version

Summary of OsREG493 (All List)

OrganismOryza sativa  
IDOsREG493  
SequenceATTTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1874  

Entry Sequences (1874 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422CTGGCCCAAATPeptidyl-tRNA hydrolase family protein. 
Os01g0138500AK073435GCCCAAATProtein of unknown function DUF789 family protein. 
J023118K18GCCCAAATNONE 
J033039C22GCCCAAATNONE 
Os01g0147200016-005-F02ATTTGGGCCGGANONE 
AK106463ATTTGGGCCGGANONE 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
J033098O16ATTTGGGCCGGANONE 
J033106E16ATTTGGGCCGGANONE 
J043026D12ATTTGGGCCGGANONE 
J065070B04ATTTGGGCCGGANONE 
J065162L03ATTTGGGCCGGANONE 
J065166F01ATTTGGGCCGGANONE 
J075030A13ATTTGGGCCGGANONE 
J075093O12ATTTGGGCCGGANONE 
J075106K15ATTTGGGCCGGANONE 
J075107F20ATTTGGGCCGGANONE 
J090031F21ATTTGGGCCGGANONE 
J090079E17ATTTGGGCCGGANONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0327600AK120216ATTTGGGCCTGANONE 
AK121799ATTTGGGCCTGAConserved hypothetical protein. 
J065081I07ATTTGGGCCTGANONE 
J065082D04ATTTGGGCCTGANONE 
J065082G10ATTTGGGCCTGANONE 
J065085G24ATTTGGGCCTGANONE 
J065105J24ATTTGGGCCTGANONE 
J065128D18ATTTGGGCCTGANONE 
J065155D13ATTTGGGCCTGANONE 
J065200C11ATTTGGGCCTGANONE 
Os01g0379400016-006-B06GCCCACCATTTGGGCNONE 
AK064420GCCCACCATTTGGGCNONE 
AK102388GCCCACCATTTGGGCNONE 
AK110939GCCCACCATTTGGGCCyclin-like F-box domain containing protein. 
J033092D18GCCCACCATTTGGGCNONE 
J065070N09GCCCACCATTTGGGCNONE 
J065078L01GCCCACCATTTGGGCNONE 
J065083G15GCCCACCATTTGGGCNONE 
Os01g0571200014-074-A10ATTTGGGCCTANONE 
AK121299ATTTGGGCCTASimilar to Ribosomal protein L34. 
J023110L12ATTTGGGCCTANONE 
Os01g0580200AK103045GCCCAAATSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023141C23GCCCAAATNONE 
J033097N10GCCCAAATNONE 
J033117F22GCCCAAATNONE 
J053098K12GCCCAAATNONE 
J065029C14GCCCAAATNONE 
J065082G13GCCCAAATNONE 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01TCATGGGCCCAAATNONE 
Os01g0616600009-171-H09ATTTGGGCCGCANONE 
011-005-G09ATTTGGGCCGCANONE 
012-089-C03ATTTGGGCCGCANONE 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
AK101490ATTTGGGCCGCANONE 
Os01g0621600AK100122ATTTGGGCCAGProtein of unknown function DUF1221 domain containing protein. 
Os01g0643900AK108288ATTTGGGCTOleosin family protein. 
Os01g0644200014-007-H12ATTTGGGCTNONE 
AK063634ATTTGGGCTConserved hypothetical protein. 
AY549310ATTTGGGCTNONE 
J075068F10ATTTGGGCTNONE 
J075082A11ATTTGGGCTNONE 
Os01g0678700AK111611GCCCAAATDP protein. 
AY224529GCCCAAATNONE 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0707300AK059962ATTTGGGCCATNONE 
AK104463ATTTGGGCCATSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0737900012-087-D12ATTTGGGCCTANONE 
AK072600ATTTGGGCCTAProtein prenyltransferase domain containing protein. 
J023006E12ATTTGGGCCTANONE 
J023130A18ATTTGGGCCTANONE 
J023134O05ATTTGGGCCTANONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0773500009-029-F02TCCGGCCCAAATNONE 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0784600AK067527GCCCAAATConserved hypothetical protein. 
Os01g0805400AK105954ATTTGGGCTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0823600J075039G17GCCCAAATConserved hypothetical protein. 
J075042I11GCCCAAATNONE 
J075054M24GCCCAAATNONE 
J075074C22GCCCAAATNONE 
J075081G13GCCCAAATNONE 
J075099I03GCCCAAATNONE 
J075108D14GCCCAAATNONE 
J075129O14GCCCAAATNONE 
J075136P07GCCCAAATNONE 
J075149P09GCCCAAATNONE 
J075157K12GCCCAAATNONE 
J075176K20GCCCAAATNONE 
J080302C21GCCCAAATNONE 
Os01g0827400AK108526ATTTGGGCTPrenylated rab acceptor PRA1 family protein. 
J065099C03ATTTGGGCTNONE 
J075090E23ATTTGGGCTNONE 
Os01g0832200004-009-E08ATTTGGGCTGGNONE 
009-103-F06ATTTGGGCTGGNONE 
AK060017ATTTGGGCTGGNONE 
AK068980ATTTGGGCTGGConserved hypothetical protein. 
J023085I24ATTTGGGCTGGNONE 
J090016I03ATTTGGGCTGGNONE 
J090078K06ATTTGGGCTGGNONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0908800AK065889ATTTGGGCCGAProtein prenyltransferase domain containing protein. 
AK065889ATTTGGGCTProtein prenyltransferase domain containing protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0101500012-006-E03ATTTGGGCCCCNONE 
013-006-A02ATTTGGGCCCCNONE 
013-011-F03ATTTGGGCCCCNONE 
AK067642ATTTGGGCCCCNONE 
AK072105ATTTGGGCCCCSimilar to NADH-dependent hydroxypyruvate reductase (EC 1.1.1.29) (Fragment). 
J013027G04ATTTGGGCCCCNONE 
J013034P10ATTTGGGCCCCNONE 
J013039D15ATTTGGGCCCCNONE 
J013048P14ATTTGGGCCCCNONE 
J013050O03ATTTGGGCCCCNONE 
J013056H19ATTTGGGCCCCNONE 
J013071D11ATTTGGGCCCCNONE 
J013097D17ATTTGGGCCCCNONE 
J013104F13ATTTGGGCCCCNONE 
J013108J23ATTTGGGCCCCNONE 
J013119J12ATTTGGGCCCCNONE 
J013122N16ATTTGGGCCCCNONE 
J013146M24ATTTGGGCCCCNONE 
J013149E16ATTTGGGCCCCNONE 
J013157E04ATTTGGGCCCCNONE 
J023012P06ATTTGGGCCCCNONE 
J023050C21ATTTGGGCCCCNONE 
J023107F18ATTTGGGCCCCNONE 
J023110B19ATTTGGGCCCCNONE 
J023111H01ATTTGGGCCCCNONE 
J023148P04ATTTGGGCCCCNONE 
J043009E13ATTTGGGCCCCNONE 
J043009H22ATTTGGGCCCCNONE 
J065007D17ATTTGGGCCCCNONE 
J065038K16ATTTGGGCCCCNONE 
J065042A01ATTTGGGCCCCNONE 
J065075C20ATTTGGGCCCCNONE 
J065091I04ATTTGGGCCCCNONE 
J065131A03ATTTGGGCCCCNONE 
J075152O18ATTTGGGCCCCNONE 
J075152P17ATTTGGGCCCCNONE 
J080001F06ATTTGGGCCCCNONE 
J080002H09ATTTGGGCCCCNONE 
J080004L23ATTTGGGCCCCNONE 
J080005H18ATTTGGGCCCCNONE 
J080010D22ATTTGGGCCCCNONE 
J080010G17ATTTGGGCCCCNONE 
J080013E07ATTTGGGCCCCNONE 
J080013P18ATTTGGGCCCCNONE 
J080015D22ATTTGGGCCCCNONE 
J080025H24ATTTGGGCCCCNONE 
J080026O03ATTTGGGCCCCNONE 
J080036J01ATTTGGGCCCCNONE 
J080036L03ATTTGGGCCCCNONE 
J080037O13ATTTGGGCCCCNONE 
J080041D10ATTTGGGCCCCNONE 
J080045J04ATTTGGGCCCCNONE 
J080046J06ATTTGGGCCCCNONE 
J080048G16ATTTGGGCCCCNONE 
J080048I21ATTTGGGCCCCNONE 
J080056F16ATTTGGGCCCCNONE 
J080056L16ATTTGGGCCCCNONE 
J080057C02ATTTGGGCCCCNONE 
J080058D03ATTTGGGCCCCNONE 
J080061B19ATTTGGGCCCCNONE 
J080061E16ATTTGGGCCCCNONE 
J080061L22ATTTGGGCCCCNONE 
J080062P08ATTTGGGCCCCNONE 
J080067C01ATTTGGGCCCCNONE 
J080067G13ATTTGGGCCCCNONE 
J080068F20ATTTGGGCCCCNONE 
J080072H15ATTTGGGCCCCNONE 
J080072P12ATTTGGGCCCCNONE 
J080079O21ATTTGGGCCCCNONE 
J080081J15ATTTGGGCCCCNONE 
J080081K02ATTTGGGCCCCNONE 
J080085O11ATTTGGGCCCCNONE 
J080086N15ATTTGGGCCCCNONE 
J080087E22ATTTGGGCCCCNONE 
J080087O15ATTTGGGCCCCNONE 
J080091D07ATTTGGGCCCCNONE 
J080091J02ATTTGGGCCCCNONE 
J080091L21ATTTGGGCCCCNONE 
J080093B13ATTTGGGCCCCNONE 
J100069F01ATTTGGGCCCCNONE 
J100086B08ATTTGGGCCCCNONE 
Os02g0102700006-096-A07TAGGCCCAAATNONE 
AK061193TAGGCCCAAATSimilar to AGL157Cp. 
AK061558TAGGCCCAAATNONE 
AK103689TAGGCCCAAATNONE 
J023128B06TAGGCCCAAATNONE 
J033136G21TAGGCCCAAATNONE 
J053084F10TAGGCCCAAATNONE 
J053089D12TAGGCCCAAATNONE 
J075149B12TAGGCCCAAATNONE 
J075165L17TAGGCCCAAATNONE 
Os02g0116400AK072347CTGGCCCAAATOligopeptide transporter OPT superfamily protein. 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0134500AK108836ATTTGGGCConserved hypothetical protein. 
Os02g0138200AK062066ATTTGGGCTNONE 
AK068239ATTTGGGCTNONE 
J013147K19ATTTGGGCTNONE 
Os02g0176400009-099-H11AGCCCAACCAGGGCCCAAATNONE 
009-099-H11GCCCAAATNONE 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
AK062746GCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0186700AK064492GAGGCCCAAATConserved hypothetical protein. 
J065210K09GAGGCCCAAATNONE 
J075006A17GAGGCCCAAATNONE 
J075108C18GAGGCCCAAATNONE 
J075153E08GAGGCCCAAATNONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0196600AK100988AGCCCAAATATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein. 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0321900AK058256GCCCAAATNONE 
AK062103GCCCAAATSimilar to 60S ribosomal protein L10a-1. 
AK102574GCCCAAATNONE 
J065176M06GCCCAAATNONE 
J075112D24GCCCAAATNONE 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0510200AK058963ATTTGGGCTGCNONE 
Os02g0521300AK120851GCCCAAATC2 domain containing protein. 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0567000AK068282TAGGCCCAAATConserved hypothetical protein. 
J075034A17TAGGCCCAAATNONE 
J075129I09TAGGCCCAAATNONE 
Os02g0578400Os02g0578400GAGGCCCAAATPhotosystem II oxygen evolving complex protein PsbQ family protein. 
Os02g0595400AK069935CTGGCCCAAATConserved hypothetical protein. 
AK099175CTGGCCCAAATNONE 
AK103993CTGGCCCAAATNONE 
J065021M23CTGGCCCAAATNONE 
J065021M24CTGGCCCAAATNONE 
J065205M09CTGGCCCAAATNONE 
J100082C06CTGGCCCAAATNONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0618700AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15GCCCAGCCCAAATNONE 
Os02g0621600AK071074AAGGCCCAAATNONE 
AK108575AAGGCCCAAATConserved hypothetical protein. 
J023078O20AAGGCCCAAATNONE 
J075025M01AAGGCCCAAATNONE 
J090047L11AAGGCCCAAATNONE 
Os02g0632500AK101701ATTTGGGCArf GTPase activating protein family protein. 
Os02g0672700AK059611ATTTGGGCDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179ATTTGGGCNONE 
J023098L23ATTTGGGCNONE 
J065042J21ATTTGGGCNONE 
J065187L09ATTTGGGCNONE 
J065190O10ATTTGGGCNONE 
J080041G14ATTTGGGCNONE 
J080078K08ATTTGGGCNONE 
J080089D20ATTTGGGCNONE 
J080094D04ATTTGGGCNONE 
Os02g0688900AK066093ATTTGGGCCATGPI transamidase subunit PIG-U family protein. 
J065007D18ATTTGGGCCATNONE 
J065040G21ATTTGGGCCATNONE 
J065103G03ATTTGGGCCATNONE 
J065175F18ATTTGGGCCATNONE 
J065202A07ATTTGGGCCATNONE 
J075006C01ATTTGGGCCATNONE 
J075178F24ATTTGGGCCATNONE 
Os02g0705300006-028-G05GCCCAAAATTTGGGCTNONE 
006-064-H09GCCCAAAATTTGGGCTNONE 
AK062089GCCCAAAATTTGGGCTNONE 
AK064855GCCCAAAATTTGGGCTNONE 
AK106164GCCCAAAATTTGGGCTTubby family protein. 
Os02g0720600006-086-D09ATTTGGGCTGTNONE 
AK101967ATTTGGGCTGTPeptidase A1, pepsin family protein. 
AK105989ATTTGGGCTGTNONE 
J023073N17ATTTGGGCTGTNONE 
J033076I21ATTTGGGCTGTNONE 
J065057O13ATTTGGGCTGTNONE 
J065101I01ATTTGGGCTGTNONE 
J065102J23ATTTGGGCTGTNONE 
J065122L12ATTTGGGCTGTNONE 
J065132N22ATTTGGGCTGTNONE 
J065167A04ATTTGGGCTGTNONE 
J065168G11ATTTGGGCTGTNONE 
J065188C07ATTTGGGCTGTNONE 
J100018E15ATTTGGGCTGTNONE 
J100035L14ATTTGGGCTGTNONE 
J100041M01ATTTGGGCTGTNONE 
J100056J07ATTTGGGCTGTNONE 
J100065J09ATTTGGGCTGTNONE 
J100072E07ATTTGGGCTGTNONE 
J100081G12ATTTGGGCTGTNONE 
J100083G22ATTTGGGCTGTNONE 
J100085E19ATTTGGGCTGTNONE 
J100090P18ATTTGGGCTGTNONE 
Os02g0752300AK072544GCGGCCCAAATConserved hypothetical protein. 
J023132N16GCGGCCCAAATNONE 
J033069F17GCGGCCCAAATNONE 
Os02g0753200AK067176GTTTGGGCCCAAATConserved hypothetical protein. 
J013097D23GTTTGGGCCCAAATNONE 
J065085J01GTTTGGGCCCAAATNONE 
J065152L23GTTTGGGCCCAAATNONE 
J065162F18GTTTGGGCCCAAATNONE 
J075002K17GTTTGGGCCCAAATNONE 
J075047D24GTTTGGGCCCAAATNONE 
J075064A01GTTTGGGCCCAAATNONE 
J075075C09GTTTGGGCCCAAATNONE 
J075088M01GTTTGGGCCCAAATNONE 
J075130K03GTTTGGGCCCAAATNONE 
J075146K03GTTTGGGCCCAAATNONE 
J090049F07GTTTGGGCCCAAATNONE 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0762300AK106684TCAGCCCAAATProtein of unknown function UPF0021 family protein. 
J090060M09TCAGCCCAAATNONE 
J100083E05TCAGCCCAAATNONE 
Os02g0777950J090078H24GTTTGGGCCCAAATConserved hypothetical protein. 
Os02g0782500013-043-A07ATTTGGGCTTTNONE 
013-068-B10ATTTGGGCTTTNONE 
013-093-A08ATTTGGGCTTTNONE 
014-083-C12ATTTGGGCTTTNONE 
AK063602ATTTGGGCTTTNONE 
AK119261ATTTGGGCTTTSimilar to Small heat stress protein class CIII. 
J065013N12ATTTGGGCTTTNONE 
J075136E01ATTTGGGCTTTNONE 
J075149G04ATTTGGGCTTTNONE 
Os02g0814300AK111376ATTTGGGCCACCytochrome c, monohaem domain containing protein. 
AK111376GAGGCCCAAATCytochrome c, monohaem domain containing protein. 
J065063I24ATTTGGGCCACNONE 
J065063I24GAGGCCCAAATNONE 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0824700009-023-E06ATTTGGGCCTCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18ATTTGGGCCTCNONE 
J065017H21ATTTGGGCCTCNONE 
J065052N02ATTTGGGCCTCNONE 
J065053M01ATTTGGGCCTCNONE 
J065064B14ATTTGGGCCTCNONE 
J065146K22ATTTGGGCCTCNONE 
Os02g0834700AK061331CTCGGCCCAAATNONE 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0125000006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0148000AK110468ATTTGGGCTTCProtein of unknown function DUF677 family protein. 
Os03g0151900009-084-F09AGCCCAAATNONE 
AB032761AGCCCAAATNONE 
AK105389AGCCCAAATNONE 
AK121527AGCCCAAATSimilar to Small GTP-binding protein. 
J075028M03AGCCCAAATNONE 
J075031H15AGCCCAAATNONE 
J075045L24AGCCCAAATNONE 
J075055K14AGCCCAAATNONE 
J075100O08AGCCCAAATNONE 
J075112B20AGCCCAAATNONE 
J075188D21AGCCCAAATNONE 
Os03g0182600006-028-E05GCCCAAATNONE 
006-047-F10GCCCAAATNONE 
009-123-C08GCCCAAATNONE 
016-033-G05GCCCAAATNONE 
AK061289GCCCAAATRibosomal protein S2 family protein. 
AK066899GCCCAAATNONE 
J013065H05GCCCAAATNONE 
J023012F15GCCCAAATNONE 
J023065M10GCCCAAATNONE 
J033079N15GCCCAAATNONE 
J033109E21GCCCAAATNONE 
J033148M14GCCCAAATNONE 
J043015G23GCCCAAATNONE 
J043022M01GCCCAAATNONE 
J053060D01GCCCAAATNONE 
J053062E24GCCCAAATNONE 
J053096N12GCCCAAATNONE 
J053098N02GCCCAAATNONE 
J090024N09GCCCAAATNONE 
J090027G22GCCCAAATNONE 
J090043C10GCCCAAATNONE 
J090063F05GCCCAAATNONE 
J090066J05GCCCAAATNONE 
J090073I17GCCCAAATNONE 
J090087L04GCCCAAATNONE 
J100075O12GCCCAAATNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0210400AK065966ATTTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0244200003-114-A11ATTTGGGCNONE 
015-089-B03ATTTGGGCNONE 
016-048-G01ATTTGGGCNONE 
AK101837ATTTGGGCSimilar to Thaumatin-like protein. 
AK105771ATTTGGGCNONE 
AK107182ATTTGGGCNONE 
J065054I12ATTTGGGCNONE 
J065208F20ATTTGGGCNONE 
J075088F18ATTTGGGCNONE 
J075092G13ATTTGGGCNONE 
J075120G01ATTTGGGCNONE 
J075147M20ATTTGGGCNONE 
J075151J03ATTTGGGCNONE 
J100064H21ATTTGGGCNONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0255500AK102392ATTTGGGCCTCSimilar to Phosphoenolpyruvate carboxykinase 4 (EC 4.1.1.49) (Fragment). 
Os03g0261500AK061995ATTTGGGCCTCNONE 
J013044K20ATTTGGGCCTCNONE 
J033113A11ATTTGGGCCTCNONE 
J100032O18ATTTGGGCCTCNONE 
J100037K21ATTTGGGCCTCNONE 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0274000AK119251ATTTGGGCNONE 
J080046E19ATTTGGGCNONE 
J080050M05ATTTGGGCNONE 
J080057N03ATTTGGGCNONE 
J080061A16ATTTGGGCNONE 
J080094M24ATTTGGGCNONE 
J090013O05ATTTGGGCNONE 
Os03g0278900006-049-H12TACGGCCCAAATNONE 
006-082-A07TACGGCCCAAATNONE 
009-169-C04TACGGCCCAAATNONE 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCAAATNONE 
AY224460TACGGCCCAAATNONE 
J065021K17TACGGCCCAAATNONE 
J065141H24TACGGCCCAAATNONE 
J065142J20TACGGCCCAAATNONE 
J065152J03TACGGCCCAAATNONE 
J065163A13TACGGCCCAAATNONE 
J065191I21TACGGCCCAAATNONE 
J065193K12TACGGCCCAAATNONE 
J075003D01TACGGCCCAAATNONE 
J075017D24TACGGCCCAAATNONE 
J075060F20TACGGCCCAAATNONE 
J075154C11TACGGCCCAAATNONE 
J075173F04TACGGCCCAAATNONE 
Os03g0283100006-097-E01ATTTGGGCCGAGNONE 
AK061849ATTTGGGCCGAGNONE 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
J013044J05ATTTGGGCCGAGNONE 
J013130I02ATTTGGGCCGAGNONE 
J013162M18ATTTGGGCCGAGNONE 
J023014O17ATTTGGGCCGAGNONE 
J023139N17ATTTGGGCCGAGNONE 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
J033119B03ATTTGGGCCCCACANONE 
J065205G10ATTTGGGCCCCACANONE 
J080069C17ATTTGGGCCCCACANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
Os03g0300600003-125-G06AGCCCAAATNONE 
006-048-C04AGCCCAAATNONE 
009-044-A09AGCCCAAATNONE 
AK059801AGCCCAAATNONE 
AK066250AGCCCAAATSimilar to Chaperone protein dnaJ. 
AK069897AGCCCAAATNONE 
AK104186AGCCCAAATNONE 
J065197D15AGCCCAAATNONE 
J090031C11AGCCCAAATNONE 
J100024C23AGCCCAAATNONE 
J100030B16AGCCCAAATNONE 
J100033K12AGCCCAAATNONE 
J100043M19AGCCCAAATNONE 
J100056N09AGCCCAAATNONE 
J100058E12AGCCCAAATNONE 
J100084J08AGCCCAAATNONE 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0324800AK059868GAGGCCCAAATNONE 
AK071431GAGGCCCAAATHypothetical protein. 
Os03g0331900AK063044ATTTGGGCTTGNONE 
AK099570ATTTGGGCTTGConserved hypothetical protein. 
J065064G01ATTTGGGCTTGNONE 
Os03g0335100AK107094CCAGCCCAAATConserved hypothetical protein. 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0363350Os03g0363350GCCCAAATProtein of unknown function DUF455 family protein. 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0647500015-025-E10GCCCAAATNONE 
AK064308GCCCAAATConserved hypothetical protein. 
AK103649GCCCAAATNONE 
J033135D01GCCCAAATNONE 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAATNONE 
J023008E04CACGGCCCAAATNONE 
J023030D22CACGGCCCAAATNONE 
J033027E16CACGGCCCAAATNONE 
J033046D09CACGGCCCAAATNONE 
J033068I10CACGGCCCAAATNONE 
J033135A12CACGGCCCAAATNONE 
J065027E22CACGGCCCAAATNONE 
J065191K23CACGGCCCAAATNONE 
J090054D15CACGGCCCAAATNONE 
J090058J15CACGGCCCAAATNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0806600AK070959ATTTGGGCConserved hypothetical protein. 
J075036P17ATTTGGGCNONE 
J075168O13ATTTGGGCNONE 
J075177J23ATTTGGGCNONE 
Os03g0821900AK070847ATTTGGGCCATSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0833700011-060-A10ATTTGGGCCTANONE 
AK121918ATTTGGGCCTARNA 3'-terminal phosphate cyclase family protein. 
Os03g0855700AK070400ATGGCCCAAATNucleic acid-binding, OB-fold domain containing protein. 
Os03g0858700006-024-D11GCCCAAATNONE 
AK061723GCCCAAATProtein of unknown function DUF1499 family protein. 
AK064976GCCCAAATNONE 
J013001B23GCCCAAATNONE 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0445200009-034-A06GAGGCCCAAATNONE 
AK062427GAGGCCCAAATProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720GAGGCCCAAATNONE 
J065022E20GAGGCCCAAATNONE 
J065062D16GAGGCCCAAATNONE 
J065081I02GAGGCCCAAATNONE 
J065087C10GAGGCCCAAATNONE 
J065116N16GAGGCCCAAATNONE 
J065132F10GAGGCCCAAATNONE 
J065140F18GAGGCCCAAATNONE 
J065143M22GAGGCCCAAATNONE 
J065158K17GAGGCCCAAATNONE 
J065162D07GAGGCCCAAATNONE 
J065207H19GAGGCCCAAATNONE 
J075155B20GAGGCCCAAATNONE 
J075167E24GAGGCCCAAATNONE 
J075178B19GAGGCCCAAATNONE 
J080301D22GAGGCCCAAATNONE 
J080301J15GAGGCCCAAATNONE 
J080308J02GAGGCCCAAATNONE 
Os04g0449000AK064234ATTTGGGCCGNONE 
AK105976ATTTGGGCCGNONE 
Os04g0451200006-041-H09ATTTGGGCNONE 
AK061024ATTTGGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK068176ATTTGGGCNONE 
J065045M24ATTTGGGCNONE 
Os04g0477900006-046-B01ATTTGGGCCGCANONE 
006-103-C03ATTTGGGCCGCANONE 
006-106-F09ATTTGGGCCGCANONE 
009-093-B07ATTTGGGCCGCANONE 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTTGGGCCGCANONE 
J013158A11ATTTGGGCCGCANONE 
J023050E17ATTTGGGCCGCANONE 
J023078J03ATTTGGGCCGCANONE 
J033027G18ATTTGGGCCGCANONE 
J033086G10ATTTGGGCCGCANONE 
J090060G14ATTTGGGCCGCANONE 
Os04g0481100AK119297ATTTGGGCTTGNONE 
Os04g0520900AK068793TAGGCCCAAATProtein prenyltransferase domain containing protein. 
AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TAGGCCCAAATNONE 
AK105606TCTCGGCCCAAATNONE 
Os04g0531300016-006-E10ACAGCCCAAATNONE 
AK072647ACAGCCCAAATDihydrouridine synthase, DuS family protein. 
AK103911ACAGCCCAAATNONE 
J013038P22ACAGCCCAAATNONE 
J023130D01ACAGCCCAAATNONE 
J033150P13ACAGCCCAAATNONE 
J043026L14ACAGCCCAAATNONE 
J065049A08ACAGCCCAAATNONE 
J065215C17ACAGCCCAAATNONE 
Os04g0581300009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0602400AK071005GCCCAAATSimilar to Maltose excess protein 1, chloroplast precursor (Root cap protein 1). 
J023078D11GCCCAAATNONE 
Os04g0609200AK103652ATTTGGGCTMajor facilitator superfamily protein. 
Os04g0610500006-115-C07TACGGCCCAAATNONE 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TACGGCCCAAATNONE 
J013096N09TACGGCCCAAATNONE 
J023054I11TACGGCCCAAATNONE 
J023121P20TACGGCCCAAATNONE 
J053039O20TACGGCCCAAATNONE 
J053071L20TACGGCCCAAATNONE 
J053088H23TACGGCCCAAATNONE 
J053096J03TACGGCCCAAATNONE 
Os04g0645100AK100454AGCCCAAATNONE 
J075047L12AGCCCAAATNONE 
J075095P06AGCCCAAATNONE 
J090024C03AGCCCAAATNONE 
J090054E23AGCCCAAATNONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0682300AK061384GCCCAAATSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004GCCCAAATNONE 
J033102P12GCCCAAATNONE 
J100038F01GCCCAAATNONE 
Os04g0690600011-007-D04ATTTGGGCNONE 
AK109449ATTTGGGCConserved hypothetical protein. 
J065019H13ATTTGGGCNONE 
J065021N08ATTTGGGCNONE 
J065085C08ATTTGGGCNONE 
J065214O07ATTTGGGCNONE 
Os05g0110500AK060179TACGGCCCAAATNONE 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
J013055E22TACGGCCCAAATNONE 
J090056E03TACGGCCCAAATNONE 
Os05g0121700016-085-G05ATTTGGGCNONE 
AK106510ATTTGGGCNONE 
AK107571ATTTGGGCRecA bacterial DNA recombination family protein. 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0127500AK068517GCCCAAATSimilar to Leucoanthocyanidin dioxygenase-like protein. 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0178100AK120915CAAGCCCAAATGA 3beta-hydroxylase. 
Os05g0215500AK070424ATTTGGGCCATHypothetical protein. 
J023050J01ATTTGGGCCATNONE 
Os05g0224800AK111685GAAGCCCAAATSimilar to Modification methyltransferase, cytosine-specific. 
J013170M08GAAGCCCAAATNONE 
Os05g0226300AK067770ATTTGGGCCTTConserved hypothetical protein. 
J013120H22ATTTGGGCCTTNONE 
J013146E15ATTTGGGCCTTNONE 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0349700004-017-C10ATTTGGGCNONE 
009-017-C09ATTTGGGCNONE 
AK060912ATTTGGGCNONE 
Os05g0388500AK065313AGCCCAAATSimilar to 50S ribosomal protein L1. 
AK098990AGCCCAAATNONE 
AK104689AGCCCAAATNONE 
J013094L23AGCCCAAATNONE 
J065118O04AGCCCAAATNONE 
Os05g0400600AK072045ATTTGGGCCobalt transport protein family protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
Os05g0432400015-089-G11GCCCAAATNONE 
016-072-A11GCCCAAATNONE 
AK058468GCCCAAATNONE 
AK071117GCCCAAATNONE 
AK072299GCCCAAATProtein of unknown function DUF1682 family protein. 
AK099260GCCCAAATNONE 
J023028L21GCCCAAATNONE 
J023055D07GCCCAAATNONE 
J023075H23GCCCAAATNONE 
J033129C12GCCCAAATNONE 
Os05g0447000AK108280GCCCAAATSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0459300009-006-D08ATTTGGGCTTCNONE 
AK062312ATTTGGGCTTCNONE 
AK119604ATTTGGGCTTCNONE 
AK121463ATTTGGGCTTCConserved hypothetical protein. 
J023145E12ATTTGGGCTTCNONE 
Os05g0480700AK100850AGCCCAAATSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGCCCAAATNONE 
Os05g0515600Os05g0515600GCCCAAATSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT). 
Os05g0542300009-050-C12ATTTGGGCCGGCNONE 
009-185-D06ATTTGGGCCGGCNONE 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
Os05g0552900AK102095GCCCAAATMAP65/ASE1 family protein. 
Os05g0553700006-100-D08AAAGCCCAAATNONE 
AK099747AAAGCCCAAATNONE 
AK101606AAAGCCCAAATNONE 
AK103396AAAGCCCAAATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23AAAGCCCAAATNONE 
J090086G01AAAGCCCAAATNONE 
Os05g0559900AK067197GCAGCCCAAATtRNA-binding arm domain containing protein. 
J013074C15GCAGCCCAAATNONE 
J013098O16GCAGCCCAAATNONE 
J033030M01GCAGCCCAAATNONE 
J090058H12GCAGCCCAAATNONE 
J090075M06GCAGCCCAAATNONE 
Os05g0561500006-066-D12ATTTGGGCTAGGCCCAGGNONE 
AK061788ATTTGGGCTAGGCCCAGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862ATTTGGGCTAGGCCCAGGNONE 
J013000O09ATTTGGGCTAGGCCCAGGNONE 
J033145C24ATTTGGGCTAGGCCCAGGNONE 
Os05g0577200AK069756ATTTGGGCCarboxylesterase, type B family protein. 
Os05g0591400AK120015GAGGCCCAAATHeat shock protein Hsp70 family protein. 
Os05g0591900013-001-H05ATTTGGGCNONE 
013-001-H05GCCCAAATNONE 
Os06g0113600016-067-E03ATTTGGGCCGGANONE 
016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCGGANONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCGGANONE 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCGGANONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCGGANONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCGGANONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCGGANONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCGGANONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCGGANONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCGGANONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCGGANONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCGGANONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCGGANONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCGGANONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCGGANONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCGGANONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCGGANONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCGGANONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0115200J100029D05ATTTGGGCNONE 
J100048P05ATTTGGGCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0128500AK058563ATTTGGGCCTGARibosomal protein L47, mitochondrial family protein. 
AK122132ATTTGGGCCTGANONE 
J033133F04ATTTGGGCCTGANONE 
J065094M24ATTTGGGCCTGANONE 
J065122J07ATTTGGGCCTGANONE 
J065137G10ATTTGGGCCTGANONE 
J065178L09ATTTGGGCCTGANONE 
J080011E11ATTTGGGCCTGANONE 
J080020G21ATTTGGGCCTGANONE 
J080039H03ATTTGGGCCTGANONE 
J080039J04ATTTGGGCCTGANONE 
Os06g0143700AK067270GCCCAAATSimilar to Sulfate transporter 2. 
J013098O05GCCCAAATNONE 
J065017H17GCCCAAATNONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0217700009-074-A04AGCCCAAATNONE 
AK062617AGCCCAAATConserved hypothetical protein. 
Os06g0218800011-007-B09GCCCAAATNONE 
AK073565GCCCAAATNONE 
AK104975GCCCAAATConserved hypothetical protein. 
J033041B13GCCCAAATNONE 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0286228AK069113AAAGCCCAAATCupredoxin domain containing protein. 
Os06g0360500AK109778CGGGCCCAAATConserved hypothetical protein. 
Os06g0574700J100040C03ATTTGGGCApple-like domain containing protein. 
J100053O04ATTTGGGCNONE 
J100061A03ATTTGGGCNONE 
J100068A20ATTTGGGCNONE 
J100072L21ATTTGGGCNONE 
Os06g0600100AK065619AGCCCAAATSimilar to TAT-binding protein homolog (Fragment). 
AK065619ATTTGGGCSimilar to TAT-binding protein homolog (Fragment). 
Os06g0603400AK060002AGGGCCCAAATNONE 
AK102325AGGGCCCAAATNONE 
AK106905AGGGCCCAAATSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGGGCCCAAATNONE 
J100022N15AGGGCCCAAATNONE 
J100023E09AGGGCCCAAATNONE 
J100052D21AGGGCCCAAATNONE 
Os06g0607800012-010-G03CAAGGCCCAAATNONE 
012-010-G03TAGGCCCAAATNONE 
AB070254CAAGGCCCAAATNONE 
AB070254TAGGCCCAAATNONE 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK063158TAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAAGGCCCAAATNONE 
AK066695TAGGCCCAAATNONE 
J013074G13CAAGGCCCAAATNONE 
J013074G13TAGGCCCAAATNONE 
J090015C16CAAGGCCCAAATNONE 
J090015C16TAGGCCCAAATNONE 
J090069H10CAAGGCCCAAATNONE 
J090069H10TAGGCCCAAATNONE 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0673500J100018J12GCAGCCCAAATNONE 
J100072F13GCAGCCCAAATSimilar to Ubiquitin. 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
Os06g0676700009-185-F09GCCCAAATNONE 
AK063175GCCCAAATNONE 
AK105449GCCCAAATSimilar to High pI alpha-glucosidase. 
AK121588GCCCAAATNONE 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0702800009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0714100AK121079GAAGCCCAAATComplex 1 LYR protein family protein. 
J023062M13GAAGCCCAAATNONE 
J043020D18GAAGCCCAAATNONE 
J065073A17GAAGCCCAAATNONE 
J065158D09GAAGCCCAAATNONE 
J065195H04GAAGCCCAAATNONE 
J065214P13GAAGCCCAAATNONE 
J080079I22GAAGCCCAAATNONE 
J100031M06GAAGCCCAAATNONE 
J100036I12GAAGCCCAAATNONE 
Os07g0110800009-107-B11ATTTGGGCTTTNONE 
AK062792ATTTGGGCTTTConserved hypothetical protein. 
J053026P09ATTTGGGCTTTNONE 
J053074L17ATTTGGGCTTTNONE 
J065057E24ATTTGGGCTTTNONE 
J065149B18ATTTGGGCTTTNONE 
J075002O20ATTTGGGCTTTNONE 
J090002C13ATTTGGGCTTTNONE 
Os07g0110900AK058987AAAGCCCAAATConserved hypothetical protein. 
J065032L02AAAGCCCAAATNONE 
J065074H06AAAGCCCAAATNONE 
J065168M23AAAGCCCAAATNONE 
Os07g0127500009-139-F12ATTTGGGCCACGTGNONE 
AK062949ATTTGGGCCACGTGSimilar to PR-1a pathogenesis related protein (Hv-1a) precursor. 
J100077L01ATTTGGGCCACGTGNONE 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0164500J013094M18CTCGGCCCAAATNONE 
J013153L05CTCGGCCCAAATNONE 
J023011J18CTCGGCCCAAATNONE 
J023106H21CTCGGCCCAAATNONE 
J033105F10CTCGGCCCAAATNONE 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CTCGGCCCAAATNONE 
J090061C13CTCGGCCCAAATNONE 
J090074K15CTCGGCCCAAATNONE 
Os07g0172200AK103352ATTTGGGCConserved hypothetical protein. 
J100026D09ATTTGGGCNONE 
Os07g0181000AK060932TCAGCCCAAATNONE 
AK066918ACAGCCCAAATNONE 
AK070512ACAGCCCAAATSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0231500AK109283CAAGCCCAAATCyclin-like domain containing protein. 
J075001D10CAAGCCCAAATNONE 
J075088P14CAAGCCCAAATNONE 
J075115C22CAAGCCCAAATNONE 
J075199L15CAAGCCCAAATNONE 
Os07g0242600AK065752TTGGCCCAAATCyclin-like F-box domain containing protein. 
J013037K22TTGGCCCAAATNONE 
Os07g0270900015-039-A02ATTTGGGCCGCNONE 
AK058966ATTTGGGCCGCMak16 protein family protein. 
AK068904ATTTGGGCCGCNONE 
J013169N21ATTTGGGCCGCNONE 
J065039I11ATTTGGGCCGCNONE 
J065081J11ATTTGGGCCGCNONE 
J065162P04ATTTGGGCCGCNONE 
Os07g0281200AK121421GCCCAAATConserved hypothetical protein. 
J023133M08GCCCAAATNONE 
Os07g0287400009-035-G12GCCCAAATNONE 
009-128-G05GCCCAAATNONE 
AK105204GCCCAAATPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J065169C18GCCCAAATNONE 
Os07g0296900J075050I18ATTTGGGCCCAATTConserved hypothetical protein. 
Os07g0450000009-033-A08ATTTGGGCCGANONE 
AK063789ATTTGGGCCGANONE 
AK121702ATTTGGGCCGASimilar to 60S ribosomal protein L44. 
J033073H17ATTTGGGCCGANONE 
J065006A02ATTTGGGCCGANONE 
J065009C05ATTTGGGCCGANONE 
J065028M04ATTTGGGCCGANONE 
J065070D07ATTTGGGCCGANONE 
J065072H17ATTTGGGCCGANONE 
J065114J23ATTTGGGCCGANONE 
J065127A02ATTTGGGCCGANONE 
J065146L07ATTTGGGCCGANONE 
J065213H17ATTTGGGCCGANONE 
J065214B07ATTTGGGCCGANONE 
J100045B16ATTTGGGCCGANONE 
Os07g0463100009-138-B06GCGGCCCAAATNONE 
AK121807GCGGCCCAAATDNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
J013162G21GCGGCCCAAATNONE 
J065061H22GCGGCCCAAATNONE 
J075091J19GCGGCCCAAATNONE 
J075107E13GCGGCCCAAATNONE 
J075141I11GCGGCCCAAATNONE 
J075172E07GCGGCCCAAATNONE 
J080305N05GCGGCCCAAATNONE 
J080311B17GCGGCCCAAATNONE 
J080316I07GCGGCCCAAATNONE 
Os07g0469100009-036-F03GCCCAAATNONE 
009-126-D06GCCCAAATNONE 
009-190-A01GCCCAAATNONE 
AK061626GCCCAAATNONE 
AK120365GCCCAAATSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10GCCCAAATNONE 
J053066C23GCCCAAATNONE 
J065011K15GCCCAAATNONE 
J065053E15GCCCAAATNONE 
J065167F21GCCCAAATNONE 
J075065G04GCCCAAATNONE 
J075146A09GCCCAAATNONE 
Os07g0562700003-111-G08GCCCAAATNONE 
004-013-E07GCCCAAATNONE 
006-021-D03GCCCAAATNONE 
006-021-D07GCCCAAATNONE 
006-021-F09GCCCAAATNONE 
006-023-D01GCCCAAATNONE 
006-024-F04GCCCAAATNONE 
006-024-G09GCCCAAATNONE 
006-024-G11GCCCAAATNONE 
006-025-A10GCCCAAATNONE 
006-025-B08GCCCAAATNONE 
006-025-E10GCCCAAATNONE 
006-025-F10GCCCAAATNONE 
006-026-B04GCCCAAATNONE 
006-026-C08GCCCAAATNONE 
006-026-D03GCCCAAATNONE 
006-026-F03GCCCAAATNONE 
006-026-F08GCCCAAATNONE 
006-026-F12GCCCAAATNONE 
006-027-A10GCCCAAATNONE 
006-027-C03GCCCAAATNONE 
006-028-C03GCCCAAATNONE 
006-029-E02GCCCAAATNONE 
006-029-G05GCCCAAATNONE 
006-030-A10GCCCAAATNONE 
006-030-C06GCCCAAATNONE 
006-030-D03GCCCAAATNONE 
006-030-D06GCCCAAATNONE 
006-030-G05GCCCAAATNONE 
006-031-B10GCCCAAATNONE 
006-031-D04GCCCAAATNONE 
006-031-D11GCCCAAATNONE 
006-031-H09GCCCAAATNONE 
006-032-C09GCCCAAATNONE 
006-032-H09GCCCAAATNONE 
006-033-B02GCCCAAATNONE 
006-033-B09GCCCAAATNONE 
006-033-E01GCCCAAATNONE 
006-033-F06GCCCAAATNONE 
006-033-G03GCCCAAATNONE 
006-034-A08GCCCAAATNONE 
006-034-C09GCCCAAATNONE 
006-034-F06GCCCAAATNONE 
006-035-B12GCCCAAATNONE 
006-035-C12GCCCAAATNONE 
006-035-H04GCCCAAATNONE 
006-035-H12GCCCAAATNONE 
006-036-A05GCCCAAATNONE 
006-036-A09GCCCAAATNONE 
006-036-B10GCCCAAATNONE 
006-036-C03GCCCAAATNONE 
006-036-E06GCCCAAATNONE 
006-037-H11GCCCAAATNONE 
006-038-G01GCCCAAATNONE 
006-039-B01GCCCAAATNONE 
006-039-B12GCCCAAATNONE 
006-039-C02GCCCAAATNONE 
006-039-E06GCCCAAATNONE 
006-039-G12GCCCAAATNONE 
006-040-G07GCCCAAATNONE 
006-041-H04GCCCAAATNONE 
006-042-A11GCCCAAATNONE 
006-042-E07GCCCAAATNONE 
006-042-F12GCCCAAATNONE 
006-043-C01GCCCAAATNONE 
006-045-H12GCCCAAATNONE 
006-046-A12GCCCAAATNONE 
006-046-F03GCCCAAATNONE 
006-047-A07GCCCAAATNONE 
006-047-A09GCCCAAATNONE 
006-047-E10GCCCAAATNONE 
006-047-G12GCCCAAATNONE 
006-048-B04GCCCAAATNONE 
006-049-D01GCCCAAATNONE 
006-049-G02GCCCAAATNONE 
006-049-G10GCCCAAATNONE 
006-049-H04GCCCAAATNONE 
006-050-D05GCCCAAATNONE 
006-050-F05GCCCAAATNONE 
006-051-B05GCCCAAATNONE 
006-051-G12GCCCAAATNONE 
006-052-D12GCCCAAATNONE 
006-053-D06GCCCAAATNONE 
006-054-H02GCCCAAATNONE 
006-055-A03GCCCAAATNONE 
006-055-C01GCCCAAATNONE 
006-055-E07GCCCAAATNONE 
006-055-H06GCCCAAATNONE 
006-056-F06GCCCAAATNONE 
006-057-D03GCCCAAATNONE 
006-057-D05GCCCAAATNONE 
006-057-G01GCCCAAATNONE 
006-058-A03GCCCAAATNONE 
006-058-B06GCCCAAATNONE 
006-059-A09GCCCAAATNONE 
006-059-H11GCCCAAATNONE 
006-060-A04GCCCAAATNONE 
006-060-A09GCCCAAATNONE 
006-060-C11GCCCAAATNONE 
006-060-D08GCCCAAATNONE 
006-061-A04GCCCAAATNONE 
006-061-E01GCCCAAATNONE 
006-061-G10GCCCAAATNONE 
006-061-H12GCCCAAATNONE 
006-062-B07GCCCAAATNONE 
006-062-G03GCCCAAATNONE 
006-062-H12GCCCAAATNONE 
006-063-D05GCCCAAATNONE 
006-063-E04GCCCAAATNONE 
006-063-F05GCCCAAATNONE 
006-063-G05GCCCAAATNONE 
006-064-B07GCCCAAATNONE 
006-065-C11GCCCAAATNONE 
006-065-H02GCCCAAATNONE 
006-067-C12GCCCAAATNONE 
006-067-F10GCCCAAATNONE 
006-068-E02GCCCAAATNONE 
006-068-G04GCCCAAATNONE 
006-069-A02GCCCAAATNONE 
006-071-A07GCCCAAATNONE 
006-072-F11GCCCAAATNONE 
006-072-F12GCCCAAATNONE 
006-073-E12GCCCAAATNONE 
006-073-F08GCCCAAATNONE 
006-073-H07GCCCAAATNONE 
006-074-A07GCCCAAATNONE 
006-075-A12GCCCAAATNONE 
006-075-B01GCCCAAATNONE 
006-075-H10GCCCAAATNONE 
006-075-H12GCCCAAATNONE 
006-076-B06GCCCAAATNONE 
006-077-A09GCCCAAATNONE 
006-077-D05GCCCAAATNONE 
006-078-C11GCCCAAATNONE 
006-078-D12GCCCAAATNONE 
006-078-E02GCCCAAATNONE 
006-079-A01GCCCAAATNONE 
006-079-E02GCCCAAATNONE 
006-079-F03GCCCAAATNONE 
006-080-G11GCCCAAATNONE 
006-081-C02GCCCAAATNONE 
006-081-C08GCCCAAATNONE 
006-082-B06GCCCAAATNONE 
006-082-C11GCCCAAATNONE 
006-082-H04GCCCAAATNONE 
006-083-E04GCCCAAATNONE 
006-083-H12GCCCAAATNONE 
006-084-C08GCCCAAATNONE 
006-084-E07GCCCAAATNONE 
006-084-E10GCCCAAATNONE 
006-085-E06GCCCAAATNONE 
006-085-E10GCCCAAATNONE 
006-086-F06GCCCAAATNONE 
006-087-D08GCCCAAATNONE 
006-087-F03GCCCAAATNONE 
006-087-F10GCCCAAATNONE 
006-087-G07GCCCAAATNONE 
006-088-A02GCCCAAATNONE 
006-089-A04GCCCAAATNONE 
006-089-B12GCCCAAATNONE 
006-089-D06GCCCAAATNONE 
006-089-D10GCCCAAATNONE 
006-089-H05GCCCAAATNONE 
006-090-C06GCCCAAATNONE 
006-091-A03GCCCAAATNONE 
006-091-E04GCCCAAATNONE 
006-091-H12GCCCAAATNONE 
006-092-A08GCCCAAATNONE 
006-092-F01GCCCAAATNONE 
006-092-G08GCCCAAATNONE 
006-093-B12GCCCAAATNONE 
006-093-D04GCCCAAATNONE 
006-093-F01GCCCAAATNONE 
006-094-A08GCCCAAATNONE 
006-094-F01GCCCAAATNONE 
006-094-F03GCCCAAATNONE 
006-095-C12GCCCAAATNONE 
006-095-E10GCCCAAATNONE 
006-095-E12GCCCAAATNONE 
006-095-G06GCCCAAATNONE 
006-096-B12GCCCAAATNONE 
006-096-C12GCCCAAATNONE 
006-096-G02GCCCAAATNONE 
006-097-D01GCCCAAATNONE 
006-097-D07GCCCAAATNONE 
006-097-F04GCCCAAATNONE 
006-098-C07GCCCAAATNONE 
006-098-D04GCCCAAATNONE 
006-099-E06GCCCAAATNONE 
006-099-F02GCCCAAATNONE 
006-099-F10GCCCAAATNONE 
006-100-A07GCCCAAATNONE 
006-100-B10GCCCAAATNONE 
006-100-G01GCCCAAATNONE 
006-100-H06GCCCAAATNONE 
006-101-D01GCCCAAATNONE 
006-101-F03GCCCAAATNONE 
006-102-A12GCCCAAATNONE 
006-102-B11GCCCAAATNONE 
006-102-C03GCCCAAATNONE 
006-102-F11GCCCAAATNONE 
006-103-A08GCCCAAATNONE 
006-103-B06GCCCAAATNONE 
006-103-D01GCCCAAATNONE 
006-103-F02GCCCAAATNONE 
006-104-B02GCCCAAATNONE 
006-104-C01GCCCAAATNONE 
006-104-F09GCCCAAATNONE 
006-104-H11GCCCAAATNONE 
006-105-A03GCCCAAATNONE 
006-105-D09GCCCAAATNONE 
006-106-B10GCCCAAATNONE 
006-107-A06GCCCAAATNONE 
006-107-C04GCCCAAATNONE 
006-107-E03GCCCAAATNONE 
006-107-F05GCCCAAATNONE 
006-108-C09GCCCAAATNONE 
006-109-C09GCCCAAATNONE 
006-109-D10GCCCAAATNONE 
006-109-E06GCCCAAATNONE 
006-109-E10GCCCAAATNONE 
006-110-A06GCCCAAATNONE 
006-110-C11GCCCAAATNONE 
006-111-A02GCCCAAATNONE 
006-111-F02GCCCAAATNONE 
006-112-A08GCCCAAATNONE 
006-112-H06GCCCAAATNONE 
006-113-A08GCCCAAATNONE 
006-113-B01GCCCAAATNONE 
006-113-C05GCCCAAATNONE 
006-113-D01GCCCAAATNONE 
006-113-D04GCCCAAATNONE 
006-113-D06GCCCAAATNONE 
006-113-E09GCCCAAATNONE 
006-114-F06GCCCAAATNONE 
006-116-B02GCCCAAATNONE 
006-117-B07GCCCAAATNONE 
006-117-G04GCCCAAATNONE 
006-118-D01GCCCAAATNONE 
006-118-D12GCCCAAATNONE 
006-118-F12GCCCAAATNONE 
006-118-G12GCCCAAATNONE 
006-119-B08GCCCAAATNONE 
006-120-E09GCCCAAATNONE 
006-120-G05GCCCAAATNONE 
006-120-G10GCCCAAATNONE 
009-022-D12GCCCAAATNONE 
009-051-H08GCCCAAATNONE 
009-065-F05GCCCAAATNONE 
009-070-A06GCCCAAATNONE 
009-073-B07GCCCAAATNONE 
009-092-C10GCCCAAATNONE 
009-093-D03GCCCAAATNONE 
009-103-B04GCCCAAATNONE 
009-106-H08GCCCAAATNONE 
009-120-B05GCCCAAATNONE 
009-121-F05GCCCAAATNONE 
009-122-B04GCCCAAATNONE 
009-122-D08GCCCAAATNONE 
009-123-F07GCCCAAATNONE 
009-125-G02GCCCAAATNONE 
009-128-F02GCCCAAATNONE 
009-128-H07GCCCAAATNONE 
009-131-C06GCCCAAATNONE 
009-132-F08GCCCAAATNONE 
009-133-G08GCCCAAATNONE 
009-134-D09GCCCAAATNONE 
009-135-F01GCCCAAATNONE 
009-149-E11GCCCAAATNONE 
009-153-H04GCCCAAATNONE 
009-161-E04GCCCAAATNONE 
009-163-A09GCCCAAATNONE 
009-163-C05GCCCAAATNONE 
009-163-E10GCCCAAATNONE 
009-165-F04GCCCAAATNONE 
009-166-A07GCCCAAATNONE 
009-169-G12GCCCAAATNONE 
009-172-G08GCCCAAATNONE 
009-179-E06GCCCAAATNONE 
009-181-F09GCCCAAATNONE 
009-190-G07GCCCAAATNONE 
009-191-D01GCCCAAATNONE 
009-195-G02GCCCAAATNONE 
AF022738GCCCAAATNONE 
AK061512GCCCAAATNONE 
AK068972GCCCAAATNONE 
AK103926GCCCAAATNONE 
AK103999GCCCAAATNONE 
AK104224GCCCAAATNONE 
AK104465GCCCAAATNONE 
AK104495GCCCAAATNONE 
AK109399GCCCAAATSimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCAAATNONE 
AK119545GCCCAAATNONE 
J013043L10GCCCAAATNONE 
J013050A09GCCCAAATNONE 
J023001G03GCCCAAATNONE 
J023024D14GCCCAAATNONE 
J023072E11GCCCAAATNONE 
J023149E18GCCCAAATNONE 
J033029B16GCCCAAATNONE 
J065001O21GCCCAAATNONE 
J065035B04GCCCAAATNONE 
J065044D18GCCCAAATNONE 
J065057F12GCCCAAATNONE 
J065060A11GCCCAAATNONE 
J065062G15GCCCAAATNONE 
J065080F13GCCCAAATNONE 
J065084N12GCCCAAATNONE 
J065101D02GCCCAAATNONE 
J065107C07GCCCAAATNONE 
J065112N24GCCCAAATNONE 
J065141I16GCCCAAATNONE 
J065147D05GCCCAAATNONE 
J065167H02GCCCAAATNONE 
J065207K23GCCCAAATNONE 
J075008E16GCCCAAATNONE 
J075014F03GCCCAAATNONE 
J075015O17GCCCAAATNONE 
J075020H20GCCCAAATNONE 
J075021E22GCCCAAATNONE 
J075023N13GCCCAAATNONE 
J075028H10GCCCAAATNONE 
J075040F20GCCCAAATNONE 
J075051L23GCCCAAATNONE 
J075069G16GCCCAAATNONE 
J075084F24GCCCAAATNONE 
J075090H09GCCCAAATNONE 
J075092M21GCCCAAATNONE 
J075110C10GCCCAAATNONE 
J075111J12GCCCAAATNONE 
J075114L04GCCCAAATNONE 
J075139E02GCCCAAATNONE 
J075160M10GCCCAAATNONE 
J075176J03GCCCAAATNONE 
J075183I17GCCCAAATNONE 
J075191N10GCCCAAATNONE 
J075193D07GCCCAAATNONE 
J075194M16GCCCAAATNONE 
J075197K04GCCCAAATNONE 
J080032I11GCCCAAATNONE 
J080076M11GCCCAAATNONE 
J080311J08GCCCAAATNONE 
J080317E05GCCCAAATNONE 
J090034L08GCCCAAATNONE 
J100040D19GCCCAAATNONE 
J100074C11GCCCAAATNONE 
Os07g0573800AK072835ATTTGGGCCATPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154ATTTGGGCCATNONE 
AK104308ATTTGGGCCATNONE 
AK107962ATTTGGGCCATNONE 
J023134F17ATTTGGGCCATNONE 
J043027A09ATTTGGGCCATNONE 
Os07g0604500009-018-C07ATTTGGGCTGANONE 
009-194-C02ATTTGGGCTGANONE 
011-023-C06ATTTGGGCTGANONE 
015-035-B10ATTTGGGCTGANONE 
AK064312ATTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085ATTTGGGCTGANONE 
J090050I12ATTTGGGCTGANONE 
J100027C10ATTTGGGCTGANONE 
J100029A05ATTTGGGCTGANONE 
J100031P17ATTTGGGCTGANONE 
J100039E20ATTTGGGCTGANONE 
J100064L15ATTTGGGCTGANONE 
J100066K08ATTTGGGCTGANONE 
Os07g0614100AB032062ATTTGGGCCGGANONE 
AK058885ATTTGGGCCGGANONE 
AK069145ATTTGGGCCGGANONE 
AK102448ATTTGGGCCGGAAlpha 1-2 subunit of 20S proteasome. 
J023007E07ATTTGGGCCGGANONE 
J033093O06ATTTGGGCCGGANONE 
Os07g0620200AK099859GTGGCCCAAATHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04GTGGCCCAAATNONE 
Os07g0626600Os07g0626600AAAGCCCAAATSimilar to Embryogenic callus protein-like. 
Os07g0628900AK111564ATTTGGGCSimilar to KI domain interacting kinase 1. 
Os07g0668200AK059051ATGGCCCAAATNONE 
AK059051CAAGCCCAAATNONE 
AK101682ATGGCCCAAATConserved hypothetical protein. 
AK101682CAAGCCCAAATConserved hypothetical protein. 
AK102839ATGGCCCAAATNONE 
AK102839CAAGCCCAAATNONE 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0112800009-113-D03ATTTGGGCCAANONE 
AK121176ATTTGGGCCAARickettsia 17 kDa surface antigen family protein. 
J023083C18ATTTGGGCCAANONE 
J033074M10ATTTGGGCCAANONE 
J033097G10ATTTGGGCCAANONE 
J065090F05ATTTGGGCCAANONE 
J090001J03ATTTGGGCCAANONE 
J090044F23ATTTGGGCCAANONE 
J090078H09ATTTGGGCCAANONE 
J100088G23ATTTGGGCCAANONE 
Os08g0162500AK121633ATTTGGGCCTAConserved hypothetical protein. 
J033105E19ATTTGGGCCTANONE 
J080012K11ATTTGGGCCTANONE 
J080041I12ATTTGGGCCTANONE 
J080049G05ATTTGGGCCTANONE 
J080050P09ATTTGGGCCTANONE 
J080051A10ATTTGGGCCTANONE 
J080054G05ATTTGGGCCTANONE 
J080058M08ATTTGGGCCTANONE 
J080064N23ATTTGGGCCTANONE 
J080072L15ATTTGGGCCTANONE 
J080096H09ATTTGGGCCTANONE 
J100079I08ATTTGGGCCTANONE 
Os08g0280200AK069036ATTTGGGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0363000015-090-A07AAAGCCCAAATNONE 
AK103677AAAGCCCAAATNONE 
AK106532AAAGCCCAAATProtein of unknown function DUF295 family protein. 
J033136B21AAAGCCCAAATNONE 
J033136E01AAAGCCCAAATNONE 
J043029N11AAAGCCCAAATNONE 
J065071G13AAAGCCCAAATNONE 
J065105J22AAAGCCCAAATNONE 
J075084B18AAAGCCCAAATNONE 
Os08g0412200006-028-H07AAGGCCCAAATNONE 
AJ575234AAGGCCCAAATNONE 
AK059631AAGGCCCAAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAGGCCCAAATNONE 
AK104578AAGGCCCAAATNONE 
J033071L08AAGGCCCAAATNONE 
J065197K18AAGGCCCAAATNONE 
Os08g0431500009-186-D05ATTTGGGCCGGGCNONE 
AK058993ATTTGGGCCGGGCNONE 
AK100797ATTTGGGCCGGGCConserved hypothetical protein. 
J023121F15ATTTGGGCCGGGCNONE 
Os08g0441400011-033-F01ATTTGGGCCGCANONE 
015-084-B04ATTTGGGCCGCANONE 
AK063317ATTTGGGCCGCANONE 
AK064141ATTTGGGCCGCAConserved hypothetical protein. 
J065060F06ATTTGGGCCGCANONE 
J075110A22ATTTGGGCCGCANONE 
J080307P11ATTTGGGCCGCANONE 
J090041E06ATTTGGGCCGCANONE 
Os08g0442900AK110520GCCCAAATEggshell protein family protein. 
Os08g0447200AK067377TAAGCCCAAATSGT1 family protein. 
J013106M17TAAGCCCAAATNONE 
J033133D18TAAGCCCAAATNONE 
J033140B09TAAGCCCAAATNONE 
J100028I17TAAGCCCAAATNONE 
J100086C22TAAGCCCAAATNONE 
Os08g0474750J075009C13TCTGGCCCAAATNONE 
J075122O14TCTGGCCCAAATHypothetical protein. 
Os08g0474800Os08g0474800TCTGGCCCAAATEsterase/lipase/thioesterase domain containing protein. 
Os08g0487100AK107150CTCGGCCCAAATSimilar to BZIP transcription factor BZI-2. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK060178ATTTGGGCTGGNONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK071053ATTTGGGCTGGParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
AK100101ATTTGGGCTGGNONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023004I20ATTTGGGCTGGNONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J023067D13ATTTGGGCTGGNONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033028G05ATTTGGGCTGGNONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033060L15ATTTGGGCTGGNONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033103N12ATTTGGGCTGGNONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J033125B19ATTTGGGCTGGNONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065132A12ATTTGGGCTGGNONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065161F02ATTTGGGCTGGNONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J065162L05ATTTGGGCTGGNONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J090093I18ATTTGGGCTGGNONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100061I05ATTTGGGCTGGNONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
J100081G13ATTTGGGCTGGNONE 
Os08g0494300AK066150GCAGCCCAAATvon Willebrand factor, type A domain containing protein. 
Os08g0499900J033080E06ATTTGGGCGGGCCCACANONE 
Os08g0540500AK106511TAGGCCCAAATSAM (and some other nucleotide) binding motif domain containing protein. 
Os09g0101800AK102345ATTTGGGCTGGGWD40-like domain containing protein. 
J090030C23ATTTGGGCTGGGNONE 
Os09g0112400AK109186AATTGGGCCCAAATSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0115900009-055-E06TAAGCCCAAATNONE 
AK068597TAAGCCCAAATConserved hypothetical protein. 
J065136F11TAAGCCCAAATNONE 
J080023D14TAAGCCCAAATNONE 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0382400009-125-E12GCCCAAATNONE 
AK062891GCCCAAATConserved hypothetical protein. 
J065069H20GCCCAAATNONE 
J065137I22GCCCAAATNONE 
J065218O10GCCCAAATNONE 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0427800J090021D12GCCCAAATNONE 
J090040B21GCCCAAATGlycosyl transferase, family 20 domain containing protein. 
J090049G09GCCCAAATNONE 
J090050G02GCCCAAATNONE 
Os09g0457900AK067195GCCCAAATSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J013098P10GCCCAAATNONE 
Os09g0463700016-008-D06AAAGCCCAAATNONE 
AK060708AAAGCCCAAATSimilar to AHM1. 
J090013G05AAAGCCCAAATNONE 
Os09g0480400AK100641GCCCAAATSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15GCCCAAATNONE 
J090053K21GCCCAAATNONE 
Os09g0485800AK108749ATTTGGGCCAGAConserved hypothetical protein. 
J065137H03ATTTGGGCCAGANONE 
Os09g0494200AK069564GCCCAAATNONE 
AK103755GCCCAAATSimilar to Chitinase-like protein (EC 3.2.1.14). 
Os09g0531900AK073015CAGGCCCAAATAGCCCAGCSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0549700J053039F06CCACGGCCCAAATNONE 
J065089F23CCACGGCCCAAATRibosomal protein L18P/L5E family protein. 
J065090G14CCACGGCCCAAATNONE 
J065093M17CCACGGCCCAAATNONE 
J065096L23CCACGGCCCAAATNONE 
J065152A18CCACGGCCCAAATNONE 
J065155H12CCACGGCCCAAATNONE 
Os09g0560600AK071381ATTTGGGCTGCNONE 
J023089I18ATTTGGGCTGCNONE 
J075015L11ATTTGGGCTGCNONE 
J075038B17ATTTGGGCTGCNONE 
J075059J18ATTTGGGCTGCNONE 
J075077H09ATTTGGGCTGCNONE 
J075091F07ATTTGGGCTGCNONE 
J075100O20ATTTGGGCTGCNONE 
J075118G11ATTTGGGCTGCNONE 
J075149F18ATTTGGGCTGCNONE 
J075156B19ATTTGGGCTGCNONE 
J075185L12ATTTGGGCTGCNONE 
J075189N02ATTTGGGCTGCNONE 
J075196A12ATTTGGGCTGCNONE 
J090024N23ATTTGGGCTGCNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os11g0131200J065024D18AGCCCAAATMpv17/PMP22 family protein. 
J065206C17AGCCCAAATNONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139500AK121845ATTTGGGCTGGNONE 
Os11g0150100AK062247ATTTGGGCNONE 
AK068167ATTTGGGCNONE 
Os11g0156200AK100124GAGGCCCAAATPeptidase S28 family protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0512800AK064740GCCCAAATConserved hypothetical protein. 
Os11g0549690J065085G07ATTTGGGCCCACCTGTConserved hypothetical protein. 
J065218B08ATTTGGGCCCACCTGTNONE 
J090036H16ATTTGGGCCCACCTGTNONE 
Os11g0586300AK072257GGACGGCCCAAATConserved hypothetical protein. 
Os11g0615700AB026561ATTTGGGCCTTNONE 
AK059521ATTTGGGCCTTNONE 
AK103487ATTTGGGCCTTProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ATTTGGGCCTTNONE 
J065044A11ATTTGGGCCTTNONE 
J065090I02ATTTGGGCCTTNONE 
J065104I09ATTTGGGCCTTNONE 
J065187J10ATTTGGGCCTTNONE 
J075024E07ATTTGGGCCTTNONE 
J075025O13ATTTGGGCCTTNONE 
J090062N12ATTTGGGCCTTNONE 
J090087G06ATTTGGGCCTTNONE 
J090098K11ATTTGGGCCTTNONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0143150009-090-F09GGGGCCCAAATUbiquitin domain containing protein. 
J013121D01GGGGCCCAAATNONE 
J065129G09GGGGCCCAAATNONE 
J080311D13GGGGCCCAAATNONE 
J090014O10GGGGCCCAAATNONE 
J090045E21GGGGCCCAAATNONE 
J100047D12GGGGCCCAAATNONE 
Os12g0167900005-004-A06ATTTGGGCCGTANONE 
006-024-H01ATTTGGGCCGTANONE 
006-044-H12ATTTGGGCCGTANONE 
006-053-B08ATTTGGGCCGTANONE 
015-080-F12ATTTGGGCCGTANONE 
AK060925ATTTGGGCCGTA60S ribosomal protein L3. 
D10403ATTTGGGCCGTANONE 
D12630ATTTGGGCCGTANONE 
J013046A17ATTTGGGCCGTANONE 
J013048A16ATTTGGGCCGTANONE 
J013057L14ATTTGGGCCGTANONE 
J023058G08ATTTGGGCCGTANONE 
J023058I08ATTTGGGCCGTANONE 
J023078E17ATTTGGGCCGTANONE 
J023087E03ATTTGGGCCGTANONE 
J023097D18ATTTGGGCCGTANONE 
J023141E14ATTTGGGCCGTANONE 
J023150P21ATTTGGGCCGTANONE 
J033045K05ATTTGGGCCGTANONE 
J033071G03ATTTGGGCCGTANONE 
J033071I15ATTTGGGCCGTANONE 
J033136D08ATTTGGGCCGTANONE 
J043012M21ATTTGGGCCGTANONE 
J043015C13ATTTGGGCCGTANONE 
J053031L19ATTTGGGCCGTANONE 
J053050C01ATTTGGGCCGTANONE 
J053055I20ATTTGGGCCGTANONE 
J053074B18ATTTGGGCCGTANONE 
J053091I08ATTTGGGCCGTANONE 
J053097N01ATTTGGGCCGTANONE 
J065058A02ATTTGGGCCGTANONE 
J065141H11ATTTGGGCCGTANONE 
J075019D10ATTTGGGCCGTANONE 
J075078G18ATTTGGGCCGTANONE 
J075094C12ATTTGGGCCGTANONE 
J075165H12ATTTGGGCCGTANONE 
J090011E05ATTTGGGCCGTANONE 
J090021H18ATTTGGGCCGTANONE 
J090027N07ATTTGGGCCGTANONE 
J090035F04ATTTGGGCCGTANONE 
J090050F21ATTTGGGCCGTANONE 
J090051M02ATTTGGGCCGTANONE 
J090060F21ATTTGGGCCGTANONE 
J090075G15ATTTGGGCCGTANONE 
J090092P11ATTTGGGCCGTANONE 
J090097B18ATTTGGGCCGTANONE 
J100019C17ATTTGGGCCGTANONE 
J100022O04ATTTGGGCCGTANONE 
J100034G13ATTTGGGCCGTANONE 
J100048A13ATTTGGGCCGTANONE 
J100050P18ATTTGGGCCGTANONE 
J100054B21ATTTGGGCCGTANONE 
J100062L01ATTTGGGCCGTANONE 
J100065E11ATTTGGGCCGTANONE 
J100074P09ATTTGGGCCGTANONE 
J100086E10ATTTGGGCCGTANONE 
Os12g0197100AK071816AGCCCAAATPhosphoribosylglycinamide synthetase domain containing protein. 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0590900J100033M15GCCCAAATConserved hypothetical protein. 
J100042H14GCCCAAATNONE 
J100059P17GCCCAAATNONE 
J100062H13GCCCAAATNONE 
Os12g0638100012-096-H01ATTTGGGCCCATCTNONE 
AK059245ATTTGGGCCCATCTNONE 
J033071D06ATTTGGGCCCATCTNONE 
J033090A15ATTTGGGCCCATCTNONE 
J033090A18ATTTGGGCCCATCTNONE 
J033098M15ATTTGGGCCCATCTNONE 
J033111F01ATTTGGGCCCATCTNONE 
J033111I05ATTTGGGCCCATCTNONE 
J033117B13ATTTGGGCCCATCTNONE 
J033127C21ATTTGGGCCCATCTNONE 
J053025M14ATTTGGGCCCATCTNONE 
J053032E24ATTTGGGCCCATCTNONE 
J053089K20ATTTGGGCCCATCTNONE 
J065010A05ATTTGGGCCCATCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.