version

Summary of OsREG495 (All List)

OrganismOryza sativa  
IDOsREG495  
SequenceCAACGGTC  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count505  

Entry Sequences (505 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09CAACGGTCNONE 
015-011-E06CAACGGTCNONE 
016-083-H11CAACGGTCNONE 
AK100002CAACGGTCConserved hypothetical protein. 
J065063K05CAACGGTCNONE 
J065191H24CAACGGTCNONE 
J100079N16CAACGGTCNONE 
Os01g0172100AK060343CAACGGTCSimilar to Triose phosphate/phosphate translocator, non-green plastid, chloroplast precursor (CTPT). 
Os01g0176500AK102552GACCGTTGConserved hypothetical protein. 
Os01g0191800AK061360GACCGTTGNONE 
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE 
AK068883GTTTGGGCCGACCGTTGNONE 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GTTTGGGCCGACCGTTGNONE 
J043013D08GTTTGGGCCGACCGTTGNONE 
J065089G19GTTTGGGCCGACCGTTGNONE 
J065197K19GTTTGGGCCGACCGTTGNONE 
J075161L21GTTTGGGCCGACCGTTGNONE 
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE 
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein. 
Os01g0281200AK107209GACCGTTGGASimilar to Type B-like cyclin (Fragment). 
AY647458GACCGTTGGANONE 
Os01g0290700AK058263GACCGTTGSimilar to CjMDR1. 
Os01g0296900Os01g0296900CAACGGTCProtein of unknown function DUF6, transmembrane domain containing protein. 
Os01g0306100AK111041GACCGTTGPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0367100AK068655CAACGGTCCAGANONE 
AK101540CAACGGTCCAGANONE 
AK101542CAACGGTCCAGANONE 
AK119785CAACGGTCCAGAConserved hypothetical protein. 
Os01g0578000AK060971ATCCAACGGTCRecA bacterial DNA recombination family protein. 
AK068701ATCCAACGGTCNONE 
J090025J16ATCCAACGGTCNONE 
Os01g0692200AK111036GACCGTTGConserved hypothetical protein. 
Os01g0751600AK108569GACCGTTGConserved hypothetical protein. 
J075117H02GACCGTTGNONE 
J075172C03GACCGTTGNONE 
Os01g0826400AK107199CAACGGTCWRKY transcription factor 24 (WRKY24). 
AY341849CAACGGTCNONE 
AY676925CAACGGTCNONE 
AY870608CAACGGTCNONE 
Os01g0848300AK120668AGCCCATCAACGGTCProtein prenyltransferase domain containing protein. 
Os01g0864100AK064616GACCGTTGGAConserved hypothetical protein. 
Os01g0866200009-039-E12ATCCAACGGTCNONE 
J065059P16ATCCAACGGTCNONE 
J065063E21ATCCAACGGTCNONE 
J065078B21ATCCAACGGTCNONE 
J065079A11ATCCAACGGTCNONE 
J065087H15ATCCAACGGTCNONE 
J065137M10ATCCAACGGTCNONE 
J065138K24ATCCAACGGTCNONE 
J065142E08ATCCAACGGTCNONE 
J065171G11ATCCAACGGTCNONE 
J065183K15ATCCAACGGTCNONE 
J065192J05ATCCAACGGTCNONE 
J075151P09ATCCAACGGTCNONE 
J090020B17ATCCAACGGTCNONE 
J090067F15ATCCAACGGTCNONE 
J090070K06ATCCAACGGTCNONE 
J090094G13ATCCAACGGTCNONE 
J100081M20ATCCAACGGTCHistone H3. 
J100089D06ATCCAACGGTCNONE 
Os01g0866300006-087-C06ATCCAACGGTCNONE 
006-114-E01ATCCAACGGTCNONE 
J065202L13ATCCAACGGTCNONE 
Os01g0934300AK101422GACCGTTGNONE 
J033038C07GACCGTTGNONE 
Os01g0954100009-087-G12TCTGGACCGTTGNONE 
AK062680TCTGGACCGTTGConserved hypothetical protein. 
Os01g0962500AK073163CAACGGTCZinc finger, HIT-type domain containing protein. 
AK105822CAACGGTCNONE 
J033024I07CAACGGTCNONE 
Os02g0251900AK109286GACCGTTGSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0705000006-069-G11CAACGGTCNONE 
006-096-C01CAACGGTCNONE 
006-099-A07CAACGGTCNONE 
AK068080CAACGGTCNmrA-like family protein. 
AK104529CAACGGTCNONE 
AK106021CAACGGTCNONE 
J013132K15CAACGGTCNONE 
Os02g0733300AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGTCCCACCCGNONE 
Os02g0738200J100040B06CAACGGTCNONE 
J100050N02CAACGGTCU box domain containing protein. 
J100056J12CAACGGTCNONE 
Os02g0771200011-006-B07ATCCAACGGTCNONE 
AK066823ATCCAACGGTCConserved hypothetical protein. 
AK071059ATCCAACGGTCNONE 
J013075K03ATCCAACGGTCNONE 
Os02g0771700011-075-D10CAACGGTCNONE 
011-086-E10CAACGGTCNONE 
AK058571CAACGGTCGlycoside hydrolase, family 17 protein. 
AK102185CAACGGTCNONE 
J023001D03CAACGGTCNONE 
J023041N11CAACGGTCNONE 
J033086N13CAACGGTCNONE 
J033106K14CAACGGTCNONE 
J033125P22CAACGGTCNONE 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os02g0789600AK101046CAACGGTCNONE 
AK112100CAACGGTCSimilar to DEM2. 
Os03g0174200AK060616CATCCCCCCAACGGTCNONE 
AK103762CATCCCCCCAACGGTCConserved hypothetical protein. 
J033143G15CATCCCCCCAACGGTCNONE 
J090025L02CATCCCCCCAACGGTCNONE 
Os03g0192500AK068957CCACCAACGGTCProtein phosphatase 2C-like domain containing protein. 
AY603974CCACCAACGGTCNONE 
Os03g0285800AF216315GACCGTTGNONE 
AF332873GACCGTTGNONE 
AF479883GACCGTTGNONE 
AF479884GACCGTTGNONE 
AJ250311GACCGTTGNONE 
AJ486975GACCGTTGNONE 
AK067339GACCGTTGMAP Kinase. 
AK104834GACCGTTGNONE 
J013102O17GACCGTTGNONE 
J023055N19GACCGTTGNONE 
J023099F06GACCGTTGNONE 
J065144H06GACCGTTGNONE 
J065153A14GACCGTTGNONE 
J065212K01GACCGTTGNONE 
Os03g0421800AK099491CCGATCCGACCGTTGVirulence factor, pectin lyase fold family protein. 
J065198F08CCGATCCGACCGTTGNONE 
Os03g0587250J065002M05CAACGGTCConserved hypothetical protein. 
Os03g0669200J013037D23CAACGGTCNONE 
J023026K09CAACGGTCNONE 
J075008E21CAACGGTCNONE 
J075061B21CAACGGTCNONE 
J075151B13CAACGGTCNONE 
J075195L02CAACGGTCNONE 
J090061B07CAACGGTCNONE 
Os03g0672400AK061599CAACGGTCConserved hypothetical protein. 
Os03g0685500009-034-F03TCCAACGGTCNONE 
009-081-B02TCCAACGGTCNONE 
AB110171TCCAACGGTCNONE 
AK062080TCCAACGGTCCHCH domain containing protein. 
AK120726TCCAACGGTCNONE 
J013099K19TCCAACGGTCNONE 
J023002L22TCCAACGGTCNONE 
J023052G18TCCAACGGTCNONE 
J023057J22TCCAACGGTCNONE 
J023095A10TCCAACGGTCNONE 
J033097N07TCCAACGGTCNONE 
J033132H15TCCAACGGTCNONE 
J065064M10TCCAACGGTCNONE 
J065069C22TCCAACGGTCNONE 
J065202I16TCCAACGGTCNONE 
J065214M17TCCAACGGTCNONE 
J075007E07TCCAACGGTCNONE 
J075016A20TCCAACGGTCNONE 
J075036C08TCCAACGGTCNONE 
J075057C03TCCAACGGTCNONE 
J075064H21TCCAACGGTCNONE 
J075078B13TCCAACGGTCNONE 
J075078D01TCCAACGGTCNONE 
J075087P03TCCAACGGTCNONE 
J075091N16TCCAACGGTCNONE 
J075110P14TCCAACGGTCNONE 
J075116J17TCCAACGGTCNONE 
J075148J23TCCAACGGTCNONE 
J075171C20TCCAACGGTCNONE 
J075175K20TCCAACGGTCNONE 
J080035F24TCCAACGGTCNONE 
J080058E06TCCAACGGTCNONE 
J080086E16TCCAACGGTCNONE 
J080301L22TCCAACGGTCNONE 
J080304O06TCCAACGGTCNONE 
J080305N09TCCAACGGTCNONE 
J080306J16TCCAACGGTCNONE 
J080306N17TCCAACGGTCNONE 
J080311O12TCCAACGGTCNONE 
J080315L06TCCAACGGTCNONE 
J080317H12TCCAACGGTCNONE 
J080317O05TCCAACGGTCNONE 
J080318L22TCCAACGGTCNONE 
J090065J21TCCAACGGTCNONE 
J090070G13TCCAACGGTCNONE 
J100028F03TCCAACGGTCNONE 
J100073D05TCCAACGGTCNONE 
Os03g0687700AK064673CAACGGTCConserved hypothetical protein. 
AK119706CAACGGTCNONE 
J075042I10CAACGGTCNONE 
J075111I20CAACGGTCNONE 
J075176K09CAACGGTCNONE 
J080072D18CAACGGTCNONE 
J080306M23CAACGGTCNONE 
Os03g0695400AK070048ATCCAACGGTCAnkyrin repeat containing protein. 
Os03g0726100004-005-B05GACCGTTGNONE 
006-023-C08GACCGTTGNONE 
006-029-H02GACCGTTGNONE 
006-032-B03GACCGTTGNONE 
006-035-C10GACCGTTGNONE 
006-040-H05GACCGTTGNONE 
006-043-C02GACCGTTGNONE 
006-046-B11GACCGTTGNONE 
006-046-E05GACCGTTGNONE 
006-046-H04GACCGTTGNONE 
006-048-A09GACCGTTGNONE 
006-050-A02GACCGTTGNONE 
006-063-A02GACCGTTGNONE 
006-064-A09GACCGTTGNONE 
006-070-G11GACCGTTGNONE 
006-072-G04GACCGTTGNONE 
006-077-G12GACCGTTGNONE 
006-080-F04GACCGTTGNONE 
006-080-H01GACCGTTGNONE 
006-084-D10GACCGTTGNONE 
006-084-G06GACCGTTGNONE 
006-085-H10GACCGTTGNONE 
006-086-C05GACCGTTGNONE 
006-087-D10GACCGTTGNONE 
006-096-C09GACCGTTGNONE 
006-100-F10GACCGTTGNONE 
006-108-D12GACCGTTGNONE 
006-115-G10GACCGTTGNONE 
006-119-C09GACCGTTGNONE 
006-120-E05GACCGTTGNONE 
011-042-H01GACCGTTGNONE 
011-075-B11GACCGTTGNONE 
013-003-D03GACCGTTGNONE 
013-028-B11GACCGTTGNONE 
013-031-A01GACCGTTGNONE 
013-035-F03GACCGTTGNONE 
013-051-D02GACCGTTGNONE 
013-055-D06GACCGTTGNONE 
013-059-H03GACCGTTGNONE 
013-076-A09GACCGTTGNONE 
013-076-B01GACCGTTGNONE 
013-090-F09GACCGTTGNONE 
013-100-A05GACCGTTGNONE 
013-100-F05GACCGTTGNONE 
013-100-G12GACCGTTGNONE 
014-006-G08GACCGTTGNONE 
015-003-B07GACCGTTGNONE 
016-093-C06GACCGTTGNONE 
AF030548GACCGTTGNONE 
AK102194GACCGTTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247GACCGTTGNONE 
AK119362GACCGTTGNONE 
AK119638GACCGTTGNONE 
J013066P16GACCGTTGNONE 
J023022H18GACCGTTGNONE 
J023087O13GACCGTTGNONE 
J023121I16GACCGTTGNONE 
J023123M09GACCGTTGNONE 
J033022M05GACCGTTGNONE 
J033087C05GACCGTTGNONE 
J065022K07GACCGTTGNONE 
J065024E22GACCGTTGNONE 
J065041G05GACCGTTGNONE 
J065045M11GACCGTTGNONE 
J065082K10GACCGTTGNONE 
J065121K18GACCGTTGNONE 
J065137O07GACCGTTGNONE 
J065144B12GACCGTTGNONE 
J065152E04GACCGTTGNONE 
J065159D24GACCGTTGNONE 
J065217E02GACCGTTGNONE 
J075014N22GACCGTTGNONE 
J075064O17GACCGTTGNONE 
J080316L10GACCGTTGNONE 
J080318L20GACCGTTGNONE 
J090034D01GACCGTTGNONE 
J090034P05GACCGTTGNONE 
J090041H08GACCGTTGNONE 
J090042F20GACCGTTGNONE 
J090042I15GACCGTTGNONE 
J090050O17GACCGTTGNONE 
J090054L13GACCGTTGNONE 
J090062A12GACCGTTGNONE 
J090068I22GACCGTTGNONE 
J090070J23GACCGTTGNONE 
J090070M18GACCGTTGNONE 
J090084L07GACCGTTGNONE 
J090087H13GACCGTTGNONE 
J090095H10GACCGTTGNONE 
J090099M17GACCGTTGNONE 
J100022O10GACCGTTGNONE 
J100048A05GACCGTTGNONE 
J100057O06GACCGTTGNONE 
X91806GACCGTTGNONE 
Os03g0786000AK061286CAACGGTCConserved hypothetical protein. 
AK073187CAACGGTCNONE 
Os03g0799000013-010-A07GACCGTTGGATGGGNONE 
013-081-H02GACCGTTGGATGGGNONE 
AK067840GACCGTTGGATGGGSimilar to Histone H1. 
AK099211GACCGTTGGATGGGNONE 
J065066F23GACCGTTGGATGGGNONE 
J065138O20GACCGTTGGATGGGNONE 
J065163G22GACCGTTGGATGGGNONE 
J065211J01GACCGTTGGATGGGNONE 
J080027D02GACCGTTGGATGGGNONE 
J080029E20GACCGTTGGATGGGNONE 
J080045D03GACCGTTGGATGGGNONE 
J080060G13GACCGTTGGATGGGNONE 
J080067E14GACCGTTGGATGGGNONE 
J080067J04GACCGTTGGATGGGNONE 
J080067J21GACCGTTGGATGGGNONE 
J080068L09GACCGTTGGATGGGNONE 
J080077E15GACCGTTGGATGGGNONE 
J080078B03GACCGTTGGATGGGNONE 
J080086H09GACCGTTGGATGGGNONE 
J090095G02GACCGTTGGATGGGNONE 
J100058H04GACCGTTGGATGGGNONE 
Os04g0128700AK107172CAACGGTCThioredoxin-like fold domain containing protein. 
J065102M16CAACGGTCNONE 
J065124K01CAACGGTCNONE 
J065129I12CAACGGTCNONE 
J065192C08CAACGGTCNONE 
Os04g0408900009-183-E05GACCGTTGNONE 
AK058627GACCGTTGSimilar to DNA-binding protein S1FA. 
J023014N01GACCGTTGNONE 
J023088K23GACCGTTGNONE 
J065086B17GACCGTTGNONE 
J065095F08GACCGTTGNONE 
J065119N11GACCGTTGNONE 
J100032H17GACCGTTGNONE 
Os04g0458900AK121454CAACGGTCSimilar to Pectin methylesterase-like protein. 
J023001D17CAACGGTCNONE 
J023042F14CAACGGTCNONE 
J023142P03CAACGGTCNONE 
Os04g0470300AK059742GACCGTTGNONE 
AK070483GACCGTTGProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06GACCGTTGNONE 
J090047A18GACCGTTGNONE 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0504200AK110863CAACGGTCConserved hypothetical protein. 
Os04g0506300AK063591CAACGGTCTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08CAACGGTCNONE 
Os04g0510000AK109180GACCGTTGConserved hypothetical protein. 
Os04g0559400AK106376CAACGGTCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0623100006-042-D10CAACGGTCNONE 
AK067276CAACGGTCBromodomain containing protein. 
J013097L22CAACGGTCNONE 
J013099L18CAACGGTCNONE 
J023009D13CAACGGTCNONE 
J023041M21CAACGGTCNONE 
J090088H12CAACGGTCNONE 
Os04g0671800AK070857CAACGGTCZinc finger, CCCH-type domain containing protein. 
J065099I11CAACGGTCNONE 
J065198C01CAACGGTCNONE 
J090031E15CAACGGTCNONE 
Os05g0167600AK060646GACCGTTGConserved hypothetical protein. 
Os05g0205100AK111332GACCGTTGNLI interacting factor domain containing protein. 
AK111332GACCGTTGNLI interacting factor domain containing protein. 
Os05g0217000AK062517CAACGGTCProtein of unknown function DUF1070 family protein. 
J075142D02CAACGGTCNONE 
Os05g0409400AK102597CGGGCCGACCGTTGMAP65/ASE1 family protein. 
Os05g0410800AK108312CAACGGTCTGF-beta receptor, type I/II extracellular region family protein. 
Os05g0456000AK058420ATCCAACGGTCCAGAMitochondrial glycoprotein family protein. 
AK102036ATCCAACGGTCCAGANONE 
J065066F02ATCCAACGGTCCAGANONE 
Os05g0507000AK108025CAACGGTCConserved hypothetical protein. 
Os05g0547800009-166-F08GACCGTTGNONE 
AK073272GACCGTTGConserved hypothetical protein. 
J033029C12GACCGTTGNONE 
Os06g0172000AK068738ATCCAACGGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0179700AK065602GACCGTTGGATSimilar to DNA-binding protein phosphatase 2C. 
Os06g0212900AK071518ATCCAACGGTCHeat shock protein Hsp70 family protein. 
AK104048ATCCAACGGTCNONE 
J023019O18ATCCAACGGTCNONE 
J023090N13ATCCAACGGTCNONE 
J023101M15ATCCAACGGTCNONE 
J023122F06ATCCAACGGTCNONE 
J075023H16ATCCAACGGTCNONE 
J090006J22ATCCAACGGTCNONE 
J090075F24ATCCAACGGTCNONE 
J090095A17ATCCAACGGTCNONE 
Os06g0557100AK111851GACCGTTGProtein kinase-like domain containing protein. 
AK119892GACCGTTGNONE 
J023150C23GACCGTTGNONE 
J033108M17GACCGTTGNONE 
J065062L01GACCGTTGNONE 
J065161G20GACCGTTGNONE 
J090062G13GACCGTTGNONE 
J090087H11GACCGTTGNONE 
J100055H23GACCGTTGNONE 
J100063G05GACCGTTGNONE 
Os06g0589600AK111758CAACGGTCProtein kinase-like domain containing protein. 
J100032C08CAACGGTCNONE 
J100067P18CAACGGTCNONE 
Os06g0612200016-021-A02CAACGGTCNONE 
AK059094CAACGGTCRNA polymerase Rpb1, domain 5 containing protein. 
Os06g0683900011-042-B09CAACGGTCNONE 
011-042-F07CAACGGTCNONE 
015-047-H05CAACGGTCNONE 
016-011-D06CAACGGTCNONE 
AK063941CAACGGTCConserved hypothetical protein. 
AK102096CAACGGTCNONE 
J090059F01CAACGGTCNONE 
Os06g0710900AK073326CAACGGTCConserved hypothetical protein. 
Os06g0726800AK070518GACCGTTGG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GACCGTTGNONE 
J053032B13GACCGTTGNONE 
X82036GACCGTTGNONE 
Os07g0136300AK064609CAACGGTCConserved hypothetical protein. 
Os07g0194800015-063-F04CAACGGTCNONE 
AK064329CAACGGTCNONE 
AK100100CAACGGTCConserved hypothetical protein. 
AK101244CAACGGTCNONE 
J065176O11CAACGGTCNONE 
Os07g0474300AK108961ATCCAACGGTCConserved hypothetical protein. 
AK108961GATCCGACCGTTGGAConserved hypothetical protein. 
Os07g0599000AK069667CAACGGTCProtein prenyltransferase domain containing protein. 
J065037F02CAACGGTCNONE 
Os07g0614100AB032062CAACGGTCNONE 
AK058885CAACGGTCNONE 
AK069145CAACGGTCNONE 
AK102448CAACGGTCAlpha 1-2 subunit of 20S proteasome. 
J023007E07CAACGGTCNONE 
J033093O06CAACGGTCNONE 
Os07g0688300AK068325GACCGTTGGASimilar to Importin alpha 1. 
AK099611GACCGTTGGANONE 
Os08g0127100003-104-H01CAACGGTCNONE 
015-032-F08CAACGGTCNONE 
AK065217CAACGGTCNONE 
AK102015CAACGGTCAmino acid transporter, transmembrane family protein. 
J013002G10CAACGGTCNONE 
J013152E01CAACGGTCNONE 
J023007G24CAACGGTCNONE 
J023019F17CAACGGTCNONE 
J023074N19CAACGGTCNONE 
J023120E22CAACGGTCNONE 
J023120J05CAACGGTCNONE 
J023125E14CAACGGTCNONE 
J023145J12CAACGGTCNONE 
J033092G02CAACGGTCNONE 
J065019M06CAACGGTCNONE 
J065029J04CAACGGTCNONE 
J065031G24CAACGGTCNONE 
J065043J15CAACGGTCNONE 
J065049A17CAACGGTCNONE 
J065055N20CAACGGTCNONE 
J065062O05CAACGGTCNONE 
J065083A02CAACGGTCNONE 
J065086H21CAACGGTCNONE 
J065109F15CAACGGTCNONE 
J065121C11CAACGGTCNONE 
J065132J19CAACGGTCNONE 
J065135C06CAACGGTCNONE 
J065194N14CAACGGTCNONE 
J065201A20CAACGGTCNONE 
J100027B05CAACGGTCNONE 
J100036C02CAACGGTCNONE 
J100043G09CAACGGTCNONE 
J100048A10CAACGGTCNONE 
J100056I17CAACGGTCNONE 
J100062N21CAACGGTCNONE 
J100064N15CAACGGTCNONE 
J100082K15CAACGGTCNONE 
Os08g0338900AK073476GACCGTTGConserved hypothetical protein. 
AK110998GACCGTTGNONE 
Os08g0369400J065116P10ATCCAACGGTCAnkyrin repeat containing protein. 
Os08g0430600009-181-E04CAACGGTCNONE 
AK060045CAACGGTCConserved hypothetical protein. 
AK068922CAACGGTCNONE 
J013170B19CAACGGTCNONE 
J065076C03CAACGGTCNONE 
J065218G16CAACGGTCNONE 
J090045N10CAACGGTCNONE 
J100028O03CAACGGTCNONE 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0496400AK110964GACCGTTGConserved hypothetical protein. 
Os09g0127800AK103786CAACGGTCCAGASimilar to Coatomer alpha subunit. 
Os09g0270900012-092-E06CAACGGTCNONE 
015-057-G12CAACGGTCNONE 
AK106363CAACGGTCFe-S metabolism associated SufE family protein. 
J065013K03CAACGGTCNONE 
Os09g0322300AK107151ATCCAACGGTCCAGAHypothetical protein. 
J075023P17ATCCAACGGTCCAGANONE 
J075143O05ATCCAACGGTCCAGANONE 
Os09g0450901J065009G09CAACGGTCNONE 
J065015O13CAACGGTCNONE 
J065082C06CAACGGTCConserved hypothetical protein. 
Os09g0538450J080302B10GACCGTTGHypothetical protein. 
Os09g0538700Os09g0538700GACCGTTGGlutelin family protein. 
Os09g0547200016-021-H03GACCGTTGNONE 
AK073078GACCGTTGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GACCGTTGNONE 
J065005L05GACCGTTGNONE 
J065039C06GACCGTTGNONE 
J065116H17GACCGTTGNONE 
J100046A17GACCGTTGNONE 
Os11g0137500AK070070GTCGAGTCCAACGGTCTranscription factor TFIIE, alpha subunit family protein. 
Os11g0157400AK066482CAACGGTCExo70 exocyst complex subunit family protein. 
Os11g0223000J065060C21CAACGGTCNONE 
Os11g0448400AB095094TCCAACGGTCSimilar to Sigma factor SIG2A. 
J075053H03TCCAACGGTCNONE 
J075062F23TCCAACGGTCNONE 
J090029D08TCCAACGGTCNONE 
Os11g0542100J065162B12GACCGTTGZinc finger, RING-type domain containing protein. 
Os11g0586300AK072257CAACGGTCConserved hypothetical protein. 
Os12g0285600AK069104CAACGGTCOxysterol-binding protein family protein. 
Os12g0407100J075130F11CAACGGTCCAGANONE 
J075150G14CAACGGTCCAGAConserved hypothetical protein. 
J090089B20CAACGGTCCAGANONE 
J100042D22CAACGGTCCAGANONE 
Os12g0610100Os12g0610100CAACGGTCConserved hypothetical protein. 
Os12g0640500AK070701CAACGGTCSimilar to Na+/H+ antiporter-like protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.