version

Summary of OsREG490 (All List)

OrganismOryza sativa  
IDOsREG490  
SequenceATGGGCCG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count5467  

Entry Sequences (5467 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE 
009-148-C12GCCACGTCGGCCCATTNONE 
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein. 
AK102848GCCACGTCGGCCCATTNONE 
J033036P20GCCACGTCGGCCCATTNONE 
J065171N21GCCACGTCGGCCCATTNONE 
J065209M02GCCACGTCGGCCCATTNONE 
J075067A03GCCACGTCGGCCCATTNONE 
J075110C09GCCACGTCGGCCCATTNONE 
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0148700006-099-B04CATGGGCCGTTTNONE 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
AK109379CATGGGCCGTTTNONE 
J023101J18CATGGGCCGTTTNONE 
J033036D19CATGGGCCGTTTNONE 
J033051P05CATGGGCCGTTTNONE 
J033061D21CATGGGCCGTTTNONE 
J033071M06CATGGGCCGTTTNONE 
J033072D18CATGGGCCGTTTNONE 
J033073M13CATGGGCCGTTTNONE 
J033084N02CATGGGCCGTTTNONE 
J065092C13CATGGGCCGTTTNONE 
J080017H24CATGGGCCGTTTNONE 
J080032E16CATGGGCCGTTTNONE 
J080077J07CATGGGCCGTTTNONE 
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0166800AK073783ATATGGGCCGGAConserved hypothetical protein. 
AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378ATATGGGCCGGANONE 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10ATATGGGCCGGANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18ATATGGGCCGGANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17ATATGGGCCGGANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11ATATGGGCCGGANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09ATATGGGCCGGANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0203300015-045-F03ACCGGCCCATCTNONE 
015-045-F03ACCGGCCCATTNONE 
AK106329ACCGGCCCATCTConserved hypothetical protein. 
AK106329ACCGGCCCATTConserved hypothetical protein. 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0219100J065130F20TAATGGGCCGAANONE 
J065208O10TAATGGGCCGAASFT2-like family protein. 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0316800009-188-E08ACCGGCCCATAANONE 
009-188-E08GACGGCCCATTTNONE 
AK058821ACCGGCCCATAANONE 
AK058821GACGGCCCATTTNONE 
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
AK119788GACGGCCCATTTSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09ACCGGCCCATAANONE 
J065098A09GACGGCCCATTTNONE 
J065102J21ACCGGCCCATAANONE 
J065102J21GACGGCCCATTTNONE 
J065173M10ACCGGCCCATAANONE 
J065173M10GACGGCCCATTTNONE 
J075066K08ACCGGCCCATAANONE 
J075066K08GACGGCCCATTTNONE 
J080302B04ACCGGCCCATAANONE 
J080302B04GACGGCCCATTTNONE 
J080310P14ACCGGCCCATAANONE 
J080310P14GACGGCCCATTTNONE 
J080311I23ACCGGCCCATAANONE 
J080311I23GACGGCCCATTTNONE 
J080319N12ACCGGCCCATAANONE 
J080319N12GACGGCCCATTTNONE 
J100024D14ACCGGCCCATAANONE 
J100024D14GACGGCCCATTTNONE 
J100055N12ACCGGCCCATAANONE 
J100055N12GACGGCCCATTTNONE 
Os01g0328400006-092-H09GCGGCCCATCTNONE 
009-085-A02GCGGCCCATCTNONE 
012-078-B03GCGGCCCATCTNONE 
AK061988GCGGCCCATCTUbiquitin. 
J013073B13GCGGCCCATCTNONE 
J023135L09GCGGCCCATCTNONE 
J023135O07GCGGCCCATCTNONE 
J033027B12GCGGCCCATCTNONE 
J033084P17GCGGCCCATCTNONE 
J065010M05GCGGCCCATCTNONE 
J065021N11GCGGCCCATCTNONE 
J065021N12GCGGCCCATCTNONE 
J065031K11GCGGCCCATCTNONE 
J065072P04GCGGCCCATCTNONE 
J065098D05GCGGCCCATCTNONE 
J065122N23GCGGCCCATCTNONE 
J065129L13GCGGCCCATCTNONE 
J065135N13GCGGCCCATCTNONE 
J065215N10GCGGCCCATCTNONE 
J075120N22GCGGCCCATCTNONE 
J090011G23GCGGCCCATCTNONE 
J090014F06GCGGCCCATCTNONE 
J090040G23GCGGCCCATCTNONE 
J090075I20GCGGCCCATCTNONE 
J090075N01GCGGCCCATCTNONE 
J090089B04GCGGCCCATCTNONE 
J090090F08GCGGCCCATCTNONE 
J090091M17GCGGCCCATCTNONE 
J090094L03GCGGCCCATCTNONE 
J090099L06GCGGCCCATCTNONE 
J100018A18GCGGCCCATCTNONE 
J100027H13GCGGCCCATCTNONE 
J100069C05GCGGCCCATCTNONE 
J100086L10GCGGCCCATCTNONE 
Os01g0346400J100032G11ACCGGCCCATTConserved hypothetical protein. 
Os01g0508300AK101435GCGGCCCATGANONE 
AK111287GCGGCCCATGAConserved hypothetical protein. 
J065096N08GCGGCCCATGANONE 
J075003F13GCGGCCCATGANONE 
J075014I16GCGGCCCATGANONE 
J075022D23GCGGCCCATGANONE 
J075040N19GCGGCCCATGANONE 
J075121O06GCGGCCCATGANONE 
J075131E17GCGGCCCATGANONE 
J075136N22GCGGCCCATGANONE 
J075147D01GCGGCCCATGANONE 
J075173C07GCGGCCCATGANONE 
J075196L22GCGGCCCATGANONE 
Os01g0513700AK058445ACATGGGCCGCNONE 
AK058445ACCGGCCCATGGNONE 
AK068877ACATGGGCCGCSybindin-like protein family protein. 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
J023001F01ACATGGGCCGCNONE 
J023001F01ACCGGCCCATGGNONE 
J065065I18ACATGGGCCGCNONE 
J065065I18ACCGGCCCATGGNONE 
J065165A09ACATGGGCCGCNONE 
J065165A09ACCGGCCCATGGNONE 
J065184N12ACATGGGCCGCNONE 
J065184N12ACCGGCCCATGGNONE 
J065205M05ACATGGGCCGCNONE 
J065205M05ACCGGCCCATGGNONE 
J075172I17ACATGGGCCGCNONE 
J075172I17ACCGGCCCATGGNONE 
J090025O09ACATGGGCCGCNONE 
J090025O09ACCGGCCCATGGNONE 
J100087H03ACATGGGCCGCNONE 
J100087H03ACCGGCCCATGGNONE 
Os01g0513800012-032-E11AGATGGGCCGAANONE 
AK100776AGATGGGCCGAASimilar to Brix domain containing protein 1 homolog. 
J023120C10AGATGGGCCGAANONE 
J033044A22AGATGGGCCGAANONE 
J033048H13AGATGGGCCGAANONE 
J033118F03AGATGGGCCGAANONE 
J065176B05AGATGGGCCGAANONE 
J075026B19AGATGGGCCGAANONE 
J075048I23AGATGGGCCGAANONE 
J075141A19AGATGGGCCGAANONE 
J075148E05AGATGGGCCGAANONE 
J090031M12AGATGGGCCGAANONE 
Os01g0514300AK121086ATATGGGCCGGCLissencephaly type-1-like homology motif domain containing protein. 
AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0530366J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023019D12TGGATGGGCCGGANONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0612800AK071035AAATGGGCCGAConserved hypothetical protein. 
J090075K01AAATGGGCCGANONE 
Os01g0613900014-018-D04GCGGCCCATGANONE 
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GCGGCCCATGANONE 
J065019A15GCGGCCCATGANONE 
J075090J10GCGGCCCATGANONE 
J075195H12GCGGCCCATGANONE 
Os01g0618500011-019-D03TAATGGGCCGANONE 
AK067476TAATGGGCCGASimilar to RNA helicase (Fragment). 
J013020E19TAATGGGCCGANONE 
J033046J12TAATGGGCCGANONE 
J033055D06TAATGGGCCGANONE 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0674500013-062-A08CCCGGCCCATCCNONE 
AK072815CCCGGCCCATCCNONE 
J023142B02CCCGGCCCATCCNONE 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08ACCGGCCCATGANONE 
J033064N24ACCGGCCCATGANONE 
J043022M20ACCGGCCCATGANONE 
J065075K20ACCGGCCCATGANONE 
J065081K04ACCGGCCCATGANONE 
J065128K13ACCGGCCCATGANONE 
J065131K12ACCGGCCCATGANONE 
J065137H20ACCGGCCCATGANONE 
J065205A09ACCGGCCCATGANONE 
J090030C13ACCGGCCCATGANONE 
J090053I08ACCGGCCCATGANONE 
J090054O22ACCGGCCCATGANONE 
J090082C15ACCGGCCCATGANONE 
J090097P12ACCGGCCCATGANONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0705300AK102719AAATGGGCCGTGConserved hypothetical protein. 
AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK102719CACGGCCCATCTConserved hypothetical protein. 
AK103903AAATGGGCCGTGNONE 
AK103903AGATGGGCCGTGGGCCGTGNONE 
AK103903CACGGCCCATCTNONE 
J013146O16AAATGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J013146O16CACGGCCCATCTNONE 
J023024O09AAATGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J023024O09CACGGCCCATCTNONE 
J033105F22AAATGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033105F22CACGGCCCATCTNONE 
J033150L19AAATGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J033150L19CACGGCCCATCTNONE 
J075008G14AAATGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J075008G14CACGGCCCATCTNONE 
J090089L03AAATGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J090089L03CACGGCCCATCTNONE 
J100040H18AAATGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
J100040H18CACGGCCCATCTNONE 
Os01g0705500AK063120AGATGGGCCGTGConserved hypothetical protein. 
AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
AK063120CACGGCCCATTTConserved hypothetical protein. 
J065063M12AGATGGGCCGTGNONE 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065063M12CACGGCCCATTTNONE 
J065165C11AGATGGGCCGTGNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCATTTNONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0754000014-081-F07AAATGGGCCGCNONE 
AK063730AAATGGGCCGCConserved hypothetical protein. 
J065219A11AAATGGGCCGCNONE 
J075136N13AAATGGGCCGCNONE 
J100051G01AAATGGGCCGCNONE 
J100053M22AAATGGGCCGCNONE 
Os01g0764600AK060621TGATGGGCCGGAFosfomycin resistance kinase FomA family protein. 
J013111L18TGATGGGCCGGANONE 
J013134N08TGATGGGCCGGANONE 
Os01g0767100AK109493TGATGGGCCGGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0770500AK071653TCGGCCCATCANONE 
AK099603TCGGCCCATCASimilar to ABC transporter ATP-binding protein. 
Os01g0773600AK067004TCGGCCCATTGlycoside hydrolase, family 47 protein. 
J013091F09TCGGCCCATTNONE 
J013134K14TCGGCCCATTNONE 
J013158J15TCGGCCCATTNONE 
J033060O20TCGGCCCATTNONE 
J033074C16TCGGCCCATTNONE 
J075086F05TCGGCCCATTNONE 
J075150H08TCGGCCCATTNONE 
J090006E02TCGGCCCATTNONE 
J090074E02TCGGCCCATTNONE 
J100030M05TCGGCCCATTNONE 
J100036M16TCGGCCCATTNONE 
J100063H18TCGGCCCATTNONE 
Os01g0784600AK067527TCGGCCCATATConserved hypothetical protein. 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0830500006-117-F06TCCGGCCCATCCNONE 
AK061475TCCGGCCCATCCNONE 
AK105801TCCGGCCCATCC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17TCCGGCCCATCCNONE 
J065211O10TCCGGCCCATCCNONE 
Os01g0838300J090017B22AATGGGCCGTANONE 
J090061B04AATGGGCCGTANONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein. 
Os01g0863166J065007F23CCACGGCCCATTTNONE 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
Os01g0865100016-066-A05CCCGGCCCATCNONE 
AK065779CCCGGCCCATCNONE 
AK071410CCCGGCCCATCSimilar to Uricase (Fragment). 
J013039E23CCCGGCCCATCNONE 
J023024I07CCCGGCCCATCNONE 
J065160J15CCCGGCCCATCNONE 
J090052J17CCCGGCCCATCNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0869800006-029-F03CACGCCACGCGGCCCATGNONE 
006-067-H02CACGCCACGCGGCCCATGNONE 
006-084-A06CACGCCACGCGGCCCATGNONE 
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS. 
AK071827CACGCCACGCGGCCCATGNONE 
AK104275CACGCCACGCGGCCCATGNONE 
J013049J07CACGCCACGCGGCCCATGNONE 
J033089F12CACGCCACGCGGCCCATGNONE 
J090094I11CACGCCACGCGGCCCATGNONE 
Os01g0876500J053026A07CGATGGGCCGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CGATGGGCCGTGNONE 
Os01g0904400AJ535210GCGGCCCATGGNONE 
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog. 
Os01g0924000004-020-C09GTATGGGCCGGCCCNONE 
004-020-C09TGATGGGCCGTANONE 
005-014-A06GTATGGGCCGGCCCNONE 
005-014-A06TGATGGGCCGTANONE 
009-085-G12GTATGGGCCGGCCCNONE 
009-085-G12TGATGGGCCGTANONE 
009-123-A08GTATGGGCCGGCCCNONE 
009-123-A08TGATGGGCCGTANONE 
009-134-A05GTATGGGCCGGCCCNONE 
009-134-A05TGATGGGCCGTANONE 
009-137-F06GTATGGGCCGGCCCNONE 
009-137-F06TGATGGGCCGTANONE 
016-016-B08GTATGGGCCGGCCCNONE 
016-016-B08TGATGGGCCGTANONE 
AF050674GTATGGGCCGGCCCNONE 
AF050674TGATGGGCCGTANONE 
AK061690GTATGGGCCGGCCCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690TGATGGGCCGTASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GTATGGGCCGGCCCNONE 
AK120797TGATGGGCCGTANONE 
J013040A15GTATGGGCCGGCCCNONE 
J013040A15TGATGGGCCGTANONE 
J013104L20GTATGGGCCGGCCCNONE 
J013104L20TGATGGGCCGTANONE 
J013127E12GTATGGGCCGGCCCNONE 
J013127E12TGATGGGCCGTANONE 
J013158O05GTATGGGCCGGCCCNONE 
J013158O05TGATGGGCCGTANONE 
J023012E09GTATGGGCCGGCCCNONE 
J023012E09TGATGGGCCGTANONE 
J023126L23GTATGGGCCGGCCCNONE 
J023126L23TGATGGGCCGTANONE 
J023143B03GTATGGGCCGGCCCNONE 
J023143B03TGATGGGCCGTANONE 
J065005B16GTATGGGCCGGCCCNONE 
J065005B16TGATGGGCCGTANONE 
J065101J15GTATGGGCCGGCCCNONE 
J065101J15TGATGGGCCGTANONE 
J065105K16GTATGGGCCGGCCCNONE 
J065105K16TGATGGGCCGTANONE 
J065155K16GTATGGGCCGGCCCNONE 
J065155K16TGATGGGCCGTANONE 
J065171M17GTATGGGCCGGCCCNONE 
J065171M17TGATGGGCCGTANONE 
J065182F07GTATGGGCCGGCCCNONE 
J065182F07TGATGGGCCGTANONE 
J065187D10GTATGGGCCGGCCCNONE 
J065187D10TGATGGGCCGTANONE 
J065194I24GTATGGGCCGGCCCNONE 
J065194I24TGATGGGCCGTANONE 
J065207E24GTATGGGCCGGCCCNONE 
J065207E24TGATGGGCCGTANONE 
J075001C24GTATGGGCCGGCCCNONE 
J075001C24TGATGGGCCGTANONE 
J075090O10GTATGGGCCGGCCCNONE 
J075090O10TGATGGGCCGTANONE 
J075095H17GTATGGGCCGGCCCNONE 
J075095H17TGATGGGCCGTANONE 
J075109M24GTATGGGCCGGCCCNONE 
J075109M24TGATGGGCCGTANONE 
J075123C18GTATGGGCCGGCCCNONE 
J075123C18TGATGGGCCGTANONE 
J075148G22GTATGGGCCGGCCCNONE 
J075148G22TGATGGGCCGTANONE 
J090009B09GTATGGGCCGGCCCNONE 
J090009B09TGATGGGCCGTANONE 
J090075K17GTATGGGCCGGCCCNONE 
J090075K17TGATGGGCCGTANONE 
J090081H23GTATGGGCCGGCCCNONE 
J090081H23TGATGGGCCGTANONE 
J090097H21GTATGGGCCGGCCCNONE 
J090097H21TGATGGGCCGTANONE 
J100063P14GTATGGGCCGGCCCNONE 
J100063P14TGATGGGCCGTANONE 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os01g0946200AK071060AAATGGGCCGCNo apical meristem (NAM) protein domain containing protein. 
J023080K20AAATGGGCCGCNONE 
Os01g0954400003-009-F12TAATGGGCCGANONE 
012-080-B09TAATGGGCCGANONE 
AK065709TAATGGGCCGASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335TAATGGGCCGANONE 
J013039J02TAATGGGCCGANONE 
J033081E17TAATGGGCCGANONE 
J075058B02TAATGGGCCGANONE 
J075067K19TAATGGGCCGANONE 
J075120E23TAATGGGCCGANONE 
J075147I16TAATGGGCCGANONE 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0119400AK060055GACGGCCCATATNONE 
AK102774GACGGCCCATATSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GACGGCCCATATNONE 
J075175F09GACGGCCCATATNONE 
J090011H05GACGGCCCATATNONE 
J090091O05GACGGCCCATATNONE 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0130300011-005-D07AAATGGGCCGAGNONE 
011-041-B06AAATGGGCCGAGNONE 
015-099-D11AAATGGGCCGAGNONE 
016-049-D06AAATGGGCCGAGNONE 
AK102708AAATGGGCCGAGZinc finger, RING-type domain containing protein. 
Os02g0136800011-089-E11CTCGGCCCATTNONE 
AK070727CTCGGCCCATTNONE 
AK103485CTCGGCCCATTProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10CTCGGCCCATTNONE 
J033140H14CTCGGCCCATTNONE 
J033142H14CTCGGCCCATTNONE 
J065151O09CTCGGCCCATTNONE 
J090076K09CTCGGCCCATTNONE 
J090085K04CTCGGCCCATTNONE 
Os02g0148400AK070451TCCGGCCCATGANONE 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TCCGGCCCATGANONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
Os02g0187600AK069783CGATGGGCCGCANONE 
AK109387CGATGGGCCGCAConserved hypothetical protein. 
J090029C18CGATGGGCCGCANONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0193500009-092-G09TCTCGGCCCATCANONE 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13TCTCGGCCCATCANONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0205300006-050-H03ACATGGGCCGGCNONE 
011-057-B04ACATGGGCCGGCNONE 
AB033537ACATGGGCCGGCNONE 
AB052887ACATGGGCCGGCNONE 
AK061762ACATGGGCCGGCNONE 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
AK106217ACATGGGCCGGCNONE 
J013000E18ACATGGGCCGGCNONE 
J023030F11ACATGGGCCGGCNONE 
J033030E16ACATGGGCCGGCNONE 
J033061B21ACATGGGCCGGCNONE 
J033086D09ACATGGGCCGGCNONE 
J033089I16ACATGGGCCGGCNONE 
J033132G01ACATGGGCCGGCNONE 
J090003O15ACATGGGCCGGCNONE 
J090004A19ACATGGGCCGGCNONE 
J090054P05ACATGGGCCGGCNONE 
J090083M17ACATGGGCCGGCNONE 
J100039E08ACATGGGCCGGCNONE 
J100058D24ACATGGGCCGGCNONE 
J100066P09ACATGGGCCGGCNONE 
J100086K12ACATGGGCCGGCNONE 
J100088J15ACATGGGCCGGCNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0227000J023084F07ACCGGCCCATTTNONE 
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein. 
Os02g0230200AK105482GACGGCCCATTTConserved hypothetical protein. 
AK105482TTATGGGCCGCConserved hypothetical protein. 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0266500AK100307TCGGCCCATTTSimilar to RASPBERRY3. 
Os02g0304800Os02g0304800TCCGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0312700AK072956CGATGGGCCGTGATP11 family protein. 
AK102909CGATGGGCCGTGNONE 
J065017G18CGATGGGCCGTGNONE 
J075066A05CGATGGGCCGTGNONE 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK060611TCGGCCCATAABrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
AK102534TCGGCCCATAANONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08TCGGCCCATAANONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18TCGGCCCATAANONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01TCGGCCCATAANONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14TCGGCCCATAANONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17TCGGCCCATAANONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13TCGGCCCATAANONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17TCGGCCCATAANONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07TCGGCCCATAANONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10TCGGCCCATAANONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03TCGGCCCATAANONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20TCGGCCCATAANONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03TCGGCCCATAANONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12TCGGCCCATAANONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07TCGGCCCATAANONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06TCGGCCCATAANONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07TCGGCCCATAANONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08TCGGCCCATAANONE 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0605600016-017-B02TCATGGGCCGCNONE 
AK066104TCATGGGCCGCLUC7 related family protein. 
J013052G16TCATGGGCCGCNONE 
J043022E03TCATGGGCCGCNONE 
J065105P10TCATGGGCCGCNONE 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0646200009-031-C03AACGGCCCATGNONE 
AK071507AACGGCCCATGZinc finger, B-box domain containing protein. 
J023090D24AACGGCCCATGNONE 
Os02g0651900AK101633AATGGGCCGGTNONE 
AK102949AATGGGCCGGTConserved hypothetical protein. 
J080018N20AATGGGCCGGTNONE 
J080062I19AATGGGCCGGTNONE 
J100064N12AATGGGCCGGTNONE 
J100083B11AATGGGCCGGTNONE 
J100089D08AATGGGCCGGTNONE 
Os02g0656500011-045-C08AAATGGGCCGAANONE 
011-045-E06AAATGGGCCGAANONE 
016-046-A01AAATGGGCCGAANONE 
016-046-B01AAATGGGCCGAANONE 
AK062239AAATGGGCCGAANONE 
AK066420AAATGGGCCGAADnaJ-like protein. 
J013067J21AAATGGGCCGAANONE 
J065047L09AAATGGGCCGAANONE 
J065104M20AAATGGGCCGAANONE 
J065134B04AAATGGGCCGAANONE 
J065152C10AAATGGGCCGAANONE 
J065161O03AAATGGGCCGAANONE 
J065169F18AAATGGGCCGAANONE 
J065210M21AAATGGGCCGAANONE 
J065217B03AAATGGGCCGAANONE 
J065218C10AAATGGGCCGAANONE 
J075041F09AAATGGGCCGAANONE 
J075048A02AAATGGGCCGAANONE 
J075083F21AAATGGGCCGAANONE 
J080005F10AAATGGGCCGAANONE 
J080013P21AAATGGGCCGAANONE 
J080027J09AAATGGGCCGAANONE 
J080037O17AAATGGGCCGAANONE 
J080039F02AAATGGGCCGAANONE 
J080039G01AAATGGGCCGAANONE 
J080041I09AAATGGGCCGAANONE 
J080043M01AAATGGGCCGAANONE 
J080060H17AAATGGGCCGAANONE 
J080062O07AAATGGGCCGAANONE 
J080079F05AAATGGGCCGAANONE 
J080093H04AAATGGGCCGAANONE 
J080096B15AAATGGGCCGAANONE 
J080097H24AAATGGGCCGAANONE 
J090032O11AAATGGGCCGAANONE 
J090044F01AAATGGGCCGAANONE 
J090045E04AAATGGGCCGAANONE 
J090048O03AAATGGGCCGAANONE 
J090049E04AAATGGGCCGAANONE 
J090070E19AAATGGGCCGAANONE 
J090079E13AAATGGGCCGAANONE 
J090089L14AAATGGGCCGAANONE 
J090095K13AAATGGGCCGAANONE 
J090096I19AAATGGGCCGAANONE 
J090098B04AAATGGGCCGAANONE 
J100027P13AAATGGGCCGAANONE 
J100048H06AAATGGGCCGAANONE 
J100060J15AAATGGGCCGAANONE 
J100070K16AAATGGGCCGAANONE 
J100074O22AAATGGGCCGAANONE 
Os02g0665400AK073914TGGATGGGCCGANONE 
AK109787TGGATGGGCCGANONE 
AK120141TGGATGGGCCGASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TGGATGGGCCGANONE 
J075165B08TGGATGGGCCGANONE 
J075177B03TGGATGGGCCGANONE 
J075191K02TGGATGGGCCGANONE 
J090051I12TGGATGGGCCGANONE 
J090057E21TGGATGGGCCGANONE 
J090058E01TGGATGGGCCGANONE 
J090087C06TGGATGGGCCGANONE 
J100025K07TGGATGGGCCGANONE 
J100026I21TGGATGGGCCGANONE 
J100041E12TGGATGGGCCGANONE 
J100083B01TGGATGGGCCGANONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein. 
J075148E09AACGGCCCATGNONE 
J080024A08AACGGCCCATGNONE 
J080063C14AACGGCCCATGNONE 
J080072L04AACGGCCCATGNONE 
J080074H15AACGGCCCATGNONE 
J080080E22AACGGCCCATGNONE 
J080086H10AACGGCCCATGNONE 
J080093B21AACGGCCCATGNONE 
J080094G01AACGGCCCATGNONE 
J080306H24AACGGCCCATGNONE 
Os02g0679200AK110789TTCGGCCCATACTetratricopeptide-like helical domain containing protein. 
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like. 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0717100014-089-G06CACGGCCCATTANONE 
AK063741CACGGCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J065052A22CACGGCCCATTANONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0736500AK065166TAATGGGCCGAANicastrin family protein. 
J013099D16TAATGGGCCGAANONE 
Os02g0740300AK067833TTCGGCCCATATAAA ATPase domain containing protein. 
Os02g0750500AK101960GCGGCCCATTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GCGGCCCATTTNONE 
J065054F02GCGGCCCATTTNONE 
J065124N03GCGGCCCATTTNONE 
J090001H12GCGGCCCATTTNONE 
J100057J01GCGGCCCATTTNONE 
J100062F12GCGGCCCATTTNONE 
Os02g0757900006-114-B06AGATGGGCCGANONE 
AK061269AGATGGGCCGASimilar to Poly(A)-binding protein II-like. 
AK071146AGATGGGCCGANONE 
J023081D16AGATGGGCCGANONE 
J043034B17AGATGGGCCGANONE 
J065027M09AGATGGGCCGANONE 
J065043F02AGATGGGCCGANONE 
J065086G05AGATGGGCCGANONE 
J065093A05AGATGGGCCGANONE 
J065109F16AGATGGGCCGANONE 
J065130N09AGATGGGCCGANONE 
J065154D24AGATGGGCCGANONE 
J065199L11AGATGGGCCGANONE 
J075166H22AGATGGGCCGANONE 
Os02g0758000013-065-E04TCGGCCCATCTNONE 
014-002-E03TCGGCCCATCTNONE 
014-004-B07TCGGCCCATCTNONE 
014-038-F03TCGGCCCATCTNONE 
014-072-G02TCGGCCCATCTNONE 
014-078-E02TCGGCCCATCTNONE 
014-081-H11TCGGCCCATCTNONE 
016-060-C11TCGGCCCATCTNONE 
AK064389TCGGCCCATCTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003TCGGCCCATCTNONE 
AK105464TCGGCCCATCTNONE 
J033076P21TCGGCCCATCTNONE 
Os02g0767100011-054-E05AGATGGGCCGAGNONE 
AK063351AGATGGGCCGAGNONE 
AK103640AGATGGGCCGAGConserved hypothetical protein. 
J090022G11AGATGGGCCGAGNONE 
J090072L18AGATGGGCCGAGNONE 
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein. 
Os02g0771200011-006-B07GCCGGCCCATAANONE 
AK066823GCCGGCCCATAAConserved hypothetical protein. 
AK071059GCCGGCCCATAANONE 
J013075K03GCCGGCCCATAANONE 
Os02g0775600003-118-H07AAATGGGCCGGGNONE 
009-075-H07AAATGGGCCGGGNONE 
AK058592AAATGGGCCGGGNONE 
AK068762AAATGGGCCGGGZinc finger, C2H2-type domain containing protein. 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AB042415GACGGCCCATCANONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK072308GACGGCCCATCAReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
AK101212GACGGCCCATCANONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J033031B02GACGGCCCATCANONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090004E18GACGGCCCATCANONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
J090084C24GACGGCCCATCANONE 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0788500006-024-A02AGATGGGCCGAGNONE 
006-031-G02AGATGGGCCGAGNONE 
006-081-F11AGATGGGCCGAGNONE 
006-082-H05AGATGGGCCGAGNONE 
AK061452AGATGGGCCGAGConserved hypothetical protein. 
AK104117AGATGGGCCGAGNONE 
AK104526AGATGGGCCGAGNONE 
J075024D11AGATGGGCCGAGNONE 
J075056B12AGATGGGCCGAGNONE 
J075108H12AGATGGGCCGAGNONE 
J075156P10AGATGGGCCGAGNONE 
J075197A19AGATGGGCCGAGNONE 
Os02g0803200AK063404AGATGGGCCGGASimilar to 30S ribosomal protein S15. 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
Os02g0819100AK100156TTCGGCCCATTAZinc finger, DHHC-type domain containing protein. 
J013088C21TTCGGCCCATTANONE 
Os02g0823600AK070498TAATGGGCCGCConserved hypothetical protein. 
AK070498TCCGGCCCATTTConserved hypothetical protein. 
J065055C02TAATGGGCCGCNONE 
J065055C02TCCGGCCCATTTNONE 
J065098A17TAATGGGCCGCNONE 
J065098A17TCCGGCCCATTTNONE 
J065119B13TAATGGGCCGCNONE 
J065119B13TCCGGCCCATTTNONE 
J065146F10TAATGGGCCGCNONE 
J065146F10TCCGGCCCATTTNONE 
J065209G06TAATGGGCCGCNONE 
J065209G06TCCGGCCCATTTNONE 
J080001K12TAATGGGCCGCNONE 
J080001K12TCCGGCCCATTTNONE 
J080004O17TAATGGGCCGCNONE 
J080004O17TCCGGCCCATTTNONE 
J080005P21TAATGGGCCGCNONE 
J080005P21TCCGGCCCATTTNONE 
J080009M18TAATGGGCCGCNONE 
J080009M18TCCGGCCCATTTNONE 
J080013O18TAATGGGCCGCNONE 
J080013O18TCCGGCCCATTTNONE 
J080014B04TAATGGGCCGCNONE 
J080014B04TCCGGCCCATTTNONE 
J080014O21TAATGGGCCGCNONE 
J080014O21TCCGGCCCATTTNONE 
J080015B04TAATGGGCCGCNONE 
J080015B04TCCGGCCCATTTNONE 
J080016B17TAATGGGCCGCNONE 
J080016B17TCCGGCCCATTTNONE 
J080017G09TAATGGGCCGCNONE 
J080017G09TCCGGCCCATTTNONE 
J080022A17TAATGGGCCGCNONE 
J080022A17TCCGGCCCATTTNONE 
J080024M10TAATGGGCCGCNONE 
J080024M10TCCGGCCCATTTNONE 
J080025F17TAATGGGCCGCNONE 
J080025F17TCCGGCCCATTTNONE 
J080025O16TAATGGGCCGCNONE 
J080025O16TCCGGCCCATTTNONE 
J080029H09TAATGGGCCGCNONE 
J080029H09TCCGGCCCATTTNONE 
J080030G24TAATGGGCCGCNONE 
J080030G24TCCGGCCCATTTNONE 
J080031E02TAATGGGCCGCNONE 
J080031E02TCCGGCCCATTTNONE 
J080032A18TAATGGGCCGCNONE 
J080032A18TCCGGCCCATTTNONE 
J080032G24TAATGGGCCGCNONE 
J080032G24TCCGGCCCATTTNONE 
J080033C05TAATGGGCCGCNONE 
J080033C05TCCGGCCCATTTNONE 
J080033N19TAATGGGCCGCNONE 
J080033N19TCCGGCCCATTTNONE 
J080035H10TAATGGGCCGCNONE 
J080035H10TCCGGCCCATTTNONE 
J080035L05TAATGGGCCGCNONE 
J080035L05TCCGGCCCATTTNONE 
J080042N09TAATGGGCCGCNONE 
J080042N09TCCGGCCCATTTNONE 
J080044C14TAATGGGCCGCNONE 
J080044C14TCCGGCCCATTTNONE 
J080048K16TAATGGGCCGCNONE 
J080048K16TCCGGCCCATTTNONE 
J080050L07TAATGGGCCGCNONE 
J080050L07TCCGGCCCATTTNONE 
J080051L06TAATGGGCCGCNONE 
J080051L06TCCGGCCCATTTNONE 
J080051P22TAATGGGCCGCNONE 
J080051P22TCCGGCCCATTTNONE 
J080053D09TAATGGGCCGCNONE 
J080053D09TCCGGCCCATTTNONE 
J080053J15TAATGGGCCGCNONE 
J080053J15TCCGGCCCATTTNONE 
J080053O12TAATGGGCCGCNONE 
J080053O12TCCGGCCCATTTNONE 
J080057L01TAATGGGCCGCNONE 
J080057L01TCCGGCCCATTTNONE 
J080062E08TAATGGGCCGCNONE 
J080062E08TCCGGCCCATTTNONE 
J080062I09TAATGGGCCGCNONE 
J080062I09TCCGGCCCATTTNONE 
J080063A21TAATGGGCCGCNONE 
J080063A21TCCGGCCCATTTNONE 
J080063E04TAATGGGCCGCNONE 
J080063E04TCCGGCCCATTTNONE 
J080063E08TAATGGGCCGCNONE 
J080063E08TCCGGCCCATTTNONE 
J080064D15TAATGGGCCGCNONE 
J080064D15TCCGGCCCATTTNONE 
J080064N15TAATGGGCCGCNONE 
J080064N15TCCGGCCCATTTNONE 
J080068F13TAATGGGCCGCNONE 
J080068F13TCCGGCCCATTTNONE 
J080070L16TAATGGGCCGCNONE 
J080070L16TCCGGCCCATTTNONE 
J080072O17TAATGGGCCGCNONE 
J080072O17TCCGGCCCATTTNONE 
J080075A07TAATGGGCCGCNONE 
J080075A07TCCGGCCCATTTNONE 
J080076H10TAATGGGCCGCNONE 
J080076H10TCCGGCCCATTTNONE 
J080077K19TAATGGGCCGCNONE 
J080077K19TCCGGCCCATTTNONE 
J080078E19TAATGGGCCGCNONE 
J080078E19TCCGGCCCATTTNONE 
J080082A02TAATGGGCCGCNONE 
J080082A02TCCGGCCCATTTNONE 
J080083O05TAATGGGCCGCNONE 
J080083O05TCCGGCCCATTTNONE 
J080091I07TAATGGGCCGCNONE 
J080091I07TCCGGCCCATTTNONE 
J080094K10TAATGGGCCGCNONE 
J080094K10TCCGGCCCATTTNONE 
J080094N03TAATGGGCCGCNONE 
J080094N03TCCGGCCCATTTNONE 
J080096F09TAATGGGCCGCNONE 
J080096F09TCCGGCCCATTTNONE 
J080097O04TAATGGGCCGCNONE 
J080097O04TCCGGCCCATTTNONE 
J090037B19TAATGGGCCGCNONE 
J090037B19TCCGGCCCATTTNONE 
J100017A13TAATGGGCCGCNONE 
J100017A13TCCGGCCCATTTNONE 
J100068N22TAATGGGCCGCNONE 
J100068N22TCCGGCCCATTTNONE 
J100072C06TAATGGGCCGCNONE 
J100072C06TCCGGCCCATTTNONE 
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein. 
J075055J16ACCGGCCCATATNONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os03g0115200009-112-E09GCGGCCCATTANONE 
009-112-E09TCGGACGGCCCATGNONE 
AK071287GCGGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06GCGGCCCATTANONE 
J023088J06TCGGACGGCCCATGNONE 
J065075D17GCGGCCCATTANONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15GCGGCCCATTANONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16GCGGCCCATTANONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12GCGGCCCATTANONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06GCGGCCCATTANONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14GCGGCCCATTANONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10GCGGCCCATTANONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04GCGGCCCATTANONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05GCGGCCCATTANONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16GCGGCCCATTANONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0116500AF106844TAATGGGCCGANONE 
AK101870TAATGGGCCGAConstitutive photomorphogenic 11. 
J023055L16TAATGGGCCGANONE 
J023088I16TAATGGGCCGANONE 
J033070E21TAATGGGCCGANONE 
J065124N22TAATGGGCCGANONE 
J075152A19TAATGGGCCGANONE 
J075181J21TAATGGGCCGANONE 
J090011F23TAATGGGCCGANONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882ACATGGGCCGTGNONE 
AK104882TTTCGGCCCATATNONE 
J013075C10ACATGGGCCGTGNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18ACATGGGCCGTGNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08ACATGGGCCGTGNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0125000006-032-D09CGATGGGCCGAANONE 
006-033-B05CGATGGGCCGAANONE 
006-048-G06CGATGGGCCGAANONE 
006-048-G09CGATGGGCCGAANONE 
006-052-D09CGATGGGCCGAANONE 
006-072-A04CGATGGGCCGAANONE 
006-076-F12CGATGGGCCGAANONE 
006-080-B03CGATGGGCCGAANONE 
006-092-H03CGATGGGCCGAANONE 
006-103-G04CGATGGGCCGAANONE 
009-079-E01CGATGGGCCGAANONE 
009-150-F03CGATGGGCCGAANONE 
AF095708CGATGGGCCGAANONE 
AK059557CGATGGGCCGAANONE 
AK070779CGATGGGCCGAASimilar to 50S ribosomal protein L5, chloroplast. 
AK098999CGATGGGCCGAANONE 
AK104137CGATGGGCCGAANONE 
J065002D07CGATGGGCCGAANONE 
J065167E24CGATGGGCCGAANONE 
J075199O14CGATGGGCCGAANONE 
J100083L01CGATGGGCCGAANONE 
Os03g0125700009-132-G03TAATGGGCCGAAANONE 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16TAATGGGCCGAAANONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0128500AB037900AATGGGCCGGANONE 
AB037900TCCGGCCCATTNONE 
AK067991AATGGGCCGGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
AK067991TCCGGCCCATTSimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04AATGGGCCGGANONE 
J013124O04TCCGGCCCATTNONE 
J090032P09AATGGGCCGGANONE 
J090032P09TCCGGCCCATTNONE 
Os03g0130700AK110670TCCGGCCCATTTNONE 
Os03g0131200AB020502TGCGGCCCATGTNONE 
AK062174TGCGGCCCATGTNONE 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372TGCGGCCCATGTNONE 
J013060B21TGCGGCCCATGTNONE 
J013149P20TGCGGCCCATGTNONE 
J023060E16TGCGGCCCATGTNONE 
J043004A19TGCGGCCCATGTNONE 
J053029N09TGCGGCCCATGTNONE 
J053072I10TGCGGCCCATGTNONE 
J065016G02TGCGGCCCATGTNONE 
J065022E22TGCGGCCCATGTNONE 
J065024K17TGCGGCCCATGTNONE 
J065035E10TGCGGCCCATGTNONE 
J065036D13TGCGGCCCATGTNONE 
J065041E06TGCGGCCCATGTNONE 
J065064H14TGCGGCCCATGTNONE 
J065067I06TGCGGCCCATGTNONE 
J065080C01TGCGGCCCATGTNONE 
J065086K23TGCGGCCCATGTNONE 
J065087L12TGCGGCCCATGTNONE 
J065090I05TGCGGCCCATGTNONE 
J065117E23TGCGGCCCATGTNONE 
J065120A10TGCGGCCCATGTNONE 
J065120L22TGCGGCCCATGTNONE 
J065123F02TGCGGCCCATGTNONE 
J065128G02TGCGGCCCATGTNONE 
J065142B04TGCGGCCCATGTNONE 
J065143K12TGCGGCCCATGTNONE 
J065148B18TGCGGCCCATGTNONE 
J065153C16TGCGGCCCATGTNONE 
J065163J11TGCGGCCCATGTNONE 
J065168L24TGCGGCCCATGTNONE 
J065181J11TGCGGCCCATGTNONE 
J065190F19TGCGGCCCATGTNONE 
J065209E24TGCGGCCCATGTNONE 
J065210G04TGCGGCCCATGTNONE 
J065217H17TGCGGCCCATGTNONE 
J065219I20TGCGGCCCATGTNONE 
J075001M13TGCGGCCCATGTNONE 
J075007B08TGCGGCCCATGTNONE 
J075009I01TGCGGCCCATGTNONE 
J075014C11TGCGGCCCATGTNONE 
J075014L02TGCGGCCCATGTNONE 
J075016E07TGCGGCCCATGTNONE 
J075017J02TGCGGCCCATGTNONE 
J075018F07TGCGGCCCATGTNONE 
J075018N07TGCGGCCCATGTNONE 
J075019B06TGCGGCCCATGTNONE 
J075024F21TGCGGCCCATGTNONE 
J075026B18TGCGGCCCATGTNONE 
J075026M12TGCGGCCCATGTNONE 
J075032B13TGCGGCCCATGTNONE 
J075033O09TGCGGCCCATGTNONE 
J075041A09TGCGGCCCATGTNONE 
J075045L13TGCGGCCCATGTNONE 
J075048N11TGCGGCCCATGTNONE 
J075052A14TGCGGCCCATGTNONE 
J075061B17TGCGGCCCATGTNONE 
J075061I05TGCGGCCCATGTNONE 
J075066I11TGCGGCCCATGTNONE 
J075066P09TGCGGCCCATGTNONE 
J075068F03TGCGGCCCATGTNONE 
J075068P22TGCGGCCCATGTNONE 
J075080I15TGCGGCCCATGTNONE 
J075081I07TGCGGCCCATGTNONE 
J075082K01TGCGGCCCATGTNONE 
J075083A18TGCGGCCCATGTNONE 
J075086O11TGCGGCCCATGTNONE 
J075087E02TGCGGCCCATGTNONE 
J075087M19TGCGGCCCATGTNONE 
J075088G23TGCGGCCCATGTNONE 
J075092K18TGCGGCCCATGTNONE 
J075095H15TGCGGCCCATGTNONE 
J075095K12TGCGGCCCATGTNONE 
J075096L06TGCGGCCCATGTNONE 
J075100H23TGCGGCCCATGTNONE 
J075100K01TGCGGCCCATGTNONE 
J075102K21TGCGGCCCATGTNONE 
J075104F24TGCGGCCCATGTNONE 
J075106C17TGCGGCCCATGTNONE 
J075106E06TGCGGCCCATGTNONE 
J075106M19TGCGGCCCATGTNONE 
J075106O12TGCGGCCCATGTNONE 
J075108I09TGCGGCCCATGTNONE 
J075111M06TGCGGCCCATGTNONE 
J075112E12TGCGGCCCATGTNONE 
J075114C04TGCGGCCCATGTNONE 
J075120A06TGCGGCCCATGTNONE 
J075120D14TGCGGCCCATGTNONE 
J075122P15TGCGGCCCATGTNONE 
J075123A11TGCGGCCCATGTNONE 
J075123L12TGCGGCCCATGTNONE 
J075127G14TGCGGCCCATGTNONE 
J075127H09TGCGGCCCATGTNONE 
J075128M04TGCGGCCCATGTNONE 
J075129J04TGCGGCCCATGTNONE 
J075130J01TGCGGCCCATGTNONE 
J075137N02TGCGGCCCATGTNONE 
J075137O14TGCGGCCCATGTNONE 
J075138H22TGCGGCCCATGTNONE 
J075139P16TGCGGCCCATGTNONE 
J075141G08TGCGGCCCATGTNONE 
J075142C17TGCGGCCCATGTNONE 
J075143B09TGCGGCCCATGTNONE 
J075156I11TGCGGCCCATGTNONE 
J075158M03TGCGGCCCATGTNONE 
J075166I21TGCGGCCCATGTNONE 
J075167C08TGCGGCCCATGTNONE 
J075170C12TGCGGCCCATGTNONE 
J075170F08TGCGGCCCATGTNONE 
J075170G04TGCGGCCCATGTNONE 
J075172N16TGCGGCCCATGTNONE 
J075172P13TGCGGCCCATGTNONE 
J075173G24TGCGGCCCATGTNONE 
J075175D01TGCGGCCCATGTNONE 
J075175K01TGCGGCCCATGTNONE 
J075181O04TGCGGCCCATGTNONE 
J075186A04TGCGGCCCATGTNONE 
J075190B08TGCGGCCCATGTNONE 
J075190M24TGCGGCCCATGTNONE 
J075193D18TGCGGCCCATGTNONE 
J075193H03TGCGGCCCATGTNONE 
J075195N18TGCGGCCCATGTNONE 
J080001N20TGCGGCCCATGTNONE 
J080006K17TGCGGCCCATGTNONE 
J080012I16TGCGGCCCATGTNONE 
J080013K20TGCGGCCCATGTNONE 
J080018N01TGCGGCCCATGTNONE 
J080041G15TGCGGCCCATGTNONE 
J080048L15TGCGGCCCATGTNONE 
J080049A21TGCGGCCCATGTNONE 
J080075G12TGCGGCCCATGTNONE 
J080076O09TGCGGCCCATGTNONE 
J080078P10TGCGGCCCATGTNONE 
J080084D10TGCGGCCCATGTNONE 
J090005N07TGCGGCCCATGTNONE 
Os03g0139000006-059-C06TACGGCCCATCTNONE 
009-055-F07TACGGCCCATCTNONE 
AK060973TACGGCCCATCTConserved hypothetical protein. 
AK103850TACGGCCCATCTNONE 
Os03g0142900011-054-A05CAACGGCCCATTNONE 
AK067103CAACGGCCCATTNONE 
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein. 
J013097D18CAACGGCCCATTNONE 
J013098E18CAACGGCCCATTNONE 
J013099I17CAACGGCCCATTNONE 
J013108C09CAACGGCCCATTNONE 
J023045J15CAACGGCCCATTNONE 
J033034E13CAACGGCCCATTNONE 
J033095F07CAACGGCCCATTNONE 
J033102N22CAACGGCCCATTNONE 
J065016C14CAACGGCCCATTNONE 
J065034E13CAACGGCCCATTNONE 
J065065F21CAACGGCCCATTNONE 
J065159M09CAACGGCCCATTNONE 
J075012C13CAACGGCCCATTNONE 
J075017P18CAACGGCCCATTNONE 
J075018M03CAACGGCCCATTNONE 
J075021H19CAACGGCCCATTNONE 
J075070K23CAACGGCCCATTNONE 
J075077B18CAACGGCCCATTNONE 
J075085E20CAACGGCCCATTNONE 
J075090N23CAACGGCCCATTNONE 
J075137M16CAACGGCCCATTNONE 
J075151E03CAACGGCCCATTNONE 
J090042L02CAACGGCCCATTNONE 
J090060C21CAACGGCCCATTNONE 
J090089I17CAACGGCCCATTNONE 
J100024L19CAACGGCCCATTNONE 
J100025A06CAACGGCCCATTNONE 
J100033C24CAACGGCCCATTNONE 
J100052J17CAACGGCCCATTNONE 
J100063H10CAACGGCCCATTNONE 
J100073P04CAACGGCCCATTNONE 
J100075D01CAACGGCCCATTNONE 
J100077J17CAACGGCCCATTNONE 
J100087F03CAACGGCCCATTNONE 
J100087F09CAACGGCCCATTNONE 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21ACATGGGCCGCANONE 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08ACATGGGCCGCANONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19ACATGGGCCGCANONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10ACATGGGCCGCANONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22ACATGGGCCGCANONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09ACATGGGCCGCANONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18ACATGGGCCGCANONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03ACATGGGCCGCANONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05ACATGGGCCGCANONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23ACATGGGCCGCANONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16ACATGGGCCGCANONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04ACATGGGCCGCANONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03ACATGGGCCGCANONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15ACATGGGCCGCANONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18ACATGGGCCGCANONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0143600AB110188AAATGGGCCGCNONE 
AK068424AAATGGGCCGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464AAATGGGCCGCNONE 
AY224545AAATGGGCCGCNONE 
J013154F02AAATGGGCCGCNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0145700AK065716AAATGGGCCGGTNONE 
J013039F14AAATGGGCCGGTNONE 
J013091M20AAATGGGCCGGTNONE 
J065059P20AAATGGGCCGGTNONE 
J065128M07AAATGGGCCGGTNONE 
J065136N23AAATGGGCCGGTNONE 
J065163H21AAATGGGCCGGTNONE 
J065176B18AAATGGGCCGGTNONE 
J065177A17AAATGGGCCGGTNONE 
J065201F24AAATGGGCCGGTNONE 
Os03g0168200AK099530TGATGGGCCGTGConserved hypothetical protein. 
Os03g0181600AK067807TCCGGCCCATAASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TCCGGCCCATAANONE 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0204900009-041-G04TAATGGGCCGGGNONE 
AK062601TAATGGGCCGGGSimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein. 
AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGCNONE 
AK121985ACATGGGCCGTCNONE 
J023114O06ACATGGGCCGCNONE 
J023114O06ACATGGGCCGTCNONE 
J100043M20ACATGGGCCGCNONE 
J100043M20ACATGGGCCGTCNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0253100AK119618TTCGGCCCATTTPhosphomevalonate kinase Erg8 family protein. 
J033052A14TTCGGCCCATTTNONE 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0271500AK068546TATGGGCCGGCNONE 
AK109239TATGGGCCGGCConserved hypothetical protein. 
J013157P04TATGGGCCGGCNONE 
J075041K23TATGGGCCGGCNONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0298800009-079-B10TACGGCCCATCGNONE 
AK103337TACGGCCCATCGSimilar to Spliceosomal protein. 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0309800004-019-H07GGATGGGCCGCANONE 
AK060922GGATGGGCCGCANONE 
AK098942GGATGGGCCGCANONE 
AK106141GGATGGGCCGCANONE 
AK111530GGATGGGCCGCANONE 
AK111624GGATGGGCCGCASimilar to PPR2. 
J013024C10GGATGGGCCGCANONE 
J013043D15GGATGGGCCGCANONE 
J013108I11GGATGGGCCGCANONE 
J100058L07GGATGGGCCGCANONE 
J100071I19GGATGGGCCGCANONE 
Os03g0312600AK073391TGATGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0333000AK109811TGATGGGCCGAGConserved hypothetical protein. 
J065152D04TGATGGGCCGAGNONE 
J090011B05TGATGGGCCGAGNONE 
Os03g0333100AK101050CTCGGCCCATCAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067CTCGGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02CTCGGCCCATCTNONE 
J065162C21CTCGGCCCATCTNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0339100AK111641TGATGGGCCGGGSimilar to PRL1 protein. 
Os03g0343500009-042-G06CTCGGCCCATTANONE 
009-063-D01CTCGGCCCATTANONE 
009-156-H09CTCGGCCCATTANONE 
AB117995CTCGGCCCATTANONE 
AK058737CTCGGCCCATTANONE 
AK059599CTCGGCCCATTASimilar to 60S ribosomal protein L22-2. 
AK121502CTCGGCCCATTANONE 
J023082D10CTCGGCCCATTANONE 
J033022G11CTCGGCCCATTANONE 
J075048M16CTCGGCCCATTANONE 
J075049O20CTCGGCCCATTANONE 
J075082I02CTCGGCCCATTANONE 
J075105G01CTCGGCCCATTANONE 
J075131K05CTCGGCCCATTANONE 
J080002H01CTCGGCCCATTANONE 
J080003H01CTCGGCCCATTANONE 
J080005G08CTCGGCCCATTANONE 
J080011M13CTCGGCCCATTANONE 
J080020M02CTCGGCCCATTANONE 
J080026N24CTCGGCCCATTANONE 
J080028L09CTCGGCCCATTANONE 
J080032O14CTCGGCCCATTANONE 
J080033J12CTCGGCCCATTANONE 
J080035D05CTCGGCCCATTANONE 
J080039H01CTCGGCCCATTANONE 
J080044B07CTCGGCCCATTANONE 
J080044E23CTCGGCCCATTANONE 
J080049N11CTCGGCCCATTANONE 
J080050A21CTCGGCCCATTANONE 
J080055L24CTCGGCCCATTANONE 
J080059N20CTCGGCCCATTANONE 
J080061F04CTCGGCCCATTANONE 
J080078I16CTCGGCCCATTANONE 
J080079G24CTCGGCCCATTANONE 
J080080K13CTCGGCCCATTANONE 
J080083G20CTCGGCCCATTANONE 
J080087B08CTCGGCCCATTANONE 
J080091L19CTCGGCCCATTANONE 
J080094D06CTCGGCCCATTANONE 
J090038L06CTCGGCCCATTANONE 
J090075H06CTCGGCCCATTANONE 
J090081D12CTCGGCCCATTANONE 
Os03g0349000011-089-G05AGATGGGCCGANONE 
AK099999AGATGGGCCGANucleoporin interacting component family protein. 
J013134K18AGATGGGCCGANONE 
J033024G23AGATGGGCCGANONE 
J033098A12AGATGGGCCGANONE 
J090001N18AGATGGGCCGANONE 
J090058F11AGATGGGCCGANONE 
J090065C04AGATGGGCCGANONE 
J100067M17AGATGGGCCGANONE 
J100083P13AGATGGGCCGANONE 
Os03g0352800009-030-G08ACATGGGCCGTANONE 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17ACATGGGCCGTANONE 
J075050N19ACATGGGCCGTANONE 
J075104J18ACATGGGCCGTANONE 
J075142K05ACATGGGCCGTANONE 
J100050I19ACATGGGCCGTANONE 
J100057N04ACATGGGCCGTANONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0410700J065102A22GCGGCCCATGANONE 
J065102A22GCGGCCCATGGNONE 
Os03g0410900J065067F10CCATGGGCCGCNONE 
J065067F10TCATGGGCCGCNONE 
J065073D08CCATGGGCCGCNONE 
J065073D08TCATGGGCCGCNONE 
J065176C06CCATGGGCCGCNONE 
J065176C06TCATGGGCCGCNONE 
J065189O13CCATGGGCCGCNONE 
J065189O13TCATGGGCCGCNONE 
J065214E05CCATGGGCCGCNONE 
J065214E05TCATGGGCCGCNONE 
J080007H09CCATGGGCCGCNONE 
J080007H09TCATGGGCCGCNONE 
J080012B19CCATGGGCCGCNONE 
J080012B19TCATGGGCCGCNONE 
J080020J16CCATGGGCCGCNONE 
J080020J16TCATGGGCCGCNONE 
J080038J22CCATGGGCCGCNONE 
J080038J22TCATGGGCCGCNONE 
J080045I09CCATGGGCCGCNONE 
J080045I09TCATGGGCCGCNONE 
J080059M16CCATGGGCCGCNONE 
J080059M16TCATGGGCCGCNONE 
J080060C19CCATGGGCCGCNONE 
J080060C19TCATGGGCCGCNONE 
J080080P22CCATGGGCCGCNONE 
J080080P22TCATGGGCCGCNONE 
J080083C03CCATGGGCCGCNONE 
J080083C03TCATGGGCCGCNONE 
J080093M17CCATGGGCCGCNONE 
J080093M17TCATGGGCCGCNONE 
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
Os03g0415500AK108435GCGGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCGGCCCATCCANONE 
Os03g0442400Os03g0442400CCCGGCCCATCCNONE 
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein. 
Os03g0606200009-030-E09CCCGGCCCATGTNONE 
009-076-H10CCCGGCCCATGTNONE 
009-122-H12CCCGGCCCATGTNONE 
009-153-F09CCCGGCCCATGTNONE 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCCGGCCCATGTNONE 
AK107928CCCGGCCCATGTNONE 
J023078E13CCCGGCCCATGTNONE 
J053031N01CCCGGCCCATGTNONE 
J053046K19CCCGGCCCATGTNONE 
J053062P07CCCGGCCCATGTNONE 
J053091C23CCCGGCCCATGTNONE 
J053099N19CCCGGCCCATGTNONE 
J065005E06CCCGGCCCATGTNONE 
J065030N03CCCGGCCCATGTNONE 
J065138O21CCCGGCCCATGTNONE 
J065159K03CCCGGCCCATGTNONE 
J075030M08CCCGGCCCATGTNONE 
J080006E23CCCGGCCCATGTNONE 
J080010D10CCCGGCCCATGTNONE 
J080016N17CCCGGCCCATGTNONE 
J080024N09CCCGGCCCATGTNONE 
J080028E23CCCGGCCCATGTNONE 
J080035I11CCCGGCCCATGTNONE 
J080038D15CCCGGCCCATGTNONE 
J080040H08CCCGGCCCATGTNONE 
J080043L04CCCGGCCCATGTNONE 
J080047C06CCCGGCCCATGTNONE 
J080061G04CCCGGCCCATGTNONE 
J080066E10CCCGGCCCATGTNONE 
J080067P03CCCGGCCCATGTNONE 
J080082D07CCCGGCCCATGTNONE 
J080089M13CCCGGCCCATGTNONE 
J080094O09CCCGGCCCATGTNONE 
J080095C24CCCGGCCCATGTNONE 
J080309E21CCCGGCCCATGTNONE 
J090016G15CCCGGCCCATGTNONE 
J090031C20CCCGGCCCATGTNONE 
J090033A15CCCGGCCCATGTNONE 
J090037L07CCCGGCCCATGTNONE 
J090038I10CCCGGCCCATGTNONE 
J090072P19CCCGGCCCATGTNONE 
J100040J02CCCGGCCCATGTNONE 
J100047N05CCCGGCCCATGTNONE 
J100048M10CCCGGCCCATGTNONE 
J100076C02CCCGGCCCATGTNONE 
J100077G23CCCGGCCCATGTNONE 
J100080O08CCCGGCCCATGTNONE 
J100085C06CCCGGCCCATGTNONE 
J100085F16CCCGGCCCATGTNONE 
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39. 
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE 
AK063673GTATGGGCCGGGACCCASimilar to THA4. 
Os03g0647800003-103-H03GACGGCCCATCTNONE 
006-104-G09GACGGCCCATCTNONE 
AK070243GACGGCCCATCTConserved hypothetical protein. 
J100056F22GACGGCCCATCTNONE 
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein. 
AK066416TACGGCCCATTTNusB/RsmB/TIM44 domain containing protein. 
AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23ATATGGGCCGGTNONE 
J065157L23TACGGCCCATTTNONE 
J065157L23TTTCGGCCCATGANONE 
J065166P22ATATGGGCCGGTNONE 
J065166P22TACGGCCCATTTNONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0668900AK108369AATGGGCCGAAConserved hypothetical protein. 
Os03g0670700009-028-B03GCGGCCCATAANONE 
009-028-B03GCGGCCCATGTNONE 
009-036-H12GCGGCCCATAANONE 
009-036-H12GCGGCCCATGTNONE 
009-053-H05GCGGCCCATAANONE 
009-053-H05GCGGCCCATGTNONE 
009-126-B02GCGGCCCATAANONE 
009-126-B02GCGGCCCATGTNONE 
009-135-D07GCGGCCCATAANONE 
009-135-D07GCGGCCCATGTNONE 
009-148-A03GCGGCCCATAANONE 
009-148-A03GCGGCCCATGTNONE 
009-148-A12GCGGCCCATAANONE 
009-148-A12GCGGCCCATGTNONE 
009-152-B02GCGGCCCATAANONE 
009-152-B02GCGGCCCATGTNONE 
009-153-B06GCGGCCCATAANONE 
009-153-B06GCGGCCCATGTNONE 
009-166-G05GCGGCCCATAANONE 
009-166-G05GCGGCCCATGTNONE 
009-181-A09GCGGCCCATAANONE 
009-181-A09GCGGCCCATGTNONE 
011-061-D07GCGGCCCATAANONE 
011-061-D07GCGGCCCATGTNONE 
012-043-C04GCGGCCCATAANONE 
012-043-C04GCGGCCCATGTNONE 
013-001-A02GCGGCCCATAANONE 
013-001-A02GCGGCCCATGTNONE 
013-004-F05GCGGCCCATAANONE 
013-004-F05GCGGCCCATGTNONE 
013-008-C08GCGGCCCATAANONE 
013-008-C08GCGGCCCATGTNONE 
013-015-B09GCGGCCCATAANONE 
013-015-B09GCGGCCCATGTNONE 
013-016-G05GCGGCCCATAANONE 
013-016-G05GCGGCCCATGTNONE 
013-023-A06GCGGCCCATAANONE 
013-023-A06GCGGCCCATGTNONE 
013-023-B06GCGGCCCATAANONE 
013-023-B06GCGGCCCATGTNONE 
013-032-F09GCGGCCCATAANONE 
013-032-F09GCGGCCCATGTNONE 
013-059-C07GCGGCCCATAANONE 
013-059-C07GCGGCCCATGTNONE 
013-071-E09GCGGCCCATAANONE 
013-071-E09GCGGCCCATGTNONE 
013-073-D06GCGGCCCATAANONE 
013-073-D06GCGGCCCATGTNONE 
013-077-C02GCGGCCCATAANONE 
013-077-C02GCGGCCCATGTNONE 
013-078-B12GCGGCCCATAANONE 
013-078-B12GCGGCCCATGTNONE 
013-093-A01GCGGCCCATAANONE 
013-093-A01GCGGCCCATGTNONE 
014-002-B12GCGGCCCATAANONE 
014-002-B12GCGGCCCATGTNONE 
014-003-E08GCGGCCCATAANONE 
014-003-E08GCGGCCCATGTNONE 
014-004-D06GCGGCCCATAANONE 
014-004-D06GCGGCCCATGTNONE 
014-007-C11GCGGCCCATAANONE 
014-007-C11GCGGCCCATGTNONE 
014-007-G10GCGGCCCATAANONE 
014-007-G10GCGGCCCATGTNONE 
014-019-C04GCGGCCCATAANONE 
014-019-C04GCGGCCCATGTNONE 
014-021-F05GCGGCCCATAANONE 
014-021-F05GCGGCCCATGTNONE 
014-024-G06GCGGCCCATAANONE 
014-024-G06GCGGCCCATGTNONE 
014-027-C07GCGGCCCATAANONE 
014-027-C07GCGGCCCATGTNONE 
014-027-D03GCGGCCCATAANONE 
014-027-D03GCGGCCCATGTNONE 
014-029-E07GCGGCCCATAANONE 
014-029-E07GCGGCCCATGTNONE 
014-031-B04GCGGCCCATAANONE 
014-031-B04GCGGCCCATGTNONE 
014-033-B05GCGGCCCATAANONE 
014-033-B05GCGGCCCATGTNONE 
014-033-C03GCGGCCCATAANONE 
014-033-C03GCGGCCCATGTNONE 
014-033-C12GCGGCCCATAANONE 
014-033-C12GCGGCCCATGTNONE 
014-036-F01GCGGCCCATAANONE 
014-036-F01GCGGCCCATGTNONE 
014-037-C04GCGGCCCATAANONE 
014-037-C04GCGGCCCATGTNONE 
014-040-H02GCGGCCCATAANONE 
014-040-H02GCGGCCCATGTNONE 
014-045-H04GCGGCCCATAANONE 
014-045-H04GCGGCCCATGTNONE 
014-045-H06GCGGCCCATAANONE 
014-045-H06GCGGCCCATGTNONE 
014-052-A08GCGGCCCATAANONE 
014-052-A08GCGGCCCATGTNONE 
014-076-G01GCGGCCCATAANONE 
014-076-G01GCGGCCCATGTNONE 
014-083-F04GCGGCCCATAANONE 
014-083-F04GCGGCCCATGTNONE 
014-086-E01GCGGCCCATAANONE 
014-086-E01GCGGCCCATGTNONE 
014-091-D02GCGGCCCATAANONE 
014-091-D02GCGGCCCATGTNONE 
014-091-F05GCGGCCCATAANONE 
014-091-F05GCGGCCCATGTNONE 
014-093-E10GCGGCCCATAANONE 
014-093-E10GCGGCCCATGTNONE 
014-100-C10GCGGCCCATAANONE 
014-100-C10GCGGCCCATGTNONE 
015-011-H02GCGGCCCATAANONE 
015-011-H02GCGGCCCATGTNONE 
015-073-B03GCGGCCCATAANONE 
015-073-B03GCGGCCCATGTNONE 
AF010579GCGGCCCATAANONE 
AF010579GCGGCCCATGTNONE 
AK059164GCGGCCCATAASimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATAANONE 
AK070016GCGGCCCATGTNONE 
AK119238GCGGCCCATAANONE 
AK119238GCGGCCCATGTNONE 
AK119242GCGGCCCATAANONE 
AK119242GCGGCCCATGTNONE 
J023037K17GCGGCCCATAANONE 
J023037K17GCGGCCCATGTNONE 
J033136F11GCGGCCCATAANONE 
J033136F11GCGGCCCATGTNONE 
J065008C13GCGGCCCATAANONE 
J065008C13GCGGCCCATGTNONE 
J065032K18GCGGCCCATAANONE 
J065032K18GCGGCCCATGTNONE 
J065043N10GCGGCCCATAANONE 
J065043N10GCGGCCCATGTNONE 
J065045E06GCGGCCCATAANONE 
J065045E06GCGGCCCATGTNONE 
J065046P21GCGGCCCATAANONE 
J065046P21GCGGCCCATGTNONE 
J065048J17GCGGCCCATAANONE 
J065048J17GCGGCCCATGTNONE 
J065053I23GCGGCCCATAANONE 
J065053I23GCGGCCCATGTNONE 
J065053P03GCGGCCCATAANONE 
J065053P03GCGGCCCATGTNONE 
J065054C13GCGGCCCATAANONE 
J065054C13GCGGCCCATGTNONE 
J065058I17GCGGCCCATAANONE 
J065058I17GCGGCCCATGTNONE 
J065061I12GCGGCCCATAANONE 
J065061I12GCGGCCCATGTNONE 
J065062E09GCGGCCCATAANONE 
J065062E09GCGGCCCATGTNONE 
J065063P04GCGGCCCATAANONE 
J065063P04GCGGCCCATGTNONE 
J065068J07GCGGCCCATAANONE 
J065068J07GCGGCCCATGTNONE 
J065076D02GCGGCCCATAANONE 
J065076D02GCGGCCCATGTNONE 
J065083O07GCGGCCCATAANONE 
J065083O07GCGGCCCATGTNONE 
J065090J02GCGGCCCATAANONE 
J065090J02GCGGCCCATGTNONE 
J065093N08GCGGCCCATAANONE 
J065093N08GCGGCCCATGTNONE 
J065097F02GCGGCCCATAANONE 
J065097F02GCGGCCCATGTNONE 
J065112H17GCGGCCCATAANONE 
J065112H17GCGGCCCATGTNONE 
J065121B01GCGGCCCATAANONE 
J065121B01GCGGCCCATGTNONE 
J065124F12GCGGCCCATAANONE 
J065124F12GCGGCCCATGTNONE 
J065130L03GCGGCCCATAANONE 
J065130L03GCGGCCCATGTNONE 
J065131K05GCGGCCCATAANONE 
J065131K05GCGGCCCATGTNONE 
J065132C06GCGGCCCATAANONE 
J065132C06GCGGCCCATGTNONE 
J065135J18GCGGCCCATAANONE 
J065135J18GCGGCCCATGTNONE 
J065138J22GCGGCCCATAANONE 
J065138J22GCGGCCCATGTNONE 
J065140G21GCGGCCCATAANONE 
J065140G21GCGGCCCATGTNONE 
J065161B19GCGGCCCATAANONE 
J065161B19GCGGCCCATGTNONE 
J065162F22GCGGCCCATAANONE 
J065162F22GCGGCCCATGTNONE 
J065162M09GCGGCCCATAANONE 
J065162M09GCGGCCCATGTNONE 
J065163D03GCGGCCCATAANONE 
J065163D03GCGGCCCATGTNONE 
J065163O21GCGGCCCATAANONE 
J065163O21GCGGCCCATGTNONE 
J065165H11GCGGCCCATAANONE 
J065165H11GCGGCCCATGTNONE 
J065165O16GCGGCCCATAANONE 
J065165O16GCGGCCCATGTNONE 
J065167N06GCGGCCCATAANONE 
J065167N06GCGGCCCATGTNONE 
J065168I08GCGGCCCATAANONE 
J065168I08GCGGCCCATGTNONE 
J065170A14GCGGCCCATAANONE 
J065170A14GCGGCCCATGTNONE 
J065170L03GCGGCCCATAANONE 
J065170L03GCGGCCCATGTNONE 
J065171C08GCGGCCCATAANONE 
J065171C08GCGGCCCATGTNONE 
J065173G11GCGGCCCATAANONE 
J065173G11GCGGCCCATGTNONE 
J065173M09GCGGCCCATAANONE 
J065173M09GCGGCCCATGTNONE 
J065176P07GCGGCCCATAANONE 
J065176P07GCGGCCCATGTNONE 
J065178K24GCGGCCCATAANONE 
J065178K24GCGGCCCATGTNONE 
J065185O12GCGGCCCATAANONE 
J065185O12GCGGCCCATGTNONE 
J065191E02GCGGCCCATAANONE 
J065191E02GCGGCCCATGTNONE 
J065204H10GCGGCCCATAANONE 
J065204H10GCGGCCCATGTNONE 
J075033C23GCGGCCCATAANONE 
J075033C23GCGGCCCATGTNONE 
J075041M21GCGGCCCATAANONE 
J075041M21GCGGCCCATGTNONE 
J075043F13GCGGCCCATAANONE 
J075043F13GCGGCCCATGTNONE 
J075044D02GCGGCCCATAANONE 
J075044D02GCGGCCCATGTNONE 
J075044J15GCGGCCCATAANONE 
J075044J15GCGGCCCATGTNONE 
J075048L07GCGGCCCATAANONE 
J075048L07GCGGCCCATGTNONE 
J075054G12GCGGCCCATAANONE 
J075054G12GCGGCCCATGTNONE 
J075055J10GCGGCCCATAANONE 
J075055J10GCGGCCCATGTNONE 
J075059F09GCGGCCCATAANONE 
J075059F09GCGGCCCATGTNONE 
J075066M23GCGGCCCATAANONE 
J075066M23GCGGCCCATGTNONE 
J075071O09GCGGCCCATAANONE 
J075071O09GCGGCCCATGTNONE 
J075085G23GCGGCCCATAANONE 
J075085G23GCGGCCCATGTNONE 
J075086B21GCGGCCCATAANONE 
J075086B21GCGGCCCATGTNONE 
J075087L18GCGGCCCATAANONE 
J075087L18GCGGCCCATGTNONE 
J075087L21GCGGCCCATAANONE 
J075087L21GCGGCCCATGTNONE 
J075087N14GCGGCCCATAANONE 
J075087N14GCGGCCCATGTNONE 
J075088O13GCGGCCCATAANONE 
J075088O13GCGGCCCATGTNONE 
J075089B06GCGGCCCATAANONE 
J075089B06GCGGCCCATGTNONE 
J075089E20GCGGCCCATAANONE 
J075089E20GCGGCCCATGTNONE 
J075090J01GCGGCCCATAANONE 
J075090J01GCGGCCCATGTNONE 
J075090L05GCGGCCCATAANONE 
J075090L05GCGGCCCATGTNONE 
J075091G05GCGGCCCATAANONE 
J075091G05GCGGCCCATGTNONE 
J075091N06GCGGCCCATAANONE 
J075091N06GCGGCCCATGTNONE 
J075093G08GCGGCCCATAANONE 
J075093G08GCGGCCCATGTNONE 
J075094C13GCGGCCCATAANONE 
J075094C13GCGGCCCATGTNONE 
J075095K01GCGGCCCATAANONE 
J075095K01GCGGCCCATGTNONE 
J075096C02GCGGCCCATAANONE 
J075096C02GCGGCCCATGTNONE 
J075097L16GCGGCCCATAANONE 
J075097L16GCGGCCCATGTNONE 
J075097O10GCGGCCCATAANONE 
J075097O10GCGGCCCATGTNONE 
J075098H24GCGGCCCATAANONE 
J075098H24GCGGCCCATGTNONE 
J075099H02GCGGCCCATAANONE 
J075099H02GCGGCCCATGTNONE 
J075099J11GCGGCCCATAANONE 
J075099J11GCGGCCCATGTNONE 
J075099L08GCGGCCCATAANONE 
J075099L08GCGGCCCATGTNONE 
J075109I11GCGGCCCATAANONE 
J075109I11GCGGCCCATGTNONE 
J075114F03GCGGCCCATAANONE 
J075114F03GCGGCCCATGTNONE 
J075121G07GCGGCCCATAANONE 
J075121G07GCGGCCCATGTNONE 
J075122D23GCGGCCCATAANONE 
J075122D23GCGGCCCATGTNONE 
J075132O07GCGGCCCATAANONE 
J075132O07GCGGCCCATGTNONE 
J075141L21GCGGCCCATAANONE 
J075141L21GCGGCCCATGTNONE 
J075142I08GCGGCCCATAANONE 
J075142I08GCGGCCCATGTNONE 
J075145A06GCGGCCCATAANONE 
J075145A06GCGGCCCATGTNONE 
J075147J15GCGGCCCATAANONE 
J075147J15GCGGCCCATGTNONE 
J075150B09GCGGCCCATAANONE 
J075150B09GCGGCCCATGTNONE 
J075151E07GCGGCCCATAANONE 
J075151E07GCGGCCCATGTNONE 
J075161M16GCGGCCCATAANONE 
J075161M16GCGGCCCATGTNONE 
J075190I16GCGGCCCATAANONE 
J075190I16GCGGCCCATGTNONE 
J075192L05GCGGCCCATAANONE 
J075192L05GCGGCCCATGTNONE 
J075192O03GCGGCCCATAANONE 
J075192O03GCGGCCCATGTNONE 
J075192O08GCGGCCCATAANONE 
J075192O08GCGGCCCATGTNONE 
J075193L12GCGGCCCATAANONE 
J075193L12GCGGCCCATGTNONE 
J080001M24GCGGCCCATAANONE 
J080001M24GCGGCCCATGTNONE 
J080004E20GCGGCCCATAANONE 
J080004E20GCGGCCCATGTNONE 
J080005K15GCGGCCCATAANONE 
J080005K15GCGGCCCATGTNONE 
J080005L05GCGGCCCATAANONE 
J080005L05GCGGCCCATGTNONE 
J080014P20GCGGCCCATAANONE 
J080014P20GCGGCCCATGTNONE 
J080029D12GCGGCCCATAANONE 
J080029D12GCGGCCCATGTNONE 
J080030H09GCGGCCCATAANONE 
J080030H09GCGGCCCATGTNONE 
J080039G05GCGGCCCATAANONE 
J080039G05GCGGCCCATGTNONE 
J080040E18GCGGCCCATAANONE 
J080040E18GCGGCCCATGTNONE 
J080041B02GCGGCCCATAANONE 
J080041B02GCGGCCCATGTNONE 
J080041E06GCGGCCCATAANONE 
J080041E06GCGGCCCATGTNONE 
J080041G05GCGGCCCATAANONE 
J080041G05GCGGCCCATGTNONE 
J080041G24GCGGCCCATAANONE 
J080041G24GCGGCCCATGTNONE 
J080041H07GCGGCCCATAANONE 
J080041H07GCGGCCCATGTNONE 
J080041K03GCGGCCCATAANONE 
J080041K03GCGGCCCATGTNONE 
J080047G01GCGGCCCATAANONE 
J080047G01GCGGCCCATGTNONE 
J080052E07GCGGCCCATAANONE 
J080052E07GCGGCCCATGTNONE 
J080053B15GCGGCCCATAANONE 
J080053B15GCGGCCCATGTNONE 
J080053N01GCGGCCCATAANONE 
J080053N01GCGGCCCATGTNONE 
J080054I01GCGGCCCATAANONE 
J080054I01GCGGCCCATGTNONE 
J080054N02GCGGCCCATAANONE 
J080054N02GCGGCCCATGTNONE 
J080063P03GCGGCCCATAANONE 
J080063P03GCGGCCCATGTNONE 
J080064E13GCGGCCCATAANONE 
J080064E13GCGGCCCATGTNONE 
J080064G13GCGGCCCATAANONE 
J080064G13GCGGCCCATGTNONE 
J080065F02GCGGCCCATAANONE 
J080065F02GCGGCCCATGTNONE 
J080065G03GCGGCCCATAANONE 
J080065G03GCGGCCCATGTNONE 
J080065K17GCGGCCCATAANONE 
J080065K17GCGGCCCATGTNONE 
J080067D06GCGGCCCATAANONE 
J080067D06GCGGCCCATGTNONE 
J080067H23GCGGCCCATAANONE 
J080067H23GCGGCCCATGTNONE 
J080067M15GCGGCCCATAANONE 
J080067M15GCGGCCCATGTNONE 
J080068B20GCGGCCCATAANONE 
J080068B20GCGGCCCATGTNONE 
J080068G24GCGGCCCATAANONE 
J080068G24GCGGCCCATGTNONE 
J080072K19GCGGCCCATAANONE 
J080072K19GCGGCCCATGTNONE 
J080076I24GCGGCCCATAANONE 
J080076I24GCGGCCCATGTNONE 
J080092F05GCGGCCCATAANONE 
J080092F05GCGGCCCATGTNONE 
J080092K14GCGGCCCATAANONE 
J080092K14GCGGCCCATGTNONE 
J080092N22GCGGCCCATAANONE 
J080092N22GCGGCCCATGTNONE 
J080093K02GCGGCCCATAANONE 
J080093K02GCGGCCCATGTNONE 
J080094C08GCGGCCCATAANONE 
J080094C08GCGGCCCATGTNONE 
J080094E09GCGGCCCATAANONE 
J080094E09GCGGCCCATGTNONE 
J080094E20GCGGCCCATAANONE 
J080094E20GCGGCCCATGTNONE 
J080094G08GCGGCCCATAANONE 
J080094G08GCGGCCCATGTNONE 
J080094H18GCGGCCCATAANONE 
J080094H18GCGGCCCATGTNONE 
J080094P22GCGGCCCATAANONE 
J080094P22GCGGCCCATGTNONE 
J080095J23GCGGCCCATAANONE 
J080095J23GCGGCCCATGTNONE 
J080096F14GCGGCCCATAANONE 
J080096F14GCGGCCCATGTNONE 
J080097A21GCGGCCCATAANONE 
J080097A21GCGGCCCATGTNONE 
J080097I07GCGGCCCATAANONE 
J080097I07GCGGCCCATGTNONE 
J080097J02GCGGCCCATAANONE 
J080097J02GCGGCCCATGTNONE 
J080097K01GCGGCCCATAANONE 
J080097K01GCGGCCCATGTNONE 
J080097K03GCGGCCCATAANONE 
J080097K03GCGGCCCATGTNONE 
J080305H18GCGGCCCATAANONE 
J080305H18GCGGCCCATGTNONE 
J080306G01GCGGCCCATAANONE 
J080306G01GCGGCCCATGTNONE 
J080306O08GCGGCCCATAANONE 
J080306O08GCGGCCCATGTNONE 
J080311I01GCGGCCCATAANONE 
J080311I01GCGGCCCATGTNONE 
J080315N24GCGGCCCATAANONE 
J080315N24GCGGCCCATGTNONE 
J090003K21GCGGCCCATAANONE 
J090003K21GCGGCCCATGTNONE 
J090008C20GCGGCCCATAANONE 
J090008C20GCGGCCCATGTNONE 
J090008K19GCGGCCCATAANONE 
J090008K19GCGGCCCATGTNONE 
J090008P13GCGGCCCATAANONE 
J090008P13GCGGCCCATGTNONE 
J090015H22GCGGCCCATAANONE 
J090015H22GCGGCCCATGTNONE 
J090016M01GCGGCCCATAANONE 
J090016M01GCGGCCCATGTNONE 
J090018E13GCGGCCCATAANONE 
J090018E13GCGGCCCATGTNONE 
J090018G03GCGGCCCATAANONE 
J090018G03GCGGCCCATGTNONE 
J090018L17GCGGCCCATAANONE 
J090018L17GCGGCCCATGTNONE 
J090019H11GCGGCCCATAANONE 
J090019H11GCGGCCCATGTNONE 
J090021B19GCGGCCCATAANONE 
J090021B19GCGGCCCATGTNONE 
J090021K02GCGGCCCATAANONE 
J090021K02GCGGCCCATGTNONE 
J090023H15GCGGCCCATAANONE 
J090023H15GCGGCCCATGTNONE 
J090034E03GCGGCCCATAANONE 
J090034E03GCGGCCCATGTNONE 
J090045D16GCGGCCCATAANONE 
J090045D16GCGGCCCATGTNONE 
J090045I06GCGGCCCATAANONE 
J090045I06GCGGCCCATGTNONE 
J090047L09GCGGCCCATAANONE 
J090047L09GCGGCCCATGTNONE 
J090048B05GCGGCCCATAANONE 
J090048B05GCGGCCCATGTNONE 
J090048D11GCGGCCCATAANONE 
J090048D11GCGGCCCATGTNONE 
J090048N11GCGGCCCATAANONE 
J090048N11GCGGCCCATGTNONE 
J090050F20GCGGCCCATAANONE 
J090050F20GCGGCCCATGTNONE 
J090052M20GCGGCCCATAANONE 
J090052M20GCGGCCCATGTNONE 
J090083H03GCGGCCCATAANONE 
J090083H03GCGGCCCATGTNONE 
J090084C12GCGGCCCATAANONE 
J090084C12GCGGCCCATGTNONE 
J090095B05GCGGCCCATAANONE 
J090095B05GCGGCCCATGTNONE 
J090095M18GCGGCCCATAANONE 
J090095M18GCGGCCCATGTNONE 
J100024I22GCGGCCCATAANONE 
J100024I22GCGGCCCATGTNONE 
J100024J12GCGGCCCATAANONE 
J100024J12GCGGCCCATGTNONE 
J100024J22GCGGCCCATAANONE 
J100024J22GCGGCCCATGTNONE 
J100025F07GCGGCCCATAANONE 
J100025F07GCGGCCCATGTNONE 
J100026B13GCGGCCCATAANONE 
J100026B13GCGGCCCATGTNONE 
J100027N03GCGGCCCATAANONE 
J100027N03GCGGCCCATGTNONE 
J100029F14GCGGCCCATAANONE 
J100029F14GCGGCCCATGTNONE 
J100029L20GCGGCCCATAANONE 
J100029L20GCGGCCCATGTNONE 
J100032C22GCGGCCCATAANONE 
J100032C22GCGGCCCATGTNONE 
J100032I08GCGGCCCATAANONE 
J100032I08GCGGCCCATGTNONE 
J100032O05GCGGCCCATAANONE 
J100032O05GCGGCCCATGTNONE 
J100033J24GCGGCCCATAANONE 
J100033J24GCGGCCCATGTNONE 
J100033L12GCGGCCCATAANONE 
J100033L12GCGGCCCATGTNONE 
J100034K06GCGGCCCATAANONE 
J100034K06GCGGCCCATGTNONE 
J100037D09GCGGCCCATAANONE 
J100037D09GCGGCCCATGTNONE 
J100038H02GCGGCCCATAANONE 
J100038H02GCGGCCCATGTNONE 
J100039A12GCGGCCCATAANONE 
J100039A12GCGGCCCATGTNONE 
J100039N12GCGGCCCATAANONE 
J100039N12GCGGCCCATGTNONE 
J100039O21GCGGCCCATAANONE 
J100039O21GCGGCCCATGTNONE 
J100040K05GCGGCCCATAANONE 
J100040K05GCGGCCCATGTNONE 
J100042A02GCGGCCCATAANONE 
J100042A02GCGGCCCATGTNONE 
J100042A17GCGGCCCATAANONE 
J100042A17GCGGCCCATGTNONE 
J100043C15GCGGCCCATAANONE 
J100043C15GCGGCCCATGTNONE 
J100044A17GCGGCCCATAANONE 
J100044A17GCGGCCCATGTNONE 
J100044E18GCGGCCCATAANONE 
J100044E18GCGGCCCATGTNONE 
J100044I11GCGGCCCATAANONE 
J100044I11GCGGCCCATGTNONE 
J100044J15GCGGCCCATAANONE 
J100044J15GCGGCCCATGTNONE 
J100045E23GCGGCCCATAANONE 
J100045E23GCGGCCCATGTNONE 
J100049B18GCGGCCCATAANONE 
J100049B18GCGGCCCATGTNONE 
J100050G04GCGGCCCATAANONE 
J100050G04GCGGCCCATGTNONE 
J100051D06GCGGCCCATAANONE 
J100051D06GCGGCCCATGTNONE 
J100051H20GCGGCCCATAANONE 
J100051H20GCGGCCCATGTNONE 
J100052J01GCGGCCCATAANONE 
J100052J01GCGGCCCATGTNONE 
J100052K07GCGGCCCATAANONE 
J100052K07GCGGCCCATGTNONE 
J100055I01GCGGCCCATAANONE 
J100055I01GCGGCCCATGTNONE 
J100057D02GCGGCCCATAANONE 
J100057D02GCGGCCCATGTNONE 
J100059G14GCGGCCCATAANONE 
J100059G14GCGGCCCATGTNONE 
J100059G21GCGGCCCATAANONE 
J100059G21GCGGCCCATGTNONE 
J100059H03GCGGCCCATAANONE 
J100059H03GCGGCCCATGTNONE 
J100059H15GCGGCCCATAANONE 
J100059H15GCGGCCCATGTNONE 
J100063E13GCGGCCCATAANONE 
J100063E13GCGGCCCATGTNONE 
J100063M02GCGGCCCATAANONE 
J100063M02GCGGCCCATGTNONE 
J100064B17GCGGCCCATAANONE 
J100064B17GCGGCCCATGTNONE 
J100064F11GCGGCCCATAANONE 
J100064F11GCGGCCCATGTNONE 
J100066G12GCGGCCCATAANONE 
J100066G12GCGGCCCATGTNONE 
J100066H09GCGGCCCATAANONE 
J100066H09GCGGCCCATGTNONE 
J100068B12GCGGCCCATAANONE 
J100068B12GCGGCCCATGTNONE 
J100068L16GCGGCCCATAANONE 
J100068L16GCGGCCCATGTNONE 
J100068M23GCGGCCCATAANONE 
J100068M23GCGGCCCATGTNONE 
J100069A02GCGGCCCATAANONE 
J100069A02GCGGCCCATGTNONE 
J100069D07GCGGCCCATAANONE 
J100069D07GCGGCCCATGTNONE 
J100069M13GCGGCCCATAANONE 
J100069M13GCGGCCCATGTNONE 
J100070C07GCGGCCCATAANONE 
J100070C07GCGGCCCATGTNONE 
J100070J11GCGGCCCATAANONE 
J100070J11GCGGCCCATGTNONE 
J100070L20GCGGCCCATAANONE 
J100070L20GCGGCCCATGTNONE 
J100071H10GCGGCCCATAANONE 
J100071H10GCGGCCCATGTNONE 
J100072L14GCGGCCCATAANONE 
J100072L14GCGGCCCATGTNONE 
J100072N12GCGGCCCATAANONE 
J100072N12GCGGCCCATGTNONE 
J100073A21GCGGCCCATAANONE 
J100073A21GCGGCCCATGTNONE 
J100074K17GCGGCCCATAANONE 
J100074K17GCGGCCCATGTNONE 
J100074M04GCGGCCCATAANONE 
J100074M04GCGGCCCATGTNONE 
J100075F11GCGGCCCATAANONE 
J100075F11GCGGCCCATGTNONE 
J100076E23GCGGCCCATAANONE 
J100076E23GCGGCCCATGTNONE 
J100076G03GCGGCCCATAANONE 
J100076G03GCGGCCCATGTNONE 
J100077K01GCGGCCCATAANONE 
J100077K01GCGGCCCATGTNONE 
J100077N23GCGGCCCATAANONE 
J100077N23GCGGCCCATGTNONE 
J100079H17GCGGCCCATAANONE 
J100079H17GCGGCCCATGTNONE 
J100081N01GCGGCCCATAANONE 
J100081N01GCGGCCCATGTNONE 
J100082E04GCGGCCCATAANONE 
J100082E04GCGGCCCATGTNONE 
J100082K11GCGGCCCATAANONE 
J100082K11GCGGCCCATGTNONE 
J100085H23GCGGCCCATAANONE 
J100085H23GCGGCCCATGTNONE 
J100086O18GCGGCCCATAANONE 
J100086O18GCGGCCCATGTNONE 
J100087F21GCGGCCCATAANONE 
J100087F21GCGGCCCATGTNONE 
J100088E02GCGGCCCATAANONE 
J100088E02GCGGCCCATGTNONE 
J100088F08GCGGCCCATAANONE 
J100088F08GCGGCCCATGTNONE 
J100088G24GCGGCCCATAANONE 
J100088G24GCGGCCCATGTNONE 
J100088K20GCGGCCCATAANONE 
J100088K20GCGGCCCATGTNONE 
J100089B19GCGGCCCATAANONE 
J100089B19GCGGCCCATGTNONE 
J100089K22GCGGCCCATAANONE 
J100089K22GCGGCCCATGTNONE 
J100089N22GCGGCCCATAANONE 
J100089N22GCGGCCCATGTNONE 
J100089O17GCGGCCCATAANONE 
J100089O17GCGGCCCATGTNONE 
J100090N05GCGGCCCATAANONE 
J100090N05GCGGCCCATGTNONE 
Os03g0685000009-031-F08GGATGGGCCGCNONE 
AK059896GGATGGGCCGCSimilar to Ferredoxin. 
AK098989GGATGGGCCGCNONE 
AK099303GGATGGGCCGCNONE 
J065041E14GGATGGGCCGCNONE 
J065085G22GGATGGGCCGCNONE 
Os03g0701900AK068404CCCGGCCCATTConserved hypothetical protein. 
Os03g0725300011-085-E09TGCGGCCCATANONE 
AK063969TGCGGCCCATASimilar to Dbr1-prov protein. 
AK073636TGCGGCCCATANONE 
J033050L15TGCGGCCCATANONE 
J053082G03TGCGGCCCATANONE 
Os03g0726900AK072553GACGGCCCATTConserved hypothetical protein. 
AK100280GACGGCCCATTNONE 
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein. 
AK072060TTCGGCCCATCCMitochondrial substrate carrier family protein. 
AK120533GCGGCCCATGANONE 
AK120533TTCGGCCCATCCNONE 
J043026E20GCGGCCCATGANONE 
J043026E20TTCGGCCCATCCNONE 
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE 
011-093-H12GGCCCGGCCCATCCNONE 
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19CGGGCCGATGGGCCGANONE 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16CGGGCCGATGGGCCGANONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16CGGGCCGATGGGCCGANONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19CGGGCCGATGGGCCGANONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0743200J065049G14GCGGCCCATAANONE 
J065158O18GCGGCCCATAANONE 
Os03g0744700AK071178CGATGGGCCGGCConserved hypothetical protein. 
AK071178TCCGGCCCATTTConserved hypothetical protein. 
J075006D24CGATGGGCCGGCNONE 
J075006D24TCCGGCCCATTTNONE 
J075165F21CGATGGGCCGGCNONE 
J075165F21TCCGGCCCATTTNONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
J080305A09ACATGGGCCGGANONE 
J080310E24ACATGGGCCGGANONE 
J080310O12ACATGGGCCGGANONE 
J080311N04ACATGGGCCGGANONE 
J080313N20ACATGGGCCGGANONE 
J080317H24ACATGGGCCGGANONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0761200011-038-H02AAATGGGCCGGAAAATGGGCCNONE 
015-055-D12AAATGGGCCGGAAAATGGGCCNONE 
016-032-B01AAATGGGCCGGAAAATGGGCCNONE 
AK064205AAATGGGCCGGAAAATGGGCCNONE 
AK101534AAATGGGCCGGAAAATGGGCCAnkyrin repeat containing protein. 
J075033L23AAATGGGCCGGAAAATGGGCCNONE 
J075046K09AAATGGGCCGGAAAATGGGCCNONE 
J075134K18AAATGGGCCGGAAAATGGGCCNONE 
J075157I10AAATGGGCCGGAAAATGGGCCNONE 
Os03g0766900AK066137TCCGGCCCATTTAllene oxide synthase. 
AK071361TCCGGCCCATTTNONE 
AK103989TCCGGCCCATTTNONE 
J023090K09TCCGGCCCATTTNONE 
J043022H11TCCGGCCCATTTNONE 
J053078F12TCCGGCCCATTTNONE 
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein. 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786500016-056-D08AGATGGGCCGANONE 
AK106487AGATGGGCCGASimilar to Glycine-rich protein 2. 
J080001C23AGATGGGCCGANONE 
J080005A02AGATGGGCCGANONE 
J080009A14AGATGGGCCGANONE 
J080009B11AGATGGGCCGANONE 
J080011L03AGATGGGCCGANONE 
J080017E21AGATGGGCCGANONE 
J080018H08AGATGGGCCGANONE 
J080021E11AGATGGGCCGANONE 
J080025O20AGATGGGCCGANONE 
J080026H21AGATGGGCCGANONE 
J080029I10AGATGGGCCGANONE 
J080036L01AGATGGGCCGANONE 
J080038M15AGATGGGCCGANONE 
J080051H09AGATGGGCCGANONE 
J080053E18AGATGGGCCGANONE 
J080054I12AGATGGGCCGANONE 
J080055B14AGATGGGCCGANONE 
J080060L16AGATGGGCCGANONE 
J080067G06AGATGGGCCGANONE 
J080069K14AGATGGGCCGANONE 
J080070N14AGATGGGCCGANONE 
J080071G10AGATGGGCCGANONE 
J080076D08AGATGGGCCGANONE 
J080076O11AGATGGGCCGANONE 
J080078E10AGATGGGCCGANONE 
J080079B15AGATGGGCCGANONE 
J080079K03AGATGGGCCGANONE 
J080079O15AGATGGGCCGANONE 
J080087B18AGATGGGCCGANONE 
Os03g0795800AK102207TCCGGCCCATATProtein of unknown function UPF0005 family protein. 
J023014M02TCCGGCCCATATNONE 
J023026E12TCCGGCCCATATNONE 
J023036I07TCCGGCCCATATNONE 
J023079M08TCCGGCCCATATNONE 
J023129D24TCCGGCCCATATNONE 
J033087H03TCCGGCCCATATNONE 
J033115G02TCCGGCCCATATNONE 
J033122G06TCCGGCCCATATNONE 
J033150J15TCCGGCCCATATNONE 
J065064L16TCCGGCCCATATNONE 
J065065H20TCCGGCCCATATNONE 
J065096I18TCCGGCCCATATNONE 
J065114A10TCCGGCCCATATNONE 
J065164G10TCCGGCCCATATNONE 
J065178L20TCCGGCCCATATNONE 
J075071D20TCCGGCCCATATNONE 
Os03g0795900012-092-G05AGATGGGCCGANONE 
012-092-G05ATATGGGCCGGANONE 
015-043-D09AGATGGGCCGANONE 
015-043-D09ATATGGGCCGGANONE 
016-078-G11AGATGGGCCGANONE 
016-078-G11ATATGGGCCGGANONE 
AK068660AGATGGGCCGASimilar to Heat shock transcription factor 31 (Fragment). 
AK068660ATATGGGCCGGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14AGATGGGCCGANONE 
J013162K14ATATGGGCCGGANONE 
J023001L04AGATGGGCCGANONE 
J023001L04ATATGGGCCGGANONE 
J053032K11AGATGGGCCGANONE 
J053032K11ATATGGGCCGGANONE 
J065059E10AGATGGGCCGANONE 
J065059E10ATATGGGCCGGANONE 
J065095H19AGATGGGCCGANONE 
J065095H19ATATGGGCCGGANONE 
J065181M06AGATGGGCCGANONE 
J065181M06ATATGGGCCGGANONE 
J100047D11AGATGGGCCGANONE 
J100047D11ATATGGGCCGGANONE 
J100068G04AGATGGGCCGANONE 
J100068G04ATATGGGCCGGANONE 
Os03g0797000AK073440TCCGGCCCATATSimilar to Indole synthase. 
AK073440TCCGGCCCATATSimilar to Indole synthase. 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0822100AK101094GGGCCGGCCCATATSimilar to Transposase (Fragment). 
J033024N05GGGCCGGCCCATATNONE 
Os03g0824400AK070153CACGGCCCATGGNONE 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0824500AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os03g0829000AK071107TTATGGGCCGTAFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTATGGGCCGTANONE 
AK121596TTATGGGCCGTANONE 
J065045C17TTATGGGCCGTANONE 
J065068E23TTATGGGCCGTANONE 
J065083N15TTATGGGCCGTANONE 
J065166P10TTATGGGCCGTANONE 
J065189B13TTATGGGCCGTANONE 
J090082J08TTATGGGCCGTANONE 
J100030P13TTATGGGCCGTANONE 
Os03g0829100AK072669TCGGCCCATCCASimilar to Soluble epoxide hydrolase. 
J013073C22TCGGCCCATCCANONE 
J033067O15TCGGCCCATCCANONE 
J065021D04TCGGCCCATCCANONE 
J065102E20TCGGCCCATCCANONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os03g0835400AK061773TCCGGCCCATTTSimilar to Uvs101. 
AK098986TCCGGCCCATTTNONE 
AK105896TCCGGCCCATTTNONE 
Os03g0837300AK111243TTCGGCCCATTTNONE 
AK121140TTCGGCCCATTTNicotinate phosphoribosyltransferase and related family protein. 
AY214337TTCGGCCCATTTNONE 
J023077G12TTCGGCCCATTTNONE 
J023078M10TTCGGCCCATTTNONE 
J033031B10TTCGGCCCATTTNONE 
J033067L18TTCGGCCCATTTNONE 
J043005P09TTCGGCCCATTTNONE 
J090013J15TTCGGCCCATTTNONE 
J090042E10TTCGGCCCATTTNONE 
J090045A20TTCGGCCCATTTNONE 
J100022H02TTCGGCCCATTTNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0846900016-055-F06CCCGGCCCATCCNONE 
AK059297CCCGGCCCATCCConserved hypothetical protein. 
J090028J16CCCGGCCCATCCNONE 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
J033086B08ACATGGGCCGAANONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os03g0856200009-070-B07GACGGCCCATCANONE 
009-135-H05GACGGCCCATCANONE 
J100067D22GACGGCCCATCANONE 
J100067L13GACGGCCCATCANONE 
J100073I07GACGGCCCATCANONE 
J100080D01GACGGCCCATCANONE 
Os03g0860600AK071828CCCGGCCCATTTSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08CCCGGCCCATTTNONE 
J100032J11CCCGGCCCATTTNONE 
Os04g0105700004-005-E05AATGGGCCGGCNONE 
006-037-C11AATGGGCCGGCNONE 
006-039-E07AATGGGCCGGCNONE 
006-049-A02AATGGGCCGGCNONE 
006-076-D05AATGGGCCGGCNONE 
006-089-E04AATGGGCCGGCNONE 
006-097-F12AATGGGCCGGCNONE 
AK060872AATGGGCCGGCNONE 
AK065082AATGGGCCGGCNONE 
AK104254AATGGGCCGGCConserved hypothetical protein. 
AK104546AATGGGCCGGCNONE 
AK104634AATGGGCCGGCNONE 
AY224557AATGGGCCGGCNONE 
J013001L09AATGGGCCGGCNONE 
J013151B18AATGGGCCGGCNONE 
J023054G18AATGGGCCGGCNONE 
Os04g0258900009-146-B02CCCGGCCCATTTNONE 
AK062983CCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os04g0378200AK103076TGATGGGCCGAGSterile alpha motif SAM domain containing protein. 
J033118E02TGATGGGCCGAGNONE 
J065065F15TGATGGGCCGAGNONE 
J090080I24TGATGGGCCGAGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0397901J065050P16TCGGCCCATCGConserved hypothetical protein. 
Os04g0407300AK101793GACGGCCCATCGNONE 
AK121980GACGGCCCATCGHypothetical protein. 
J033065K23GACGGCCCATCGNONE 
J033108L11GACGGCCCATCGNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0459600006-039-H09AGATGGGCCGCNONE 
AK061516AGATGGGCCGCRan-interacting Mog1 protein family protein. 
J065112J03AGATGGGCCGCNONE 
Os04g0476400J033082D17CCATGGGCCGANONE 
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0481800AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24TCGGCCCATGGNONE 
Os04g0502300009-116-F02TGCGGCCCATGTNONE 
009-130-H06TGCGGCCCATGTNONE 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
J013124K01TGCGGCCCATGTNONE 
J023102F03TGCGGCCCATGTNONE 
J033094F17TGCGGCCCATGTNONE 
J053054C22TGCGGCCCATGTNONE 
J065024N13TGCGGCCCATGTNONE 
J065083J18TGCGGCCCATGTNONE 
J065132O14TGCGGCCCATGTNONE 
J065156M09TGCGGCCCATGTNONE 
J065176N15TGCGGCCCATGTNONE 
J065208H08TGCGGCCCATGTNONE 
J075054B03TGCGGCCCATGTNONE 
J090053E20TGCGGCCCATGTNONE 
J100075B09TGCGGCCCATGTNONE 
J100089H12TGCGGCCCATGTNONE 
Os04g0504600J065162K24TAATGGGCCGCNONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0528100009-090-G06TCCGGCCCATATNONE 
009-168-C11TCCGGCCCATATNONE 
AK065957TCCGGCCCATATConserved hypothetical protein. 
J013039G20TCCGGCCCATATNONE 
J013044D08TCCGGCCCATATNONE 
J065013L14TCCGGCCCATATNONE 
J065143H08TCCGGCCCATATNONE 
J065146C14TCCGGCCCATATNONE 
J065149K22TCCGGCCCATATNONE 
J065156B18TCCGGCCCATATNONE 
J065201A04TCCGGCCCATATNONE 
J065209A04TCCGGCCCATATNONE 
Os04g0530000009-106-E11TCGGCCCATTTNONE 
011-012-E12TCGGCCCATTTNONE 
AK066169TCGGCCCATTTConserved hypothetical protein. 
J013052P20TCGGCCCATTTNONE 
J090060G12TCGGCCCATTTNONE 
J100073H10TCGGCCCATTTNONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0542900AK068610TCGGCCCATTAConserved hypothetical protein. 
Os04g0562000006-096-A05AAATGGGCCGGANONE 
006-105-B08AAATGGGCCGGANONE 
AK060894AAATGGGCCGGANONE 
AK072630AAATGGGCCGGAZinc finger, DHHC-type domain containing protein. 
AK104521AAATGGGCCGGANONE 
J023038A11AAATGGGCCGGANONE 
J023130P03AAATGGGCCGGANONE 
J090006F10AAATGGGCCGGANONE 
J090007M22AAATGGGCCGGANONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0570600AK106747GCCGGCCCATCCCytochrome P450 family protein. 
J080319G08GCCGGCCCATCCNONE 
Os04g0581000AK061337TGATGGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TGATGGGCCGGCNONE 
Os04g0584100012-063-E01CACGGCCCATAANONE 
AK105292CACGGCCCATAAConserved hypothetical protein. 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0595000AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0614500AK100259TGATGGGCCGTCAminotransferase class-III family protein. 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-097-D05AAATGGGCCGTGGNONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
J013035J20AAATGGGCCGTGGNONE 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK104273ACATGGGCCGGTNONE 
Os04g0658300AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0658600AK064729TACGGCCCATCANONE 
AK119253TACGGCCCATCANucleolar, Nop52 family protein. 
J075132J07TACGGCCCATCANONE 
J075157N21TACGGCCCATCANONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0661700AK066532GCGGCCCATAConserved hypothetical protein. 
J065083O18GCGGCCCATANONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0674100J080097J12TAATGGGCCGAGThioredoxin-like fold domain containing protein. 
J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965CTCGGCCCATTANONE 
AK101965TGCGGCCCATGANONE 
AK103795CTCGGCCCATTACoenzyme Q biosynthesis Coq4 family protein. 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14CTCGGCCCATTANONE 
J033076F14TGCGGCCCATGANONE 
J065020P20CTCGGCCCATTANONE 
J065020P20TGCGGCCCATGANONE 
J065057I21CTCGGCCCATTANONE 
J065057I21TGCGGCCCATGANONE 
J065059P11CTCGGCCCATTANONE 
J065059P11TGCGGCCCATGANONE 
J065083A22CTCGGCCCATTANONE 
J065083A22TGCGGCCCATGANONE 
J065093K10CTCGGCCCATTANONE 
J065093K10TGCGGCCCATGANONE 
J065097D03CTCGGCCCATTANONE 
J065097D03TGCGGCCCATGANONE 
J065103P05CTCGGCCCATTANONE 
J065103P05TGCGGCCCATGANONE 
J065113K09CTCGGCCCATTANONE 
J065113K09TGCGGCCCATGANONE 
J065118F23CTCGGCCCATTANONE 
J065118F23TGCGGCCCATGANONE 
J065119M06CTCGGCCCATTANONE 
J065119M06TGCGGCCCATGANONE 
J065146K17CTCGGCCCATTANONE 
J065146K17TGCGGCCCATGANONE 
J065161N12CTCGGCCCATTANONE 
J065161N12TGCGGCCCATGANONE 
J065169L02CTCGGCCCATTANONE 
J065169L02TGCGGCCCATGANONE 
J065189H12CTCGGCCCATTANONE 
J065189H12TGCGGCCCATGANONE 
J065192E24CTCGGCCCATTANONE 
J065192E24TGCGGCCCATGANONE 
J065193K17CTCGGCCCATTANONE 
J065193K17TGCGGCCCATGANONE 
J065197O21CTCGGCCCATTANONE 
J065197O21TGCGGCCCATGANONE 
J065214D09CTCGGCCCATTANONE 
J065214D09TGCGGCCCATGANONE 
J065217B11CTCGGCCCATTANONE 
J065217B11TGCGGCCCATGANONE 
J075132K07CTCGGCCCATTANONE 
J075132K07TGCGGCCCATGANONE 
J100059D14CTCGGCCCATTANONE 
J100059D14TGCGGCCCATGANONE 
Os04g0674350J065104O14AGATGGGCCGCNONE 
J065104O14TCTCGGCCCATGGNONE 
J065118J19AGATGGGCCGCNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12AGATGGGCCGCHypothetical protein. 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os04g0674400015-042-B08GCGGCCCATCTNONE 
AK102124GCGGCCCATCTSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22GCGGCCCATCTNONE 
J023022I24GCGGCCCATCTNONE 
J023120A15GCGGCCCATCTNONE 
J023123P20GCGGCCCATCTNONE 
J033068P09GCGGCCCATCTNONE 
J033107G22GCGGCCCATCTNONE 
J033116G12GCGGCCCATCTNONE 
J033133F03GCGGCCCATCTNONE 
J033143B20GCGGCCCATCTNONE 
J043006G12GCGGCCCATCTNONE 
J043027M18GCGGCCCATCTNONE 
J043034H17GCGGCCCATCTNONE 
J090091E20GCGGCCCATCTNONE 
J100035H09GCGGCCCATCTNONE 
J100037J04GCGGCCCATCTNONE 
J100047J24GCGGCCCATCTNONE 
J100059G06GCGGCCCATCTNONE 
J100066O12GCGGCCCATCTNONE 
J100074G23GCGGCCCATCTNONE 
J100077M12GCGGCCCATCTNONE 
Os04g0678800AK072212AAATGGGCCGAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065AAATGGGCCGANONE 
Os04g0682800AK121846GCCGGCCCATTSodium/hydrogen exchanger family protein. 
Os04g0684500AK066014GGATGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0687300AK060617TGCGGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04TGCGGCCCATAANONE 
Os04g0692500AK101528GCGGCCCATTNONE 
Os05g0110100009-015-D08TGCGGCCCATATNONE 
009-023-C09TGCGGCCCATATNONE 
009-031-B11TGCGGCCCATATNONE 
009-034-C02TGCGGCCCATATNONE 
009-050-B08TGCGGCCCATATNONE 
009-065-D12TGCGGCCCATATNONE 
009-090-G08TGCGGCCCATATNONE 
009-111-H07TGCGGCCCATATNONE 
009-136-F12TGCGGCCCATATNONE 
009-138-E06TGCGGCCCATATNONE 
009-138-G12TGCGGCCCATATNONE 
009-141-D08TGCGGCCCATATNONE 
009-143-D01TGCGGCCCATATNONE 
009-179-D09TGCGGCCCATATNONE 
009-179-E03TGCGGCCCATATNONE 
009-196-A09TGCGGCCCATATNONE 
009-199-F04TGCGGCCCATATNONE 
013-021-E05TGCGGCCCATATNONE 
013-076-C04TGCGGCCCATATNONE 
013-096-F06TGCGGCCCATATNONE 
014-071-A05TGCGGCCCATATNONE 
014-077-F09TGCGGCCCATATNONE 
AK099779TGCGGCCCATATNONE 
AK121142TGCGGCCCATATConserved hypothetical protein. 
J013095A16TGCGGCCCATATNONE 
J013111A17TGCGGCCCATATNONE 
J013132G04TGCGGCCCATATNONE 
J023077M04TGCGGCCCATATNONE 
J065001B11TGCGGCCCATATNONE 
J065001E11TGCGGCCCATATNONE 
J065057G10TGCGGCCCATATNONE 
J065057L08TGCGGCCCATATNONE 
J065080E07TGCGGCCCATATNONE 
J065087K10TGCGGCCCATATNONE 
J065091M15TGCGGCCCATATNONE 
J065167A15TGCGGCCCATATNONE 
J075018F02TGCGGCCCATATNONE 
J075063F20TGCGGCCCATATNONE 
J075064F18TGCGGCCCATATNONE 
J075066N19TGCGGCCCATATNONE 
J075073I02TGCGGCCCATATNONE 
J075080P17TGCGGCCCATATNONE 
J075081F11TGCGGCCCATATNONE 
J075085E03TGCGGCCCATATNONE 
J075101G18TGCGGCCCATATNONE 
J075149N08TGCGGCCCATATNONE 
J075158I21TGCGGCCCATATNONE 
J075161M20TGCGGCCCATATNONE 
J075190F12TGCGGCCCATATNONE 
J075194K16TGCGGCCCATATNONE 
J080001E08TGCGGCCCATATNONE 
J080001F21TGCGGCCCATATNONE 
J080001H19TGCGGCCCATATNONE 
J080001O15TGCGGCCCATATNONE 
J080005I22TGCGGCCCATATNONE 
J080006K23TGCGGCCCATATNONE 
J080014D20TGCGGCCCATATNONE 
J080014I05TGCGGCCCATATNONE 
J080014K21TGCGGCCCATATNONE 
J080017I24TGCGGCCCATATNONE 
J080017K11TGCGGCCCATATNONE 
J080018F11TGCGGCCCATATNONE 
J080022L18TGCGGCCCATATNONE 
J080024N23TGCGGCCCATATNONE 
J080027J23TGCGGCCCATATNONE 
J080029B14TGCGGCCCATATNONE 
J080032F14TGCGGCCCATATNONE 
J080032K19TGCGGCCCATATNONE 
J080032O21TGCGGCCCATATNONE 
J080033P17TGCGGCCCATATNONE 
J080034I06TGCGGCCCATATNONE 
J080039F24TGCGGCCCATATNONE 
J080040O13TGCGGCCCATATNONE 
J080042B02TGCGGCCCATATNONE 
J080043E12TGCGGCCCATATNONE 
J080043J15TGCGGCCCATATNONE 
J080043N09TGCGGCCCATATNONE 
J080052J08TGCGGCCCATATNONE 
J080053K01TGCGGCCCATATNONE 
J080053K19TGCGGCCCATATNONE 
J080055J09TGCGGCCCATATNONE 
J080058D07TGCGGCCCATATNONE 
J080062F11TGCGGCCCATATNONE 
J080063J24TGCGGCCCATATNONE 
J080066H04TGCGGCCCATATNONE 
J080066I09TGCGGCCCATATNONE 
J080067B02TGCGGCCCATATNONE 
J080067N09TGCGGCCCATATNONE 
J080068D22TGCGGCCCATATNONE 
J080068K13TGCGGCCCATATNONE 
J080069N19TGCGGCCCATATNONE 
J080070D07TGCGGCCCATATNONE 
J080070E05TGCGGCCCATATNONE 
J080071G04TGCGGCCCATATNONE 
J080077G05TGCGGCCCATATNONE 
J080077O06TGCGGCCCATATNONE 
J080085F05TGCGGCCCATATNONE 
J080086E07TGCGGCCCATATNONE 
J080089G16TGCGGCCCATATNONE 
J080092K15TGCGGCCCATATNONE 
J080094A08TGCGGCCCATATNONE 
J080097A09TGCGGCCCATATNONE 
J080097J07TGCGGCCCATATNONE 
J090027N01TGCGGCCCATATNONE 
J090081J05TGCGGCCCATATNONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0120300AK109108CATGGGCCGAHypothetical protein. 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
Os05g0122900009-052-C11TAATGGGCCGCNONE 
009-132-C12TAATGGGCCGCNONE 
014-091-G03TAATGGGCCGCNONE 
AB072977TAATGGGCCGCNONE 
AK071296TAATGGGCCGCNONE 
AK099375TAATGGGCCGCNONE 
AK104970TAATGGGCCGCBLE1 protein. 
J065007I09TAATGGGCCGCNONE 
J065081H07TAATGGGCCGCNONE 
J065122B18TAATGGGCCGCNONE 
J065181G15TAATGGGCCGCNONE 
J065182J07TAATGGGCCGCNONE 
J065197D23TAATGGGCCGCNONE 
J065197G08TAATGGGCCGCNONE 
J065201H20TAATGGGCCGCNONE 
J090034E11TAATGGGCCGCNONE 
J100077M04TAATGGGCCGCNONE 
Os05g0123400AK069521CACGGCCCATCAConserved hypothetical protein. 
J023022O05CACGGCCCATCANONE 
Os05g0126200AK059554CCCGGCCCATCTConserved hypothetical protein. 
AK121734CCCGGCCCATCTNONE 
J033084B09CCCGGCCCATCTNONE 
J090010I10CCCGGCCCATCTNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
Os05g0169400AK073439AAATGGGCCGAAProtein of unknown function DUF1421 family protein. 
AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15AAATGGGCCGAANONE 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02AAATGGGCCGAANONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0176600009-151-A09ACATGGGCCGCNONE 
009-151-A09TTATGGGCCGAANONE 
AK071760ACATGGGCCGCConserved hypothetical protein. 
AK071760TTATGGGCCGAAConserved hypothetical protein. 
J023110C14ACATGGGCCGCNONE 
J023110C14TTATGGGCCGAANONE 
J065116G18ACATGGGCCGCNONE 
J065116G18TTATGGGCCGAANONE 
J065131I04ACATGGGCCGCNONE 
J065131I04TTATGGGCCGAANONE 
J065163H12ACATGGGCCGCNONE 
J065163H12TTATGGGCCGAANONE 
J075088L08ACATGGGCCGCNONE 
J075088L08TTATGGGCCGAANONE 
J075165F17ACATGGGCCGCNONE 
J075165F17TTATGGGCCGAANONE 
Os05g0182700003-102-E07CCCGGCCCATGANONE 
011-019-D04CCCGGCCCATGANONE 
013-068-D09CCCGGCCCATGANONE 
014-032-G03CCCGGCCCATGANONE 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK104343CCCGGCCCATGANONE 
J013045E01CCCGGCCCATGANONE 
J013156L15CCCGGCCCATGANONE 
J023029P17CCCGGCCCATGANONE 
J023134I24CCCGGCCCATGANONE 
J033099A10CCCGGCCCATGANONE 
J033115L16CCCGGCCCATGANONE 
J090007M24CCCGGCCCATGANONE 
J090019F02CCCGGCCCATGANONE 
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein. 
J080093O15ACCGGCCCATTTNONE 
J090061N02ACCGGCCCATTTNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0255600AK073067CACGGCCCATTThioredoxin domain 2 containing protein. 
J033022A04CACGGCCCATTNONE 
J033022B03CACGGCCCATTNONE 
J033116F22CACGGCCCATTNONE 
J065017H13CACGGCCCATTNONE 
J065038G20CACGGCCCATTNONE 
J065076J16CACGGCCCATTNONE 
J065135D06CACGGCCCATTNONE 
J065168P22CACGGCCCATTNONE 
J065188G21CACGGCCCATTNONE 
J065207C14CACGGCCCATTNONE 
J080014C23CACGGCCCATTNONE 
J080018G12CACGGCCCATTNONE 
J080021F03CACGGCCCATTNONE 
J100068C14CACGGCCCATTNONE 
Os05g0304200009-059-H05CTCGGCCCATAANONE 
AK099372CTCGGCCCATAANONE 
AK112073CTCGGCCCATAAPAP fibrillin family protein. 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0327000014-005-A12CATGGGCCGANONE 
AK064059CATGGGCCGACyclin-like domain containing protein. 
AK101588CATGGGCCGANONE 
J033051A05CATGGGCCGANONE 
J065106E02CATGGGCCGANONE 
J065183D01CATGGGCCGANONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0361700