version

Summary of OsREG494 (All List)

OrganismOryza sativa  
IDOsREG494  
SequenceCAACGGCC  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count1178  

Entry Sequences (1178 entries)

LocusGene modelSequenceDescription
Os01g0139200J023061K13GGCCGTTGNONE 
J053024M09GGCCGTTGNONE 
J053047C19GGCCGTTGNONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0214500AK062484GGCCGTTGConserved hypothetical protein. 
Os01g0220200J100075D14TACGGCCCCCAACGGCCNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0294700006-057-A09CAACGGCCNONE 
AK068755CAACGGCCHaem peroxidase, plant/fungal/bacterial family protein. 
AK104388CAACGGCCNONE 
AK104781CAACGGCCNONE 
J013000M08CAACGGCCNONE 
J013067E04CAACGGCCNONE 
J013067E05CAACGGCCNONE 
J013159G18CAACGGCCNONE 
J065053A05CAACGGCCNONE 
J065065J01CAACGGCCNONE 
J065109H12CAACGGCCNONE 
J065131F05CAACGGCCNONE 
J075095D14CAACGGCCNONE 
J075156A05CAACGGCCNONE 
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein. 
J075175N03ATCCAACGGCCGAGANONE 
Os01g0348700009-125-H02CCAACGGCCNONE 
009-156-F08CCAACGGCCNONE 
009-177-A11CCAACGGCCNONE 
009-195-D02CCAACGGCCNONE 
013-040-B06CCAACGGCCNONE 
013-051-B09CCAACGGCCNONE 
AK120842CCAACGGCCSimilar to 60S ribosomal protein L23a (L25). 
J013071O22CCAACGGCCNONE 
J023022J07CCAACGGCCNONE 
J033028J08CCAACGGCCNONE 
J033109M11CCAACGGCCNONE 
J043022K15CCAACGGCCNONE 
J043031N11CCAACGGCCNONE 
J053023I10CCAACGGCCNONE 
J053045F16CCAACGGCCNONE 
J053054F22CCAACGGCCNONE 
J053094P15CCAACGGCCNONE 
J065048F01CCAACGGCCNONE 
J075012F16CCAACGGCCNONE 
J075089C09CCAACGGCCNONE 
J075179J20CCAACGGCCNONE 
J080305E19CCAACGGCCNONE 
J080309B21CCAACGGCCNONE 
J090017L05CCAACGGCCNONE 
J090058B11CCAACGGCCNONE 
Os01g0349400AK064941ATCCAACGGCCNONE 
AK100195ATCCAACGGCCNONE 
AK105047ATCCAACGGCCNONE 
AK122182ATCCAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment). 
Os01g0585400AK103584GGCCGTTGGConserved hypothetical protein. 
J033133B01GGCCGTTGGNONE 
Os01g0623900J090025M21CAACGGCCNONE 
J090082F22CAACGGCCNONE 
J090084L02CAACGGCCSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0637600AK106980CGCACCGCCAACGGCCSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0684900AK102052CAACGGCCMulti antimicrobial extrusion protein MatE family protein. 
J033082B20CAACGGCCNONE 
J100084N08CAACGGCCNONE 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0765000AK101905AGCCCAACGGCCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
J065061M19GGCCGTTGNONE 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0805000009-045-H11CAACGGCCGGCTCGGNONE 
009-196-H08CAACGGCCGGCTCGGNONE 
J013094D22CAACGGCCGGCTCGGRibosomal protein L34 family protein. 
J013119F23CAACGGCCGGCTCGGNONE 
J065128B11CAACGGCCGGCTCGGNONE 
Os01g0816700AK100654GGCCGTTGGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0838300J090017B22AGTGGGCCGTTGNONE 
J090061B04AGTGGGCCGTTGNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0862200AK059299CCAACGGCCConserved hypothetical protein. 
AK100818CCAACGGCCNONE 
J023122F03CCAACGGCCNONE 
Os01g0896400AK107067CCAACGGCCConserved hypothetical protein. 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os01g0976600AK072971GGCCGTGGCCGTTGGSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GGCCGTGGCCGTTGGNONE 
J075095H03GGCCGTGGCCGTTGGNONE 
J090089M19GGCCGTGGCCGTTGGNONE 
Os02g0139600AK107052CAACGGCCNONE 
AK121266CAACGGCCSimilar to Dars-prov protein. 
Os02g0148600AK059287GGCCGTTGGATConserved hypothetical protein. 
Os02g0205400AK101434ATCCAACGGCCWD40-like domain containing protein. 
J043024M20ATCCAACGGCCNONE 
Os02g0218400AK068947CCAACGGCCUspA domain containing protein. 
Os02g0556700AK073875ATCCAACGGCCT-complex 11 family protein. 
Os02g0556800AK060580GGCCGTTGNONE 
AK100187GGCCGTTGConserved hypothetical protein. 
J065162A21GGCCGTTGNONE 
J075093B20GGCCGTTGNONE 
J075097N04GGCCGTTGNONE 
Os02g0559300AK100088CAACGGCCGGCCCNONE 
AK121206CAACGGCCGGCCCProtein kinase-like domain containing protein. 
J023003H24CAACGGCCGGCCCNONE 
J023088A16CAACGGCCGGCCCNONE 
J023100K01CAACGGCCGGCCCNONE 
J023127H24CAACGGCCGGCCCNONE 
Os02g0617400AK108108CAACGGCCLipolytic enzyme, G-D-S-L family protein. 
J075028E08CAACGGCCNONE 
J090024M06CAACGGCCNONE 
Os02g0667600AK073500CCAACGGCCHarpin-induced 1 domain containing protein. 
AK109748CCAACGGCCNONE 
AK109816CCAACGGCCNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0695600009-130-G03GGCCGTTGGNONE 
009-141-A10GGCCGTTGGNONE 
009-185-F07GGCCGTTGGNONE 
AK062960GGCCGTTGGConserved hypothetical protein. 
J100046B17GGCCGTTGGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0727100AK069154GGCCGTTGAmino acid/polyamine transporter II family protein. 
J023006P21GGCCGTTGNONE 
J023027D19GGCCGTTGNONE 
J023044N10GGCCGTTGNONE 
J023088H15GGCCGTTGNONE 
J023090A13GGCCGTTGNONE 
J023142P16GGCCGTTGNONE 
Os02g0733300AK101108TCCAACGGCCGAAASimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGCCGAAANONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein. 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J100032C19ATATGGGCCAACGGCCNONE 
Os02g0807750J075136J04CAACGGCCGAGATHypothetical protein. 
Os02g0821800014-086-A11CAACGGCCNONE 
AK071291CAACGGCCNONE 
J023088O08CAACGGCCNONE 
J033130D23CAACGGCCNONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os02g0833400014-050-E05GGCCGTTGNONE 
AK063696GGCCGTTGNONE 
AK073112GGCCGTTGConserved hypothetical protein. 
J013158K22GGCCGTTGNONE 
J033024H02GGCCGTTGNONE 
J065038D20GGCCGTTGNONE 
J065044M04GGCCGTTGNONE 
J065073D22GGCCGTTGNONE 
J065161A22GGCCGTTGNONE 
J090080A20GGCCGTTGNONE 
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE 
AK101248ATCCAACGGCCGAAANONE 
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein. 
AK109354ATCCAACGGCCGAAANONE 
J033032D06ATCCAACGGCCGAAANONE 
J080308A01ATCCAACGGCCGAAANONE 
J090071H02ATCCAACGGCCGAAANONE 
J100048C10ATCCAACGGCCGAAANONE 
Os03g0129100003-009-E09CCAACGGCCNONE 
AF384030CCAACGGCCNONE 
AK098993CCAACGGCCSeven transmembrane protein MLO2. 
AK111990CCAACGGCCNONE 
J013098A12CCAACGGCCNONE 
J023020M16CCAACGGCCNONE 
J043001L02CCAACGGCCNONE 
Os03g0142900011-054-A05CAACGGCCCATTNONE 
AK067103CAACGGCCCATTNONE 
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein. 
J013097D18CAACGGCCCATTNONE 
J013098E18CAACGGCCCATTNONE 
J013099I17CAACGGCCCATTNONE 
J013108C09CAACGGCCCATTNONE 
J023045J15CAACGGCCCATTNONE 
J033034E13CAACGGCCCATTNONE 
J033095F07CAACGGCCCATTNONE 
J033102N22CAACGGCCCATTNONE 
J065016C14CAACGGCCCATTNONE 
J065034E13CAACGGCCCATTNONE 
J065065F21CAACGGCCCATTNONE 
J065159M09CAACGGCCCATTNONE 
J075012C13CAACGGCCCATTNONE 
J075017P18CAACGGCCCATTNONE 
J075018M03CAACGGCCCATTNONE 
J075021H19CAACGGCCCATTNONE 
J075070K23CAACGGCCCATTNONE 
J075077B18CAACGGCCCATTNONE 
J075085E20CAACGGCCCATTNONE 
J075090N23CAACGGCCCATTNONE 
J075137M16CAACGGCCCATTNONE 
J075151E03CAACGGCCCATTNONE 
J090042L02CAACGGCCCATTNONE 
J090060C21CAACGGCCCATTNONE 
J090089I17CAACGGCCCATTNONE 
J100024L19CAACGGCCCATTNONE 
J100025A06CAACGGCCCATTNONE 
J100033C24CAACGGCCCATTNONE 
J100052J17CAACGGCCCATTNONE 
J100063H10CAACGGCCCATTNONE 
J100073P04CAACGGCCCATTNONE 
J100075D01CAACGGCCCATTNONE 
J100077J17CAACGGCCCATTNONE 
J100087F03CAACGGCCCATTNONE 
J100087F09CAACGGCCCATTNONE 
Os03g0146300011-078-E08ATCCAACGGCCNONE 
014-009-B07ATCCAACGGCCNONE 
AK121395ATCCAACGGCCSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319ATCCAACGGCCNONE 
J013104I06ATCCAACGGCCNONE 
J023130M16ATCCAACGGCCNONE 
J053037E13ATCCAACGGCCNONE 
J075104M08ATCCAACGGCCNONE 
J075144I22ATCCAACGGCCNONE 
J100057B09ATCCAACGGCCNONE 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0218300015-078-G09GGCCGTTGConserved hypothetical protein. 
J090095I10GGCCGTTGNONE 
Os03g0238800AY224467CAACGGCCConserved hypothetical protein. 
J013042E23CAACGGCCNONE 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0257600Os03g0257600CAACGGCCProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0425100AK070206CAACGGCCGAGATHypothetical protein. 
J023042E01CAACGGCCGAGATNONE 
Os03g0567600011-011-F01CAACGGCCNONE 
J013000G17CAACGGCCNONE 
J013002A01CAACGGCCNONE 
J013043B17CAACGGCCNONE 
J013089P07CAACGGCCNONE 
J013157A16CAACGGCCNONE 
J013170G18CAACGGCCNONE 
J023001K10CAACGGCCNONE 
J023007O21CAACGGCCNONE 
J023027B13CAACGGCCNONE 
J023078F15CAACGGCCNONE 
J023101M07CAACGGCCNONE 
J023120B11CAACGGCCNONE 
J023149L16CAACGGCCNONE 
J033035I04CAACGGCCNONE 
J033072I21CAACGGCCNONE 
J033128C11CAACGGCCNONE 
J033149C07CAACGGCCNONE 
J065153D06CAACGGCCNONE 
J100074A03CAACGGCCNONE 
Os03g0576900AK064861ATCCAACGGCCNONE 
J013000I01ATCCAACGGCCNONE 
J013169P21ATCCAACGGCCNONE 
J023001P03ATCCAACGGCCNONE 
J023009M10ATCCAACGGCCNONE 
J023025G11ATCCAACGGCCNONE 
J033046B19ATCCAACGGCCNONE 
J033149I10ATCCAACGGCCNONE 
J090081C04ATCCAACGGCCNONE 
Os03g0609500Os03g0609500CAACGGCCSimilar to LOB domain protein 39. 
Os03g0672400AK061599TCCAACGGCCConserved hypothetical protein. 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0754800AK101584CAACGGCCMitochondrial substrate carrier family protein. 
J080305A09CAACGGCCNONE 
J080310E24CAACGGCCNONE 
J080310O12CAACGGCCNONE 
J080311N04CAACGGCCNONE 
J080313N20CAACGGCCNONE 
J080317H24CAACGGCCNONE 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0796600003-113-D10CAACGGCCNONE 
011-076-B12CAACGGCCNONE 
AK105257CAACGGCCProtein of unknown function DUF506, plant family protein. 
J075105C03CAACGGCCNONE 
J080036O17CAACGGCCNONE 
J080064E16CAACGGCCNONE 
J080069E03CAACGGCCNONE 
J080079E23CAACGGCCNONE 
J090036H20CAACGGCCNONE 
J100029L10CAACGGCCNONE 
J100055G09CAACGGCCNONE 
Os03g0815900013-097-G08CAACGGCCNONE 
AK065258CAACGGCCNONE 
AK119756CAACGGCCSimilar to DNA-directed RNA polymerase. 
J013002J17CAACGGCCNONE 
J013074A12CAACGGCCNONE 
J023045C17CAACGGCCNONE 
J033050E21CAACGGCCNONE 
J053094P05CAACGGCCNONE 
J090038F11CAACGGCCNONE 
J090072J01CAACGGCCNONE 
J100026H07CAACGGCCNONE 
J100040O06CAACGGCCNONE 
J100083D07CAACGGCCNONE 
Os03g0850600AK067191GGCCGTTGGATConserved hypothetical protein. 
J013095N12GGCCGTTGGATNONE 
J065214L06GGCCGTTGGATNONE 
J075093J10GGCCGTTGGATNONE 
Os04g0194500AK121164CAACGGCCCCCACSimilar to ABC transporter-like protein. 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0367400006-079-G12CAACGGCCNONE 
AK061121CAACGGCCReticulon family protein. 
AK100139CAACGGCCNONE 
J065009F13CAACGGCCNONE 
J065032N11CAACGGCCNONE 
J065039P10CAACGGCCNONE 
J065124I05CAACGGCCNONE 
J065197E16CAACGGCCNONE 
Os04g0376600J033065H17CAACGGCCNONE 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0560100006-090-B07CCAACGGCCCNONE 
AK071033CCAACGGCCCNONE 
AK106001CCAACGGCCCCytochrome P450 family protein. 
J023063N21CCAACGGCCCNONE 
J023078O09CCAACGGCCCNONE 
J090062K20CCAACGGCCCNONE 
Os04g0607200J065082C16CAACGGCCNONE 
J065167I02CAACGGCCNONE 
Os04g0645600AK100006CAACGGCCProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CAACGGCCNONE 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os05g0123100AK120892GGCCGTTGGlycosyl transferase, family 43 protein. 
Os05g0176000J100055L06CAACGGCCFibrillarin family protein. 
Os05g0375400003-125-H02CAACGGCCNONE 
003-128-D02CAACGGCCNONE 
003-128-F08CAACGGCCNONE 
004-007-B08CAACGGCCNONE 
006-026-D11CAACGGCCNONE 
006-027-A12CAACGGCCNONE 
006-029-G06CAACGGCCNONE 
006-047-B10CAACGGCCNONE 
006-053-D08CAACGGCCNONE 
006-070-H11CAACGGCCNONE 
006-078-C06CAACGGCCNONE 
006-079-A04CAACGGCCNONE 
006-084-C10CAACGGCCNONE 
006-099-G02CAACGGCCNONE 
006-112-F07CAACGGCCNONE 
006-118-A02CAACGGCCNONE 
006-119-G04CAACGGCCNONE 
009-039-D09CAACGGCCNONE 
009-053-C11CAACGGCCNONE 
009-178-E07CAACGGCCNONE 
011-004-H01CAACGGCCNONE 
011-010-A04CAACGGCCNONE 
011-010-H04CAACGGCCNONE 
011-018-A04CAACGGCCNONE 
011-023-H04CAACGGCCNONE 
011-025-H01CAACGGCCNONE 
011-044-B04CAACGGCCNONE 
011-044-H08CAACGGCCNONE 
011-049-F01CAACGGCCNONE 
011-056-C03CAACGGCCNONE 
011-064-H01CAACGGCCNONE 
011-070-D07CAACGGCCNONE 
011-081-H09CAACGGCCNONE 
011-087-D03CAACGGCCNONE 
011-090-E01CAACGGCCNONE 
011-094-F08CAACGGCCNONE 
011-097-E08CAACGGCCNONE 
011-099-C03CAACGGCCNONE 
012-027-H12CAACGGCCNONE 
012-031-H01CAACGGCCNONE 
012-040-G01CAACGGCCNONE 
012-047-A03CAACGGCCNONE 
012-055-E06CAACGGCCNONE 
012-076-H11CAACGGCCNONE 
012-086-B03CAACGGCCNONE 
012-091-A05CAACGGCCNONE 
012-096-C03CAACGGCCNONE 
013-001-F09CAACGGCCNONE 
013-003-D02CAACGGCCNONE 
013-006-C08CAACGGCCNONE 
013-006-G04CAACGGCCNONE 
013-007-D08CAACGGCCNONE 
013-008-B10CAACGGCCNONE 
013-008-C12CAACGGCCNONE 
013-011-A10CAACGGCCNONE 
013-011-D04CAACGGCCNONE 
013-014-B10CAACGGCCNONE 
013-015-F02CAACGGCCNONE 
013-018-F08CAACGGCCNONE 
013-021-D03CAACGGCCNONE 
013-021-E12CAACGGCCNONE 
013-026-A06CAACGGCCNONE 
013-026-E12CAACGGCCNONE 
013-028-F08CAACGGCCNONE 
013-032-B01CAACGGCCNONE 
013-032-H07CAACGGCCNONE 
013-037-B09CAACGGCCNONE 
013-038-F11CAACGGCCNONE 
013-039-C04CAACGGCCNONE 
013-040-E11CAACGGCCNONE 
013-050-E12CAACGGCCNONE 
013-050-G09CAACGGCCNONE 
013-053-G07CAACGGCCNONE 
013-055-D04CAACGGCCNONE 
013-056-E10CAACGGCCNONE 
013-056-F04CAACGGCCNONE 
013-060-G06CAACGGCCNONE 
013-066-E12CAACGGCCNONE 
013-068-A09CAACGGCCNONE 
013-068-G07CAACGGCCNONE 
013-072-B02CAACGGCCNONE 
013-073-F07CAACGGCCNONE 
013-075-G07CAACGGCCNONE 
013-082-E04CAACGGCCNONE 
013-083-B04CAACGGCCNONE 
013-085-F08CAACGGCCNONE 
013-087-D08CAACGGCCNONE 
013-089-C08CAACGGCCNONE 
013-090-A01CAACGGCCNONE 
013-093-B03CAACGGCCNONE 
013-099-A07CAACGGCCNONE 
013-099-E03CAACGGCCNONE 
014-024-E04CAACGGCCNONE 
014-049-C09CAACGGCCNONE 
014-078-E06CAACGGCCNONE 
015-038-A11CAACGGCCNONE 
015-070-G03CAACGGCCNONE 
015-074-D01CAACGGCCNONE 
015-082-G04CAACGGCCNONE 
016-006-E05CAACGGCCNONE 
016-011-E07CAACGGCCNONE 
016-040-F10CAACGGCCNONE 
016-042-F10CAACGGCCNONE 
016-052-B11CAACGGCCNONE 
016-069-B04CAACGGCCNONE 
016-079-C01CAACGGCCNONE 
016-080-A10CAACGGCCNONE 
016-085-C09CAACGGCCNONE 
016-093-D08CAACGGCCNONE 
AF323610CAACGGCCNONE 
AK060867CAACGGCCNONE 
AK121825CAACGGCCBeta-glucanase precursor. 
AY768944CAACGGCCNONE 
J013099L04CAACGGCCNONE 
J013153K08CAACGGCCNONE 
J033099G01CAACGGCCNONE 
J065176D10CAACGGCCNONE 
J065176G02CAACGGCCNONE 
J075138B12CAACGGCCNONE 
J075170I16CAACGGCCNONE 
J075194A22CAACGGCCNONE 
J100036M10CAACGGCCNONE 
J100037E23CAACGGCCNONE 
J100037I10CAACGGCCNONE 
J100041D24CAACGGCCNONE 
J100053D13CAACGGCCNONE 
J100054F07CAACGGCCNONE 
J100087M21CAACGGCCNONE 
J100090H22CAACGGCCNONE 
Os05g0413200006-067-C03CCCATCCAACGGCCNONE 
006-080-C03CCCATCCAACGGCCNONE 
006-095-G10CCCATCCAACGGCCNONE 
006-115-G11CCCATCCAACGGCCNONE 
013-040-E05CCCATCCAACGGCCNONE 
AB104732CCCATCCAACGGCCNONE 
AK122099CCCATCCAACGGCCBeta-tubulin. 
J033087H20CCCATCCAACGGCCNONE 
J033117C18CCCATCCAACGGCCNONE 
J033125G10CCCATCCAACGGCCNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0449900012-070-G05CAACGGCCNONE 
AK068138CAACGGCCHomeodomain-like containing protein. 
J013075M21CAACGGCCNONE 
J013135D01CAACGGCCNONE 
J013135L07CAACGGCCNONE 
J065130P04CAACGGCCNONE 
J065142E04CAACGGCCNONE 
Os05g0476100011-031-E09CAACGGCCNONE 
011-033-E05CAACGGCCNONE 
011-038-E02CAACGGCCNONE 
012-053-A09CAACGGCCNONE 
012-057-E02CAACGGCCNONE 
AK064010CAACGGCCProtein of unknown function DUF827, plant family protein. 
AK102615CAACGGCCNONE 
J033057J03CAACGGCCNONE 
J033099E14CAACGGCCNONE 
Os05g0493800AK110589CAACGGCCSimilar to MtN21 nodulin protein-like. 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0567500AK073046CGGGCCGTTGNONE 
AK121133CGGGCCGTTGDNA glycosylase family protein. 
J023075P20CGGGCCGTTGNONE 
Os05g0574500006-021-A08ATCCAACGGCCNONE 
006-049-A11ATCCAACGGCCNONE 
006-086-F03ATCCAACGGCCNONE 
009-051-F06ATCCAACGGCCNONE 
AB015287ATCCAACGGCCNONE 
AB015972ATCCAACGGCCNONE 
AK061714ATCCAACGGCCNONE 
AK098889ATCCAACGGCCNONE 
AK121699ATCCAACGGCCSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCAACGGCCNONE 
J013072D17ATCCAACGGCCNONE 
J023028M04ATCCAACGGCCNONE 
J023031F01ATCCAACGGCCNONE 
J023114L22ATCCAACGGCCNONE 
J033058L12ATCCAACGGCCNONE 
J033073D17ATCCAACGGCCNONE 
J043031D08ATCCAACGGCCNONE 
J043036G01ATCCAACGGCCNONE 
J065144O04ATCCAACGGCCNONE 
J065181O08ATCCAACGGCCNONE 
J080066B20ATCCAACGGCCNONE 
Os05g0586600AB096011GGCCGTTGPlastid sigma factor SIG5. 
AB096071GGCCGTTGNONE 
AK105697GGCCGTTGNONE 
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CAACGGCCCAGANONE 
AK104323CAACGGCCCAGANONE 
Os05g0594100006-034-F04TCCGGGCCGTTGNONE 
006-061-A02TCCGGGCCGTTGNONE 
009-081-E02TCCGGGCCGTTGNONE 
AK060122TCCGGGCCGTTGNONE 
AK106130TCCGGGCCGTTGSimilar to GDA2 protein. 
J023010C07TCCGGGCCGTTGNONE 
J023098J20TCCGGGCCGTTGNONE 
J023117G22TCCGGGCCGTTGNONE 
J023127J08TCCGGGCCGTTGNONE 
J033117G03TCCGGGCCGTTGNONE 
J033124I03TCCGGGCCGTTGNONE 
J043015K15TCCGGGCCGTTGNONE 
Os06g0107800009-133-F03GGCCGTTGNONE 
009-133-F03TCCGGGCCGTTGGATNONE 
AK062921GGCCGTTGSimilar to RAV-like protein. 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0115300009-165-C05CCACCAACGGCCCNONE 
AK058833CCACCAACGGCCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09CCACCAACGGCCCNONE 
J075002E09CCACCAACGGCCCNONE 
J075015K23CCACCAACGGCCCNONE 
J075043B06CCACCAACGGCCCNONE 
J075057O21CCACCAACGGCCCNONE 
J075085L21CCACCAACGGCCCNONE 
J075134N20CCACCAACGGCCCNONE 
J075155O22CCACCAACGGCCCNONE 
J075198N22CCACCAACGGCCCNONE 
Os06g0131500012-073-H11CCAACGGCCNONE 
AK105303CCAACGGCCGlycoside hydrolase, family 17 protein. 
AK109675CCAACGGCCNONE 
J100041O13CCAACGGCCNONE 
Os06g0134000AJ417525ATCCAACGGCCNONE 
AJ417525ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK120319ATCCAACGGCCNONE 
AK120319ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
Os06g0141600006-035-C07CAACGGCCACACGNONE 
AK059772CAACGGCCACACGEarly nodulin 93 ENOD93 protein family protein. 
J075028K13CAACGGCCACACGNONE 
J075070B17CAACGGCCACACGNONE 
J075075G08CAACGGCCACACGNONE 
J075081B21CAACGGCCACACGNONE 
J075116B04CAACGGCCACACGNONE 
J075133E10CAACGGCCACACGNONE 
J075144I23CAACGGCCACACGNONE 
J075147G16CAACGGCCACACGNONE 
J075151E04CAACGGCCACACGNONE 
J075162E07CAACGGCCACACGNONE 
J075163P14CAACGGCCACACGNONE 
J075182C07CAACGGCCACACGNONE 
J075196O22CAACGGCCACACGNONE 
J100086C12CAACGGCCACACGNONE 
Os06g0142200AB018376CAACGGCCACACGEarly nodulin. 
AK105832CAACGGCCACACGNONE 
AK122162CAACGGCCACACGNONE 
J033057P14CAACGGCCACACGNONE 
J033147G13CAACGGCCACACGNONE 
J043012H17CAACGGCCACACGNONE 
J065065E18CAACGGCCACACGNONE 
J065099L01CAACGGCCACACGNONE 
J065119D03CAACGGCCACACGNONE 
J065134O21CAACGGCCACACGNONE 
J065160G17CAACGGCCACACGNONE 
J065201C04CAACGGCCACACGNONE 
J090056D21CAACGGCCACACGNONE 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0607800012-010-G03CAACGGCCCGNONE 
AB070254CAACGGCCCGNONE 
AK063158CAACGGCCCGSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAACGGCCCGNONE 
J013074G13CAACGGCCCGNONE 
J090015C16CAACGGCCCGNONE 
J090069H10CAACGGCCCGNONE 
Os06g0611300AK107800CAACGGCCConserved hypothetical protein. 
Os06g0650900AK071882CAACGGCCACGGCCNONE 
AK107961CAACGGCCACGGCCHeat shock protein DnaJ family protein. 
Os06g0652000AB096015ATCCAACGGCCNONE 
AB120430ATCCAACGGCCNONE 
AK069977ATCCAACGGCCSimilar to T3/T7-like RNA polymerase (Fragment). 
J023038J05ATCCAACGGCCNONE 
J033126K18ATCCAACGGCCNONE 
J043039G23ATCCAACGGCCNONE 
J090084C08ATCCAACGGCCNONE 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os07g0115300006-039-C05ATCCAACGGCCNONE 
AK061511ATCCAACGGCCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0169600006-027-F04AGATGGGCCGTTGNONE 
006-043-C10AGATGGGCCGTTGNONE 
006-070-A04AGATGGGCCGTTGNONE 
006-081-F03AGATGGGCCGTTGNONE 
006-104-F02AGATGGGCCGTTGNONE 
012-006-D12AGATGGGCCGTTGNONE 
AK060318AGATGGGCCGTTGNONE 
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01AGATGGGCCGTTGNONE 
J023086G17AGATGGGCCGTTGNONE 
J023093G16AGATGGGCCGTTGNONE 
J033024N04AGATGGGCCGTTGNONE 
J033099A15AGATGGGCCGTTGNONE 
J033107B14AGATGGGCCGTTGNONE 
J043026F14AGATGGGCCGTTGNONE 
J065043P20AGATGGGCCGTTGNONE 
J075118L16AGATGGGCCGTTGNONE 
J075162M22AGATGGGCCGTTGNONE 
J080004K13AGATGGGCCGTTGNONE 
J080024D10AGATGGGCCGTTGNONE 
J080037C21AGATGGGCCGTTGNONE 
J080039M17AGATGGGCCGTTGNONE 
J080040A03AGATGGGCCGTTGNONE 
J080044A07AGATGGGCCGTTGNONE 
J080045I07AGATGGGCCGTTGNONE 
J080052L06AGATGGGCCGTTGNONE 
J080053A20AGATGGGCCGTTGNONE 
J080060L15AGATGGGCCGTTGNONE 
J080060N22AGATGGGCCGTTGNONE 
J080062L23AGATGGGCCGTTGNONE 
J080069B19AGATGGGCCGTTGNONE 
J080086K15AGATGGGCCGTTGNONE 
J080089H16AGATGGGCCGTTGNONE 
J080089I23AGATGGGCCGTTGNONE 
J080094P07AGATGGGCCGTTGNONE 
J090032L18AGATGGGCCGTTGNONE 
J100044E09AGATGGGCCGTTGNONE 
J100045O03AGATGGGCCGTTGNONE 
J100066B11AGATGGGCCGTTGNONE 
J100069J24AGATGGGCCGTTGNONE 
Os07g0246200012-046-B07GGCCGTTGNONE 
AB021259GGCCGTTGNONE 
AK065341GGCCGTTGSimilar to Calreticulin (Fragment). 
AK099348GGCCGTTGNONE 
AK104328GGCCGTTGNONE 
AK104826GGCCGTTGNONE 
J013000E04GGCCGTTGNONE 
J013093M19GGCCGTTGNONE 
J013108J08GGCCGTTGNONE 
J013118G03GGCCGTTGNONE 
J013121I07GGCCGTTGNONE 
J013153K07GGCCGTTGNONE 
J023028N07GGCCGTTGNONE 
J023034F12GGCCGTTGNONE 
J023043J11GGCCGTTGNONE 
J023087A03GGCCGTTGNONE 
J023099N05GGCCGTTGNONE 
J023105B02GGCCGTTGNONE 
J023110H02GGCCGTTGNONE 
J023112E15GGCCGTTGNONE 
J023132C20GGCCGTTGNONE 
J023134G12GGCCGTTGNONE 
J023138O12GGCCGTTGNONE 
J033031E05GGCCGTTGNONE 
J033032C03GGCCGTTGNONE 
J033039K10GGCCGTTGNONE 
J033050P09GGCCGTTGNONE 
J033074D03GGCCGTTGNONE 
J033075G14GGCCGTTGNONE 
J033075I23GGCCGTTGNONE 
J033081H23GGCCGTTGNONE 
J033087N08GGCCGTTGNONE 
J033110B03GGCCGTTGNONE 
J033148H22GGCCGTTGNONE 
J043027F13GGCCGTTGNONE 
J043031H01GGCCGTTGNONE 
J080003O10GGCCGTTGNONE 
J080022D10GGCCGTTGNONE 
J080029I12GGCCGTTGNONE 
J080034A09GGCCGTTGNONE 
J080035H20GGCCGTTGNONE 
J080049C10GGCCGTTGNONE 
J080053G14GGCCGTTGNONE 
J080055J22GGCCGTTGNONE 
J080058J04GGCCGTTGNONE 
J080069E14GGCCGTTGNONE 
J080069M23GGCCGTTGNONE 
J080072E19GGCCGTTGNONE 
J080072I03GGCCGTTGNONE 
J080075B13GGCCGTTGNONE 
J080078I11GGCCGTTGNONE 
J080081F16GGCCGTTGNONE 
J080088O10GGCCGTTGNONE 
J080089G18GGCCGTTGNONE 
J090009C10GGCCGTTGNONE 
J090022D23GGCCGTTGNONE 
J090023A15GGCCGTTGNONE 
J090024M10GGCCGTTGNONE 
J090038F24GGCCGTTGNONE 
J090039O13GGCCGTTGNONE 
J090040N12GGCCGTTGNONE 
J090054I18GGCCGTTGNONE 
J090061C16GGCCGTTGNONE 
J090063H23GGCCGTTGNONE 
J090067F21GGCCGTTGNONE 
J090075A01GGCCGTTGNONE 
J090076K11GGCCGTTGNONE 
J090078L11GGCCGTTGNONE 
J090079P03GGCCGTTGNONE 
J090087D23GGCCGTTGNONE 
J090087G22GGCCGTTGNONE 
J090089F03GGCCGTTGNONE 
J090092A04GGCCGTTGNONE 
J100024L17GGCCGTTGNONE 
J100031P13GGCCGTTGNONE 
J100032H05GGCCGTTGNONE 
J100036P03GGCCGTTGNONE 
J100038L07GGCCGTTGNONE 
J100043I20GGCCGTTGNONE 
J100069A21GGCCGTTGNONE 
J100078G06GGCCGTTGNONE 
J100081J24GGCCGTTGNONE 
J100081N04GGCCGTTGNONE 
J100084K16GGCCGTTGNONE 
J100085O06GGCCGTTGNONE 
J100088L13GGCCGTTGNONE 
J100090O21GGCCGTTGNONE 
Os07g0531500J065122B10TCCAACGGCCHarpin-induced 1 domain containing protein. 
Os07g0582400003-104-B09CAACGGCCNONE 
AK059423CAACGGCCNONE 
AK102676CAACGGCCNONE 
J065001F09CAACGGCCNONE 
J065005K22CAACGGCCNONE 
J065006D10CAACGGCCNONE 
J065006P17CAACGGCCNONE 
J065015G23CAACGGCCNONE 
J065020F21CAACGGCCNONE 
J065028I05CAACGGCCNONE 
J065042N09CAACGGCCNONE 
J065043P03CAACGGCCNONE 
J065059E15CAACGGCCNONE 
J065090I12CAACGGCCNONE 
J065130I02CAACGGCCNONE 
J065131P05CAACGGCCNONE 
J065163I24CAACGGCCNONE 
J065168I21CAACGGCCNONE 
J065174A12CAACGGCCNONE 
J065178K16CAACGGCCNONE 
J065182P03CAACGGCCNONE 
J065186B07CAACGGCCNONE 
J065189M13CAACGGCCNONE 
J065208J22CAACGGCCNONE 
J065211E11CAACGGCCNONE 
J075054E08CAACGGCCNONE 
J075067K14CAACGGCCNONE 
J075104E20CAACGGCCNONE 
J075152M07CAACGGCCNONE 
Os07g0586700AK102792ATCCAACGGCCConserved hypothetical protein. 
Os07g0588800015-027-E02GGCCGTTGGNONE 
AK070635GGCCGTTGGNONE 
AK103183GGCCGTTGGConserved hypothetical protein. 
J023058H18GGCCGTTGGNONE 
Os07g0607800009-036-C11GGCCGTTGGNONE 
Os07g0656400011-061-F11CAACGGCCCATAConserved hypothetical protein. 
Os07g0657200AB042102CAACGGCCGAGATNONE 
AB042102CCAACGGCCGAGATNONE 
AK072927CAACGGCCGAGATWD40-like domain containing protein. 
AK072927CCAACGGCCGAGATWD40-like domain containing protein. 
AK100911CAACGGCCGAGATNONE 
AK100911CCAACGGCCGAGATNONE 
Os07g0668200AK059051CAACGGCCCATCANONE 
AK101682CAACGGCCCATCAConserved hypothetical protein. 
AK102839CAACGGCCCATCANONE 
Os08g0421900AK064578CAACGGCCBromo adjacent region domain containing protein. 
J065102G01CAACGGCCNONE 
J065164C04CAACGGCCNONE 
J090043M20CAACGGCCNONE 
Os08g0515900J080309P03GGCCGTTGConserved hypothetical protein. 
Os08g0558400AK071334ATCCAACGGCCSimilar to Kinesin heavy chain (Fragment). 
Os09g0326800AK071400GGCCGTTGSimilar to PSMD2 subunit (Fragment). 
Os09g0358500Os09g0358500ATCCAACGGCCNONE 
Os09g0434600AK069042GGCCGTTGConserved hypothetical protein. 
AK071264GGCCGTTGNONE 
J023079H14GGCCGTTGNONE 
J023082P06GGCCGTTGNONE 
J023083M07GGCCGTTGNONE 
J023089M10GGCCGTTGNONE 
J023145P18GGCCGTTGNONE 
Os09g0438100009-186-H04GGCCGTTGNONE 
AK063180GGCCGTTGConserved hypothetical protein. 
Os09g0449500AK111342GGCCGTTGConserved hypothetical protein. 
Os09g0463600AK072780CAACGGCCNONE 
AK121134CAACGGCCProtein of unknown function DUF617, plant family protein. 
J023139I23CAACGGCCNONE 
Os09g0464000AK060777ATCCAACGGCCNONE 
AK069530ATCCAACGGCCSimilar to Carbonate dehydratase-like protein. 
Os09g0486500006-062-H11CCAACGGCCNONE 
009-049-A11CCAACGGCCNONE 
009-070-D06CCAACGGCCNONE 
009-089-A10CCAACGGCCNONE 
009-107-D06CCAACGGCCNONE 
009-133-F02CCAACGGCCNONE 
009-142-A05CCAACGGCCNONE 
009-175-G07CCAACGGCCNONE 
013-044-C05CCAACGGCCNONE 
014-044-D10CCAACGGCCNONE 
AF140722CCAACGGCCNONE 
AK061067CCAACGGCCNONE 
AK070140CCAACGGCCNONE 
AK106128CCAACGGCCMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793CCAACGGCCNONE 
J023042G11CCAACGGCCNONE 
J053043H07CCAACGGCCNONE 
J053046N13CCAACGGCCNONE 
J053091K15CCAACGGCCNONE 
J053094I21CCAACGGCCNONE 
J053094N04CCAACGGCCNONE 
J053100D12CCAACGGCCNONE 
J053101K11CCAACGGCCNONE 
J065079H06CCAACGGCCNONE 
J100028D11CCAACGGCCNONE 
J100033A20CCAACGGCCNONE 
J100033F15CCAACGGCCNONE 
Os09g0502200AK102600CAACGGCCSimilar to Beta-1,3-glucanase (Fragment). 
AK121879CAACGGCCNONE 
J100061G20CAACGGCCNONE 
Os09g0547300AK102669GGCCGTTGCCAACGGCNONE 
Os09g0553900AK099586CCAACGGCCConserved hypothetical protein. 
AY224489CCAACGGCCNONE 
J075017C20CCAACGGCCNONE 
J075019K19CCAACGGCCNONE 
J075060C16CCAACGGCCNONE 
J075089B07CCAACGGCCNONE 
J075114D23CCAACGGCCNONE 
J075143J23CCAACGGCCNONE 
J075150K03CCAACGGCCNONE 
J075156M11CCAACGGCCNONE 
J075166B12CCAACGGCCNONE 
J075179F24CCAACGGCCNONE 
Os11g0158400AK102797CCAACGGCCSimilar to Digalactosyldiacylglycerol synthase 1. 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0600700016-011-B06GGCCGTTGNONE 
AK061258GGCCGTTGNONE 
AK071098GGCCGTTGSimilar to RING domain protein. 
J023081C09GGCCGTTGNONE 
J065027B11GGCCGTTGNONE 
J075024M24GGCCGTTGNONE 
J100023I11GGCCGTTGNONE 
J100069G17GGCCGTTGNONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0621400009-043-B05CCAACGGCCNONE 
AK062468CCAACGGCCConserved hypothetical protein. 
Os11g0629200AK065196CAACGGCCSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0644750009-018-E07CAACGGCCNONE 
009-075-B11CAACGGCCNONE 
009-098-C10CAACGGCCNONE 
AK062734CAACGGCCPlant disease resistance response protein family protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0235800AK058700GGCCGTTGGNONE 
AK071066CAACGGCCCACCCSimilar to Argininosuccinate synthase (Fragment). 
Os12g0297400005-006-D01CAACGGCCACGTCNONE 
AK061658CAACGGCCACGTCHypothetical protein. 
Os12g0614300J100063C15CGGGCCGTTGConserved hypothetical protein. 
Os12g0615800AK073946CAACGGCCGAGATD111/G-patch domain containing protein. 
J033071N19CAACGGCCGAGATNONE 
Os12g0636800AK071648CAACGGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J033101J20CAACGGCCNONE 
J065174L14CAACGGCCNONE 
J075001E12CAACGGCCNONE 
J075101N08CAACGGCCNONE 
J090029O13CAACGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.