGCCCGNONE 
J090032B15TATGGGCCCGNONE 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
J100033H02CCATGGGCCCACCNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0604600J090093K23AGGGCCCATTTConserved hypothetical protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0626250J075100A11CGGGCCCATCANONE 
J075134H15CGGGCCCATCANONE 
J075142J02CGGGCCCATCANONE 
J075181A14CGGGCCCATCANONE 
J075192K17CGGGCCCATCANONE 
J090046B06CGGGCCCATCANONE 
Os03g0669000AK067769GCTGGGCCCATTTSimilar to RNA helicase (Fragment). 
AK099820GCTGGGCCCATTTNONE 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0769600AK100054TCATGGGCCCTResB-like family protein. 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J033130D12AAATGGGCCCAATTNONE 
J043035E20AAATGGGCCCAATTNONE 
J065206K15AAATGGGCCCAATTNONE 
J075053J20AAATGGGCCCAATTNONE 
J075129B11AAATGGGCCCAATTNONE 
J090003E22AAATGGGCCCAATTNONE 
J100023E23AAATGGGCCCAATTNONE 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0811800AK063320ATATGGGCCCCARibosomal protein L36 family protein. 
J065094F18ATATGGGCCCCANONE 
J090029B04ATATGGGCCCCANONE 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
J065057L18TCATGGGCCCATTTNONE 
J065083L02TCATGGGCCCATTTNONE 
J065086L24TCATGGGCCCATTTNONE 
J065121L10TCATGGGCCCATTTNONE 
J065168N03TCATGGGCCCATTTNONE 
J100035J22TCATGGGCCCATTTNONE 
J100050G18TCATGGGCCCATTTNONE 
J100055F15TCATGGGCCCATTTNONE 
Os03g0828100009-088-D04TTATGGGCCCTNONE 
009-125-F01TTATGGGCCCTNONE 
009-169-C06TTATGGGCCCTNONE 
AK059132TTATGGGCCCTNONE 
AK062799TTATGGGCCCTNONE 
AK099043TTATGGGCCCTSimilar to 50S ribosomal protein L18. 
J013146D01TTATGGGCCCTNONE 
J065057J16TTATGGGCCCTNONE 
Os03g0833900AK073655AAATGGGCCCTSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800AAATGGGCCCTNONE 
AK104068AAATGGGCCCTNONE 
J075031J11AAATGGGCCCTNONE 
J075051N01AAATGGGCCCTNONE 
J075166D18AAATGGGCCCTNONE 
J075171E14AAATGGGCCCTNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCGGANONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033044C16ATATGGGCCCCACANONE 
J090023G03ATATGGGCCCCACANONE 
J090082C21ATATGGGCCCCACANONE 
Os04g0495800003-009-C11TATGGGCCCTNONE 
AK060753TATGGGCCCTNONE 
Os04g0504600J065162K24TCTGGGCCCATGANONE 
Os04g0525000AK067753TGGATGGGCCCATCGConserved hypothetical protein. 
J013118G14TGGATGGGCCCATCGNONE 
J065026J15TGGATGGGCCCATCGNONE 
J065184H21TGGATGGGCCCATCGNONE 
J065186H22TGGATGGGCCCATCGNONE 
J065193D20TGGATGGGCCCATCGNONE 
J075060D12TGGATGGGCCCATCGNONE 
J075179L24TGGATGGGCCCATCGNONE 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0574100006-087-B01GGATGGGCCCCGCGTCGCNONE 
AK061150GGATGGGCCCCGCGTCGCNONE 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AK121041GGATGGGCCCCGCGTCGCNONE 
J023008D04GGATGGGCCCCGCGTCGCNONE 
J023052A13GGATGGGCCCCGCGTCGCNONE 
J065046P18GGATGGGCCCCGCGTCGCNONE 
J065105D10GGATGGGCCCCGCGTCGCNONE 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0602800AK100925TATGGGCCCACASimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0617050J065197A20TGTGGGGCCCATGNONE 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065211M10ACATGGGCCCACTTGNONE 
J075175E21ACATGGGCCCACTTGNONE 
J090021C06ACATGGGCCCACTTGNONE 
J090032P15ACATGGGCCCACTTGNONE 
J090082E05ACATGGGCCCACTTGNONE 
J100090O11ACATGGGCCCACTTGNONE 
Os04g0667600009-131-H09GTATGGGCCCTNONE 
009-200-A04GTATGGGCCCTNONE 
AK068657GTATGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J065013M12GTATGGGCCCTNONE 
J065024H17GTATGGGCCCTNONE 
J065025P10GTATGGGCCCTNONE 
J065028I11GTATGGGCCCTNONE 
J065044K11GTATGGGCCCTNONE 
J065045B14GTATGGGCCCTNONE 
J065052B02GTATGGGCCCTNONE 
J065061F20GTATGGGCCCTNONE 
J065061K16GTATGGGCCCTNONE 
J065063E12GTATGGGCCCTNONE 
J065065E16GTATGGGCCCTNONE 
J065082M02GTATGGGCCCTNONE 
J065084O10GTATGGGCCCTNONE 
J065096H18GTATGGGCCCTNONE 
J065122F02GTATGGGCCCTNONE 
J065131F09GTATGGGCCCTNONE 
J065139P06GTATGGGCCCTNONE 
J065148L17GTATGGGCCCTNONE 
J065164D23GTATGGGCCCTNONE 
J065167M17GTATGGGCCCTNONE 
J065174B15GTATGGGCCCTNONE 
J065176G01GTATGGGCCCTNONE 
J065186K17GTATGGGCCCTNONE 
J065186N05GTATGGGCCCTNONE 
J065213N24GTATGGGCCCTNONE 
J075001P17GTATGGGCCCTNONE 
J075004A15GTATGGGCCCTNONE 
J075007B03GTATGGGCCCTNONE 
J075026D23GTATGGGCCCTNONE 
J075032D17GTATGGGCCCTNONE 
J075058C22GTATGGGCCCTNONE 
J075080L14GTATGGGCCCTNONE 
J075094K18GTATGGGCCCTNONE 
J075097K15GTATGGGCCCTNONE 
J075098E02GTATGGGCCCTNONE 
J075104D11GTATGGGCCCTNONE 
J075120L16GTATGGGCCCTNONE 
J075126A18GTATGGGCCCTNONE 
J075129M08GTATGGGCCCTNONE 
J075143N14GTATGGGCCCTNONE 
J075146D07GTATGGGCCCTNONE 
J075149L10GTATGGGCCCTNONE 
J075171F22GTATGGGCCCTNONE 
J090058C05GTATGGGCCCTNONE 
J100018N19GTATGGGCCCTNONE 
J100024K09GTATGGGCCCTNONE 
J100036F15GTATGGGCCCTNONE 
J100042A15GTATGGGCCCTNONE 
J100042P14GTATGGGCCCTNONE 
J100051N18GTATGGGCCCTNONE 
J100055K14GTATGGGCCCTNONE 
J100056F05GTATGGGCCCTNONE 
J100058L10GTATGGGCCCTNONE 
J100083J17GTATGGGCCCTNONE 
J100086N07GTATGGGCCCTNONE 
Os04g0670800AK073170GGATGGGCCCTNONE 
Os05g0101400009-126-G06ATATGGGCCCCNONE 
AK067481ATATGGGCCCCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10ATATGGGCCCCNONE 
J065186D05ATATGGGCCCCNONE 
J065193A14ATATGGGCCCCNONE 
J075082A02ATATGGGCCCCNONE 
J075100F11ATATGGGCCCCNONE 
J075111O16ATATGGGCCCCNONE 
J075172I24ATATGGGCCCCNONE 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
J033125H15GGGGCCCATGTNONE 
J065021L01GGGGCCCATGTNONE 
J065029M01GGGGCCCATGTNONE 
J065089F17GGGGCCCATGTNONE 
J065112N04GGGGCCCATGTNONE 
J065163L03GGGGCCCATGTNONE 
J065175B04GGGGCCCATGTNONE 
J065192E02GGGGCCCATGTNONE 
J075046C20GGGGCCCATGTNONE 
J075192A01GGGGCCCATGTNONE 
J100018H13GGGGCCCATGTNONE 
J100067K20GGGGCCCATGTNONE 
J100080N03GGGGCCCATGTNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0198700Os05g0198700ATATGGGCCCTREX1 DNA Repair family protein. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os05g0536900009-033-D11AATGGGCCCGTTNONE 
AK105140AATGGGCCCGTTSimilar to RAB7A. 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0554100AK073023AAATGGGCCCTRibosomal protein L7/L12 family protein. 
AK101756AAATGGGCCCTNONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0568600009-024-B09TCATGGGCCCACGCNONE 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
J080049H14TCATGGGCCCACGCNONE 
J080062M08TCATGGGCCCACGCNONE 
J080064I07TCATGGGCCCACGCNONE 
J080068A12TCATGGGCCCACGCNONE 
J080086J10TCATGGGCCCACGCNONE 
Os05g0577900016-028-C02TGTGGGCCCATTTNONE 
016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TGTGGGCCCATTTConserved hypothetical protein. 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE 
012-009-E07GCGTGGGCCCATGGNONE 
012-096-B01GCGTGGGCCCATGGNONE 
AK059614GCGTGGGCCCATGGNONE 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
J033040P21GCGTGGGCCCATGGNONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0124900009-128-B12GGGGCCCATGNONE 
009-186-H09GGGGCCCATGNONE 
AK062901GGGGCCCATGConserved hypothetical protein. 
J013056D13GGGGCCCATGNONE 
J013056D17GGGGCCCATGNONE 
J013066A13GGGGCCCATGNONE 
J013066C03GGGGCCCATGNONE 
J013066F01GGGGCCCATGNONE 
J023078D03GGGGCCCATGNONE 
J033113N02GGGGCCCATGNONE 
J065019F09GGGGCCCATGNONE 
J065048C21GGGGCCCATGNONE 
J065077L13GGGGCCCATGNONE 
J065082J09GGGGCCCATGNONE 
J065113H16GGGGCCCATGNONE 
J065147A20GGGGCCCATGNONE 
J065180A13GGGGCCCATGNONE 
J065198M18GGGGCCCATGNONE 
J065207K19GGGGCCCATGNONE 
J075109H13GGGGCCCATGNONE 
Os06g0134300AK071534TCTGGGCCCATAAConserved hypothetical protein. 
J023106E03TCTGGGCCCATAANONE 
J075172D02TCTGGGCCCATAANONE 
J100047B13TCTGGGCCCATAANONE 
Os06g0172000AK068738AAATGGGCCCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AK059876CCATGGGCCCCNONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J075093C09CCATGGGCCCCNONE 
J100026J18AATTGGGCCCATGANONE 
J100026J18CCATGGGCCCCNONE 
J100041O16AATTGGGCCCATGANONE 
J100041O16CCATGGGCCCCNONE 
J100089K16AATTGGGCCCATGANONE 
J100089K16CCATGGGCCCCNONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03AATTGGGCCCATGGNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07AATTGGGCCCATGGNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14AATTGGGCCCATGGNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06AATTGGGCCCATGGNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08AATTGGGCCCATGGNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24AATTGGGCCCATGGNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09AATTGGGCCCATGGNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0268700AK120783GGGGCCCATTPeptidase A1, pepsin family protein. 
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17AGGGCCCATGTNONE 
J065038I02AGGGCCCATGTNONE 
J065214J02AGGGCCCATGTNONE 
Os06g0329350009-021-B05TGGATGGGCCCACANONE 
009-043-A04TGGATGGGCCCACANONE 
009-051-G06TGGATGGGCCCACANONE 
009-107-D02TGGATGGGCCCACANONE 
009-111-B11TGGATGGGCCCACANONE 
009-118-B02TGGATGGGCCCACANONE 
009-132-A11TGGATGGGCCCACANONE 
009-186-B06TGGATGGGCCCACANONE 
J065044N12TGGATGGGCCCACANONE 
J065097L15TGGATGGGCCCACANONE 
J065219N02TGGATGGGCCCACANONE 
J080009E03TGGATGGGCCCACANONE 
J080020P03TGGATGGGCCCACANONE 
J080024O15TGGATGGGCCCACANONE 
J080030B22TGGATGGGCCCACANONE 
J080032G04TGGATGGGCCCACANONE 
J080045B12TGGATGGGCCCACANONE 
J080048M05TGGATGGGCCCACANONE 
J080051M16TGGATGGGCCCACANONE 
J080053K12TGGATGGGCCCACANONE 
J080056G17TGGATGGGCCCACANONE 
J080068O22TGGATGGGCCCACANONE 
J080074K04TGGATGGGCCCACANONE 
J080075B20TGGATGGGCCCACANONE 
J080077I03TGGATGGGCCCACANONE 
J080081E17TGGATGGGCCCACANONE 
J080082B08TGGATGGGCCCACANONE 
J080084I03TGGATGGGCCCACANONE 
J080092F08TGGATGGGCCCACANONE 
J090086C01TGGATGGGCCCACAConserved hypothetical protein. 
Os06g0561200AK120422AAATGGGCCCTSimilar to Potassium/proton antiporter-like protein. 
Os06g0573700015-015-F02TTATGGGCCCATCCANONE 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24TTATGGGCCCATCCANONE 
Os06g0581300AK070987TGATGGGCCCTProtein of unknown function DUF1475 family protein. 
AK073185TGATGGGCCCTNONE 
J065209C10TGATGGGCCCTNONE 
J075060B03TGATGGGCCCTNONE 
J075117M08TGATGGGCCCTNONE 
J075126E04TGATGGGCCCTNONE 
J075189G04TGATGGGCCCTNONE 
J075189L16TGATGGGCCCTNONE 
J100061E16TGATGGGCCCTNONE 
Os06g0601000AK071330AAATGGGCCCAGAHomeodomain-like containing protein. 
AY224485AAATGGGCCCAGANONE 
Os06g0602600AK121619AATGGGCCCAACAlba, DNA/RNA-binding protein family protein. 
J033044O03AATGGGCCCAACNONE 
J043036G04AATGGGCCCAACNONE 
J075107E08AATGGGCCCAACNONE 
J090060N14AATGGGCCCAACNONE 
J090094K04AATGGGCCCAACNONE 
Os06g0625500006-034-A05CGGGCCCATCCNONE 
AK058459CGGGCCCATCCSimilar to Thioredoxin peroxidase. 
AK068955CGGGCCCATCCNONE 
AK104130CGGGCCCATCCNONE 
J023003C09CGGGCCCATCCNONE 
J033043I02CGGGCCCATCCNONE 
J065063E05CGGGCCCATCCNONE 
J065190D24CGGGCCCATCCNONE 
J065198I01CGGGCCCATCCNONE 
J075107A02CGGGCCCATCCNONE 
Os06g0646600AB061818AGGGCCCATATKNOX family class 2 homeodomain protein. 
AB061818ATATGGGCCCATTAKNOX family class 2 homeodomain protein. 
J023088C09AGGGCCCATATNONE 
J023088C09ATATGGGCCCATTANONE 
J065162G03AGGGCCCATATNONE 
J065162G03ATATGGGCCCATTANONE 
Os06g0673500J100018J12TATGGGCCCAGANONE 
J100072F13TATGGGCCCAGASimilar to Ubiquitin. 
Os06g0688100AK063450AGATGGGCCCTNONE 
AK101144AGATGGGCCCTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein. 
Os06g0714800006-033-C09AGGGCCCATTTNONE 
006-042-G10AGGGCCCATTTNONE 
006-081-G10AGGGCCCATTTNONE 
006-120-F12AGGGCCCATTTNONE 
009-149-F08AGGGCCCATTTNONE 
AK059793AGGGCCCATTTProtein of unknown function DUF581 family protein. 
AK071528AGGGCCCATTTNONE 
J023102E22AGGGCCCATTTNONE 
J065099H06AGGGCCCATTTNONE 
J065127G22AGGGCCCATTTNONE 
J075089J03AGGGCCCATTTNONE 
J075109B02AGGGCCCATTTNONE 
J075179K22AGGGCCCATTTNONE 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E04AATTGGGCCCATGTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0245100J023048C16CCATGGGCCCACTTGNONE 
J023110L14CCATGGGCCCACTTGNONE 
J053023B18CCATGGGCCCACTTGNONE 
J053031L17CCATGGGCCCACTTGNONE 
J065035I22CCATGGGCCCACTTGNONE 
J065043D21CCATGGGCCCACTTGNONE 
J065072L16CCATGGGCCCACTTGNONE 
J065214I23CCATGGGCCCACTTGNONE 
Os07g0258400AK121534AACTGGGCCCATTNONE 
L41217AACTGGGCCCATTNONE 
S81897AACTGGGCCCATTOsNramp1 (Integral membrane protein). 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
Os07g0435100AB037153TTATGGGCCCACANONE 
AK061383TTATGGGCCCACASimilar to 26S proteasome subunit RPN12. 
AK061408TTATGGGCCCACANONE 
AK101316TTATGGGCCCACANONE 
J023133D07TTATGGGCCCACANONE 
J023136B17TTATGGGCCCACANONE 
J033065M08TTATGGGCCCACANONE 
J033070F05TTATGGGCCCACANONE 
J033070L20TTATGGGCCCACANONE 
J033108J15TTATGGGCCCACANONE 
J053080M19TTATGGGCCCACANONE 
J053091B15TTATGGGCCCACANONE 
J065067J03TTATGGGCCCACANONE 
J065102C02TTATGGGCCCACANONE 
J065135H09TTATGGGCCCACANONE 
J080302K03TTATGGGCCCACANONE 
J090059J11TTATGGGCCCACANONE 
J090074G14TTATGGGCCCACANONE 
J100025F20TTATGGGCCCACANONE 
J100028L08TTATGGGCCCACANONE 
J100049L14TTATGGGCCCACANONE 
J100054O07TTATGGGCCCACANONE 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0546700009-110-H10TAATGGGCCCGNONE 
AK058262TAATGGGCCCGNONE 
J065154I05TAATGGGCCCGNONE 
J065175P09TAATGGGCCCGNONE 
J065187F11TAATGGGCCCGNONE 
J075114K16TAATGGGCCCGNONE 
J090031L21TAATGGGCCCGNONE 
U86017TAATGGGCCCGSimilar to 60S ribosomal protein L38. 
Os07g0558400003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
009-083-H02TTATGGGCCCCCACGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0116500009-007-E05AGGGCCCATCTNONE 
009-074-C07AGGGCCCATCTNONE 
009-098-A07AGGGCCCATCTNONE 
009-100-C03AGGGCCCATCTNONE 
009-136-E04AGGGCCCATCTNONE 
009-138-B08AGGGCCCATCTNONE 
009-144-B06AGGGCCCATCTNONE 
009-184-E04AGGGCCCATCTNONE 
009-189-F01AGGGCCCATCTNONE 
013-006-E05AGGGCCCATCTNONE 
013-015-C10AGGGCCCATCTNONE 
013-019-F09AGGGCCCATCTNONE 
013-020-C01AGGGCCCATCTNONE 
013-021-F05AGGGCCCATCTNONE 
013-035-D08AGGGCCCATCTNONE 
013-038-C09AGGGCCCATCTNONE 
013-054-B07AGGGCCCATCTNONE 
013-061-G10AGGGCCCATCTNONE 
013-074-B01AGGGCCCATCTNONE 
013-079-B06AGGGCCCATCTNONE 
013-099-B09AGGGCCCATCTNONE 
013-099-G11AGGGCCCATCTNONE 
014-023-F04AGGGCCCATCTNONE 
014-032-C07AGGGCCCATCTNONE 
014-045-E02AGGGCCCATCTNONE 
014-085-C02AGGGCCCATCTNONE 
014-087-F04AGGGCCCATCTNONE 
014-089-C04AGGGCCCATCTNONE 
014-090-E01AGGGCCCATCTNONE 
014-094-G11AGGGCCCATCTNONE 
014-097-B07AGGGCCCATCTNONE 
015-024-A12AGGGCCCATCTNONE 
015-032-C06AGGGCCCATCTNONE 
016-053-E09AGGGCCCATCTNONE 
016-081-F10AGGGCCCATCTNONE 
AK058240AGGGCCCATCTSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AGGGCCCATCTNONE 
J023107O19AGGGCCCATCTNONE 
J053029K21AGGGCCCATCTNONE 
J053073P11AGGGCCCATCTNONE 
J053074B04AGGGCCCATCTNONE 
J053078M14AGGGCCCATCTNONE 
J065001E12AGGGCCCATCTNONE 
J065006J12AGGGCCCATCTNONE 
J065015C06AGGGCCCATCTNONE 
J065025D13AGGGCCCATCTNONE 
J065029A04AGGGCCCATCTNONE 
J065031D23AGGGCCCATCTNONE 
J065032E24AGGGCCCATCTNONE 
J065034P16AGGGCCCATCTNONE 
J065043B04AGGGCCCATCTNONE 
J065044A15AGGGCCCATCTNONE 
J065062D18AGGGCCCATCTNONE 
J065079G13AGGGCCCATCTNONE 
J065080A19AGGGCCCATCTNONE 
J065080A20AGGGCCCATCTNONE 
J065089N19AGGGCCCATCTNONE 
J065111O07AGGGCCCATCTNONE 
J065115N15AGGGCCCATCTNONE 
J065131A04AGGGCCCATCTNONE 
J065138H02AGGGCCCATCTNONE 
J065139K10AGGGCCCATCTNONE 
J065144A02AGGGCCCATCTNONE 
J065155J17AGGGCCCATCTNONE 
J065159D18AGGGCCCATCTNONE 
J065159I18AGGGCCCATCTNONE 
J065167H12AGGGCCCATCTNONE 
J065174C22AGGGCCCATCTNONE 
J065184A05AGGGCCCATCTNONE 
J065188M15AGGGCCCATCTNONE 
J065191D23AGGGCCCATCTNONE 
J065203C07AGGGCCCATCTNONE 
J065207C23AGGGCCCATCTNONE 
J065207L16AGGGCCCATCTNONE 
J065212F01AGGGCCCATCTNONE 
J065212F05AGGGCCCATCTNONE 
J075037B07AGGGCCCATCTNONE 
J075042F15AGGGCCCATCTNONE 
J075059J03AGGGCCCATCTNONE 
J075068M18AGGGCCCATCTNONE 
J075079E13AGGGCCCATCTNONE 
J075081F12AGGGCCCATCTNONE 
J075083I05AGGGCCCATCTNONE 
J075123K23AGGGCCCATCTNONE 
J075142F16AGGGCCCATCTNONE 
J075156N03AGGGCCCATCTNONE 
J075162K05AGGGCCCATCTNONE 
J075171E08AGGGCCCATCTNONE 
J075177N03AGGGCCCATCTNONE 
J075182K17AGGGCCCATCTNONE 
J075186K02AGGGCCCATCTNONE 
J075191K05AGGGCCCATCTNONE 
J080011E10AGGGCCCATCTNONE 
J080016M21AGGGCCCATCTNONE 
J080017A17AGGGCCCATCTNONE 
J080031O09AGGGCCCATCTNONE 
J080039G21AGGGCCCATCTNONE 
J080041B01AGGGCCCATCTNONE 
J080050G20AGGGCCCATCTNONE 
J080054A12AGGGCCCATCTNONE 
J080058O08AGGGCCCATCTNONE 
J080061N04AGGGCCCATCTNONE 
J080064L23AGGGCCCATCTNONE 
J080064P05AGGGCCCATCTNONE 
J080069I17AGGGCCCATCTNONE 
J080070E07AGGGCCCATCTNONE 
J080071B20AGGGCCCATCTNONE 
J080074L08AGGGCCCATCTNONE 
J080076N08AGGGCCCATCTNONE 
J080081A14AGGGCCCATCTNONE 
J080081J17AGGGCCCATCTNONE 
J080085N14AGGGCCCATCTNONE 
J080090B09AGGGCCCATCTNONE 
J080097L11AGGGCCCATCTNONE 
J080306H13AGGGCCCATCTNONE 
J080307H13AGGGCCCATCTNONE 
J080311F12AGGGCCCATCTNONE 
J080316L23AGGGCCCATCTNONE 
J080318H02AGGGCCCATCTNONE 
J090016L15AGGGCCCATCTNONE 
J090019I02AGGGCCCATCTNONE 
J090031G21AGGGCCCATCTNONE 
J090066C15AGGGCCCATCTNONE 
J100032I02AGGGCCCATCTNONE 
J100032N07AGGGCCCATCTNONE 
J100032N16AGGGCCCATCTNONE 
J100041P21AGGGCCCATCTNONE 
J100048M04AGGGCCCATCTNONE 
J100048M14AGGGCCCATCTNONE 
J100063B08AGGGCCCATCTNONE 
J100088E20AGGGCCCATCTNONE 
J100090I08AGGGCCCATCTNONE 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0386300AK059323TGGTGGGCCCATGNONE 
AK070379TGGTGGGCCCATGCytochrome b5 domain containing protein. 
J023054P20TGGTGGGCCCATGNONE 
J033089H01TGGTGGGCCCATGNONE 
J065013I01TGGTGGGCCCATGNONE 
J065212E17TGGTGGGCCCATGNONE 
J080317O15TGGTGGGCCCATGNONE 
J090018O07TGGTGGGCCCATGNONE 
Os08g0439900AK110628AACTGGGCCCATTMitochondrial glycoprotein family protein. 
AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13AACTGGGCCCATTNONE 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0494300AK066150AGTGGGCCCATCCAvon Willebrand factor, type A domain containing protein. 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0522600014-041-A10GGGCCGGGGGCCCATTNONE 
AK105364GGGCCGGGGGCCCATTSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os08g0548900006-043-D07CCATGGGCCCATGGNONE 
006-043-H11CCATGGGCCCATGGNONE 
006-081-G06CCATGGGCCCATGGNONE 
006-109-E04CCATGGGCCCATGGNONE 
011-033-E04CCATGGGCCCATGGNONE 
AK061808CCATGGGCCCATGGSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCCCATGGNONE 
J013001D12CCATGGGCCCATGGNONE 
J033126N14CCATGGGCCCATGGNONE 
J053069M09CCATGGGCCCATGGNONE 
J053098E10CCATGGGCCCATGGNONE 
J053101C24CCATGGGCCCATGGNONE 
J065002F21CCATGGGCCCATGGNONE 
J065006C22CCATGGGCCCATGGNONE 
J065076J02CCATGGGCCCATGGNONE 
J065134M22CCATGGGCCCATGGNONE 
J075007M19CCATGGGCCCATGGNONE 
J075040I11CCATGGGCCCATGGNONE 
J075047E20CCATGGGCCCATGGNONE 
J075052D22CCATGGGCCCATGGNONE 
J075076L13CCATGGGCCCATGGNONE 
J075157P22CCATGGGCCCATGGNONE 
J075161M18CCATGGGCCCATGGNONE 
J075168P22CCATGGGCCCATGGNONE 
J075181E04CCATGGGCCCATGGNONE 
U92540CCATGGGCCCATGGNONE 
Os08g0563300009-007-B01ATATGGGCCCAANONE 
AK062315ATATGGGCCCAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04ATATGGGCCCAANONE 
Os09g0115500006-023-A12CGATGGGCCCATGTNONE 
006-042-G01CGATGGGCCCATGTNONE 
AK061717CGATGGGCCCATGTCBS domain containing protein. 
AK065986CGATGGGCCCATGTNONE 
J013043C13CGATGGGCCCATGTNONE 
J013111D13CGATGGGCCCATGTNONE 
J023114K12CGATGGGCCCATGTNONE 
J065102N18CGATGGGCCCATGTNONE 
Os09g0127300AK100234AAATGGGCCCTNAD-dependent epimerase/dehydratase family protein. 
J065025J06AAATGGGCCCTNONE 
J065026I05AAATGGGCCCTNONE 
J065042L03AAATGGGCCCTNONE 
J065061B18AAATGGGCCCTNONE 
J065121H13AAATGGGCCCTNONE 
J065183N10AAATGGGCCCTNONE 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0392000AK120392CCATGGGCCCAGCConserved hypothetical protein. 
J013074N02CCATGGGCCCAGCNONE 
Os09g0397900AK101306AGGGCCCATGGGCTSimilar to FEG protein. 
Os09g0445600AK107839GTGGGGCCCATGGConserved hypothetical protein. 
Os09g0464000AK060777ACATGGGCCCACGANONE 
AK060777TAATGGGCCCCAGNONE 
AK069530ACATGGGCCCACGASimilar to Carbonate dehydratase-like protein. 
AK069530TAATGGGCCCCAGSimilar to Carbonate dehydratase-like protein. 
Os09g0471900AK073815AGTGGGCCCATAABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0495200AK102989CACTGACATATGGGCCCTConserved hypothetical protein. 
J075062H18CACTGACATATGGGCCCTNONE 
J075098G06CACTGACATATGGGCCCTNONE 
Os09g0498600AK066995GGGGCCCATCCNONE 
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0560600AK070937ACATGGGCCCCACACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
J013112M13ACATGGGCCCCACACNONE 
J013151P14ACATGGGCCCCACACNONE 
J023022E01ACATGGGCCCCACACNONE 
J023068C02ACATGGGCCCCACACNONE 
J023107O13ACATGGGCCCCACACNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0111200AK109277TAATGGGCCCTConserved hypothetical protein. 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0175500015-087-F02AAATGGGCCCACCCNONE 
AK064320AAATGGGCCCACCCZinc finger, RING-type domain containing protein. 
AK101592AAATGGGCCCACCCNONE 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
Os11g0209100016-063-F03AAATGGGCCCAGCNONE 
AK064391AAATGGGCCCAGCCyclin-like F-box domain containing protein. 
J075027K02AAATGGGCCCAGCNONE 
J075154K15AAATGGGCCCAGCNONE 
Os11g0237700J100060P16GGATGGGCCCACCACConserved hypothetical protein. 
J100065I12GGATGGGCCCACCACNONE 
Os11g0242800006-026-C12CATGGGCCCACAANONE 
006-027-E07CATGGGCCCACAANONE 
006-060-A11CATGGGCCCACAANONE 
006-097-F07CATGGGCCCACAANONE 
006-102-B06CATGGGCCCACAANONE 
009-021-H11CATGGGCCCACAANONE 
009-057-A07CATGGGCCCACAANONE 
AK061295CATGGGCCCACAASimilar to ASCAB9-A (ASCAB9-B) (Fragment). 
AK098872CATGGGCCCACAANONE 
AK104824CATGGGCCCACAANONE 
J013001B10CATGGGCCCACAANONE 
J013046D18CATGGGCCCACAANONE 
J013047P13CATGGGCCCACAANONE 
J013109A01CATGGGCCCACAANONE 
J013155M11CATGGGCCCACAANONE 
J023029I09CATGGGCCCACAANONE 
J023043A13CATGGGCCCACAANONE 
J023050C07CATGGGCCCACAANONE 
J023062G03CATGGGCCCACAANONE 
J023063A04CATGGGCCCACAANONE 
J023067A08CATGGGCCCACAANONE 
J023079D02CATGGGCCCACAANONE 
J023080I10CATGGGCCCACAANONE 
J023112D03CATGGGCCCACAANONE 
J023114E15CATGGGCCCACAANONE 
J023117C14CATGGGCCCACAANONE 
J023120L05CATGGGCCCACAANONE 
J023126C08CATGGGCCCACAANONE 
J023143A07CATGGGCCCACAANONE 
J033107J22CATGGGCCCACAANONE 
J065051P10CATGGGCCCACAANONE 
J065204H19CATGGGCCCACAANONE 
J075004E22CATGGGCCCACAANONE 
J075014D01CATGGGCCCACAANONE 
J075021B03CATGGGCCCACAANONE 
J075024L01CATGGGCCCACAANONE 
J075028K23CATGGGCCCACAANONE 
J075059G21CATGGGCCCACAANONE 
J075072K15CATGGGCCCACAANONE 
J075115M14CATGGGCCCACAANONE 
J075116I04CATGGGCCCACAANONE 
J075117D23CATGGGCCCACAANONE 
J075128N14CATGGGCCCACAANONE 
J075132P13CATGGGCCCACAANONE 
J075134M02CATGGGCCCACAANONE 
J090079D09CATGGGCCCACAANONE 
Os11g0244800AK103215AGATGGGCCCTSimilar to Alfin-1. 
J065009E13AGATGGGCCCTNONE 
J065027D16AGATGGGCCCTNONE 
J065085B06AGATGGGCCCTNONE 
J065180O17AGATGGGCCCTNONE 
J090010C16AGATGGGCCCTNONE 
J090039K20AGATGGGCCCTNONE 
Os11g0302700AK073931TGTGGGCCCATATRecA bacterial DNA recombination family protein. 
Os11g0448400AB095094TGGATGGGCCCGSimilar to Sigma factor SIG2A. 
J075053H03TGGATGGGCCCGNONE 
J075062F23TGGATGGGCCCGNONE 
J090029D08TGGATGGGCCCGNONE 
Os11g0456200AK060974GTGTGGGGCCCATGConserved hypothetical protein. 
J065010F10GTGTGGGGCCCATGNONE 
J090079O04GTGTGGGGCCCATGNONE 
Os11g0527000J065137N17CATGGGCCCCACCTGTCConserved hypothetical protein. 
Os11g0549690J065085G07ATATGGGCCCTConserved hypothetical protein. 
J065218B08ATATGGGCCCTNONE 
J090036H16ATATGGGCCCTNONE 
Os11g0568300016-075-B02AGGGCCCATACNONE 
AK064398AGGGCCCATACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282AGGGCCCATACNONE 
J033124M10AGGGCCCATACNONE 
J065120I21AGGGCCCATACNONE 
J065144H16AGGGCCCATACNONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os11g0682600J090026G08TGTGGGGCCCATGTGGGCTConserved hypothetical protein. 
J090037N19TGTGGGGCCCATGTGGGCTNONE 
J090061M21TGTGGGGCCCATGTGGGCTNONE 
Os12g0102100J013134H02AGGGCCCATATAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0150100009-047-B11AAATGGGCCCAATNONE 
AK105075AAATGGGCCCAATSimilar to 60S ribosomal protein L26A. 
J013067G22AAATGGGCCCAATNONE 
J033103F08AAATGGGCCCAATNONE 
J065029P11AAATGGGCCCAATNONE 
J065043B18AAATGGGCCCAATNONE 
J065123E16AAATGGGCCCAATNONE 
J065141O20AAATGGGCCCAATNONE 
J065161O04AAATGGGCCCAATNONE 
J065201M07AAATGGGCCCAATNONE 
J075058I23AAATGGGCCCAATNONE 
J075172J08AAATGGGCCCAATNONE 
J100040L13AAATGGGCCCAATNONE 
Os12g0188900012-030-C08CGATGGGCCCGNONE 
J013027N23CGATGGGCCCGConserved hypothetical protein. 
J013156K23CGATGGGCCCGNONE 
J023134K02CGATGGGCCCGNONE 
J033051M18CGATGGGCCCGNONE 
J033143K05CGATGGGCCCGNONE 
J080003C24CGATGGGCCCGNONE 
J080004K05CGATGGGCCCGNONE 
J080009D14CGATGGGCCCGNONE 
J080014L12CGATGGGCCCGNONE 
J080020E23CGATGGGCCCGNONE 
J080021K20CGATGGGCCCGNONE 
J080024B19CGATGGGCCCGNONE 
J080024C12CGATGGGCCCGNONE 
J080031K10CGATGGGCCCGNONE 
J080034G09CGATGGGCCCGNONE 
J080036C10CGATGGGCCCGNONE 
J080037K18CGATGGGCCCGNONE 
J080039J17CGATGGGCCCGNONE 
J080040A20CGATGGGCCCGNONE 
J080042B06CGATGGGCCCGNONE 
J080046P07CGATGGGCCCGNONE 
J080047G02CGATGGGCCCGNONE 
J080049E12CGATGGGCCCGNONE 
J080056N14CGATGGGCCCGNONE 
J080059K10CGATGGGCCCGNONE 
J080064F05CGATGGGCCCGNONE 
J080064I04CGATGGGCCCGNONE 
J080064K17CGATGGGCCCGNONE 
J080069A15CGATGGGCCCGNONE 
J080071E22CGATGGGCCCGNONE 
J080071M24CGATGGGCCCGNONE 
J080074C17CGATGGGCCCGNONE 
J080075J07CGATGGGCCCGNONE 
J080079F11CGATGGGCCCGNONE 
J080083F15CGATGGGCCCGNONE 
J080084N21CGATGGGCCCGNONE 
J080086O03CGATGGGCCCGNONE 
J080089K02CGATGGGCCCGNONE 
J080092K22CGATGGGCCCGNONE 
J080093P09CGATGGGCCCGNONE 
J090001N04CGATGGGCCCGNONE 
J090041M02CGATGGGCCCGNONE 
Os12g0285600AK069104AGTGGGCCCATCCCCCCACCCGOxysterol-binding protein family protein. 
Os12g0405700AK061920ACATGGGCCCACCCSimilar to Wound-induced basic protein. 
AK120436ACATGGGCCCACCCNONE 
Os12g0443700AK069541GCCGGGCCCATCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCGGGCCCATCCNONE 
Os12g0480000AK061316AGATGGGCCCCACACZinc finger, DHHC-type domain containing protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0556400009-129-D04AGGGCCCATTTNONE 
AK062903AGGGCCCATTTNONE 
AK108690AGGGCCCATTTConserved hypothetical protein. 
J080027A03AGGGCCCATTTNONE 
J100074F22AGGGCCCATTTNONE 
Os12g0599900AK101252AAATGGGCCCTTetratricopeptide region domain containing protein. 
AK101252CCATGGGCCCAACTTetratricopeptide region domain containing protein. 
J033032F05AAATGGGCCCTNONE 
J033032F05CCATGGGCCCAACTNONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0630600J100033A04CGATGGGCCCATCAConserved hypothetical protein. 
Os12g0638100012-096-H01ATTTGGGCCCATCTNONE 
AK059245ATTTGGGCCCATCTNONE 
J033071D06ATTTGGGCCCATCTNONE 
J033090A15ATTTGGGCCCATCTNONE 
J033090A18ATTTGGGCCCATCTNONE 
J033098M15ATTTGGGCCCATCTNONE 
J033111F01ATTTGGGCCCATCTNONE 
J033111I05ATTTGGGCCCATCTNONE 
J033117B13ATTTGGGCCCATCTNONE 
J033127C21ATTTGGGCCCATCTNONE 
J053025M14ATTTGGGCCCATCTNONE 
J053032E24ATTTGGGCCCATCTNONE 
J053089K20ATTTGGGCCCATCTNONE 
J065010A05ATTTGGGCCCATCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.