version

Summary of OsREG492 (All List)

OrganismOryza sativa  
IDOsREG492  
SequenceATTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2647  

Entry Sequences (2647 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
Os01g0164500AK068747CACGGCCCAATSimilar to ATP-dependent RNA helicase-like protein. 
AK103737CACGGCCCAATNONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0221300011-021-E12AAGGCCCAATTNONE 
AK073330AAGGCCCAATTConserved hypothetical protein. 
J013130J18AAGGCCCAATTNONE 
J033024A12AAGGCCCAATTNONE 
J065063H09AAGGCCCAATTNONE 
J065093G05AAGGCCCAATTNONE 
J090007K12AAGGCCCAATTNONE 
Os01g0250600J075046P13CAGGCCCAATANONE 
Os01g0270100006-096-H09ATGGCCCAATANONE 
009-009-C10ATGGCCCAATANONE 
009-054-E06ATGGCCCAATANONE 
014-085-F09ATGGCCCAATANONE 
AK073275ATGGCCCAATANONE 
AK104155ATGGCCCAATANONE 
AK119511ATGGCCCAATASimilar to Cysteine protease inhibitor. 
J033025K21ATGGCCCAATANONE 
J075065H10ATGGCCCAATANONE 
J075143G10ATGGCCCAATANONE 
J100059J02ATGGCCCAATANONE 
Os01g0295900J065076G19AAGGCCCAATNONE 
Os01g0301100AK105556AATTGGGCCGAConserved hypothetical protein. 
AK105556ATGGCCCAATConserved hypothetical protein. 
Os01g0306100AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0327600AK120216TCTGGCCCAATNONE 
AK121799TCTGGCCCAATConserved hypothetical protein. 
J065081I07TCTGGCCCAATNONE 
J065082D04TCTGGCCCAATNONE 
J065082G10TCTGGCCCAATNONE 
J065085G24TCTGGCCCAATNONE 
J065105J24TCTGGCCCAATNONE 
J065128D18TCTGGCCCAATNONE 
J065155D13TCTGGCCCAATNONE 
J065200C11TCTGGCCCAATNONE 
Os01g0328400006-092-H09GCGGCCCAATANONE 
009-085-A02GCGGCCCAATANONE 
012-078-B03GCGGCCCAATANONE 
AK061988GCGGCCCAATAUbiquitin. 
J013073B13GCGGCCCAATANONE 
J023135L09GCGGCCCAATANONE 
J023135O07GCGGCCCAATANONE 
J033027B12GCGGCCCAATANONE 
J033084P17GCGGCCCAATANONE 
J065010M05GCGGCCCAATANONE 
J065021N11GCGGCCCAATANONE 
J065021N12GCGGCCCAATANONE 
J065031K11GCGGCCCAATANONE 
J065072P04GCGGCCCAATANONE 
J065098D05GCGGCCCAATANONE 
J065122N23GCGGCCCAATANONE 
J065129L13GCGGCCCAATANONE 
J065135N13GCGGCCCAATANONE 
J065215N10GCGGCCCAATANONE 
J075120N22GCGGCCCAATANONE 
J090011G23GCGGCCCAATANONE 
J090014F06GCGGCCCAATANONE 
J090040G23GCGGCCCAATANONE 
J090075I20GCGGCCCAATANONE 
J090075N01GCGGCCCAATANONE 
J090089B04GCGGCCCAATANONE 
J090090F08GCGGCCCAATANONE 
J090091M17GCGGCCCAATANONE 
J090094L03GCGGCCCAATANONE 
J090099L06GCGGCCCAATANONE 
J100018A18GCGGCCCAATANONE 
J100027H13GCGGCCCAATANONE 
J100069C05GCGGCCCAATANONE 
J100086L10GCGGCCCAATANONE 
Os01g0342900011-017-G10GCGGCCCAATNONE 
AK063921GCGGCCCAATSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
J033050H23GCGGCCCAATNONE 
J065097A19GCGGCCCAATNONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
Os01g0558500AK099982GCGGCCCAATPWWP domain containing protein. 
J065096J12GCGGCCCAATNONE 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0591300AK101427AATTGGGCCAASimilar to Cytosolic aldehyde dehydrogenase RF2D. 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0621700AK108938AATTGGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AATTGGGCCCAAANONE 
Os01g0649000AK073564TCTGGCCCAATWD40-like domain containing protein. 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0688200AK120982ACTGGGCCCAATAlpha/beta hydrolase family protein. 
Os01g0692100J043022J20GTGGCCCAATGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22GTGGCCCAATNONE 
Os01g0710000AK111794TTGGCCCAATASimilar to WD-repeat protein RBAP1. 
J023006D22TTGGCCCAATANONE 
J065106P04TTGGCCCAATANONE 
J100036G13TTGGCCCAATANONE 
Os01g0737900012-087-D12AAGGCCCATTGGGCCTTNONE 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
J023006E12AAGGCCCATTGGGCCTTNONE 
J023130A18AAGGCCCATTGGGCCTTNONE 
J023134O05AAGGCCCATTGGGCCTTNONE 
Os01g0748100AK071261AATTGGGCCATHypothetical protein. 
J023084C08AATTGGGCCATNONE 
J065058A07AATTGGGCCATNONE 
Os01g0805800006-057-H04CAAGGCCCAATNONE 
006-106-H01CAAGGCCCAATNONE 
AK059963CAAGGCCCAATNONE 
AK103408CAAGGCCCAATRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
015-005-A04TACGGCCCAATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK073951TACGGCCCAATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK103171TACGGCCCAATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J023031A22TACGGCCCAATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033098N09TACGGCCCAATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J033121G11TACGGCCCAATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
J090030L03TACGGCCCAATTNONE 
Os01g0853700AK111988CAAGGCCCAATSimilar to MCB1 protein. 
J075050N16CAAGGCCCAATNONE 
J075117H23CAAGGCCCAATNONE 
Os01g0853800006-033-H02TCAGGCCCAATTNONE 
006-037-A10TCAGGCCCAATTNONE 
006-038-F10TCAGGCCCAATTNONE 
006-054-E01TCAGGCCCAATTNONE 
006-067-E10TCAGGCCCAATTNONE 
012-015-G05TCAGGCCCAATTNONE 
AK069147TCAGGCCCAATTC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929TCAGGCCCAATTNONE 
AK106144TCAGGCCCAATTNONE 
AK106186TCAGGCCCAATTNONE 
J023007P09TCAGGCCCAATTNONE 
J023007P10TCAGGCCCAATTNONE 
J065084L10TCAGGCCCAATTNONE 
J065179B10TCAGGCCCAATTNONE 
J065186D16TCAGGCCCAATTNONE 
J075040I08TCAGGCCCAATTNONE 
J075043K21TCAGGCCCAATTNONE 
J075051J08TCAGGCCCAATTNONE 
J075061D24TCAGGCCCAATTNONE 
J075095H04TCAGGCCCAATTNONE 
J075145J12TCAGGCCCAATTNONE 
J075148O18TCAGGCCCAATTNONE 
J075187J05TCAGGCCCAATTNONE 
J090042A20TCAGGCCCAATTNONE 
J100025K01TCAGGCCCAATTNONE 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0911100AK062123ATGGCCCAATTNONE 
J013000B12ATGGCCCAATTNONE 
J013071L21ATGGCCCAATTNONE 
J013072J22ATGGCCCAATTNONE 
J065152F12ATGGCCCAATTNONE 
J065191K04ATGGCCCAATTNONE 
J100034F15ATGGCCCAATTNONE 
J100035A02ATGGCCCAATTNONE 
J100040O20ATGGCCCAATTNONE 
J100045D02ATGGCCCAATTNONE 
J100070A17ATGGCCCAATTNONE 
J100089B06ATGGCCCAATTNONE 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TACGGCCCAATANONE 
J090056H03TACGGCCCAATANONE 
J090058L14TACGGCCCAATANONE 
J090058P16TACGGCCCAATANONE 
J090076C19TACGGCCCAATANONE 
J100086P14TACGGCCCAATANONE 
Os01g0916700Os01g0916700ATTGGGCCATTGGGCCACConserved hypothetical protein. 
Os01g0919900006-027-D02ATTGGGCCAGANONE 
009-156-F01ATTGGGCCAGANONE 
AK060087ATTGGGCCAGANONE 
Os01g0920400016-005-B10AATTGGGCCTANONE 
AK073965AATTGGGCCTASimilar to Dynamin-related protein 3A (Dynamin-like protein 2) (Dynamin-like protein 2a). Splice isoform 2. 
J013023K02AATTGGGCCTANONE 
J023008G04AATTGGGCCTANONE 
J033072A13AATTGGGCCTANONE 
J033106F08AATTGGGCCTANONE 
J043009F23AATTGGGCCTANONE 
J043027F03AATTGGGCCTANONE 
J065009O17AATTGGGCCTANONE 
J065046M03AATTGGGCCTANONE 
J065051H14AATTGGGCCTANONE 
J065077G12AATTGGGCCTANONE 
J065082M20AATTGGGCCTANONE 
J065087O20AATTGGGCCTANONE 
J065123N10AATTGGGCCTANONE 
J065124O16AATTGGGCCTANONE 
J065163P15AATTGGGCCTANONE 
J065166D19AATTGGGCCTANONE 
J065212C15AATTGGGCCTANONE 
J065219F23AATTGGGCCTANONE 
J075068F08AATTGGGCCTANONE 
J075139J12AATTGGGCCTANONE 
J075196K05AATTGGGCCTANONE 
J090050D18AATTGGGCCTANONE 
J090099H08AATTGGGCCTANONE 
J100029L12AATTGGGCCTANONE 
J100044C19AATTGGGCCTANONE 
J100056L03AATTGGGCCTANONE 
J100078E23AATTGGGCCTANONE 
J100087E19AATTGGGCCTANONE 
Os01g0945300003-104-D07TATTGGGCCTANONE 
AK065371TATTGGGCCTAAmino acid/polyamine transporter I family protein. 
AK072189TATTGGGCCTANONE 
J013023D09TATTGGGCCTANONE 
J013055J18TATTGGGCCTANONE 
J013146P21TATTGGGCCTANONE 
J075109G14TATTGGGCCTANONE 
J075158O19TATTGGGCCTANONE 
Os01g0949700AK069037GCCCGGCCCAATNONE 
J023004F17GCCCGGCCCAATNONE 
J065063D04GCCCGGCCCAATNONE 
J065196H02GCCCGGCCCAATNONE 
J075198A05GCCCGGCCCAATNONE 
Os01g0970900011-018-A07ATTGGGCCTANONE 
011-022-E12ATTGGGCCTANONE 
AK063285ATTGGGCCTANONE 
AK101688ATTGGGCCTAProtein prenyltransferase domain containing protein. 
J100042L01ATTGGGCCTANONE 
J100053B11ATTGGGCCTANONE 
Os01g0976600AK072971GTGGCCCAATSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GTGGCCCAATNONE 
J075095H03GTGGCCCAATNONE 
J090089M19GTGGCCCAATNONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
009-031-C12TAGGCCCAATANONE 
AK062502ATTGGGCCCATCCANONE 
AK062502TAGGCCCAATANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
AK102186TAGGCCCAATASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J033086N17TAGGCCCAATANONE 
J065161I07ATTGGGCCCATCCANONE 
J065161I07TAGGCCCAATANONE 
J065184G15ATTGGGCCCATCCANONE 
J065184G15TAGGCCCAATANONE 
J075123E02ATTGGGCCCATCCANONE 
J075123E02TAGGCCCAATANONE 
Os02g0116900009-017-C02GCCGGCCCAATNONE 
AK121401GCCGGCCCAATSimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09GCCGGCCCAATNONE 
J023131N03GCCGGCCCAATNONE 
J033145N08GCCGGCCCAATNONE 
J065105G09GCCGGCCCAATNONE 
J075086L06GCCGGCCCAATNONE 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0162500009-181-F03ACCGGCCCAATTNONE 
AK058907ACCGGCCCAATTNONE 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
J023090I10ACCGGCCCAATTNONE 
J023136J11ACCGGCCCAATTNONE 
J053097J20ACCGGCCCAATTNONE 
J053098F01ACCGGCCCAATTNONE 
J065065B09ACCGGCCCAATTNONE 
J065082M04ACCGGCCCAATTNONE 
J065188O05ACCGGCCCAATTNONE 
J075057P15ACCGGCCCAATTNONE 
J075061J08ACCGGCCCAATTNONE 
J075061N15ACCGGCCCAATTNONE 
J075131I08ACCGGCCCAATTNONE 
J075141H13ACCGGCCCAATTNONE 
J080062E14ACCGGCCCAATTNONE 
J080062P15ACCGGCCCAATTNONE 
J080318G17ACCGGCCCAATTNONE 
J080319G19ACCGGCCCAATTNONE 
J090001L10ACCGGCCCAATTNONE 
J090024I18ACCGGCCCAATTNONE 
J090033F24ACCGGCCCAATTNONE 
J090036M16ACCGGCCCAATTNONE 
J090040I24ACCGGCCCAATTNONE 
J090048P06ACCGGCCCAATTNONE 
J090049B12ACCGGCCCAATTNONE 
J090068C02ACCGGCCCAATTNONE 
J090069O04ACCGGCCCAATTNONE 
J090084H22ACCGGCCCAATTNONE 
J100022L03ACCGGCCCAATTNONE 
J100028O14ACCGGCCCAATTNONE 
J100028O18ACCGGCCCAATTNONE 
J100032A15ACCGGCCCAATTNONE 
J100033D21ACCGGCCCAATTNONE 
J100034J23ACCGGCCCAATTNONE 
J100043K22ACCGGCCCAATTNONE 
J100052M22ACCGGCCCAATTNONE 
J100053N03ACCGGCCCAATTNONE 
J100074N24ACCGGCCCAATTNONE 
J100082J10ACCGGCCCAATTNONE 
Os02g0194000015-020-A08GGTTGGGCCCAATNONE 
AK064096GGTTGGGCCCAATMyb, DNA-binding domain containing protein. 
J090092L06GGTTGGGCCCAATNONE 
Os02g0215950J090051K07ATTGGGCCCTConserved hypothetical protein. 
Os02g0219200016-016-C03AATTGGGCCGCANONE 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-009-H04ATTGGGCCATNONE 
009-165-G06AATTGGGCCCATCCANONE 
009-165-G06ATTGGGCCATNONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
AK120417ATTGGGCCATSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J013093C14ATTGGGCCATNONE 
J023106P11AATTGGGCCCATCCANONE 
J023106P11ATTGGGCCATNONE 
J033080L09AATTGGGCCCATCCANONE 
J033080L09ATTGGGCCATNONE 
J033123O05AATTGGGCCCATCCANONE 
J033123O05ATTGGGCCATNONE 
J065197A18AATTGGGCCCATCCANONE 
J065197A18ATTGGGCCATNONE 
J065216P16AATTGGGCCCATCCANONE 
J065216P16ATTGGGCCATNONE 
J075017F02AATTGGGCCCATCCANONE 
J075017F02ATTGGGCCATNONE 
J075025L16AATTGGGCCCATCCANONE 
J075025L16ATTGGGCCATNONE 
J075027P04AATTGGGCCCATCCANONE 
J075027P04ATTGGGCCATNONE 
J075039N01AATTGGGCCCATCCANONE 
J075039N01ATTGGGCCATNONE 
J075101F24AATTGGGCCCATCCANONE 
J075101F24ATTGGGCCATNONE 
J075132J15AATTGGGCCCATCCANONE 
J075132J15ATTGGGCCATNONE 
J075164K16AATTGGGCCCATCCANONE 
J075164K16ATTGGGCCATNONE 
J075174E19AATTGGGCCCATCCANONE 
J075174E19ATTGGGCCATNONE 
J100043C23AATTGGGCCCATCCANONE 
J100043C23ATTGGGCCATNONE 
J100067B11AATTGGGCCCATCCANONE 
J100067B11ATTGGGCCATNONE 
Os02g0236100AK120541AAGGCCCAATTSimilar to SERK1 (Fragment). 
Os02g0252100AF139211TATTGGGCCTGANONE 
AK062577TATTGGGCCTGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TATTGGGCCTGANONE 
J013156E01TATTGGGCCTGANONE 
J065001D02TATTGGGCCTGANONE 
J065042A05TATTGGGCCTGANONE 
J065116H01TATTGGGCCTGANONE 
J065167P13TATTGGGCCTGANONE 
J065168N07TATTGGGCCTGANONE 
J075093G21TATTGGGCCTGANONE 
J075109H15TATTGGGCCTGANONE 
J075194P17TATTGGGCCTGANONE 
Os02g0289700009-196-H06GTGGCCCAATANONE 
009-196-H06GTGGCCCAATAGTGTGGGCNONE 
014-005-D09GTGGCCCAATANONE 
014-005-D09GTGGCCCAATAGTGTGGGCNONE 
AK063231GTGGCCCAATASimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
AK063231GTGGCCCAATAGTGTGGGCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein. 
J065115K07ATTGGGCCACGTGGCGNONE 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0606900J023065M01TAGGCCCAATANONE 
J075046E14TAGGCCCAATANONE 
Os02g0614400016-088-D04ACCGGGCCCAATNONE 
AK071805ACCGGGCCCAATConserved hypothetical protein. 
J023108N22ACCGGGCCCAATNONE 
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor. 
J033106C08ATTGGGCCGGTNONE 
J065053G20ATTGGGCCGGTNONE 
J065114P06ATTGGGCCGGTNONE 
J065174H18ATTGGGCCGGTNONE 
J065183J04ATTGGGCCGGTNONE 
J080310C15ATTGGGCCGGTNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0638400AK060633AATTGGGCCAGABRO1 domain containing protein. 
J065083J17AATTGGGCCAGANONE 
Os02g0655700AK101068AATTGGGCCATAmino acid/polyamine transporter I family protein. 
J013026C06AATTGGGCCATNONE 
J033023I17AATTGGGCCATNONE 
Os02g0670400009-189-H11AAGGCCCAATANONE 
AB079636AAGGCCCAATASimilar to HMGc1 protein. 
J090001B08AAGGCCCAATANONE 
Os02g0672600AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TATTGGGCCCGCNONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
J065019B06TACGGCCCAATTNONE 
J065065L01TACGGCCCAATTNONE 
Os02g0688900AK066093AAGGCCCAATGPI transamidase subunit PIG-U family protein. 
J065007D18AAGGCCCAATNONE 
J065040G21AAGGCCCAATNONE 
J065103G03AAGGCCCAATNONE 
J065175F18AAGGCCCAATNONE 
J065202A07AAGGCCCAATNONE 
J075006C01AAGGCCCAATNONE 
J075178F24AAGGCCCAATNONE 
Os02g0697200015-013-B10ATTGGGCCACNONE 
AK059475ATTGGGCCACNONE 
AK102993ATTGGGCCACConserved hypothetical protein. 
J033079I18ATTGGGCCACNONE 
J033082A14ATTGGGCCACNONE 
J065047H08ATTGGGCCACNONE 
J065131M14ATTGGGCCACNONE 
Os02g0725200005-020-F05AAGGCCCAATANONE 
AK058309AAGGCCCAATANONE 
AK103602AAGGCCCAATARubisco methyltransferase family protein. 
J013109C13AAGGCCCAATANONE 
J033133G01AAGGCCCAATANONE 
J075087L23AAGGCCCAATANONE 
J090073J10AAGGCCCAATANONE 
Os02g0727400AK068514TATTGGGCCTTConserved hypothetical protein. 
Os02g0727500009-018-G06CACGGCCCAATTNONE 
AK121427CACGGCCCAATTConserved hypothetical protein. 
J023136B21CACGGCCCAATTNONE 
J033044C13CACGGCCCAATTNONE 
J043037O12CACGGCCCAATTNONE 
J053072C14CACGGCCCAATTNONE 
J065008B15CACGGCCCAATTNONE 
J065033I12CACGGCCCAATTNONE 
J065077I18CACGGCCCAATTNONE 
J065149G03CACGGCCCAATTNONE 
J065159H07CACGGCCCAATTNONE 
J065162I17CACGGCCCAATTNONE 
J065168H02CACGGCCCAATTNONE 
J065176N09CACGGCCCAATTNONE 
J065178K23CACGGCCCAATTNONE 
J065216N03CACGGCCCAATTNONE 
J080001G08CACGGCCCAATTNONE 
J080002C09CACGGCCCAATTNONE 
J080007N17CACGGCCCAATTNONE 
J080009B04CACGGCCCAATTNONE 
J080009B17CACGGCCCAATTNONE 
J080011O15CACGGCCCAATTNONE 
J080022B06CACGGCCCAATTNONE 
J080022C13CACGGCCCAATTNONE 
J080024L04CACGGCCCAATTNONE 
J080031G21CACGGCCCAATTNONE 
J080035N14CACGGCCCAATTNONE 
J080036O14CACGGCCCAATTNONE 
J080040P10CACGGCCCAATTNONE 
J080042D03CACGGCCCAATTNONE 
J080042H05CACGGCCCAATTNONE 
J080042I20CACGGCCCAATTNONE 
J080043A01CACGGCCCAATTNONE 
J080043F17CACGGCCCAATTNONE 
J080046I19CACGGCCCAATTNONE 
J080053L20CACGGCCCAATTNONE 
J080055A20CACGGCCCAATTNONE 
J080055F01CACGGCCCAATTNONE 
J080056L02CACGGCCCAATTNONE 
J080058H02CACGGCCCAATTNONE 
J080059F11CACGGCCCAATTNONE 
J080062C03CACGGCCCAATTNONE 
J080064A07CACGGCCCAATTNONE 
J080064K15CACGGCCCAATTNONE 
J080067M17CACGGCCCAATTNONE 
J080067N17CACGGCCCAATTNONE 
J080068G07CACGGCCCAATTNONE 
J080069H15CACGGCCCAATTNONE 
J080069L08CACGGCCCAATTNONE 
J080069L20CACGGCCCAATTNONE 
J080069L21CACGGCCCAATTNONE 
J080069N20CACGGCCCAATTNONE 
J080071N24CACGGCCCAATTNONE 
J080074K17CACGGCCCAATTNONE 
J080076H08CACGGCCCAATTNONE 
J080082F19CACGGCCCAATTNONE 
J080086O16CACGGCCCAATTNONE 
J090025A19CACGGCCCAATTNONE 
J090025M06CACGGCCCAATTNONE 
J090070D02CACGGCCCAATTNONE 
Os02g0731700AK072346AATTGGGCCCCASimilar to CONSTANS-like 1 protein. 
AK120314AATTGGGCCCCANONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0754700AK066904TTGGCCCAATASimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TTGGCCCAATANONE 
Os02g0767100011-054-E05AATTGGGCCCGNONE 
AK063351AATTGGGCCCGNONE 
AK103640AATTGGGCCCGConserved hypothetical protein. 
J090022G11AATTGGGCCCGNONE 
J090072L18AATTGGGCCCGNONE 
Os02g0772500AK100349GAGGCCCAATAProtein prenyltransferase domain containing protein. 
J023082M21GAGGCCCAATANONE 
J065047H11GAGGCCCAATANONE 
J065055F20GAGGCCCAATANONE 
J065082I22GAGGCCCAATANONE 
J100074B04GAGGCCCAATANONE 
Os02g0782500013-043-A07TTCGGCCCAATNONE 
013-068-B10TTCGGCCCAATNONE 
013-093-A08TTCGGCCCAATNONE 
014-083-C12TTCGGCCCAATNONE 
AK063602TTCGGCCCAATNONE 
AK119261TTCGGCCCAATSimilar to Small heat stress protein class CIII. 
J065013N12TTCGGCCCAATNONE 
J075136E01TTCGGCCCAATNONE 
J075149G04TTCGGCCCAATNONE 
Os02g0788400AK060351TAGGCCCAATANONE 
AK103497TAGGCCCAATASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0794400AK065845ATTGGGCCTTInitiation factor 3 family protein. 
J013042M03ATTGGGCCTTNONE 
Os02g0800000J100043O08TATTGGGCCTGNONE 
J100064O18TATTGGGCCTGNONE 
Os02g0814800AK109850TATTGGGCCTGGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19CCCGGCCCAATTNONE 
J043022H19CCCGGCCCAATTNONE 
J065008L14CCCGGCCCAATTNONE 
J065016G09CCCGGCCCAATTNONE 
J065023C22CCCGGCCCAATTNONE 
J065024K13CCCGGCCCAATTNONE 
J065043D14CCCGGCCCAATTNONE 
J065052K16CCCGGCCCAATTNONE 
J065058D17CCCGGCCCAATTNONE 
J065087L03CCCGGCCCAATTNONE 
J065107H15CCCGGCCCAATTNONE 
J065110E12CCCGGCCCAATTNONE 
J065124P14CCCGGCCCAATTNONE 
J065131B20CCCGGCCCAATTNONE 
J065155I10CCCGGCCCAATTNONE 
J065172J02CCCGGCCCAATTNONE 
J065184D04CCCGGCCCAATTNONE 
J065189D21CCCGGCCCAATTNONE 
J065201O14CCCGGCCCAATTNONE 
J065203D20CCCGGCCCAATTNONE 
J065206M13CCCGGCCCAATTNONE 
J065211E14CCCGGCCCAATTNONE 
J065217J21CCCGGCCCAATTNONE 
J090004A20CCCGGCCCAATTNONE 
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE 
009-132-E07GAGGCCCAATTNONE 
AK059572AGTTGGGCCCAATTConserved hypothetical protein. 
AK059572GAGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCCAACTNONE 
013-089-A09AATTGGGCCTCNONE 
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein. 
AK102271AATTGGGCCTCNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCCAACTNONE 
J013105O04AATTGGGCCTCNONE 
J013124I08AATTGGGCCCAACTNONE 
J013124I08AATTGGGCCTCNONE 
J023002E08AATTGGGCCCAACTNONE 
J023002E08AATTGGGCCTCNONE 
J023025C01AATTGGGCCCAACTNONE 
J023025C01AATTGGGCCTCNONE 
J023037O12AATTGGGCCCAACTNONE 
J023037O12AATTGGGCCTCNONE 
J023049N06AATTGGGCCCAACTNONE 
J023049N06AATTGGGCCTCNONE 
J023069G18AATTGGGCCCAACTNONE 
J023069G18AATTGGGCCTCNONE 
J033029M02AATTGGGCCCAACTNONE 
J033029M02AATTGGGCCTCNONE 
J033037L22AATTGGGCCCAACTNONE 
J033037L22AATTGGGCCTCNONE 
J033089A08AATTGGGCCCAACTNONE 
J033089A08AATTGGGCCTCNONE 
J033103L07AATTGGGCCCAACTNONE 
J033103L07AATTGGGCCTCNONE 
J033125L19AATTGGGCCCAACTNONE 
J033125L19AATTGGGCCTCNONE 
J090008N20AATTGGGCCCAACTNONE 
J090008N20AATTGGGCCTCNONE 
J090041F23AATTGGGCCCAACTNONE 
J090041F23AATTGGGCCTCNONE 
J090092H16AATTGGGCCCAACTNONE 
J090092H16AATTGGGCCTCNONE 
Os02g0819100AK100156TAGGCCCAATAZinc finger, DHHC-type domain containing protein. 
J013088C21TAGGCCCAATANONE 
Os02g0819700AK067374AGGGCCCAATTZinc finger, Zim17-type family protein. 
AK067374TAGGCCCAATTZinc finger, Zim17-type family protein. 
AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160AGGGCCCAATTNONE 
AK099160TAGGCCCAATTNONE 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17AGGGCCCAATTNONE 
J100086K17TAGGCCCAATTNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0824400AK121390GAGGCCCAATTConserved hypothetical protein. 
J023128P21GAGGCCCAATTNONE 
J053097O16GAGGCCCAATTNONE 
J065012I02GAGGCCCAATTNONE 
J065049C06GAGGCCCAATTNONE 
J065051H02GAGGCCCAATTNONE 
J065069A13GAGGCCCAATTNONE 
J065082E04GAGGCCCAATTNONE 
J065102N09GAGGCCCAATTNONE 
J065157O10GAGGCCCAATTNONE 
J065188N23GAGGCCCAATTNONE 
J065190J11GAGGCCCAATTNONE 
J065202M09GAGGCCCAATTNONE 
Os02g0824700009-023-E06AATTGGGCCGCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18AATTGGGCCGCNONE 
J065017H21AATTGGGCCGCNONE 
J065052N02AATTGGGCCGCNONE 
J065053M01AATTGGGCCGCNONE 
J065064B14AATTGGGCCGCNONE 
J065146K22AATTGGGCCGCNONE 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0116500AF106844GCCGGCCCAATANONE 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
J023055L16GCCGGCCCAATANONE 
J023088I16GCCGGCCCAATANONE 
J033070E21GCCGGCCCAATANONE 
J065124N22GCCGGCCCAATANONE 
J075152A19GCCGGCCCAATANONE 
J075181J21GCCGGCCCAATANONE 
J090011F23GCCGGCCCAATANONE 
Os03g0117100005-014-F09GAGGCCCAATANONE 
006-027-C07GAGGCCCAATANONE 
006-036-G11GAGGCCCAATANONE 
006-038-H10GAGGCCCAATANONE 
006-044-D08GAGGCCCAATANONE 
006-105-H12GAGGCCCAATANONE 
009-190-G08GAGGCCCAATANONE 
AK070213GAGGCCCAATAPeroxisomal biogenesis factor 11 family protein. 
AK104570GAGGCCCAATANONE 
AK104706GAGGCCCAATANONE 
J013055H24GAGGCCCAATANONE 
J023044I05GAGGCCCAATANONE 
J075111G05GAGGCCCAATANONE 
J080002K23GAGGCCCAATANONE 
J080002N12GAGGCCCAATANONE 
J080004B01GAGGCCCAATANONE 
J080007H19GAGGCCCAATANONE 
J080008M18GAGGCCCAATANONE 
J080011D18GAGGCCCAATANONE 
J080012J01GAGGCCCAATANONE 
J080018C19GAGGCCCAATANONE 
J080022C20GAGGCCCAATANONE 
J080022I05GAGGCCCAATANONE 
J080022M12GAGGCCCAATANONE 
J080023P03GAGGCCCAATANONE 
J080025A05GAGGCCCAATANONE 
J080029C02GAGGCCCAATANONE 
J080036H08GAGGCCCAATANONE 
J080039P12GAGGCCCAATANONE 
J080040H05GAGGCCCAATANONE 
J080045I23GAGGCCCAATANONE 
J080057O04GAGGCCCAATANONE 
J080059K18GAGGCCCAATANONE 
J080061E04GAGGCCCAATANONE 
J080062C20GAGGCCCAATANONE 
J080062F10GAGGCCCAATANONE 
J080062L05GAGGCCCAATANONE 
J080068L06GAGGCCCAATANONE 
J080069N09GAGGCCCAATANONE 
J080071M14GAGGCCCAATANONE 
J080072K17GAGGCCCAATANONE 
J080080A09GAGGCCCAATANONE 
J080086A18GAGGCCCAATANONE 
J080088O14GAGGCCCAATANONE 
J080089O04GAGGCCCAATANONE 
J080092G21GAGGCCCAATANONE 
J080094K09GAGGCCCAATANONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
Os03g0195900J065063O15ATTGGGCCCGNONE 
Os03g0198400AK059522ATTGGGCCTCNONE 
AK103101ATTGGGCCTCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19ATTGGGCCTCNONE 
J075036K08ATTGGGCCTCNONE 
J075040J23ATTGGGCCTCNONE 
J075041H18ATTGGGCCTCNONE 
J075053H18ATTGGGCCTCNONE 
J075055K15ATTGGGCCTCNONE 
J075111K03ATTGGGCCTCNONE 
J075125B22ATTGGGCCTCNONE 
J075195L10ATTGGGCCTCNONE 
Os03g0204900009-041-G04GCCGGCCCAATANONE 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0210400AK065966ATTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0219200011-045-E01GCGGCCCAATTNONE 
AK073785GCGGCCCAATTSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19GCGGCCCAATTNONE 
J043009H23GCGGCCCAATTNONE 
Os03g0232500AK110980TATTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TATTGGGCCTANONE 
Os03g0253100AK119618AAGGCCCAATAPhosphomevalonate kinase Erg8 family protein. 
J033052A14AAGGCCCAATANONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0270000006-051-C05ATTGGGCCGANONE 
006-100-A03ATTGGGCCGANONE 
006-114-F11ATTGGGCCGANONE 
AK061579ATTGGGCCGANONE 
AK106069ATTGGGCCGAProtein of unknown function DUF296 domain containing protein. 
J023102O16ATTGGGCCGANONE 
J065017C10ATTGGGCCGANONE 
J065059M01ATTGGGCCGANONE 
J065104I08ATTGGGCCGANONE 
J065120B10ATTGGGCCGANONE 
J065130K08ATTGGGCCGANONE 
J065140F09ATTGGGCCGANONE 
J065166E07ATTGGGCCGANONE 
Os03g0287900009-074-B07TCTGGGCCCAATANONE 
014-027-E07TCTGGGCCCAATANONE 
AK063663TCTGGGCCCAATASimilar to Protein disulfide isomerase. 
J065009N21TCTGGGCCCAATANONE 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0302700006-099-F12ATTGGGCCACNONE 
AK112010ATTGGGCCACZinc finger, RING-type domain containing protein. 
AK121656ATTGGGCCACNONE 
J075090A19ATTGGGCCACNONE 
J075148M06ATTGGGCCACNONE 
Os03g0321000AK103653CCAGGCCCAATASimilar to Steroid membrane binding protein-like. 
Os03g0343500009-042-G06GAGGCCCAATANONE 
009-063-D01GAGGCCCAATANONE 
009-156-H09GAGGCCCAATANONE 
AB117995GAGGCCCAATANONE 
AK058737GAGGCCCAATANONE 
AK059599GAGGCCCAATASimilar to 60S ribosomal protein L22-2. 
AK121502GAGGCCCAATANONE 
J023082D10GAGGCCCAATANONE 
J033022G11GAGGCCCAATANONE 
J075048M16GAGGCCCAATANONE 
J075049O20GAGGCCCAATANONE 
J075082I02GAGGCCCAATANONE 
J075105G01GAGGCCCAATANONE 
J075131K05GAGGCCCAATANONE 
J080002H01GAGGCCCAATANONE 
J080003H01GAGGCCCAATANONE 
J080005G08GAGGCCCAATANONE 
J080011M13GAGGCCCAATANONE 
J080020M02GAGGCCCAATANONE 
J080026N24GAGGCCCAATANONE 
J080028L09GAGGCCCAATANONE 
J080032O14GAGGCCCAATANONE 
J080033J12GAGGCCCAATANONE 
J080035D05GAGGCCCAATANONE 
J080039H01GAGGCCCAATANONE 
J080044B07GAGGCCCAATANONE 
J080044E23GAGGCCCAATANONE 
J080049N11GAGGCCCAATANONE 
J080050A21GAGGCCCAATANONE 
J080055L24GAGGCCCAATANONE 
J080059N20GAGGCCCAATANONE 
J080061F04GAGGCCCAATANONE 
J080078I16GAGGCCCAATANONE 
J080079G24GAGGCCCAATANONE 
J080080K13GAGGCCCAATANONE 
J080083G20GAGGCCCAATANONE 
J080087B08GAGGCCCAATANONE 
J080091L19GAGGCCCAATANONE 
J080094D06GAGGCCCAATANONE 
J090038L06GAGGCCCAATANONE 
J090075H06GAGGCCCAATANONE 
J090081D12GAGGCCCAATANONE 
Os03g0343900009-077-C03TCCGGCCCAATANONE 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
J100059N03TCCGGCCCAATANONE 
J100079C20TCCGGCCCAATANONE 
Os03g0345100AK065579TATTGGGCCACRad9 family protein. 
J100033H02TATTGGGCCACNONE 
Os03g0405000AK070839GTGGCCCAATReticulon family protein. 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0669000AK067769CAGGCCCAATASimilar to RNA helicase (Fragment). 
AK099820CAGGCCCAATANONE 
Os03g0681900006-042-F08TCGGCCCAATTNONE 
009-043-F12TCGGCCCAATTNONE 
AK061750TCGGCCCAATTNONE 
AK062094TCGGCCCAATTSimilar to RGP-3 (Fragment). 
J033034F01TCGGCCCAATTNONE 
J033131F11TCGGCCCAATTNONE 
J033143N03TCGGCCCAATTNONE 
Os03g0685700AK066043TAGGCCCAATProtein prenyltransferase domain containing protein. 
J013048F08TAGGCCCAATNONE 
Os03g0685900009-026-A09TATTGGGCCGGTNONE 
009-145-C09TATTGGGCCGGTNONE 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
J065001D12TATTGGGCCGGTNONE 
J065023B10TATTGGGCCGGTNONE 
J065041E10TATTGGGCCGGTNONE 
J065046C01TATTGGGCCGGTNONE 
J065146I22TATTGGGCCGGTNONE 
J065184F20TATTGGGCCGGTNONE 
J075011E15TATTGGGCCGGTNONE 
J075048H17TATTGGGCCGGTNONE 
J075070H15TATTGGGCCGGTNONE 
J075133C01TATTGGGCCGGTNONE 
J075170D02TATTGGGCCGGTNONE 
J090001G08TATTGGGCCGGTNONE 
J090026B09TATTGGGCCGGTNONE 
J100055M03TATTGGGCCGGTNONE 
Os03g0687800AK106820GAGGCCCAATAConserved hypothetical protein. 
AK106820TAGGCCCAATAConserved hypothetical protein. 
Os03g0709000009-027-F11GTGGCCCAATANONE 
009-147-F02GTGGCCCAATANONE 
015-068-A04GTGGCCCAATANONE 
AK062406GTGGCCCAATAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0727100AK068587ATTGGGCCAGAConserved hypothetical protein. 
J013153F04ATTGGGCCAGANONE 
J065165J09ATTGGGCCAGANONE 
Os03g0740700011-093-H12TATTGGGCCAANONE 
AK102723TATTGGGCCAAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19TATTGGGCCAANONE 
J013126N16TATTGGGCCAANONE 
J033105J16TATTGGGCCAANONE 
J090059D19TATTGGGCCAANONE 
Os03g0741500AK110867ATGGCCCAATSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
Os03g0746600AK069559GAGGCCCAATWD40-like domain containing protein. 
J023141K22GAGGCCCAATNONE 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
AK071361CACGGCCCAATTNONE 
AK103989CACGGCCCAATTNONE 
J023090K09CACGGCCCAATTNONE 
J043022H11CACGGCCCAATTNONE 
J053078F12CACGGCCCAATTNONE 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14CCCGGCCCAATTNONE 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12CCCGGCCCAATTNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J033130D12AAATGGGCCCAATTNONE 
J043035E20AAATGGGCCCAATTNONE 
J065206K15AAATGGGCCCAATTNONE 
J075053J20AAATGGGCCCAATTNONE 
J075129B11AAATGGGCCCAATTNONE 
J090003E22AAATGGGCCCAATTNONE 
J100023E23AAATGGGCCCAATTNONE 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0795900012-092-G05CTCGGCCCAATNONE 
015-043-D09CTCGGCCCAATNONE 
016-078-G11CTCGGCCCAATNONE 
AK068660CTCGGCCCAATSimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CTCGGCCCAATNONE 
J023001L04CTCGGCCCAATNONE 
J053032K11CTCGGCCCAATNONE 
J065059E10CTCGGCCCAATNONE 
J065095H19CTCGGCCCAATNONE 
J065181M06CTCGGCCCAATNONE 
J100047D11CTCGGCCCAATNONE 
J100068G04CTCGGCCCAATNONE 
Os03g0803800012-043-D10TCCGGCCCAATTNONE 
012-043-D10TCTCGGCCCAATANONE 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0807800AK064984CAGGCCCAATSimilar to 40S ribosomal protein S2 (Fragment). 
AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14CAGGCCCAATNONE 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20CAGGCCCAATNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11CAGGCCCAATNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10CAGGCCCAATNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02CAGGCCCAATNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04CAGGCCCAATNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24CAGGCCCAATNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02CAGGCCCAATNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13CAGGCCCAATNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22CAGGCCCAATNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06CAGGCCCAATNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11CAGGCCCAATNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCCCAGATNONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013108D19TATTGGGCCCAGATNONE 
J013124D15TATTGGGCCCAGATNONE 
J013128F17TATTGGGCCCAGATNONE 
J013146J06TATTGGGCCCAGATNONE 
J013149D12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCCCAGATNONE 
J013162N01TATTGGGCCCAGATNONE 
J013170G15TATTGGGCCCAGATNONE 
J013170H16TATTGGGCCCAGATNONE 
J023022I09TATTGGGCCCAGATNONE 
J023072B19TATTGGGCCCAGATNONE 
J023106H09TATTGGGCCCAGATNONE 
J023135C03TATTGGGCCCAGATNONE 
J023141C09TATTGGGCCCAGATNONE 
J033091K23TATTGGGCCCAGATNONE 
J033107I05TATTGGGCCCAGATNONE 
J033112M18TATTGGGCCCAGATNONE 
J033120G10TATTGGGCCCAGATNONE 
J033144G06TATTGGGCCCAGATNONE 
J043017L21TATTGGGCCCAGATNONE 
J043024O10TATTGGGCCCAGATNONE 
J053023K04TATTGGGCCCAGATNONE 
J053035D01TATTGGGCCCAGATNONE 
J053037P10TATTGGGCCCAGATNONE 
J053042K15TATTGGGCCCAGATNONE 
J053047C14TATTGGGCCCAGATNONE 
J053054A06TATTGGGCCCAGATNONE 
J053071H03TATTGGGCCCAGATNONE 
J053073G08TATTGGGCCCAGATNONE 
J053090D04TATTGGGCCCAGATNONE 
J053095E17TATTGGGCCCAGATNONE 
J090007O03TATTGGGCCCAGATNONE 
J090024G24TATTGGGCCCAGATNONE 
J090042M08TATTGGGCCCAGATNONE 
J090045I16TATTGGGCCCAGATNONE 
J090051E13TATTGGGCCCAGATNONE 
J090073B15TATTGGGCCCAGATNONE 
J090096F19TATTGGGCCCAGATNONE 
J100030M23TATTGGGCCCAGATNONE 
Os03g0820100011-030-A10ATGGCCCAATTNONE 
011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01ATGGCCCAATTNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534ATGGCCCAATTSimilar to Auxin-resistance protein AXR1. 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14ATGGCCCAATTNONE 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14ATGGCCCAATTNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20ATGGCCCAATTNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04ATGGCCCAATTNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11ATGGCCCAATTNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19ATGGCCCAATTNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15ATGGCCCAATTNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01ATGGCCCAATTNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02ATGGCCCAATTNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22ATGGCCCAATTNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03ATGGCCCAATTNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08ATGGCCCAATTNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21ATGGCCCAATTNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07ATGGCCCAATTNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0822700005-010-E01AGGTGGGCCCAATNONE 
006-088-H12AGGTGGGCCCAATNONE 
AK061682AGGTGGGCCCAATNONE 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
J023091N05AGGTGGGCCCAATNONE 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0845700009-075-D05AATTGGGCCTTGNONE 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
J065068H03AATTGGGCCTTGNONE 
J065075A18AATTGGGCCTTGNONE 
J065118C19AATTGGGCCTTGNONE 
J075001B15AATTGGGCCTTGNONE 
J075048D11AATTGGGCCTTGNONE 
J075056D01AATTGGGCCTTGNONE 
J075092P03AATTGGGCCTTGNONE 
J075111I04AATTGGGCCTTGNONE 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0850600AK067191TATTGGGCCGGAConserved hypothetical protein. 
AK067191TGCGGCCCAATConserved hypothetical protein. 
J013095N12TATTGGGCCGGANONE 
J013095N12TGCGGCCCAATNONE 
J065214L06TATTGGGCCGGANONE 
J065214L06TGCGGCCCAATNONE 
J075093J10TATTGGGCCGGANONE 
J075093J10TGCGGCCCAATNONE 
Os04g0103200003-106-F06AATTGGGCCGAANONE 
015-058-G03AATTGGGCCGAANONE 
AK060850AATTGGGCCGAANONE 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
J013046D12AATTGGGCCGAANONE 
J013088L18AATTGGGCCGAANONE 
J013093J06AATTGGGCCGAANONE 
J013111I01AATTGGGCCGAANONE 
J013120B15AATTGGGCCGAANONE 
J013149K17AATTGGGCCGAANONE 
J023010J08AATTGGGCCGAANONE 
J023034J10AATTGGGCCGAANONE 
J023055D05AATTGGGCCGAANONE 
J033023L03AATTGGGCCGAANONE 
J033025N21AATTGGGCCGAANONE 
J033026A19AATTGGGCCGAANONE 
J033026M14AATTGGGCCGAANONE 
J033046J22AATTGGGCCGAANONE 
J033052H11AATTGGGCCGAANONE 
J033058P05AATTGGGCCGAANONE 
J033064A11AATTGGGCCGAANONE 
J033067K11AATTGGGCCGAANONE 
J033076H02AATTGGGCCGAANONE 
J033094E04AATTGGGCCGAANONE 
J033106A02AATTGGGCCGAANONE 
J033108N14AATTGGGCCGAANONE 
J033114I06AATTGGGCCGAANONE 
J033118H18AATTGGGCCGAANONE 
J033148C05AATTGGGCCGAANONE 
J043010I24AATTGGGCCGAANONE 
J043037C07AATTGGGCCGAANONE 
J053025M02AATTGGGCCGAANONE 
J053026N08AATTGGGCCGAANONE 
J053027O14AATTGGGCCGAANONE 
J065038N11AATTGGGCCGAANONE 
J065219C03AATTGGGCCGAANONE 
J090011F14AATTGGGCCGAANONE 
J090027C03AATTGGGCCGAANONE 
J090067M19AATTGGGCCGAANONE 
J090069C17AATTGGGCCGAANONE 
J090070P21AATTGGGCCGAANONE 
J090075N11AATTGGGCCGAANONE 
J090095C22AATTGGGCCGAANONE 
J100027O14AATTGGGCCGAANONE 
J100055E01AATTGGGCCGAANONE 
Os04g0105700004-005-E05ATTGGGCCAGNONE 
006-037-C11ATTGGGCCAGNONE 
006-039-E07ATTGGGCCAGNONE 
006-049-A02ATTGGGCCAGNONE 
006-076-D05ATTGGGCCAGNONE 
006-089-E04ATTGGGCCAGNONE 
006-097-F12ATTGGGCCAGNONE 
AK060872ATTGGGCCAGNONE 
AK065082ATTGGGCCAGNONE 
AK104254ATTGGGCCAGConserved hypothetical protein. 
AK104546ATTGGGCCAGNONE 
AK104634ATTGGGCCAGNONE 
AY224557ATTGGGCCAGNONE 
J013001L09ATTGGGCCAGNONE 
J013151B18ATTGGGCCAGNONE 
J023054G18ATTGGGCCAGNONE 
Os04g0115400015-048-B05TACGGCCCAATANONE 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
Os04g0117800Os04g0117800AATTGGGCCTCAmidase family protein. 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
J033101G08AATTGGGCCTTGNONE 
J090084B18AATTGGGCCTTGNONE 
Os04g0244400006-089-A08ATTGGGCCCTNONE 
AK061168ATTGGGCCCTNONE 
AK103892ATTGGGCCCTGlutaredoxin domain containing protein. 
J033150E08ATTGGGCCCTNONE 
J065063D07ATTGGGCCCTNONE 
J065070L22ATTGGGCCCTNONE 
J075022J16ATTGGGCCCTNONE 
J075136O21ATTGGGCCCTNONE 
J075150O05ATTGGGCCCTNONE 
J075197O15ATTGGGCCCTNONE 
J080307A14ATTGGGCCCTNONE 
J100080A07ATTGGGCCCTNONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0413600009-142-B05CTCGGCCCAATANONE 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11CTCGGCCCAATANONE 
J065085D06CTCGGCCCAATANONE 
J075062H12CTCGGCCCAATANONE 
J075072I22CTCGGCCCAATANONE 
J075074H21CTCGGCCCAATANONE 
J075087L16CTCGGCCCAATANONE 
J075088D11CTCGGCCCAATANONE 
J075115N15CTCGGCCCAATANONE 
J100064G10CTCGGCCCAATANONE 
J100080E09CTCGGCCCAATANONE 
Os04g0418000006-025-C05ATTGGGCCGCANONE 
006-025-D11ATTGGGCCGCANONE 
006-045-F02ATTGGGCCGCANONE 
006-060-B04ATTGGGCCGCANONE 
006-063-E03ATTGGGCCGCANONE 
006-070-G08ATTGGGCCGCANONE 
006-072-H05ATTGGGCCGCANONE 
AK061030ATTGGGCCGCANONE 
AK099124ATTGGGCCGCANONE 
AK106155ATTGGGCCGCAConserved hypothetical protein. 
AK119714ATTGGGCCGCANONE 
J023039I07ATTGGGCCGCANONE 
J065025N03ATTGGGCCGCANONE 
Os04g0440000AK073064TATTGGGCCTCNONE 
AK101691TATTGGGCCTCConserved hypothetical protein. 
AK102407TATTGGGCCTCNONE 
Os04g0440100AK101324AAGGCCCAATTNONE 
AK101324ATTGGGCCGGCNONE 
AK105415AAGGCCCAATTNonsense-mediated decay UPF3 domain containing protein. 
AK105415ATTGGGCCGGCNonsense-mediated decay UPF3 domain containing protein. 
Os04g0446500015-073-B06CCAGGCCCAATTNONE 
AB118009CCAGGCCCAATTNONE 
AK073743CCAGGCCCAATTNONE 
AK103814CCAGGCCCAATTSimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15CCAGGCCCAATTNONE 
J033067L09CCAGGCCCAATTNONE 
J033147C19CCAGGCCCAATTNONE 
J033147C20CCAGGCCCAATTNONE 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0477900006-046-B01ATTGGGCCGAAANONE 
006-103-C03ATTGGGCCGAAANONE 
006-106-F09ATTGGGCCGAAANONE 
009-093-B07ATTGGGCCGAAANONE 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTGGGCCGAAANONE 
J013158A11ATTGGGCCGAAANONE 
J023050E17ATTGGGCCGAAANONE 
J023078J03ATTGGGCCGAAANONE 
J033027G18ATTGGGCCGAAANONE 
J033086G10ATTGGGCCGAAANONE 
J090060G14ATTGGGCCGAAANONE 
Os04g0496400011-042-H11CTGGCCCAATNONE 
AK111787CTGGCCCAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY224465CTGGCCCAATNONE 
J033106N02CTGGCCCAATNONE 
J043026P11CTGGCCCAATNONE 
J065134J18CTGGCCCAATNONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02ATCTCGGCCCAATNONE 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10ATCTCGGCCCAATNONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0564700AK111806ATTGGGCCAGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0577000AK073711AATTGGGCCCTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AATTGGGCCCTNONE 
J013127H04AATTGGGCCCTNONE 
J033035G06AATTGGGCCCTNONE 
J033061G23AATTGGGCCCTNONE 
J033127L07AATTGGGCCCTNONE 
J065015F17AATTGGGCCCTNONE 
J065062G08AATTGGGCCCTNONE 
J065132M07AATTGGGCCCTNONE 
J065155C12AATTGGGCCCTNONE 
J075055I08AATTGGGCCCTNONE 
J075140D07AATTGGGCCCTNONE 
J090055B21AATTGGGCCCTNONE 
J100031D23AATTGGGCCCTNONE 
Os04g0589200AK068571GAGGCCCAATCGTGGGCConserved hypothetical protein. 
AK102463GAGGCCCAATCGTGGGCNONE 
J075083K10GAGGCCCAATCGTGGGCNONE 
Os04g0589600011-100-F04GAGGCCCAATNONE 
AK061833GAGGCCCAATGlycosyl transferase, group 1 domain containing protein. 
AK098964GAGGCCCAATNONE 
AK100053GAGGCCCAATNONE 
Os04g0591000006-090-E02ATTGGGCCCCANONE 
AK072902ATTGGGCCCCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ATTGGGCCCCANONE 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0612600AB042115TTGGCCCAATNONE 
AK060707TTGGCCCAATSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TTGGCCCAATNONE 
AK104427TTGGCCCAATNONE 
J023043H02TTGGCCCAATNONE 
J033033I23TTGGCCCAATNONE 
J033067P21TTGGCCCAATNONE 
J033088M21TTGGCCCAATNONE 
J033133M08TTGGCCCAATNONE 
J043030I16TTGGCCCAATNONE 
J075049H08TTGGCCCAATNONE 
Os04g0640800AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J065068M07CCCGGGCCCAATTNONE 
J065120G22CCCGGGCCCAATTNONE 
J065168J18CCCGGGCCCAATTNONE 
J065211M10CCCGGGCCCAATTNONE 
J075175E21CCCGGGCCCAATTNONE 
J090021C06CCCGGGCCCAATTNONE 
J090032P15CCCGGGCCCAATTNONE 
J090082E05CCCGGGCCCAATTNONE 
J100090O11CCCGGGCCCAATTNONE 
Os04g0674100J080097J12TATTGGGCCTAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TAGGCCCAATNONE 
AK103795TAGGCCCAATCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TAGGCCCAATNONE 
J065020P20TAGGCCCAATNONE 
J065057I21TAGGCCCAATNONE 
J065059P11TAGGCCCAATNONE 
J065083A22TAGGCCCAATNONE 
J065093K10TAGGCCCAATNONE 
J065097D03TAGGCCCAATNONE 
J065103P05TAGGCCCAATNONE 
J065113K09TAGGCCCAATNONE 
J065118F23TAGGCCCAATNONE 
J065119M06TAGGCCCAATNONE 
J065146K17TAGGCCCAATNONE 
J065161N12TAGGCCCAATNONE 
J065169L02TAGGCCCAATNONE 
J065189H12TAGGCCCAATNONE 
J065192E24TAGGCCCAATNONE 
J065193K17TAGGCCCAATNONE 
J065197O21TAGGCCCAATNONE 
J065214D09TAGGCCCAATNONE 
J065217B11TAGGCCCAATNONE 
J075132K07TAGGCCCAATNONE 
J100059D14TAGGCCCAATNONE 
Os04g0674350J065104O14CTGGCCCAATANONE 
J065118J19CTGGCCCAATANONE 
J065167I12CTGGCCCAATAHypothetical protein. 
Os04g0674400015-042-B08TATTGGGCCAGNONE 
AK102124TATTGGGCCAGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22TATTGGGCCAGNONE 
J023022I24TATTGGGCCAGNONE 
J023120A15TATTGGGCCAGNONE 
J023123P20TATTGGGCCAGNONE 
J033068P09TATTGGGCCAGNONE 
J033107G22TATTGGGCCAGNONE 
J033116G12TATTGGGCCAGNONE 
J033133F03TATTGGGCCAGNONE 
J033143B20TATTGGGCCAGNONE 
J043006G12TATTGGGCCAGNONE 
J043027M18TATTGGGCCAGNONE 
J043034H17TATTGGGCCAGNONE 
J090091E20TATTGGGCCAGNONE 
J100035H09TATTGGGCCAGNONE 
J100037J04TATTGGGCCAGNONE 
J100047J24TATTGGGCCAGNONE 
J100059G06TATTGGGCCAGNONE 
J100066O12TATTGGGCCAGNONE 
J100074G23TATTGGGCCAGNONE 
J100077M12TATTGGGCCAGNONE 
Os04g0684500AK066014TATTGGGCCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0691700015-036-C06ATTGGGCCTCNONE 
AK106305ATTGGGCCTCSimilar to Autoimmune regulator (Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein) (APECED protein). 
Os04g0692200006-047-H10CCAGGCCCAATANONE 
006-107-D08CCAGGCCCAATANONE 
009-122-B09CCAGGCCCAATANONE 
AK059807CCAGGCCCAATANONE 
AK060875CCAGGCCCAATANONE 
AK071726CCAGGCCCAATAConserved hypothetical protein. 
J023110I24CCAGGCCCAATANONE 
J033091O06CCAGGCCCAATANONE 
J053027N16CCAGGCCCAATANONE 
J053089E19CCAGGCCCAATANONE 
J053098H12CCAGGCCCAATANONE 
J053099N13CCAGGCCCAATANONE 
J075031B15CCAGGCCCAATANONE 
J080013D12CCAGGCCCAATANONE 
J080013H05CCAGGCCCAATANONE 
J080013H07CCAGGCCCAATANONE 
J080088I03CCAGGCCCAATANONE 
Os05g0110100009-015-D08AATTGGGCCAANONE 
009-023-C09AATTGGGCCAANONE 
009-031-B11AATTGGGCCAANONE 
009-034-C02AATTGGGCCAANONE 
009-050-B08AATTGGGCCAANONE 
009-065-D12AATTGGGCCAANONE 
009-090-G08AATTGGGCCAANONE 
009-111-H07AATTGGGCCAANONE 
009-136-F12AATTGGGCCAANONE 
009-138-E06AATTGGGCCAANONE 
009-138-G12AATTGGGCCAANONE 
009-141-D08AATTGGGCCAANONE 
009-143-D01AATTGGGCCAANONE 
009-179-D09AATTGGGCCAANONE 
009-179-E03AATTGGGCCAANONE 
009-196-A09AATTGGGCCAANONE 
009-199-F04AATTGGGCCAANONE 
013-021-E05AATTGGGCCAANONE 
013-076-C04AATTGGGCCAANONE 
013-096-F06AATTGGGCCAANONE 
014-071-A05AATTGGGCCAANONE 
014-077-F09AATTGGGCCAANONE 
AK099779AATTGGGCCAANONE 
AK121142AATTGGGCCAAConserved hypothetical protein. 
J013095A16AATTGGGCCAANONE 
J013111A17AATTGGGCCAANONE 
J013132G04AATTGGGCCAANONE 
J023077M04AATTGGGCCAANONE 
J065001B11AATTGGGCCAANONE 
J065001E11AATTGGGCCAANONE 
J065057G10AATTGGGCCAANONE 
J065057L08AATTGGGCCAANONE 
J065080E07AATTGGGCCAANONE 
J065087K10AATTGGGCCAANONE 
J065091M15AATTGGGCCAANONE 
J065167A15AATTGGGCCAANONE 
J075018F02AATTGGGCCAANONE 
J075063F20AATTGGGCCAANONE 
J075064F18AATTGGGCCAANONE 
J075066N19AATTGGGCCAANONE 
J075073I02AATTGGGCCAANONE 
J075080P17AATTGGGCCAANONE 
J075081F11AATTGGGCCAANONE 
J075085E03AATTGGGCCAANONE 
J075101G18AATTGGGCCAANONE 
J075149N08AATTGGGCCAANONE 
J075158I21AATTGGGCCAANONE 
J075161M20AATTGGGCCAANONE 
J075190F12AATTGGGCCAANONE 
J075194K16AATTGGGCCAANONE 
J080001E08AATTGGGCCAANONE 
J080001F21AATTGGGCCAANONE 
J080001H19AATTGGGCCAANONE 
J080001O15AATTGGGCCAANONE 
J080005I22AATTGGGCCAANONE 
J080006K23AATTGGGCCAANONE 
J080014D20AATTGGGCCAANONE 
J080014I05AATTGGGCCAANONE 
J080014K21AATTGGGCCAANONE 
J080017I24AATTGGGCCAANONE 
J080017K11AATTGGGCCAANONE 
J080018F11AATTGGGCCAANONE 
J080022L18AATTGGGCCAANONE 
J080024N23AATTGGGCCAANONE 
J080027J23AATTGGGCCAANONE 
J080029B14AATTGGGCCAANONE 
J080032F14AATTGGGCCAANONE 
J080032K19AATTGGGCCAANONE 
J080032O21AATTGGGCCAANONE 
J080033P17AATTGGGCCAANONE 
J080034I06AATTGGGCCAANONE 
J080039F24AATTGGGCCAANONE 
J080040O13AATTGGGCCAANONE 
J080042B02AATTGGGCCAANONE 
J080043E12AATTGGGCCAANONE 
J080043J15AATTGGGCCAANONE 
J080043N09AATTGGGCCAANONE 
J080052J08AATTGGGCCAANONE 
J080053K01AATTGGGCCAANONE 
J080053K19AATTGGGCCAANONE 
J080055J09AATTGGGCCAANONE 
J080058D07AATTGGGCCAANONE 
J080062F11AATTGGGCCAANONE 
J080063J24AATTGGGCCAANONE 
J080066H04AATTGGGCCAANONE 
J080066I09AATTGGGCCAANONE 
J080067B02AATTGGGCCAANONE 
J080067N09AATTGGGCCAANONE 
J080068D22AATTGGGCCAANONE 
J080068K13AATTGGGCCAANONE 
J080069N19AATTGGGCCAANONE 
J080070D07AATTGGGCCAANONE 
J080070E05AATTGGGCCAANONE 
J080071G04AATTGGGCCAANONE 
J080077G05AATTGGGCCAANONE 
J080077O06AATTGGGCCAANONE 
J080085F05AATTGGGCCAANONE 
J080086E07AATTGGGCCAANONE 
J080089G16AATTGGGCCAANONE 
J080092K15AATTGGGCCAANONE 
J080094A08AATTGGGCCAANONE 
J080097A09AATTGGGCCAANONE 
J080097J07AATTGGGCCAANONE 
J090027N01AATTGGGCCAANONE 
J090081J05AATTGGGCCAANONE 
Os05g0110700AK102486GAGGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12GAGGCCCAATANONE 
Os05g0121500006-117-B10GACGGCCCAATNONE 
009-059-D04GACGGCCCAATNONE 
J065066C12GACGGCCCAATConserved hypothetical protein. 
J075013I12GACGGCCCAATNONE 
J090046D18GACGGCCCAATNONE 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0144800AK099724TATTGGGCCATSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
J023099E19GCCGGCCCAATTNONE 
J090025C09GCCGGCCCAATTNONE 
J090071K23GCCGGCCCAATTNONE 
Os05g0168400006-039-A06AATTGGGCCAANONE 
AK069800AATTGGGCCAANONE 
AK106195AATTGGGCCAAConserved hypothetical protein. 
J065086N09AATTGGGCCAANONE 
J065137B10AATTGGGCCAANONE 
J075062B04AATTGGGCCAANONE 
J075193I07AATTGGGCCAANONE 
J075193K24AATTGGGCCAANONE 
J075194D10AATTGGGCCAANONE 
J100037F01AATTGGGCCAANONE 
J100071E09AATTGGGCCAANONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01AATGGGCTATTGGGCCGANONE 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08AATGGGCTATTGGGCCGANONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0298500Os05g0298500ATGGCCCAATConserved hypothetical protein. 
Os05g0378800AK058210TGCGGCCCAATNONE 
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1. 
AK098990TTTTGGGCCCAATCCGACGNONE 
AK104689TTTTGGGCCCAATCCGACGNONE 
J013094L23TTTTGGGCCCAATCCGACGNONE 
J065118O04TTTTGGGCCCAATCCGACGNONE 
Os05g0461000006-113-A06TCCGGCCCAATTNONE 
AB042259TCCGGCCCAATTNONE 
AK059189TCCGGCCCAATTNONE 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
AK099044TCCGGCCCAATTNONE 
AK104166TCCGGCCCAATTNONE 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
AK111946AATTGGGCCCCACTCCNONE 
AK111972AATTGGGCCCCACTCCNONE 
AK112021AATTGGGCCCCACTCCNONE 
J033135H16AATTGGGCCCCACTCCNONE 
J043036O11AATTGGGCCCCACTCCNONE 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0481000AK059369GCGGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
AK068619GCGGCCCAATNONE 
Os05g0496500011-012-D10ATTGGGCCACNONE 
AK073261ATTGGGCCACSimilar to Latex-abundant protein. 
AY224533ATTGGGCCACNONE 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0509200AK061566TATTGGGCCGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TATTGGGCCGANONE 
AK100226TATTGGGCCGANONE 
J013114B12TATTGGGCCGANONE 
J023048D09TATTGGGCCGANONE 
Os05g0518300003-113-E09CTCGGCCCAATNONE 
006-088-A08CTCGGCCCAATNONE 
011-046-H04CTCGGCCCAATNONE 
013-059-A09CTCGGCCCAATNONE 
014-094-H08CTCGGCCCAATNONE 
015-008-B01CTCGGCCCAATNONE 
015-062-H06CTCGGCCCAATNONE 
016-057-H02CTCGGCCCAATNONE 
AK061147CTCGGCCCAATLipolytic enzyme, G-D-S-L family protein. 
J065171N11CTCGGCCCAATNONE 
J065186B12CTCGGCCCAATNONE 
Os05g0521700AK070182ATTGGGCCACGTGGCGConserved hypothetical protein. 
J013170O04ATTGGGCCACGTGGCGNONE 
J023045H17ATTGGGCCACGTGGCGNONE 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0558000015-029-G05GAGGCCCAATANONE 
AK073857GAGGCCCAATARibosomal protein L1 family protein. 
J033074P11GAGGCCCAATANONE 
J090060I16GAGGCCCAATANONE 
Os05g0565200004-015-E06TATTGGGCCGCANONE 
004-015-E06TATTGGGCCTCNONE 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK067090TATTGGGCCTCSimilar to Urease accessory protein G. 
AK104200TATTGGGCCGCANONE 
AK104200TATTGGGCCTCNONE 
AK104368TATTGGGCCGCANONE 
AK104368TATTGGGCCTCNONE 
Os05g0567300013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0575300AK068873AATTGGGCCCAAGNONE 
J013170P17AATTGGGCCCAAGNONE 
Os05g0578600AK108477TTGGCCCAATASimilar to Polygalacturonase PG2. 
Os05g0587400AK102121TATTGGGCCTAPrefoldin domain containing protein. 
J033084N12TATTGGGCCTANONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
AK120746CACGGCCCAATANONE 
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4. 
AK102678ACCGGCCCAATNONE 
J075185K19ACCGGCCCAATNONE 
J090028C16ACCGGCCCAATNONE 
J090099N12ACCGGCCCAATNONE 
J100070O10ACCGGCCCAATNONE 
Os06g0136700AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TTTCGGCCCAATNONE 
J013039I03TTTCGGCCCAATNONE 
Os06g0140900AK058823ATTGGGCCAGSigma factor, regions 3 and 4 domain containing protein. 
J065159C22ATTGGGCCAGNONE 
J090061D18ATTGGGCCAGNONE 
J100066L20ATTGGGCCAGNONE 
J100085F19ATTGGGCCAGNONE 
J100088E11ATTGGGCCAGNONE 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J033022L20TATTGGGCCGGCCCNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGGCCCNONE 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J100026J18AATTGGGCCCATGANONE 
J100041O16AATTGGGCCCATGANONE 
J100089K16AATTGGGCCCATGANONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J075006K03AATTGGGCCCATGGNONE 
J075067F07AATTGGGCCCATGGNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068H14AATTGGGCCCATGGNONE 
J075098N06AATTGGGCCCATGGNONE 
J075099F08AATTGGGCCCATGGNONE 
J075154G24AATTGGGCCCATGGNONE 
J075195H09AATTGGGCCCATGGNONE 
Os06g0291100J043017O10TTGGCCCAATHypothetical protein. 
Os06g0292400J065040E24TATTGGGCCTGAConserved hypothetical protein. 
Os06g0320000009-030-C04CAAGGCCCAATTNONE 
009-135-F08CAAGGCCCAATTNONE 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CAAGGCCCAATTNONE 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
J033044B19CTCGGCCCAATANONE 
Os06g0482200AK119703TTGGCCCAATAThioredoxin fold domain containing protein. 
J065014B11TTGGCCCAATANONE 
J065055E22TTGGCCCAATANONE 
J065092L13TTGGCCCAATANONE 
J065113E21TTGGCCCAATANONE 
J065191D11TTGGCCCAATANONE 
J065214F18TTGGCCCAATANONE 
J075104E18TTGGCCCAATANONE 
J075149O19TTGGCCCAATANONE 
J075170I11TTGGCCCAATANONE 
Os06g0494400AK067594CCAGGCCCAATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0498900AK065724GCCACGTGGCCCAATGTP-binding protein, HSR1-related domain containing protein. 
Os06g0547900AK100950ATTGGGCCATSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665ATTGGGCCATNONE 
J023139I22ATTGGGCCATNONE 
J090066J10ATTGGGCCATNONE 
Y13437ATTGGGCCATNONE 
Os06g0549600AK073505ATTGGGCCAAFAD linked oxidase, N-terminal domain containing protein. 
J033046H14ATTGGGCCAANONE 
Os06g0591200009-125-G07GGGGCCCAATTNONE 
009-177-A08GGGGCCCAATTNONE 
AK062563GGGGCCCAATTConserved hypothetical protein. 
AK120112GGGGCCCAATTNONE 
J013025D20GGGGCCCAATTNONE 
J100018M02GGGGCCCAATTNONE 
J100021J11GGGGCCCAATTNONE 
J100024D08GGGGCCCAATTNONE 
J100044L11GGGGCCCAATTNONE 
J100077A22GGGGCCCAATTNONE 
J100090B19GGGGCCCAATTNONE 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0650100009-016-C02ATTGGGCCATNONE 
AK062354ATTGGGCCATSimilar to Polyubiquitin gene (Fragment). 
Os06g0688100AK063450AATTGGGCCGCNONE 
AK101144AATTGGGCCGCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0704600AK065784ATTGGGCCTANONE 
AK101836ATTGGGCCTASimilar to Delta-aminolevulinic acid dehydratase (Fragment). 
AK119551ATTGGGCCTANONE 
Os06g0704900AK103054TATTGGGCCTGASimilar to Cell division-like protein. 
J033117I21TATTGGGCCTGANONE 
Os06g0709300AK108588GAGGCCCAATFAR1 domain containing protein. 
Os06g0710300AK121344ATGGCCCAATAUncharacterized protein UPF0114 family protein. 
J043016B12ATGGCCCAATANONE 
J065104H21ATGGCCCAATANONE 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os07g0110100009-059-D11TATTGGGCCGGANONE 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
J065064P17TATTGGGCCGGANONE 
J065111B09TATTGGGCCGGANONE 
J075099A14TATTGGGCCGGANONE 
J075139C23TATTGGGCCGGANONE 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0142600009-115-C09TATTGGGCCACNONE 
AK062842TATTGGGCCACConserved hypothetical protein. 
Os07g0150200009-152-C07GAGGCCCAATTNONE 
AK058680GAGGCCCAATTNONE 
AK121635GAGGCCCAATTSimilar to 40S ribosomal protein S12-1. 
J033051C16GAGGCCCAATTNONE 
J033123H15GAGGCCCAATTNONE 
J065093I01GAGGCCCAATTNONE 
J065197C05GAGGCCCAATTNONE 
J075037B11GAGGCCCAATTNONE 
J075114B08GAGGCCCAATTNONE 
J075123N01GAGGCCCAATTNONE 
J075129O04GAGGCCCAATTNONE 
J075160H17GAGGCCCAATTNONE 
J075166H17GAGGCCCAATTNONE 
J080310F11GAGGCCCAATTNONE 
J080315P11GAGGCCCAATTNONE 
J090025A22GAGGCCCAATTNONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E03TATTGGGCCTTNONE 
006-036-E04AATTGGGCCCATGTNONE 
006-036-E04TATTGGGCCTTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK061006TATTGGGCCTTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
AK104606TATTGGGCCTTNONE 
Os07g0158300006-049-G04TAGGCCCAATTNONE 
AK099188TAGGCCCAATTNONE 
AK104773TAGGCCCAATTNONE 
J013106F16TAGGCCCAATTNONE 
J013123H22TAGGCCCAATTNONE 
J023029J02TAGGCCCAATTNONE 
J023029J03TAGGCCCAATTNONE 
J033138N08TAGGCCCAATTNONE 
J075011F05TAGGCCCAATTNONE 
J075022F10TAGGCCCAATTNONE 
J075071L13TAGGCCCAATTNONE 
J075094B08TAGGCCCAATTNONE 
J075119B21TAGGCCCAATTNONE 
J075140L02TAGGCCCAATTNONE 
J075199O21TAGGCCCAATTNONE 
J080001I17TAGGCCCAATTNONE 
J080005M04TAGGCCCAATTNONE 
J080011P17TAGGCCCAATTNONE 
J080026B14TAGGCCCAATTNONE 
J080026C12TAGGCCCAATTNONE 
J080030N16TAGGCCCAATTNONE 
J080035K23TAGGCCCAATTNONE 
J080039J22TAGGCCCAATTNONE 
J080045D04TAGGCCCAATTNONE 
J080050C06TAGGCCCAATTNONE 
J080050K14TAGGCCCAATTNONE 
J080051I09TAGGCCCAATTNONE 
J080053F18TAGGCCCAATTNONE 
J080053G10TAGGCCCAATTNONE 
J080055F05TAGGCCCAATTNONE 
J080057E22TAGGCCCAATTNONE 
J080058F17TAGGCCCAATTNONE 
J080063C18TAGGCCCAATTNONE 
J080065E02TAGGCCCAATTNONE 
J080066E06TAGGCCCAATTNONE 
J080067O05TAGGCCCAATTNONE 
J080068N15TAGGCCCAATTNONE 
J080071O04TAGGCCCAATTNONE 
J080074A20TAGGCCCAATTNONE 
J080074E14TAGGCCCAATTNONE 
J080074L05TAGGCCCAATTNONE 
J080075E08TAGGCCCAATTNONE 
J080075H07TAGGCCCAATTNONE 
J080077D04TAGGCCCAATTNONE 
J080077N15TAGGCCCAATTNONE 
J080078A07TAGGCCCAATTNONE 
J080079H22TAGGCCCAATTNONE 
J080080F20TAGGCCCAATTNONE 
J080080M22TAGGCCCAATTNONE 
J080081K09TAGGCCCAATTNONE 
J080081L04TAGGCCCAATTNONE 
J080090K09TAGGCCCAATTNONE 
J080093O13TAGGCCCAATTNONE 
J080094A18TAGGCCCAATTNONE 
J080094E10TAGGCCCAATTNONE 
J080094H06TAGGCCCAATTNONE 
J080096I21TAGGCCCAATTNONE 
J100081A19TAGGCCCAATTNONE 
Os07g0190900012-063-F11AATTGGGCCTANONE 
AK073533AATTGGGCCTASMAD/FHA domain containing protein. 
J013110O09AATTGGGCCTANONE 
J033041I12AATTGGGCCTANONE 
J033046D05AATTGGGCCTANONE 
J033101K24AATTGGGCCTANONE 
J090009F10AATTGGGCCTANONE 
J090095B17AATTGGGCCTANONE 
Os07g0191000AK071379TAGGCCCAATTInositol monophosphatase family protein. 
AK103440TAGGCCCAATTNONE 
Os07g0213600AK107696TTTTGGGCCCAATPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09TTTTGGGCCCAATNONE 
J100082J05TTTTGGGCCCAATNONE 
Os07g0256200AK072904AATTGGGCCTARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23AATTGGGCCTANONE 
Os07g0296900J075050I18ATTTGGGCCCAATTConserved hypothetical protein. 
Os07g0462700009-033-D05ATTGGGCCGGTNONE 
AK073834ATTGGGCCGGTNONE 
AK104968ATTGGGCCGGTThioesterase superfamily domain containing protein. 
J065104G16ATTGGGCCGGTNONE 
J065197C14ATTGGGCCGGTNONE 
J065213E17ATTGGGCCGGTNONE 
J065215D11ATTGGGCCGGTNONE 
J075001J15ATTGGGCCGGTNONE 
J075026M11ATTGGGCCGGTNONE 
J075142G03ATTGGGCCGGTNONE 
J075178H04ATTGGGCCGGTNONE 
J100069P18ATTGGGCCGGTNONE 
Os07g0506700AK073959AGCCCATTGGGCCAAWD40-like domain containing protein. 
Os07g0595700003-103-G05GAGGCCCAATTNONE 
AK108488GAGGCCCAATTConserved hypothetical protein. 
J065136O05GAGGCCCAATTNONE 
Os07g0595800011-069-G09AATTGGGCCTCNONE 
AK066349AATTGGGCCTCPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05AATTGGGCCTCNONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0623300AK070292GGCCGTGGCCCAATSimilar to Splicing factor SC35. 
J023050C05GGCCGTGGCCCAATNONE 
J090025O12GGCCGTGGCCCAATNONE 
Os07g0626300AK100052TCGGCCCAATTConserved hypothetical protein. 
Os07g0631300009-145-C11AATTGGGCATTGGGCCTCNONE 
AK063855AATTGGGCATTGGGCCTCConserved hypothetical protein. 
J043012K22AATTGGGCATTGGGCCTCNONE 
J043020D08AATTGGGCATTGGGCCTCNONE 
J065015L18AATTGGGCATTGGGCCTCNONE 
J065021G12AATTGGGCATTGGGCCTCNONE 
J065021H11AATTGGGCATTGGGCCTCNONE 
J065042D02AATTGGGCATTGGGCCTCNONE 
J065067O21AATTGGGCATTGGGCCTCNONE 
J065078J12AATTGGGCATTGGGCCTCNONE 
J065094B22AATTGGGCATTGGGCCTCNONE 
J065106N18AATTGGGCATTGGGCCTCNONE 
J065150G13AATTGGGCATTGGGCCTCNONE 
J065157K08AATTGGGCATTGGGCCTCNONE 
J065164B05AATTGGGCATTGGGCCTCNONE 
J065172G19AATTGGGCATTGGGCCTCNONE 
J065173F12AATTGGGCATTGGGCCTCNONE 
J065174D16AATTGGGCATTGGGCCTCNONE 
J065185B02AATTGGGCATTGGGCCTCNONE 
J065207B14AATTGGGCATTGGGCCTCNONE 
J065207J19AATTGGGCATTGGGCCTCNONE 
J065212L20AATTGGGCATTGGGCCTCNONE 
J100053C03AATTGGGCATTGGGCCTCNONE 
Os07g0633800AK103878TATTGGGCCACConserved hypothetical protein. 
AK103878TATTGGGCCTCConserved hypothetical protein. 
J033025K08TATTGGGCCACNONE 
J033025K08TATTGGGCCTCNONE 
J033026N04TATTGGGCCACNONE 
J033026N04TATTGGGCCTCNONE 
J090062M09TATTGGGCCACNONE 
J090062M09TATTGGGCCTCNONE 
J090087F04TATTGGGCCACNONE 
J090087F04TATTGGGCCTCNONE 
Os07g0644300AK066726CTCGGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483CTCGGCCCAATTNONE 
Os07g0664400006-092-E02AGGGCCCAATGCCCATACNONE 
J065053N04AGGGCCCAATGCCCATACGlucose/ribitol dehydrogenase family protein. 
J065057F09AGGGCCCAATGCCCATACNONE 
J065105C24AGGGCCCAATGCCCATACNONE 
J065192I04AGGGCCCAATGCCCATACNONE 
J065199L10AGGGCCCAATGCCCATACNONE 
J065200C14AGGGCCCAATGCCCATACNONE 
J065214L10AGGGCCCAATGCCCATACNONE 
Os07g0673000011-058-G06AATTGGGCCAANONE 
AK063364AATTGGGCCAAConserved hypothetical protein. 
Os07g0673700AK071934ATTGGGCCAACyclin-like F-box domain containing protein. 
AK107556ATTGGGCCAANONE 
Os07g0688300AK068325TATTGGGCCAASimilar to Importin alpha 1. 
AK099611TATTGGGCCAANONE 
Os08g0107900014-055-C03TCCGGCCCAATTNONE 
J065062G20TCCGGCCCAATTNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0139100006-027-E12AATTGGGCCTCNONE 
006-089-E06AATTGGGCCTCNONE 
006-113-G02AATTGGGCCTCNONE 
AK061429AATTGGGCCTCNONE 
AK099590AATTGGGCCTCSimilar to DAG protein, chloroplast precursor. 
AK104727AATTGGGCCTCNONE 
J013043H11AATTGGGCCTCNONE 
J013049N13AATTGGGCCTCNONE 
J065079F01AATTGGGCCTCNONE 
J065122N24AATTGGGCCTCNONE 
J065142J24AATTGGGCCTCNONE 
J065193N03AATTGGGCCTCNONE 
J075041I21AATTGGGCCTCNONE 
J075145E04AATTGGGCCTCNONE 
Os08g0143500006-072-G06TATTGGGCCTANONE 
016-053-H02TATTGGGCCTANONE 
AK061094TATTGGGCCTANONE 
AK071122TATTGGGCCTAGlycosyl transferase, family 14 protein. 
J023081E17TATTGGGCCTANONE 
J023106O18TATTGGGCCTANONE 
J043001N22TATTGGGCCTANONE 
J065062D05TATTGGGCCTANONE 
J065099M15TATTGGGCCTANONE 
J065180K12TATTGGGCCTANONE 
J090045L23TATTGGGCCTANONE 
J100088K05TATTGGGCCTANONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0167500006-063-D04AATTGGGCCGCANONE 
006-066-G09AATTGGGCCGCANONE 
AK061061AATTGGGCCGCAConserved hypothetical protein. 
AK071197AATTGGGCCGCANONE 
J023082N10AATTGGGCCGCANONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0224700AK121754ATTGGGCCTTSimilar to 26S proteasome subunit RPN2a. 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0451101009-086-F06TATTGGGCCCCAProtein of unknown function DUF581 family protein. 
J065021F04TATTGGGCCCCANONE 
J080014E10TATTGGGCCCCANONE 
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE 
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein. 
J100048N11ACCGGCCCAATGGGCCATNONE 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0500900AK102314TATTGGGCCTTSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0511000AK107578TATTGGGCCTGGProtein prenyltransferase domain containing protein. 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0535600AK121683ATGGCCCAATAZinc finger, Tim10/DDP-type family protein. 
J065077E05ATGGCCCAATANONE 
J075088M24ATGGCCCAATANONE 
J075140B03ATGGCCCAATANONE 
J090014B14ATGGCCCAATANONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os09g0101800AK102345GTGGCCCAATWD40-like domain containing protein. 
J090030C23GTGGCCCAATNONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0112400AK109186AATTGGGCCCAAATSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0240500009-064-F01TATTGGGCCGCNONE 
009-169-F01TATTGGGCCGCNONE 
AK062192TATTGGGCCGCNONE 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0325100J080009O19ATGGCCCAATNONE 
J080011H14ATGGCCCAATConserved hypothetical protein. 
J080014F14ATGGCCCAATNONE 
J080014M09ATGGCCCAATNONE 
J080014N20ATGGCCCAATNONE 
J080018K13ATGGCCCAATNONE 
J080023C08ATGGCCCAATNONE 
J080023C09ATGGCCCAATNONE 
J080023K14ATGGCCCAATNONE 
J080025I09ATGGCCCAATNONE 
J080030J04ATGGCCCAATNONE 
J080039D08ATGGCCCAATNONE 
J080039L17ATGGCCCAATNONE 
J080041B13ATGGCCCAATNONE 
J080041P21ATGGCCCAATNONE 
J080042J21ATGGCCCAATNONE 
J080042L19ATGGCCCAATNONE 
J080045F07ATGGCCCAATNONE 
J080047B10ATGGCCCAATNONE 
J080051F23ATGGCCCAATNONE 
J080053D15ATGGCCCAATNONE 
J080053K02ATGGCCCAATNONE 
J080058K18ATGGCCCAATNONE 
J080061M13ATGGCCCAATNONE 
J080064M24ATGGCCCAATNONE 
J080067H07ATGGCCCAATNONE 
J080080B21ATGGCCCAATNONE 
J080080D18ATGGCCCAATNONE 
J080082G07ATGGCCCAATNONE 
J080088B01ATGGCCCAATNONE 
J080088E09ATGGCCCAATNONE 
J080093L01ATGGCCCAATNONE 
Os09g0325300011-005-H08TTTCGGCCCAATTNONE 
AK068435TTTCGGCCCAATTConserved hypothetical protein. 
AK073998TTTCGGCCCAATTNONE 
J033071H21TTTCGGCCCAATTNONE 
J065214H05TTTCGGCCCAATTNONE 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0437900AK107833CTGGCCCAATASimilar to Adrenodoxin. 
Os09g0467700AK061600ATGGCCCAATConserved hypothetical protein. 
AK061600GCGGCCCAATConserved hypothetical protein. 
Os09g0487500AK108131GCCCGGCCCAATConserved hypothetical protein. 
J080062L16GCCCGGCCCAATNONE 
Os09g0495200AK102989ATTGGGCCTCConserved hypothetical protein. 
J075062H18ATTGGGCCTCNONE 
J075098G06ATTGGGCCTCNONE 
Os09g0497400009-087-E03TCGGCCCAATNONE 
AK058354CTCGGCCCAATANONE 
AK058354TCGGCCCAATNONE 
AK068677CTCGGCCCAATAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19CTCGGCCCAATANONE 
J013159B19TCGGCCCAATNONE 
J023011D22CTCGGCCCAATANONE 
J023011D22TCGGCCCAATNONE 
J023081K05CTCGGCCCAATANONE 
J023081K05TCGGCCCAATNONE 
J033060O14CTCGGCCCAATANONE 
J033060O14TCGGCCCAATNONE 
J075020I08CTCGGCCCAATANONE 
J075020I08TCGGCCCAATNONE 
J075034J03CTCGGCCCAATANONE 
J075034J03TCGGCCCAATNONE 
J075049M15CTCGGCCCAATANONE 
J075049M15TCGGCCCAATNONE 
J075065K02CTCGGCCCAATANONE 
J075065K02TCGGCCCAATNONE 
J075099L06CTCGGCCCAATANONE 
J075099L06TCGGCCCAATNONE 
Os09g0509200AK069525GGGCCGGCCCAATTSimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0511700AK101420ATTGGGCCGGGCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
AK101420ATTGGGCCTGSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19ATTGGGCCGGGCNONE 
J013022L19ATTGGGCCTGNONE 
J013036D23ATTGGGCCGGGCNONE 
J013036D23ATTGGGCCTGNONE 
J013037F22ATTGGGCCGGGCNONE 
J013037F22ATTGGGCCTGNONE 
J013111M23ATTGGGCCGGGCNONE 
J013111M23ATTGGGCCTGNONE 
J023109F14ATTGGGCCGGGCNONE 
J023109F14ATTGGGCCTGNONE 
J023119H17ATTGGGCCGGGCNONE 
J023119H17ATTGGGCCTGNONE 
J023133H23ATTGGGCCGGGCNONE 
J023133H23ATTGGGCCTGNONE 
J033032G17ATTGGGCCGGGCNONE 
J033032G17ATTGGGCCTGNONE 
J033038B10ATTGGGCCGGGCNONE 
J033038B10ATTGGGCCTGNONE 
J033071M16ATTGGGCCGGGCNONE 
J033071M16ATTGGGCCTGNONE 
J033096G04ATTGGGCCGGGCNONE 
J033096G04ATTGGGCCTGNONE 
J033109D06ATTGGGCCGGGCNONE 
J033109D06ATTGGGCCTGNONE 
J043016E22ATTGGGCCGGGCNONE 
J043016E22ATTGGGCCTGNONE 
J043022O09ATTGGGCCGGGCNONE 
J043022O09ATTGGGCCTGNONE 
J100023N11ATTGGGCCGGGCNONE 
J100023N11ATTGGGCCTGNONE 
J100046I21ATTGGGCCGGGCNONE 
J100046I21ATTGGGCCTGNONE 
Os09g0528100009-173-A08TATTGGGCCAANONE 
009-190-G12TATTGGGCCAANONE 
AK059096TATTGGGCCAASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0566100J013035O15ATTGGGCCTTNONE 
J013132B07ATTGGGCCTTNONE 
J023049I24ATTGGGCCTTNONE 
J033033A21ATTGGGCCTTNONE 
J033057C14ATTGGGCCTTNONE 
Os11g0150400006-104-E01CTGGCCCAATNONE 
009-067-G02CTGGCCCAATNONE 
AK058243CTGGCCCAATDimeric alpha-beta barrel domain containing protein. 
AK061232CTGGCCCAATNONE 
AK099186CTGGCCCAATNONE 
Os11g0163500AK101154GAGGCCCAATAHomeodomain-like containing protein. 
Os11g0171700AK099115ATTGGGCCAASMAD/FHA domain containing protein. 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0209100016-063-F03AATTGGGCCNONE 
AK064391AATTGGGCCCyclin-like F-box domain containing protein. 
J075027K02AATTGGGCCNONE 
J075154K15AATTGGGCCNONE 
Os11g0219400AK069850TATTGGGCCGTGCCTGGGCCGTGAnkyrin repeat containing protein. 
AK099123TATTGGGCCGTGCCTGGGCCGTGNONE 
J023143G18TATTGGGCCGTGCCTGGGCCGTGNONE 
Os11g0220300AK068820AATTGGGCCCCAGConserved hypothetical protein. 
Os11g0244200AK107883ATTGGGCCCAACTSimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0286800AK072702AATTGGGCCTATerpene synthase family protein. 
AK100763AATTGGGCCTANONE 
AK107355AATTGGGCCTANONE 
J013026O22AATTGGGCCTANONE 
J013065A14AATTGGGCCTANONE 
J013129G22AATTGGGCCTANONE 
J023119J04AATTGGGCCTANONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os11g0606300J075039E08ATTGGGCCGGCCCGGTNONE 
J075044E18ATTGGGCCGGCCCGGTNONE 
J075053G16ATTGGGCCGGCCCGGTConserved hypothetical protein. 
Os11g0640000Os11g0640000GCGGCCCAATTNB-ARC domain containing protein. 
Os11g0640000TCGGCCCAATANB-ARC domain containing protein. 
Os12g0112250J013069O10TATTGGGCCGCASaposin B domain containing protein. 
J065206G04TATTGGGCCGCANONE 
J080302C06TATTGGGCCGCANONE 
J080306K06TATTGGGCCGCANONE 
J080307O09TATTGGGCCGCANONE 
J080310J07TATTGGGCCGCANONE 
J080311G18TATTGGGCCGCANONE 
J080318C07TATTGGGCCGCANONE 
Os12g0133600AK103096TATTGGGCCGCAConserved hypothetical protein. 
J033118M03TATTGGGCCGCANONE 
Os12g0136600AK064762ATTGGGCCTTGConserved hypothetical protein. 
J075198J21ATTGGGCCTTGNONE 
J080024B04ATTGGGCCTTGNONE 
J080042H13ATTGGGCCTTGNONE 
J080042J18ATTGGGCCTTGNONE 
J080068A13ATTGGGCCTTGNONE 
J080076G10ATTGGGCCTTGNONE 
J080076H12ATTGGGCCTTGNONE 
J080097E20ATTGGGCCTTGNONE 
J080097L07ATTGGGCCTTGNONE 
J090049I08ATTGGGCCTTGNONE 
Os12g0150100009-047-B11AAATGGGCCCAATNONE 
AK105075AAATGGGCCCAATSimilar to 60S ribosomal protein L26A. 
J013067G22AAATGGGCCCAATNONE 
J033103F08AAATGGGCCCAATNONE 
J065029P11AAATGGGCCCAATNONE 
J065043B18AAATGGGCCCAATNONE 
J065123E16AAATGGGCCCAATNONE 
J065141O20AAATGGGCCCAATNONE 
J065161O04AAATGGGCCCAATNONE 
J065201M07AAATGGGCCCAATNONE 
J075058I23AAATGGGCCCAATNONE 
J075172J08AAATGGGCCCAATNONE 
J100040L13AAATGGGCCCAATNONE 
Os12g0156400012-065-D02AATTGGGCCTCNONE 
AK072086AATTGGGCCTCNONE 
AK099278AATTGGGCCTCDcp1-like decapping family protein. 
J013063H09AATTGGGCCTCNONE 
J023125D09AATTGGGCCTCNONE 
J023149G21AATTGGGCCTCNONE 
J033064E07AATTGGGCCTCNONE 
J033093C07AATTGGGCCTCNONE 
J033107E06AATTGGGCCTCNONE 
J075172A11AATTGGGCCTCNONE 
J090009E07AATTGGGCCTCNONE 
J090023F13AATTGGGCCTCNONE 
J090071N18AATTGGGCCTCNONE 
Os12g0190100AK109819AGGGCCCAATSimilar to Auxin-independent growth promoter-like protein. 
Os12g0228900J033132F01AATTGGGCCCNONE 
J043003P05AATTGGGCCCNONE 
J065079N16AATTGGGCCCNONE 
J065141L03AATTGGGCCCNONE 
J075001I21AATTGGGCCCNONE 
J075032L11AATTGGGCCCNONE 
J075126O12AATTGGGCCCNONE 
J100079E06AATTGGGCCCNONE 
Os12g0236900AK068145CTGGCCCAATNuclear protein SET domain containing protein. 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0503200014-087-C11TAGGCCCAATTNONE 
AK105377TAGGCCCAATTNONE 
Os12g0565800AK072828AGGGCCCAATZinc finger, TTF-type domain containing protein. 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0575000009-057-B12ATTGGGCCATNONE 
009-113-B05ATTGGGCCATNONE 
009-170-F09ATTGGGCCATNONE 
009-191-D05ATTGGGCCATNONE 
AK059885ATTGGGCCATNONE 
AK104945ATTGGGCCATProtein of unknown function DUF1118 family protein. 
J013124C09ATTGGGCCATNONE 
J013156G23ATTGGGCCATNONE 
J023033G18ATTGGGCCATNONE 
J065055H05ATTGGGCCATNONE 
J065129P17ATTGGGCCATNONE 
J065188E10ATTGGGCCATNONE 
J065195J24ATTGGGCCATNONE 
J075027I24ATTGGGCCATNONE 
J075028H07ATTGGGCCATNONE 
J075032A03ATTGGGCCATNONE 
J075057M10ATTGGGCCATNONE 
J075093K11ATTGGGCCATNONE 
J075098D20ATTGGGCCATNONE 
J075126N24ATTGGGCCATNONE 
J075140M14ATTGGGCCATNONE 
J075140M21ATTGGGCCATNONE 
J075147P07ATTGGGCCATNONE 
J075153F12ATTGGGCCATNONE 
J075157C13ATTGGGCCATNONE 
J075174K01ATTGGGCCATNONE 
J075194B17ATTGGGCCATNONE 
J075195E11ATTGGGCCATNONE 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
Os12g0605400009-005-G05CTGGCCCAATNONE 
016-024-B01CTGGCCCAATNONE 
016-043-A11CTGGCCCAATNONE 
AK068060CTGGCCCAATSimilar to CROC-1-like protein (Fragment). 
J013130B07CTGGCCCAATNONE 
J023141C14CTGGCCCAATNONE 
J033037O04CTGGCCCAATNONE 
J033081L17CTGGCCCAATNONE 
J033108C03CTGGCCCAATNONE 
J065079G22CTGGCCCAATNONE 
J065082D03CTGGCCCAATNONE 
J065207O15CTGGCCCAATNONE 
J075027C23CTGGCCCAATNONE 
J075037A17CTGGCCCAATNONE 
J075056D17CTGGCCCAATNONE 
J075064O21CTGGCCCAATNONE 
J075096E08CTGGCCCAATNONE 
J090036I15CTGGCCCAATNONE 
J100018P15CTGGCCCAATNONE 
J100074O06CTGGCCCAATNONE 
Os12g0610100Os12g0610100CAGGCCCAATTConserved hypothetical protein. 
Os12g0610100TACGGCCCAATAConserved hypothetical protein. 
Os12g0611000AK111837ATTGGGCCCAAACSimilar to Zinc-finger protein Lsd1. 
Os12g0612500Os12g0612500ATTGGGCCGGCCCATTTModification methylase HemK family protein. 
Os12g0615300AK119448TATTGGGCCGCAEGF-like calcium-binding domain containing protein. 
Os12g0616900AK063753AATTGGGCCTTSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464AATTGGGCCTTNONE 
J033126J16AATTGGGCCTTNONE 
J065140B05AATTGGGCCTTNONE 
Os12g0636600AK111056AATTGGGCCGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.