version

Summary of OsREG491 (All List)

OrganismOryza sativa  
IDOsREG491  
SequenceATGGGCTG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1776  

Entry Sequences (1776 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
AK073130TCAGCCCATACSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0229900AK065381ACAGCCCATANONE 
AK065429ACAGCCCATASimilar to Shaggy-related protein kinase dzeta (EC 2.7.1.-) (ASK-dzeta). 
Os01g0242200AK107468GCAGCCCATGZinc finger, C2H2-type domain containing protein. 
Os01g0248800009-103-G11CCAGCCCATTTNONE 
AK062766CCAGCCCATTTConserved hypothetical protein. 
Os01g0286600AB057749CCCAGCCCATTSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0348600AK062168TCAGCCCATTTNONE 
AK099063TCAGCCCATTTNONE 
J013157A11TCAGCCCATTTNONE 
Os01g0358300AK060388AAATGGGCTGGGNONE 
AK072081AAATGGGCTGGGTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11CCCAGCCCATTTNONE 
006-083-B11CCCAGCCCATTTNONE 
006-083-C09CCCAGCCCATTTNONE 
006-088-H03CCCAGCCCATTTNONE 
006-102-H05CCCAGCCCATTTNONE 
AK061826CCCAGCCCATTTSimilar to 40S ribosomal protein S4. 
J013105M07CCCAGCCCATTTNONE 
J013155A16CCCAGCCCATTTNONE 
J033025C03CCCAGCCCATTTNONE 
J033072L20CCCAGCCCATTTNONE 
J033095I15CCCAGCCCATTTNONE 
J033105E03CCCAGCCCATTTNONE 
J033112G18CCCAGCCCATTTNONE 
J033125D09CCCAGCCCATTTNONE 
J065100L16CCCAGCCCATTTNONE 
J065176I05CCCAGCCCATTTNONE 
J090001C14CCCAGCCCATTTNONE 
J090058E15CCCAGCCCATTTNONE 
J090068F07CCCAGCCCATTTNONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0590200011-100-E06CGATGGGCTGGNONE 
012-005-A05CGATGGGCTGGNONE 
AK063416CGATGGGCTGGConserved hypothetical protein. 
AK099235CGATGGGCTGGNONE 
AK105022CGATGGGCTGGNONE 
J065030D21CGATGGGCTGGNONE 
J065031C10CGATGGGCTGGNONE 
J065105A22CGATGGGCTGGNONE 
J065173M19CGATGGGCTGGNONE 
J075188F15CGATGGGCTGGNONE 
J090050C15CGATGGGCTGGNONE 
J100058K07CGATGGGCTGGNONE 
Os01g0590300014-089-E04CCATGGGCTGANONE 
AK063740CCATGGGCTGAConserved hypothetical protein. 
Os01g0626300016-070-G04ATATGGGCTGGNONE 
AK122071ATATGGGCTGGSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04ATATGGGCTGGNONE 
J033117J08ATATGGGCTGGNONE 
J065007O12ATATGGGCTGGNONE 
J065020K12ATATGGGCTGGNONE 
J065142D24ATATGGGCTGGNONE 
J065157K19ATATGGGCTGGNONE 
J080307H19ATATGGGCTGGNONE 
J080311D16ATATGGGCTGGNONE 
J080316C12ATATGGGCTGGNONE 
J080316E03ATATGGGCTGGNONE 
J100033K16ATATGGGCTGGNONE 
J100042J21ATATGGGCTGGNONE 
J100051E06ATATGGGCTGGNONE 
J100071E22ATATGGGCTGGNONE 
Os01g0667900013-097-A02TCAGCCCATCANONE 
014-011-C01TCAGCCCATCANONE 
AK105335TCAGCCCATCAGlutaredoxin-like, plant II family protein. 
J065156F10TCAGCCCATCANONE 
J065163D22TCAGCCCATCANONE 
J065197J04TCAGCCCATCANONE 
J075122C02TCAGCCCATCANONE 
J100047L16TCAGCCCATCANONE 
Os01g0678700AK111611AAATGGGCTGTDP protein. 
AY224529AAATGGGCTGTNONE 
Os01g0686800006-098-B12AATGGGCTGCNONE 
006-098-B12GCAGCCCATTTNONE 
006-113-H04AATGGGCTGCNONE 
006-113-H04GCAGCCCATTTNONE 
AK060428AATGGGCTGCNONE 
AK060428GCAGCCCATTTNONE 
AK098877AATGGGCTGCNONE 
AK098877GCAGCCCATTTNONE 
AK098893AATGGGCTGCNONE 
AK098893GCAGCCCATTTNONE 
AK121587AATGGGCTGCGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK121587GCAGCCCATTTGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231AATGGGCTGCNONE 
D38231GCAGCCCATTTNONE 
J013001E12AATGGGCTGCNONE 
J013001E12GCAGCCCATTTNONE 
J013001N15AATGGGCTGCNONE 
J013001N15GCAGCCCATTTNONE 
J013098G22AATGGGCTGCNONE 
J013098G22GCAGCCCATTTNONE 
J023004P15AATGGGCTGCNONE 
J023004P15GCAGCCCATTTNONE 
J023014D09AATGGGCTGCNONE 
J023014D09GCAGCCCATTTNONE 
J023020G09AATGGGCTGCNONE 
J023020G09GCAGCCCATTTNONE 
J023034A19AATGGGCTGCNONE 
J023034A19GCAGCCCATTTNONE 
J023050I11AATGGGCTGCNONE 
J023050I11GCAGCCCATTTNONE 
J023079D13AATGGGCTGCNONE 
J023079D13GCAGCCCATTTNONE 
J023091B11AATGGGCTGCNONE 
J023091B11GCAGCCCATTTNONE 
J023099M03AATGGGCTGCNONE 
J023099M03GCAGCCCATTTNONE 
J023101H20AATGGGCTGCNONE 
J023101H20GCAGCCCATTTNONE 
J023106P14AATGGGCTGCNONE 
J023106P14GCAGCCCATTTNONE 
J023111F19AATGGGCTGCNONE 
J023111F19GCAGCCCATTTNONE 
J023132C22AATGGGCTGCNONE 
J023132C22GCAGCCCATTTNONE 
J023139O03AATGGGCTGCNONE 
J023139O03GCAGCCCATTTNONE 
J023146O10AATGGGCTGCNONE 
J023146O10GCAGCCCATTTNONE 
J033022G16AATGGGCTGCNONE 
J033022G16GCAGCCCATTTNONE 
J033030C10AATGGGCTGCNONE 
J033030C10GCAGCCCATTTNONE 
J033032G18AATGGGCTGCNONE 
J033032G18GCAGCCCATTTNONE 
J033034N09AATGGGCTGCNONE 
J033034N09GCAGCCCATTTNONE 
J033037K24AATGGGCTGCNONE 
J033037K24GCAGCCCATTTNONE 
J033038B22AATGGGCTGCNONE 
J033038B22GCAGCCCATTTNONE 
J033061E06AATGGGCTGCNONE 
J033061E06GCAGCCCATTTNONE 
J033065F08AATGGGCTGCNONE 
J033065F08GCAGCCCATTTNONE 
J033065I24AATGGGCTGCNONE 
J033065I24GCAGCCCATTTNONE 
J033069L01AATGGGCTGCNONE 
J033069L01GCAGCCCATTTNONE 
J033086N21AATGGGCTGCNONE 
J033086N21GCAGCCCATTTNONE 
J033102I06AATGGGCTGCNONE 
J033102I06GCAGCCCATTTNONE 
J033111N07AATGGGCTGCNONE 
J033111N07GCAGCCCATTTNONE 
J033118K11AATGGGCTGCNONE 
J033118K11GCAGCCCATTTNONE 
J033125D08AATGGGCTGCNONE 
J033125D08GCAGCCCATTTNONE 
J033129P22AATGGGCTGCNONE 
J033129P22GCAGCCCATTTNONE 
J033131L12AATGGGCTGCNONE 
J033131L12GCAGCCCATTTNONE 
J033139D08AATGGGCTGCNONE 
J033139D08GCAGCCCATTTNONE 
J033141J08AATGGGCTGCNONE 
J033141J08GCAGCCCATTTNONE 
J043024B14AATGGGCTGCNONE 
J043024B14GCAGCCCATTTNONE 
J053048G19AATGGGCTGCNONE 
J053048G19GCAGCCCATTTNONE 
J065023B15AATGGGCTGCNONE 
J065023B15GCAGCCCATTTNONE 
J065082C15AATGGGCTGCNONE 
J065082C15GCAGCCCATTTNONE 
J065087D24AATGGGCTGCNONE 
J065087D24GCAGCCCATTTNONE 
J065122D11AATGGGCTGCNONE 
J065122D11GCAGCCCATTTNONE 
J065128P13AATGGGCTGCNONE 
J065128P13GCAGCCCATTTNONE 
J065149I19AATGGGCTGCNONE 
J065149I19GCAGCCCATTTNONE 
J065154E16AATGGGCTGCNONE 
J065154E16GCAGCCCATTTNONE 
J065156K21AATGGGCTGCNONE 
J065156K21GCAGCCCATTTNONE 
J065166H09AATGGGCTGCNONE 
J065166H09GCAGCCCATTTNONE 
J065169F24AATGGGCTGCNONE 
J065169F24GCAGCCCATTTNONE 
J065194I16AATGGGCTGCNONE 
J065194I16GCAGCCCATTTNONE 
J065213M20AATGGGCTGCNONE 
J065213M20GCAGCCCATTTNONE 
J075020F19AATGGGCTGCNONE 
J075020F19GCAGCCCATTTNONE 
J075051J16AATGGGCTGCNONE 
J075051J16GCAGCCCATTTNONE 
J075093C18AATGGGCTGCNONE 
J075093C18GCAGCCCATTTNONE 
J075119H02AATGGGCTGCNONE 
J075119H02GCAGCCCATTTNONE 
J075120J11AATGGGCTGCNONE 
J075120J11GCAGCCCATTTNONE 
J075173A15AATGGGCTGCNONE 
J075173A15GCAGCCCATTTNONE 
J080302B05AATGGGCTGCNONE 
J080302B05GCAGCCCATTTNONE 
J080304G10AATGGGCTGCNONE 
J080304G10GCAGCCCATTTNONE 
J080305E13AATGGGCTGCNONE 
J080305E13GCAGCCCATTTNONE 
J080315L11AATGGGCTGCNONE 
J080315L11GCAGCCCATTTNONE 
J090005H15AATGGGCTGCNONE 
J090005H15GCAGCCCATTTNONE 
J090021C24AATGGGCTGCNONE 
J090021C24GCAGCCCATTTNONE 
J090025H24AATGGGCTGCNONE 
J090025H24GCAGCCCATTTNONE 
J090025M11AATGGGCTGCNONE 
J090025M11GCAGCCCATTTNONE 
J090026C22AATGGGCTGCNONE 
J090026C22GCAGCCCATTTNONE 
J090027H15AATGGGCTGCNONE 
J090027H15GCAGCCCATTTNONE 
J090034B17AATGGGCTGCNONE 
J090034B17GCAGCCCATTTNONE 
J090045G11AATGGGCTGCNONE 
J090045G11GCAGCCCATTTNONE 
J090048H02AATGGGCTGCNONE 
J090048H02GCAGCCCATTTNONE 
J090051N04AATGGGCTGCNONE 
J090051N04GCAGCCCATTTNONE 
J090052I06AATGGGCTGCNONE 
J090052I06GCAGCCCATTTNONE 
J090054L17AATGGGCTGCNONE 
J090054L17GCAGCCCATTTNONE 
J090060M22AATGGGCTGCNONE 
J090060M22GCAGCCCATTTNONE 
J090075N17AATGGGCTGCNONE 
J090075N17GCAGCCCATTTNONE 
J090079K13AATGGGCTGCNONE 
J090079K13GCAGCCCATTTNONE 
J090086H08AATGGGCTGCNONE 
J090086H08GCAGCCCATTTNONE 
J090094N20AATGGGCTGCNONE 
J090094N20GCAGCCCATTTNONE 
J100021F03AATGGGCTGCNONE 
J100021F03GCAGCCCATTTNONE 
J100031M01AATGGGCTGCNONE 
J100031M01GCAGCCCATTTNONE 
J100033I18AATGGGCTGCNONE 
J100033I18GCAGCCCATTTNONE 
J100034P07AATGGGCTGCNONE 
J100034P07GCAGCCCATTTNONE 
J100043M16AATGGGCTGCNONE 
J100043M16GCAGCCCATTTNONE 
J100046J12AATGGGCTGCNONE 
J100046J12GCAGCCCATTTNONE 
J100055F09AATGGGCTGCNONE 
J100055F09GCAGCCCATTTNONE 
J100057D19AATGGGCTGCNONE 
J100057D19GCAGCCCATTTNONE 
J100060O10AATGGGCTGCNONE 
J100060O10GCAGCCCATTTNONE 
J100064G09AATGGGCTGCNONE 
J100064G09GCAGCCCATTTNONE 
J100077F24AATGGGCTGCNONE 
J100077F24GCAGCCCATTTNONE 
J100080E12AATGGGCTGCNONE 
J100080E12GCAGCCCATTTNONE 
J100089J04AATGGGCTGCNONE 
J100089J04GCAGCCCATTTNONE 
Os01g0700500AK072715GCAGCCCATGGCytochrome P450 family protein. 
AK119264GCAGCCCATGGNONE 
Os01g0721900AK059581TCAGCCCATGGNONE 
J065191A18TCAGCCCATGGNONE 
J100064H01TCAGCCCATGGNONE 
J100075M23TCAGCCCATGGNONE 
J100090A11TCAGCCCATGGNONE 
Os01g0752300AK121755CCAGCCCATATSimilar to 60S ribosomal protein L18a-1. 
J013049F10CCAGCCCATATNONE 
J013088L10CCAGCCCATATNONE 
J023020B21CCAGCCCATATNONE 
J023038M01CCAGCCCATATNONE 
J033058H15CCAGCCCATATNONE 
J033088C04CCAGCCCATATNONE 
J033115N19CCAGCCCATATNONE 
J033131H04CCAGCCCATATNONE 
J065067E05CCAGCCCATATNONE 
J065085C07CCAGCCCATATNONE 
J065095D12CCAGCCCATATNONE 
J065124B19CCAGCCCATATNONE 
J065181H07CCAGCCCATATNONE 
J065197B09CCAGCCCATATNONE 
J075090K22CCAGCCCATATNONE 
J075101P17CCAGCCCATATNONE 
J075181F13CCAGCCCATATNONE 
J075190H19CCAGCCCATATNONE 
J090004P17CCAGCCCATATNONE 
J090066I03CCAGCCCATATNONE 
Os01g0776700J065046N20ACAGCCCATCGConserved hypothetical protein. 
J100086L02ACAGCCCATCGNONE 
Os01g0838350J065034O10CCAGCCCATGNONE 
J065151M02CCAGCCCATGConserved hypothetical protein. 
J065187I12CCAGCCCATGNONE 
J075083I04CCAGCCCATGNONE 
J075117N03CCAGCCCATGNONE 
Os01g0847700AK103729GCCCATAATGGGCTGTSimilar to Aldose reductase. 
J033031B19GCCCATAATGGGCTGTNONE 
J065110K09GCCCATAATGGGCTGTNONE 
J065135H06GCCCATAATGGGCTGTNONE 
J075015H10GCCCATAATGGGCTGTNONE 
Os01g0850400AJ575220TGGATGGGCTGANONE 
AK108582TGGATGGGCTGASimilar to MYBY1 protein (Fragment). 
Os01g0850900009-089-D11CCAGCCCATGANONE 
AK063822CCAGCCCATGANONE 
AK102887CCAGCCCATGASOUL heme-binding protein family protein. 
J033112K22CCAGCCCATGANONE 
J065087B10CCAGCCCATGANONE 
J065100A05CCAGCCCATGANONE 
J075077M10CCAGCCCATGANONE 
Os01g0856500AK103981GGATGGGCTGANONE 
Os01g0872100AK099405TCAGCCCATTATGF-beta receptor, type I/II extracellular region family protein. 
J013001K17TCAGCCCATTANONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0949700AK069037ACAGCCCATCCNONE 
AK069037CCAGCCCATGGNONE 
J023004F17ACAGCCCATCCNONE 
J023004F17CCAGCCCATGGNONE 
J065063D04ACAGCCCATCCNONE 
J065063D04CCAGCCCATGGNONE 
J065196H02ACAGCCCATCCNONE 
J065196H02CCAGCCCATGGNONE 
J075198A05ACAGCCCATCCNONE 
J075198A05CCAGCCCATGGNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0976700AK068121CCATGGGCTGCNONE 
AK100571CCATGGGCTGCSimilar to Protein phosphatase 2C-like protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0158900AK108324GCAGCCCATGSimilar to SNF4. 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0205000AK060003CCAGCCCATCANONE 
AK073514CCAGCCCATCARibosomal protein L19 family protein. 
J065106I07CCAGCCCATCANONE 
Os02g0241100Os02g0241100AGATGGGCTGAProtein kinase-like domain containing protein. 
Os02g0439700AK067803CCAGCCCATATPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0496900AK059542ATATGGGCTGTConserved hypothetical protein. 
J053031E06ATATGGGCTGTNONE 
J065195E11ATATGGGCTGTNONE 
J090008P16ATATGGGCTGTNONE 
Os02g0600100AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0621700011-079-F10CCAGCCCATACNONE 
AK101006CCAGCCCATACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525CCAGCCCATACNONE 
J013026C02CCAGCCCATACNONE 
J013104M10CCAGCCCATACNONE 
J023003D01CCAGCCCATACNONE 
J023007H13CCAGCCCATACNONE 
J023019G09CCAGCCCATACNONE 
J023020L19CCAGCCCATACNONE 
J023022L12CCAGCCCATACNONE 
J023022O14CCAGCCCATACNONE 
J023036F16CCAGCCCATACNONE 
J023047D16CCAGCCCATACNONE 
J023052P08CCAGCCCATACNONE 
J023077C01CCAGCCCATACNONE 
J023083M06CCAGCCCATACNONE 
J023105A11CCAGCCCATACNONE 
J023117F21CCAGCCCATACNONE 
J023119D20CCAGCCCATACNONE 
J023148E03CCAGCCCATACNONE 
J023149B13CCAGCCCATACNONE 
J033029A10CCAGCCCATACNONE 
J033046L17CCAGCCCATACNONE 
J033052M04CCAGCCCATACNONE 
J033057M14CCAGCCCATACNONE 
J033066K24CCAGCCCATACNONE 
J033069K02CCAGCCCATACNONE 
J033079G14CCAGCCCATACNONE 
J033101E06CCAGCCCATACNONE 
J033116E06CCAGCCCATACNONE 
J033118L18CCAGCCCATACNONE 
J033135B13CCAGCCCATACNONE 
J033136C10CCAGCCCATACNONE 
J033136P08CCAGCCCATACNONE 
J043027B13CCAGCCCATACNONE 
J065039I03CCAGCCCATACNONE 
J065185N21CCAGCCCATACNONE 
J090008D14CCAGCCCATACNONE 
J090029K17CCAGCCCATACNONE 
J090047H20CCAGCCCATACNONE 
J090048N17CCAGCCCATACNONE 
J090085G08CCAGCCCATACNONE 
J090089F07CCAGCCCATACNONE 
Os02g0634800003-004-F03TCAGCCCATGANONE 
AK059694TCAGCCCATGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCAGCCCATGANONE 
J053077G20TCAGCCCATGANONE 
J075195F14TCAGCCCATGANONE 
Os02g0634900006-032-G12TCATGGGCTGANONE 
006-033-E09TCATGGGCTGANONE 
006-117-F10TCATGGGCTGANONE 
006-118-E01TCATGGGCTGANONE 
013-056-G08TCATGGGCTGANONE 
AK059769TCATGGGCTGANONE 
AK068583TCATGGGCTGANONE 
AK072855TCATGGGCTGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCATGGGCTGANONE 
J023138P05TCATGGGCTGANONE 
J023143J07TCATGGGCTGANONE 
J033022O09TCATGGGCTGANONE 
J033111L02TCATGGGCTGANONE 
J033135O03TCATGGGCTGANONE 
J065005K19TCATGGGCTGANONE 
J065044C17TCATGGGCTGANONE 
J065116K09TCATGGGCTGANONE 
J065119O21TCATGGGCTGANONE 
J075014L05TCATGGGCTGANONE 
J075109H16TCATGGGCTGANONE 
J075117D04TCATGGGCTGANONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0651500AK066333TCAGCCCATGANONE 
AK121865TCAGCCCATGAHypothetical protein. 
J090038J11TCAGCCCATGANONE 
Os02g0658300AK073923ACAGCCCATTAConserved hypothetical protein. 
J065152M15ACAGCCCATTANONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0690600AK110831CCAGCCCATATU box domain containing protein. 
Os02g0732900AK065796GCAGCCCATTACGGCCCProtein of unknown function DUF794, plant family protein. 
AK104342GCAGCCCATTACGGCCCNONE 
Os02g0772500AK100349TTATGGGCTGAProtein prenyltransferase domain containing protein. 
J023082M21TTATGGGCTGANONE 
J065047H11TTATGGGCTGANONE 
J065055F20TTATGGGCTGANONE 
J065082I22TTATGGGCTGANONE 
J100074B04TTATGGGCTGANONE 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0776800AB042415CCAGCCCATCCANONE 
AK072308CCAGCCCATCCAReplication protein A 70kDa. 
AK101212CCAGCCCATCCANONE 
J033031B02CCAGCCCATCCANONE 
J090004E18CCAGCCCATCCANONE 
J090084C24CCAGCCCATCCANONE 
Os02g0791800AK066282CATGGGCTGCNONE 
AK099697CATGGGCTGCWD-40 repeat containing protein. 
AY445625CATGGGCTGCNONE 
J053065H07CATGGGCTGCNONE 
J065108P05CATGGGCTGCNONE 
J065154P22CATGGGCTGCNONE 
J100037P04CATGGGCTGCNONE 
J100068K05CATGGGCTGCNONE 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0122000AK101458ACAGCCCATAProtein kinase-like domain containing protein. 
J013035K10ACAGCCCATANONE 
J013050E10ACAGCCCATANONE 
J033040C13ACAGCCCATANONE 
Os03g0130700015-052-H06TCATGGGCTGTNONE 
AK073872TCATGGGCTGTNONE 
AK100822TCATGGGCTGTNONE 
AK119886TCATGGGCTGTNONE 
J090060L05TCATGGGCTGTNONE 
J100059N01TCATGGGCTGTNONE 
Os03g0151500AK109181TCAGCCCATTConserved hypothetical protein. 
Os03g0156600014-033-H04TCAGCCCATTNONE 
014-051-C04TCAGCCCATTNONE 
AK105367TCAGCCCATTSimilar to Farnesylated protein (ATFP6). 
Os03g0182800003-126-E06ACAGCCCATCCNONE 
AJ304840ACAGCCCATCCNONE 
AK073133ACAGCCCATCCNONE 
AY323478ACAGCCCATCCSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13ACAGCCCATCCNONE 
J033028C22ACAGCCCATCCNONE 
J033042J03ACAGCCCATCCNONE 
J065022E13ACAGCCCATCCNONE 
J065208N24ACAGCCCATCCNONE 
J100034B17ACAGCCCATCCNONE 
J100035J21ACAGCCCATCCNONE 
J100039L16ACAGCCCATCCNONE 
J100040A02ACAGCCCATCCNONE 
J100051L11ACAGCCCATCCNONE 
J100064F07ACAGCCCATCCNONE 
J100070J12ACAGCCCATCCNONE 
Os03g0197000AK071163CCATGGGCTGGConserved hypothetical protein. 
J023079A07CCATGGGCTGGNONE 
Os03g0213800AK103114AGATGGGCTGGMitochondrial substrate carrier family protein. 
Os03g0239300AK066038ACAGCCCATATZinc finger, C2H2-type domain containing protein. 
AK068149ACAGCCCATATNONE 
AK071768ACAGCCCATATNONE 
J053027G22ACAGCCCATATNONE 
J075048G23ACAGCCCATATNONE 
J100060G19ACAGCCCATATNONE 
Os03g0253100AK119618ACAGCCCATGTPhosphomevalonate kinase Erg8 family protein. 
J033052A14ACAGCCCATGTNONE 
Os03g0279600006-070-A07CCAGCCCATATNONE 
AK061080CCAGCCCATATConserved hypothetical protein. 
AK071043CCAGCCCATATNONE 
AK103191CCAGCCCATATNONE 
J065077E22CCAGCCCATATNONE 
J065208F22CCAGCCCATATNONE 
J075156K12CCAGCCCATATNONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0298800009-079-B10ACATGGGCTGTNONE 
AK103337ACATGGGCTGTSimilar to Spliceosomal protein. 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067GCAGCCCATATProtein prenyltransferase domain containing protein. 
AK100067TCAGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02GCAGCCCATATNONE 
J065161K02TCAGCCCATCTNONE 
J065162C21GCAGCCCATATNONE 
J065162C21TCAGCCCATCTNONE 
Os03g0338600AK066604TCAGCCCATTAtRNA pseudouridine synthase family protein. 
Os03g0343900009-077-C03TCAGCCCATATNONE 
AK105813TCAGCCCATATPhotosystem II protein PsbX family protein. 
J100059N03TCAGCCCATATNONE 
J100079C20TCAGCCCATATNONE 
Os03g0386000AK072984CCAGCCCATGSimilar to WD domain protein-like. 
J065009K18CCAGCCCATGNONE 
J065165P09CCAGCCCATGNONE 
Os03g0569800AK070080CCCATCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK120873CCCATCCAGCCCATTANONE 
Os03g0598200AK068322ACAGCCCATCANop14-like protein family protein. 
Os03g0622300AK107931AGCCCATGGGCTGTConserved hypothetical protein. 
J065184K14AGCCCATGGGCTGTNONE 
Os03g0633800AK073044CATGGGCTGCSimilar to IAA6 (Fragment). 
J065038L22CATGGGCTGCNONE 
J065185C13CATGGGCTGCNONE 
Os03g0634000014-034-A03ACAGCCCATCTGGACCNONE 
AK063673ACAGCCCATCTGGACCSimilar to THA4. 
Os03g0640800AF139210AATGGGCTGANONE 
J023022K02AATGGGCTGANONE 
J023030J24AATGGGCTGANONE 
J023062H06AATGGGCTGANONE 
J033023I12AATGGGCTGANONE 
J033023O07AATGGGCTGANONE 
J033040B18AATGGGCTGANONE 
J033041D08AATGGGCTGANONE 
J033046C22AATGGGCTGANONE 
J033052G04AATGGGCTGANONE 
J033055N17AATGGGCTGANONE 
J033068L18AATGGGCTGANONE 
J033070G21AATGGGCTGANONE 
J033071E05AATGGGCTGANONE 
J033071P14AATGGGCTGANONE 
J033072G03AATGGGCTGANONE 
J033073P10AATGGGCTGANONE 
J033076F02AATGGGCTGANONE 
J033080E23AATGGGCTGANONE 
J033089G17AATGGGCTGANONE 
J033095O20AATGGGCTGANONE 
J033103M02AATGGGCTGANONE 
J033108C06AATGGGCTGANONE 
J033109O14AATGGGCTGANONE 
J033114C01AATGGGCTGANONE 
J033121K12AATGGGCTGANONE 
J033123G23AATGGGCTGANONE 
J033124M18AATGGGCTGANONE 
J033132J15AATGGGCTGANONE 
J033140L20AATGGGCTGANONE 
J065165E15AATGGGCTGANONE 
J065217L02AATGGGCTGANONE 
J090040H05AATGGGCTGANONE 
J090073L17AATGGGCTGANONE 
J090091D11AATGGGCTGANONE 
Os03g0648400005-003-D07ACAGCCCATCTNONE 
006-048-C12ACAGCCCATCTNONE 
006-049-A03ACAGCCCATCTNONE 
011-008-F07ACAGCCCATCTNONE 
011-039-A07ACAGCCCATCTNONE 
011-044-D10ACAGCCCATCTNONE 
011-099-C01ACAGCCCATCTNONE 
012-051-B09ACAGCCCATCTNONE 
012-051-D08ACAGCCCATCTNONE 
012-056-G07ACAGCCCATCTNONE 
012-062-A01ACAGCCCATCTNONE 
012-079-C03ACAGCCCATCTNONE 
014-003-A06ACAGCCCATCTNONE 
015-010-D02ACAGCCCATCTNONE 
AK102263ACAGCCCATCTSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763ACAGCCCATCTNONE 
AK105028ACAGCCCATCTNONE 
AY224432ACAGCCCATCTNONE 
J013043H01ACAGCCCATCTNONE 
J013134K10ACAGCCCATCTNONE 
J023037D18ACAGCCCATCTNONE 
J023077K20ACAGCCCATCTNONE 
J023105M19ACAGCCCATCTNONE 
J023131M09ACAGCCCATCTNONE 
J033022F05ACAGCCCATCTNONE 
J033051J22ACAGCCCATCTNONE 
J033061D03ACAGCCCATCTNONE 
J033084H04ACAGCCCATCTNONE 
J033088M01ACAGCCCATCTNONE 
J033119H12ACAGCCCATCTNONE 
J033131C18ACAGCCCATCTNONE 
J043030C06ACAGCCCATCTNONE 
J080032A08ACAGCCCATCTNONE 
J090008C11ACAGCCCATCTNONE 
J090014D24ACAGCCCATCTNONE 
J090024C20ACAGCCCATCTNONE 
J090024H08ACAGCCCATCTNONE 
J090029F10ACAGCCCATCTNONE 
J090032K16ACAGCCCATCTNONE 
J090034L14ACAGCCCATCTNONE 
J090035C20ACAGCCCATCTNONE 
J090044H05ACAGCCCATCTNONE 
J090048M09ACAGCCCATCTNONE 
J090056I15ACAGCCCATCTNONE 
J090062B01ACAGCCCATCTNONE 
J090076F06ACAGCCCATCTNONE 
J090077A02ACAGCCCATCTNONE 
J090084E21ACAGCCCATCTNONE 
J090084J09ACAGCCCATCTNONE 
J090086G11ACAGCCCATCTNONE 
J090092C20ACAGCCCATCTNONE 
J100018G14ACAGCCCATCTNONE 
J100018I22ACAGCCCATCTNONE 
J100024N14ACAGCCCATCTNONE 
J100032K09ACAGCCCATCTNONE 
J100036F09ACAGCCCATCTNONE 
J100041M04ACAGCCCATCTNONE 
J100042H05ACAGCCCATCTNONE 
J100043P19ACAGCCCATCTNONE 
J100044B04ACAGCCCATCTNONE 
J100049L24ACAGCCCATCTNONE 
J100050M21ACAGCCCATCTNONE 
J100057F24ACAGCCCATCTNONE 
J100063I11ACAGCCCATCTNONE 
J100064J24ACAGCCCATCTNONE 
J100070B13ACAGCCCATCTNONE 
J100076A13ACAGCCCATCTNONE 
J100081C20ACAGCCCATCTNONE 
J100081L09ACAGCCCATCTNONE 
J100084G23ACAGCCCATCTNONE 
J100088H02ACAGCCCATCTNONE 
Os03g0722000AK069866GCAGCCCATCCANONE 
Os03g0743200J065049G14TCAGCCCATGANONE 
J065158O18TCAGCCCATGANONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK063445TGATGGGCTGCProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
AK070923TGATGGGCTGCNONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24TGATGGGCTGCNONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0764600AK105625ATGGGCTGGHomeodomain-like containing protein. 
Os03g0786000AK061286ACAGCCCATTAConserved hypothetical protein. 
AK073187ACAGCCCATTANONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0822900AK099787ATATGGGCTGCZinc finger, BED-type predicted domain containing protein. 
J013042C24ATATGGGCTGCNONE 
J013096O21ATATGGGCTGCNONE 
J023109I23ATATGGGCTGCNONE 
J033106N09ATATGGGCTGCNONE 
J033107H03ATATGGGCTGCNONE 
J033118G03ATATGGGCTGCNONE 
J033145I24ATATGGGCTGCNONE 
J065138D15ATATGGGCTGCNONE 
J065140L13ATATGGGCTGCNONE 
J065179M13ATATGGGCTGCNONE 
J065200F05ATATGGGCTGCNONE 
J075104F20ATATGGGCTGCNONE 
J075143A15ATATGGGCTGCNONE 
J075197J11ATATGGGCTGCNONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0833500AK119356CCATGGGCTGGSimilar to 98kDa HDM allergen. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0840200AK067797TCAGCCCATCATolB, C-terminal domain containing protein. 
AK100408TCAGCCCATCANONE 
J075027I23TCAGCCCATCANONE 
J075049N10TCAGCCCATCANONE 
J100058E07TCAGCCCATCANONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0851900AK102145TCAGCCCATTAAFG1-like ATPase family protein. 
J033086B08TCAGCCCATTANONE 
Os03g0854000009-186-C03GCAGCCCATATNONE 
009-186-C03TAATGGGCTGGNONE 
AK061374GCAGCCCATATProtein of unknown function UPF0131 family protein. 
AK061374TAATGGGCTGGProtein of unknown function UPF0131 family protein. 
J065138B11GCAGCCCATATNONE 
J065138B11TAATGGGCTGGNONE 
Os03g0856200009-070-B07GCAGCCCATCANONE 
009-070-B07TTATGGGCTGTNONE 
009-135-H05GCAGCCCATCANONE 
009-135-H05TTATGGGCTGTNONE 
J100067D22GCAGCCCATCANONE 
J100067D22TTATGGGCTGTNONE 
J100067L13GCAGCCCATCANONE 
J100067L13TTATGGGCTGTNONE 
J100073I07GCAGCCCATCANONE 
J100073I07TTATGGGCTGTNONE 
J100080D01GCAGCCCATCANONE 
J100080D01TTATGGGCTGTNONE 
Os04g0107900013-017-E10AGATGGGCTGCNONE 
014-025-A02AGATGGGCTGCNONE 
014-100-C01AGATGGGCTGCNONE 
AK063568AGATGGGCTGCNONE 
AK063698AGATGGGCTGCNONE 
AK063751AGATGGGCTGCSimilar to Heat shock protein 80. 
J013118G22AGATGGGCTGCNONE 
J033131C17AGATGGGCTGCNONE 
J065036G05AGATGGGCTGCNONE 
J065106E24AGATGGGCTGCNONE 
J065171K16AGATGGGCTGCNONE 
J065213C11AGATGGGCTGCNONE 
J065218L17AGATGGGCTGCNONE 
Os04g0270100AK063713TCATGGGCTGANONE 
AK107968TCATGGGCTGANONE 
Os04g0381000AK105435CCAGCCCATAADynamin family protein. 
J075003I06CCAGCCCATAANONE 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0431000009-127-C01CCAGCCCATANONE 
Os04g0432000AB125308CCAGCCCATCCCCCSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087CCAGCCCATCCCCCNONE 
J065206O17CCAGCCCATCCCCCNONE 
Os04g0475300AK066351GCAGCCCATTAConserved hypothetical protein. 
J065138J21GCAGCCCATTANONE 
Os04g0476000Os04g0476000ACAGCCCATTTetratricopeptide-like helical domain containing protein. 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0481800AK109152ACATGGGCTGTMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24ACATGGGCTGTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0555900009-154-G03ATATGGGCTGANONE 
AK063168ATATGGGCTGAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11ATATGGGCTGANONE 
Os04g0577000AK073711ACATGGGCTGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957ACATGGGCTGANONE 
J013127H04ACATGGGCTGANONE 
J033035G06ACATGGGCTGANONE 
J033061G23ACATGGGCTGANONE 
J033127L07ACATGGGCTGANONE 
J065015F17ACATGGGCTGANONE 
J065062G08ACATGGGCTGANONE 
J065132M07ACATGGGCTGANONE 
J065155C12ACATGGGCTGANONE 
J075055I08ACATGGGCTGANONE 
J075140D07ACATGGGCTGANONE 
J090055B21ACATGGGCTGANONE 
J100031D23ACATGGGCTGANONE 
Os04g0604200013-087-H05CCAGCCCATAANONE 
AK063614CCAGCCCATAASimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0658200J075021C22AAATGGGCTGCConserved hypothetical protein. 
Os04g0667000AK069874CCAGCCCATAATafazzin family protein. 
J100055P09CCAGCCCATAANONE 
J100057O12CCAGCCCATAANONE 
J100067H07CCAGCCCATAANONE 
J100070D06CCAGCCCATAANONE 
J100071J16CCAGCCCATAANONE 
J100072C15CCAGCCCATAANONE 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os04g0688500013-068-C11TCAGCCCATATNONE 
013-082-D10TCAGCCCATATNONE 
AK067667TCAGCCCATATPeroxidase (EC 1.11.1.7). 
J013044F01TCAGCCCATATNONE 
J013068J12TCAGCCCATATNONE 
J013075A19TCAGCCCATATNONE 
J013118D03TCAGCCCATATNONE 
J013126C19TCAGCCCATATNONE 
J013162J15TCAGCCCATATNONE 
J075110L20TCAGCCCATATNONE 
J075156K24TCAGCCCATATNONE 
Os05g0103100AK103317AAATGGGCTGATGGGCTranslocon-associated beta family protein. 
J033125H15AAATGGGCTGATGGGCNONE 
J065021L01AAATGGGCTGATGGGCNONE 
J065029M01AAATGGGCTGATGGGCNONE 
J065089F17AAATGGGCTGATGGGCNONE 
J065112N04AAATGGGCTGATGGGCNONE 
J065163L03AAATGGGCTGATGGGCNONE 
J065175B04AAATGGGCTGATGGGCNONE 
J065192E02AAATGGGCTGATGGGCNONE 
J075046C20AAATGGGCTGATGGGCNONE 
J075192A01AAATGGGCTGATGGGCNONE 
J100018H13AAATGGGCTGATGGGCNONE 
J100067K20AAATGGGCTGATGGGCNONE 
J100080N03AAATGGGCTGATGGGCNONE 
Os05g0123400AK069521CCAGCCCATGAConserved hypothetical protein. 
J023022O05CCAGCCCATGANONE 
Os05g0128100009-051-B07ACAGCCCATTTNONE 
009-127-B08ACAGCCCATTTNONE 
009-144-H03ACAGCCCATTTNONE 
009-176-B05ACAGCCCATTTNONE 
AK108556ACAGCCCATTTNONE 
AK119308ACAGCCCATTTNONE 
AK120934ACAGCCCATTTConserved hypothetical protein. 
J023036J15ACAGCCCATTTNONE 
J065122L01ACAGCCCATTTNONE 
J075104P10ACAGCCCATTTNONE 
Os05g0144800AK099724CCAGCCCATCTSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0155100006-075-B02TCAGCCCATGNONE 
AK061929TCAGCCCATGNONE 
AK102810TCAGCCCATGNONE 
AK120877TCAGCCCATGSimilar to 60S ribosomal protein L18. 
J013023E03TCAGCCCATGNONE 
J013038C16TCAGCCCATGNONE 
J013120M14TCAGCCCATGNONE 
J013153B04TCAGCCCATGNONE 
J013159B07TCAGCCCATGNONE 
J023012A02TCAGCCCATGNONE 
J023027F08TCAGCCCATGNONE 
J023027I12TCAGCCCATGNONE 
J023120F05TCAGCCCATGNONE 
J023138O03TCAGCCCATGNONE 
J023142H13TCAGCCCATGNONE 
J023143P06TCAGCCCATGNONE 
J033023P09TCAGCCCATGNONE 
J033035O14TCAGCCCATGNONE 
J033042N19TCAGCCCATGNONE 
J033043B12TCAGCCCATGNONE 
J033065D10TCAGCCCATGNONE 
J033081A12TCAGCCCATGNONE 
J033084N05TCAGCCCATGNONE 
J033085M03TCAGCCCATGNONE 
J033112D15TCAGCCCATGNONE 
J033114O07TCAGCCCATGNONE 
J033119D15TCAGCCCATGNONE 
J033140E06TCAGCCCATGNONE 
J033141K23TCAGCCCATGNONE 
J043040I22TCAGCCCATGNONE 
J053050B21TCAGCCCATGNONE 
J053065I18TCAGCCCATGNONE 
J053074O16TCAGCCCATGNONE 
J065072K13TCAGCCCATGNONE 
J065211I09TCAGCCCATGNONE 
J090004K04TCAGCCCATGNONE 
J090016L06TCAGCCCATGNONE 
J090040F22TCAGCCCATGNONE 
J090063F22TCAGCCCATGNONE 
J090081J09TCAGCCCATGNONE 
J100032A10TCAGCCCATGNONE 
J100037G20TCAGCCCATGNONE 
J100056O10TCAGCCCATGNONE 
J100071D10TCAGCCCATGNONE 
J100075K13TCAGCCCATGNONE 
J100079F16TCAGCCCATGNONE 
J100080O16TCAGCCCATGNONE 
J100086N05TCAGCCCATGNONE 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0316200AK060608CCAGCCCATCCANONE 
AK101705CCAGCCCATCCAConserved hypothetical protein. 
AK111481CCAGCCCATCCANONE 
Os05g0378900AK103841ACAGCCCATCAConserved hypothetical protein. 
AK103841CCAGCCCATCAConserved hypothetical protein. 
AK103841GTATGGGCTGGConserved hypothetical protein. 
J033148I18ACAGCCCATCANONE 
J033148I18CCAGCCCATCANONE 
J033148I18GTATGGGCTGGNONE 
J065085F12ACAGCCCATCANONE 
J065085F12CCAGCCCATCANONE 
J065085F12GTATGGGCTGGNONE 
J075041H24ACAGCCCATCANONE 
J075041H24CCAGCCCATCANONE 
J075041H24GTATGGGCTGGNONE 
J075180P06ACAGCCCATCANONE 
J075180P06CCAGCCCATCANONE 
J075180P06GTATGGGCTGGNONE 
Os05g0430200J090095K16ACAGCCCATGNONE 
Os05g0445500009-021-C05GCAGCCCATGNONE 
009-129-D11GCAGCCCATGNONE 
009-147-E04GCAGCCCATGNONE 
009-169-C11GCAGCCCATGNONE 
AK121459GCAGCCCATGSimilar to 60S acidic ribosomal protein P2B. 
D21114GCAGCCCATGNONE 
J023001K23GCAGCCCATGNONE 
J023107J19GCAGCCCATGNONE 
J023143J09GCAGCCCATGNONE 
J065049D04GCAGCCCATGNONE 
J065092I06GCAGCCCATGNONE 
J065188H04GCAGCCCATGNONE 
Os05g0469900AK109700AAATGGGCTGGGConserved hypothetical protein. 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0541500AK101190AGATGGGCTGGCyclin-like F-box domain containing protein. 
AK101531AGATGGGCTGGNONE 
J033030F10AGATGGGCTGGNONE 
Os05g0541900009-130-F05TCAGCCCATTNONE 
009-200-E07TCAGCCCATTNONE 
013-057-G09TCAGCCCATTNONE 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0558900AK101679ACATGGGCTGGSimilar to Frsb-prov protein. 
J013028M08ACATGGGCTGGNONE 
J013074E16ACATGGGCTGGNONE 
J013096L01ACATGGGCTGGNONE 
J023085M19ACATGGGCTGGNONE 
J033058I10ACATGGGCTGGNONE 
J033091D18ACATGGGCTGGNONE 
J033111H13ACATGGGCTGGNONE 
J033114C18ACATGGGCTGGNONE 
Os06g0101600AF093636AATGGGCTGCNONE 
AK070447AATGGGCTGCPlastocyanin, chloroplast precursor. 
J065001A20AATGGGCTGCNONE 
J065019M17AATGGGCTGCNONE 
J065021H18AATGGGCTGCNONE 
J065061A17AATGGGCTGCNONE 
J065073L02AATGGGCTGCNONE 
J065099F17AATGGGCTGCNONE 
J065101C23AATGGGCTGCNONE 
J065121E23AATGGGCTGCNONE 
J065122N04AATGGGCTGCNONE 
J065141N05AATGGGCTGCNONE 
J065143N21AATGGGCTGCNONE 
J065161H09AATGGGCTGCNONE 
J065161J04AATGGGCTGCNONE 
J065162P20AATGGGCTGCNONE 
J065182K10AATGGGCTGCNONE 
J065184M05AATGGGCTGCNONE 
J065186H24AATGGGCTGCNONE 
J065189G21AATGGGCTGCNONE 
J065190N14AATGGGCTGCNONE 
J065191H08AATGGGCTGCNONE 
J065205H17AATGGGCTGCNONE 
J075001E03AATGGGCTGCNONE 
J075001H21AATGGGCTGCNONE 
J075003J23AATGGGCTGCNONE 
J075003K01AATGGGCTGCNONE 
J075005I11AATGGGCTGCNONE 
J075007F16AATGGGCTGCNONE 
J075017I11AATGGGCTGCNONE 
J075018O05AATGGGCTGCNONE 
J075019G24AATGGGCTGCNONE 
J075032D04AATGGGCTGCNONE 
J075032N13AATGGGCTGCNONE 
J075033C09AATGGGCTGCNONE 
J075033D11AATGGGCTGCNONE 
J075039A20AATGGGCTGCNONE 
J075058P12AATGGGCTGCNONE 
J075062E10AATGGGCTGCNONE 
J075062P16AATGGGCTGCNONE 
J075063C17AATGGGCTGCNONE 
J075066E07AATGGGCTGCNONE 
J075066I20AATGGGCTGCNONE 
J075075K21AATGGGCTGCNONE 
J075078F03AATGGGCTGCNONE 
J075082F10AATGGGCTGCNONE 
J075086G16AATGGGCTGCNONE 
J075087E07AATGGGCTGCNONE 
J075087K06AATGGGCTGCNONE 
J075087L04AATGGGCTGCNONE 
J075088B16AATGGGCTGCNONE 
J075088D02AATGGGCTGCNONE 
J075094H21AATGGGCTGCNONE 
J075094I24AATGGGCTGCNONE 
J075094K10AATGGGCTGCNONE 
J075095C18AATGGGCTGCNONE 
J075097B05AATGGGCTGCNONE 
J075099C13AATGGGCTGCNONE 
J075099H22AATGGGCTGCNONE 
J075099L16AATGGGCTGCNONE 
J075104K08AATGGGCTGCNONE 
J075118O06AATGGGCTGCNONE 
J075119E15AATGGGCTGCNONE 
J075124N06AATGGGCTGCNONE 
J075126G02AATGGGCTGCNONE 
J075127L24AATGGGCTGCNONE 
J075131E23AATGGGCTGCNONE 
J075140H06AATGGGCTGCNONE 
J075146I20AATGGGCTGCNONE 
J075146N24AATGGGCTGCNONE 
J075147I19AATGGGCTGCNONE 
J075155K07AATGGGCTGCNONE 
J075156C05AATGGGCTGCNONE 
J075161G07AATGGGCTGCNONE 
J075164G01AATGGGCTGCNONE 
J075170J18AATGGGCTGCNONE 
J075172G17AATGGGCTGCNONE 
J075176G10AATGGGCTGCNONE 
J075178C05AATGGGCTGCNONE 
J075179G01AATGGGCTGCNONE 
J075181E24AATGGGCTGCNONE 
J080029D19AATGGGCTGCNONE 
J080034L11AATGGGCTGCNONE 
J080039G07AATGGGCTGCNONE 
J080062M23AATGGGCTGCNONE 
J080302A01AATGGGCTGCNONE 
J100042I15AATGGGCTGCNONE 
J100043G22AATGGGCTGCNONE 
J100056L12AATGGGCTGCNONE 
J100061A12AATGGGCTGCNONE 
J100073O20AATGGGCTGCNONE 
J100082I08AATGGGCTGCNONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0137500AK072896ACAGCCCATGGGCBrix domain containing protein. 
AK121945ACAGCCCATGGGCNONE 
Os06g0167600AK067977CCAGCCCATAASimilar to Proteasome subunit alpha-3 (Fragment). 
J013123K20CCAGCCCATAANONE 
J033125P19CCAGCCCATAANONE 
J065002M08CCAGCCCATAANONE 
J065045C13CCAGCCCATAANONE 
J065045J07CCAGCCCATAANONE 
J065098M04CCAGCCCATAANONE 
J065110M02CCAGCCCATAANONE 
J065113H12CCAGCCCATAANONE 
J065214E15CCAGCCCATAANONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0194000006-041-H12CCAGCCCATATNONE 
006-077-B02CCAGCCCATATNONE 
013-029-A09CCAGCCCATATNONE 
AF190770CCAGCCCATATNONE 
AK060742CCAGCCCATATNONE 
AK069833CCAGCCCATATSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCAGCCCATATNONE 
J013060G01CCAGCCCATATNONE 
J013069I06CCAGCCCATATNONE 
J013134D15CCAGCCCATATNONE 
J013149A16CCAGCCCATATNONE 
J023031B06CCAGCCCATATNONE 
J023074E17CCAGCCCATATNONE 
J023091C14CCAGCCCATATNONE 
J023101P18CCAGCCCATATNONE 
J023106O14CCAGCCCATATNONE 
J023110J17CCAGCCCATATNONE 
J023110N02CCAGCCCATATNONE 
J023128D07CCAGCCCATATNONE 
J033024O19CCAGCCCATATNONE 
J033068G19CCAGCCCATATNONE 
J033095G01CCAGCCCATATNONE 
J033108C12CCAGCCCATATNONE 
J033114C23CCAGCCCATATNONE 
J043003E04CCAGCCCATATNONE 
J053023J03CCAGCCCATATNONE 
J053026B01CCAGCCCATATNONE 
J065172F15CCAGCCCATATNONE 
J075036K13CCAGCCCATATNONE 
J090020A10CCAGCCCATATNONE 
J090073E10CCAGCCCATATNONE 
J100034P18CCAGCCCATATNONE 
J100048O18CCAGCCCATATNONE 
J100064K09CCAGCCCATATNONE 
Os06g0304500AK119441CCAGCCCATTACRS1/YhbY domain containing protein. 
J075143M24CCAGCCCATTANONE 
J075194D03CCAGCCCATTANONE 
Os06g0494400AK067594ACAGCCCATCCMulti antimicrobial extrusion protein MatE family protein. 
Os06g0581300AK070987CCAGCCCATAProtein of unknown function DUF1475 family protein. 
AK070987CCAGCCCATTProtein of unknown function DUF1475 family protein. 
AK073185CCAGCCCATANONE 
AK073185CCAGCCCATTNONE 
J065209C10CCAGCCCATANONE 
J065209C10CCAGCCCATTNONE 
J075060B03CCAGCCCATANONE 
J075060B03CCAGCCCATTNONE 
J075117M08CCAGCCCATANONE 
J075117M08CCAGCCCATTNONE 
J075126E04CCAGCCCATANONE 
J075126E04CCAGCCCATTNONE 
J075189G04CCAGCCCATANONE 
J075189G04CCAGCCCATTNONE 
J075189L16CCAGCCCATANONE 
J075189L16CCAGCCCATTNONE 
J100061E16CCAGCCCATANONE 
J100061E16CCAGCCCATTNONE 
Os06g0600100AK065619ACAGCCCATCASimilar to TAT-binding protein homolog (Fragment). 
Os06g0607800012-010-G03AAATGGGCTGANONE 
AB070254AAATGGGCTGANONE 
AK063158AAATGGGCTGASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCTGANONE 
J013074G13AAATGGGCTGANONE 
J090015C16AAATGGGCTGANONE 
J090069H10AAATGGGCTGANONE 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
Os06g0638700AK108500ACAGCCCATGTPutative cyclase family protein. 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0681000009-105-G11AGATGGGCTGTNONE 
AK062780AGATGGGCTGTConserved hypothetical protein. 
J100021E01AGATGGGCTGTNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0702800009-039-E05ACAGCCCATAANONE 
AK073948ACAGCCCATAAHypothetical protein. 
J023108K23ACAGCCCATAANONE 
J033072H04ACAGCCCATAANONE 
J065008G05ACAGCCCATAANONE 
J065128J12ACAGCCCATAANONE 
J065131A01ACAGCCCATAANONE 
J065173B12ACAGCCCATAANONE 
Os06g0711600016-047-G09TCATGGGCTGGNONE 
AK064384TCATGGGCTGGmRNA splicing factor SYF2 family protein. 
AK102831TCATGGGCTGGNONE 
J013072P18TCATGGGCTGGNONE 
J023049G01TCATGGGCTGGNONE 
J023088I01TCATGGGCTGGNONE 
J033023I22TCATGGGCTGGNONE 
J033106I12TCATGGGCTGGNONE 
J033109G07TCATGGGCTGGNONE 
J065030F22TCATGGGCTGGNONE 
J065132H19TCATGGGCTGGNONE 
J080301D07TCATGGGCTGGNONE 
J080305C09TCATGGGCTGGNONE 
J080312C03TCATGGGCTGGNONE 
J080313I15TCATGGGCTGGNONE 
J080315B09TCATGGGCTGGNONE 
J090056N21TCATGGGCTGGNONE 
J100027B07TCATGGGCTGGNONE 
Os07g0106000015-044-D09TGATGGGCTGCNONE 
AK064319TGATGGGCTGCNONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0123300AK108490GCAGCCCATCAConserved hypothetical protein. 
J065197L01GCAGCCCATCANONE 
J065206N07GCAGCCCATCANONE 
J080011N05GCAGCCCATCANONE 
J080021N11GCAGCCCATCANONE 
J080025M24GCAGCCCATCANONE 
J080031E13GCAGCCCATCANONE 
J080047B07GCAGCCCATCANONE 
J080061L03GCAGCCCATCANONE 
J080062C18GCAGCCCATCANONE 
J080063E20GCAGCCCATCANONE 
J080063O12GCAGCCCATCANONE 
J080070D20GCAGCCCATCANONE 
J080074J17GCAGCCCATCANONE 
J080076K17GCAGCCCATCANONE 
J080079K21GCAGCCCATCANONE 
J080080D02GCAGCCCATCANONE 
J080088E12GCAGCCCATCANONE 
J080092I18GCAGCCCATCANONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0187300AK103069GCAGCCCATCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12GCAGCCCATCTNONE 
J033117P16GCAGCCCATCTNONE 
Os07g0242600AK065752CCCAGCCCATATCyclin-like F-box domain containing protein. 
AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22CCCAGCCCATATNONE 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0247000AK072232TCAGCCCATGPectinesterase inhibitor domain containing protein. 
AK099091TCAGCCCATGNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0418600006-074-A11AATGGGCTGGTGGGCNONE 
009-043-A03AATGGGCTGGTGGGCNONE 
013-024-A10AATGGGCTGGTGGGCNONE 
AK105956AATGGGCTGGTGGGCConserved hypothetical protein. 
J065107I10AATGGGCTGGTGGGCNONE 
J075110E12AATGGGCTGGTGGGCNONE 
Os07g0481100003-130-F04ACAGCCCATGTNONE 
AK062302ACAGCCCATGTProtein of unknown function DUF315 domain containing protein. 
J090048K21ACAGCCCATGTNONE 
Os07g0520400J065124A13AGATGGGCTGGConserved hypothetical protein. 
Os07g0543000AB110196TCAGCCCATTANONE 
AK058889TCAGCCCATTASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0549200006-072-D03TCAGCCCATTNONE 
AK073657TCAGCCCATTNONE 
AK109365TCAGCCCATTProtein prenyltransferase domain containing protein. 
J033051K19TCAGCCCATTNONE 
J100084G13TCAGCCCATTNONE 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0573800AK072835CCAGCCCATTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154CCAGCCCATTNONE 
AK104308CCAGCCCATTNONE 
AK107962CCAGCCCATTNONE 
J023134F17CCAGCCCATTNONE 
J043027A09CCAGCCCATTNONE 
Os07g0625500AK064628ATATGGGCTGASimilar to Fimbriata-associated protein (Fragment). 
AK064628TCAGCCCATTSimilar to Fimbriata-associated protein (Fragment). 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0649200AK072510AGATGGGCTGTConserved hypothetical protein. 
Os07g0688100AK101635ACAGCCCATCTProtein prenyltransferase domain containing protein. 
J033055B02ACAGCCCATCTNONE 
J090013O08ACAGCCCATCTNONE 
J090074A17ACAGCCCATCTNONE 
Os07g0691100AK071728TCATGGGCTGASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TCATGGGCTGANONE 
J023112F11TCATGGGCTGANONE 
J023143A10TCATGGGCTGANONE 
Os07g0691200AK060763ATATGGGCTGTNONE 
Os08g0100500006-093-G03ACAGCCCATTNONE 
AK109496ACAGCCCATTNONE 
J013097K15ACAGCCCATTNONE 
J023027K12ACAGCCCATTNONE 
J033046J03ACAGCCCATTNONE 
J075012A04ACAGCCCATTNONE 
J075056N17ACAGCCCATTNONE 
J075104O11ACAGCCCATTNONE 
J075177A17ACAGCCCATTNONE 
J090012E07ACAGCCCATTNONE 
J090054H18ACAGCCCATTNONE 
J090061K07ACAGCCCATTNONE 
Os08g0116800AK063695CCAGCCCATTExoribonuclease domain containing protein. 
Os08g0130500AK062008ATATGGGCTGGNONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0139000009-092-A05TCAGCCCATGANONE 
009-150-B08TCAGCCCATGANONE 
AK070704TCAGCCCATGANONE 
AK119802TCAGCCCATGASimilar to RNA-binding glycine rich protein (RGP-2). 
J023024E19TCAGCCCATGANONE 
J023056N10TCAGCCCATGANONE 
J065028B04TCAGCCCATGANONE 
J065119H20TCAGCCCATGANONE 
J065121E01TCAGCCCATGANONE 
J065139C18TCAGCCCATGANONE 
J065160O15TCAGCCCATGANONE 
J065211A15TCAGCCCATGANONE 
J090038G23TCAGCCCATGANONE 
J100024D11TCAGCCCATGANONE 
J100032C04TCAGCCCATGANONE 
J100038G14TCAGCCCATGANONE 
J100051E19TCAGCCCATGANONE 
Os08g0139100006-027-E12ACAGCCCATAANONE 
006-089-E06ACAGCCCATAANONE 
006-113-G02ACAGCCCATAANONE 
AK061429ACAGCCCATAANONE 
AK099590ACAGCCCATAASimilar to DAG protein, chloroplast precursor. 
AK104727ACAGCCCATAANONE 
J013043H11ACAGCCCATAANONE 
J013049N13ACAGCCCATAANONE 
J065079F01ACAGCCCATAANONE 
J065122N24ACAGCCCATAANONE 
J065142J24ACAGCCCATAANONE 
J065193N03ACAGCCCATAANONE 
J075041I21ACAGCCCATAANONE 
J075145E04ACAGCCCATAANONE 
Os08g0151400AK059440CCCAGCCCATCGSimilar to Small nuclear ribonucleoprotein homolog. 
Os08g0156900AJ605583ACAGCCCATCANONE 
AK073344ACAGCCCATCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397ACAGCCCATCANONE 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0230000014-096-F01ACAGCCCATTNONE 
AK067127ACAGCCCATTConserved hypothetical protein. 
J013096C05ACAGCCCATTNONE 
J100032D12ACAGCCCATTNONE 
Os08g0260600AK108529CCCAGCCCATGCCCATGTCD9/CD37/CD63 antigen family protein. 
Os08g0270200AK101221CCATGGGCTGGExosome-associated family protein. 
J090067H03CCATGGGCTGGNONE 
Os08g0322400AK120116TGGTGGGCTGCATGGGCTGCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20TGGTGGGCTGCATGGGCTGCNONE 
J013096J15TGGTGGGCTGCATGGGCTGCNONE 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0379000AK105647ACAGCCCATCCProtein prenyltransferase domain containing protein. 
Os08g0387200AK120787TAATGGGCTGCProtein of unknown function DUF81 family protein. 
Os08g0435800AK121712ACATGGGCTGGSimilar to Lipoate protein ligase-like protein. 
J065121P15ACATGGGCTGGNONE 
Os08g0468400011-057-F06GCAGCCCATACNONE 
AK063363GCAGCCCATACHEC/Ndc80p family protein. 
J100048N11GCAGCCCATACNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0485700AK068131TCAGCCCATATNONE 
AK069097TCAGCCCATATMethyl-CpG binding domain containing protein. 
J013130L03TCAGCCCATATNONE 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0496400AK110964ACAGCCCATTAConserved hypothetical protein. 
Os08g0511000AK107578AATGGGCTGAProtein prenyltransferase domain containing protein. 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0133600006-034-E08CCCAGCCCATCANONE 
AK061477CCCAGCCCATCAPAP fibrillin family protein. 
AK099394CCCAGCCCATCANONE 
AK104742CCCAGCCCATCANONE 
AY224474CCCAGCCCATCANONE 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0341500AK073913GCAGCCCATTTConserved hypothetical protein. 
J033076F19GCAGCCCATTTNONE 
J100085E04GCAGCCCATTTNONE 
Os09g0416200AK065807CCAGCCCATCCSimilar to Glucose transporter (Fragment). 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0532600J013002F02ACAGCCCATATNONE 
Os09g0559800AK071542AGATGGGCTGASimilar to Transporter-like protein. 
J013063N24AGATGGGCTGANONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0130500J065119D16ATATGGGCTGANONE 
J065169E14ATATGGGCTGACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TCAGCCCATATConserved hypothetical protein. 
J065192M10TCAGCCCATATNONE 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0145400009-117-C07ACAGCCCATCASimilar to Ubiquitin-like protein 5. 
009-189-E08ACAGCCCATCANONE 
J023127F18ACAGCCCATCANONE 
J065071G10ACAGCCCATCANONE 
J065118J21ACAGCCCATCANONE 
J065184P05ACAGCCCATCANONE 
J080301B06ACAGCCCATCANONE 
J080303C06ACAGCCCATCANONE 
J080304F18ACAGCCCATCANONE 
J080308D02ACAGCCCATCANONE 
J080309H09ACAGCCCATCANONE 
J080311O09ACAGCCCATCANONE 
J080311O15ACAGCCCATCANONE 
J080312N11ACAGCCCATCANONE 
J080313G04ACAGCCCATCANONE 
J080313I06ACAGCCCATCANONE 
J100077F22ACAGCCCATCANONE 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0169900006-048-A03AATGGGCTGGNONE 
006-066-G11AATGGGCTGGNONE 
006-117-D09AATGGGCTGGNONE 
009-188-B11AATGGGCTGGNONE 
AK105044AATGGGCTGGSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
AK121233AATGGGCTGGNONE 
D21104AATGGGCTGGNONE 
J013108B05AATGGGCTGGNONE 
J013118B15AATGGGCTGGNONE 
J023008C14AATGGGCTGGNONE 
J023024D08AATGGGCTGGNONE 
J023093E21AATGGGCTGGNONE 
J065024J08AATGGGCTGGNONE 
J065070G07AATGGGCTGGNONE 
J065103B06AATGGGCTGGNONE 
J080011O10AATGGGCTGGNONE 
J080012O15AATGGGCTGGNONE 
J080016F12AATGGGCTGGNONE 
J080022P11AATGGGCTGGNONE 
J080023C02AATGGGCTGGNONE 
J080024I11AATGGGCTGGNONE 
J080024L13AATGGGCTGGNONE 
J080034N23AATGGGCTGGNONE 
J080036D13AATGGGCTGGNONE 
J080036M18AATGGGCTGGNONE 
J080037G09AATGGGCTGGNONE 
J080037G12AATGGGCTGGNONE 
J080049K01AATGGGCTGGNONE 
J080052J04AATGGGCTGGNONE 
J080057A14AATGGGCTGGNONE 
J080068O21AATGGGCTGGNONE 
J080072A14AATGGGCTGGNONE 
J080077E17AATGGGCTGGNONE 
J080080D15AATGGGCTGGNONE 
J080080H12AATGGGCTGGNONE 
J080083C19AATGGGCTGGNONE 
J080084M21AATGGGCTGGNONE 
J080088A08AATGGGCTGGNONE 
J080090B13AATGGGCTGGNONE 
J080094B08AATGGGCTGGNONE 
J080094F23AATGGGCTGGNONE 
J080095N07AATGGGCTGGNONE 
J090050G07AATGGGCTGGNONE 
U27098AATGGGCTGGNONE 
Os11g0199600AK101774TCAGCCCATCAZinc finger, CCHC-type domain containing protein. 
AK120040TCAGCCCATCANONE 
J023047I06TCAGCCCATCANONE 
J033064L23TCAGCCCATCANONE 
J033117I01TCAGCCCATCANONE 
J033123I18TCAGCCCATCANONE 
J053026H17TCAGCCCATCANONE 
J053078G05TCAGCCCATCANONE 
J065102A09TCAGCCCATCANONE 
J065113G11TCAGCCCATCANONE 
J065207F20TCAGCCCATCANONE 
J075027K21TCAGCCCATCANONE 
Os11g0423200AK111297ACAGCCCATGGHypothetical protein. 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0616200AK069189ATATGGGCTGCConserved hypothetical protein. 
J023004N19ATATGGGCTGCNONE 
Os11g0634200AK066700CCATGGGCTGTConserved hypothetical protein. 
J013073J21CCATGGGCTGTNONE 
Os11g0657200AK059959ACAGCCCATTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAATGGGCTGTNONE 
AK062752AAATGGGCTGTSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0127500AK064595TCAGCCCATATConserved hypothetical protein. 
J065067F11TCAGCCCATATNONE 
J090007D02TCAGCCCATATNONE 
J100035G10TCAGCCCATATNONE 
J100077J10TCAGCCCATATNONE 
Os12g0154000AK101335GGATGGGCTGGNONE 
AK105118GGATGGGCTGGProtein of unknown function DUF250 domain containing protein. 
Os12g0190100AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0488800015-085-F11AAATGGGCTGTNONE 
AK064347AAATGGGCTGTRNA polymerase II, RPB4 domain containing protein. 
J033065H11AAATGGGCTGTNONE 
J033145P10AAATGGGCTGTNONE 
J065137L04AAATGGGCTGTNONE 
J065171P08AAATGGGCTGTNONE 
Os12g0554400AK072345CCCAGCCCATCCTetratricopeptide-like helical domain containing protein. 
Os12g0556100J065083C21ACAGCCCATAADrought induced 19 family protein. 
J065124M18ACAGCCCATAANONE 
J100032P22ACAGCCCATAANONE 
J100048N01ACAGCCCATAANONE 
Os12g0595800AK072425TCAGCCCATTNONE 
AK101874TCAGCCCATTNONE 
Os12g0597500AK101904CCAGCCCATGGGCCTCNONE 
AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCAGCCCATGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCAGCCCATGGGCCTCNONE 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCAGCCCATGGGCCTCNONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0609800AK101303ACAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
AK101303AGATGGGCTGGGCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01ACAGCCCATCANONE 
J033032I01AGATGGGCTGGGNONE 
J033033K21ACAGCCCATCANONE 
J033033K21AGATGGGCTGGGNONE 
J033082L13ACAGCCCATCANONE 
J033082L13AGATGGGCTGGGNONE 
J043034M20ACAGCCCATCANONE 
J043034M20AGATGGGCTGGGNONE 
J065137J24ACAGCCCATCANONE 
J065137J24AGATGGGCTGGGNONE 
J065141A11ACAGCCCATCANONE 
J065141A11AGATGGGCTGGGNONE 
J065217H09ACAGCCCATCANONE 
J065217H09AGATGGGCTGGGNONE 
Os12g0630600J100033A04GCAGCCCATCTConserved hypothetical protein. 
Os12g0636600AK111056GGATGGGCTGAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.