version

Summary of OsREG496 (All List)

OrganismOryza sativa  
IDOsREG496  
SequenceCAAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1765  

Entry Sequences (1765 entries)

LocusGene modelSequenceDescription
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0139600AK073130TTGTGGGCTTGGSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0142500AK067964CAAGCCCAAGHomeodomain-like containing protein. 
Os01g0196600AK101742CCAAGCCCACGCNONE 
U25430CCAAGCCCACGCSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CCAAGCCCAAAANONE 
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE 
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715AGCCCAAGCCCAACANONE 
AK122128AGCCCAAGCCCAACANONE 
J033132L17AGCCCAAGCCCAACANONE 
J065019G15AGCCCAAGCCCAACANONE 
J065033O12AGCCCAAGCCCAACANONE 
J065058J19AGCCCAAGCCCAACANONE 
J065069L03AGCCCAAGCCCAACANONE 
J065072E03AGCCCAAGCCCAACANONE 
J065112J06AGCCCAAGCCCAACANONE 
J065163C18AGCCCAAGCCCAACANONE 
J065170L20AGCCCAAGCCCAACANONE 
J065184O11AGCCCAAGCCCAACANONE 
J065199M19AGCCCAAGCCCAACANONE 
J065207P22AGCCCAAGCCCAACANONE 
J065211C12AGCCCAAGCCCAACANONE 
J075072K20AGCCCAAGCCCAACANONE 
J075100B16AGCCCAAGCCCAACANONE 
J075173F02AGCCCAAGCCCAACANONE 
J090083E15AGCCCAAGCCCAACANONE 
J100022F06AGCCCAAGCCCAACANONE 
J100064C04AGCCCAAGCCCAACANONE 
J100068F11AGCCCAAGCCCAACANONE 
Os01g0327600AK120216AAATGGGCTTGGNONE 
AK121799AAATGGGCTTGGConserved hypothetical protein. 
J065081I07AAATGGGCTTGGNONE 
J065082D04AAATGGGCTTGGNONE 
J065082G10AAATGGGCTTGGNONE 
J065085G24AAATGGGCTTGGNONE 
J065105J24AAATGGGCTTGGNONE 
J065128D18AAATGGGCTTGGNONE 
J065155D13AAATGGGCTTGGNONE 
J065200C11AAATGGGCTTGGNONE 
Os01g0350900AK070217GGTTGGGCTTGSimilar to VIP2 protein. 
J065165D23GGTTGGGCTTGNONE 
Os01g0357400012-030-F01CAAGCCCAGCCNONE 
012-045-H02CAAGCCCAGCCNONE 
AK063489CAAGCCCAGCCSimilar to Alpha-amylase. 
D10417CAAGCCCAGCCNONE 
Os01g0512200J013067C10ATCCCCCACAAGCCCAACTNONE 
Os01g0571200014-074-A10GGCTGGGCTTGNONE 
AK121299GGCTGGGCTTGSimilar to Ribosomal protein L34. 
J023110L12GGCTGGGCTTGNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0623600011-011-B08CAAGCCCAGNONE 
011-052-G08CAAGCCCAGNONE 
AK103106CAAGCCCAGNONE 
J033023J06CAAGCCCAGNONE 
J033036F02CAAGCCCAGNONE 
J033057J05CAAGCCCAGNONE 
J033074C10CAAGCCCAGNONE 
J033106K18CAAGCCCAGNONE 
J033118O22CAAGCCCAGNONE 
J033120G01CAAGCCCAGNONE 
J033120P07CAAGCCCAGSimilar to Polygalacturonase precursor (EC 3.2.1.15) (PG) (Pectinase). 
J033132C08CAAGCCCAGNONE 
J033136L24CAAGCCCAGNONE 
Os01g0640800AK065688CAAGCCCAGConserved hypothetical protein 48 family protein. 
J013042L10CAAGCCCAGNONE 
J013121H08CAAGCCCAGNONE 
Os01g0661400AK073113CCAAGCCCATANucleic acid-binding, OB-fold domain containing protein. 
J023014C20CCAAGCCCATANONE 
J033022G03CCAAGCCCATANONE 
J065050H15CCAAGCCCATANONE 
J065059J19CCAAGCCCATANONE 
J065085I24CCAAGCCCATANONE 
J065166G12CCAAGCCCATANONE 
J065182C18CCAAGCCCATANONE 
Os01g0663400016-054-B01CAAGCCCAGNONE 
AK072283CAAGCCCAGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CAAGCCCAGNONE 
J065180A21CAAGCCCAGNONE 
J075026E13CAAGCCCAGNONE 
J075109M23CAAGCCCAGNONE 
J075151A02CAAGCCCAGNONE 
J090004B07CAAGCCCAGNONE 
J090023O22CAAGCCCAGNONE 
J090054G09CAAGCCCAGNONE 
J090058H13CAAGCCCAGNONE 
J090076G13CAAGCCCAGNONE 
J100057F11CAAGCCCAGNONE 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0710800013-097-E05GGTTGGGCTTGAAGCCCAACNONE 
AK069973GGTTGGGCTTGAAGCCCAACNONE 
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein. 
J023081K01GGTTGGGCTTGAAGCCCAACNONE 
J023123E16GGTTGGGCTTGAAGCCCAACNONE 
J033066B11GGTTGGGCTTGAAGCCCAACNONE 
J065144G11GGTTGGGCTTGAAGCCCAACNONE 
Os01g0736400AK069723GGCTGGGCTTGGNONE 
AK100689GGCTGGGCTTGGAminotransferase, class I and II domain containing protein. 
Os01g0739000AK069568CCAAGCCCACAASimilar to Mitochondrial processing peptidase. 
AK073810CCAAGCCCACAANONE 
J013042N17CCAAGCCCACAANONE 
J023128N16CCAAGCCCACAANONE 
J033024F18CCAAGCCCACAANONE 
J033037D09CCAAGCCCACAANONE 
J033050E17CCAAGCCCACAANONE 
J033065K22CCAAGCCCACAANONE 
J033070E13CCAAGCCCACAANONE 
J033087A13CCAAGCCCACAANONE 
Os01g0773600AK067004CAAGCCCAGGlycoside hydrolase, family 47 protein. 
J013091F09CAAGCCCAGNONE 
J013134K14CAAGCCCAGNONE 
J013158J15CAAGCCCAGNONE 
J033060O20CAAGCCCAGNONE 
J033074C16CAAGCCCAGNONE 
J075086F05CAAGCCCAGNONE 
J075150H08CAAGCCCAGNONE 
J090006E02CAAGCCCAGNONE 
J090074E02CAAGCCCAGNONE 
J100030M05CAAGCCCAGNONE 
J100036M16CAAGCCCAGNONE 
J100063H18CAAGCCCAGNONE 
Os01g0798500006-106-C11CCAAGCCCATGNONE 
AK061244CCAAGCCCATGNONE 
AK068219CCAAGCCCATGMalate synthase-like family protein. 
J065199O16CCAAGCCCATGNONE 
Os01g0838300J090017B22CCAAGCCCAACTNONE 
J090061B04CCAAGCCCAACTNONE 
Os01g0861000AK058707CAAGCCCATATConserved hypothetical protein. 
Os01g0908100AK072293TGTTGGGCTTGRabGAP/TBC domain containing protein. 
J065010B13TGTTGGGCTTGNONE 
J065010M12TGTTGGGCTTGNONE 
J065047C19TGTTGGGCTTGNONE 
J065069B18TGTTGGGCTTGNONE 
J065071K24TGTTGGGCTTGNONE 
J065142P04TGTTGGGCTTGNONE 
J065170E11TGTTGGGCTTGNONE 
Os01g0960400AK111512CCAAGCCCAACTProtein kinase-like domain containing protein. 
Os01g0976100AK069646AGTTGGGCTTGABC transporter, transmembrane region domain containing protein. 
Os02g0175800009-083-C02CAAGCCCAGNONE 
009-184-H07CAAGCCCAGNONE 
009-199-D07CAAGCCCAGNONE 
AK058292CAAGCCCAGNONE 
AK120215CAAGCCCAGConserved hypothetical protein. 
J013040G12CAAGCCCAGNONE 
J065050N21CAAGCCCAGNONE 
J065077O07CAAGCCCAGNONE 
J065102G05CAAGCCCAGNONE 
J065197A04CAAGCCCAGNONE 
J075024L24CAAGCCCAGNONE 
J075038K01CAAGCCCAGNONE 
J075044L04CAAGCCCAGNONE 
J075063D23CAAGCCCAGNONE 
J075079P13CAAGCCCAGNONE 
J075084G03CAAGCCCAGNONE 
J075135G07CAAGCCCAGNONE 
J075148D17CAAGCCCAGNONE 
J075150F13CAAGCCCAGNONE 
J075157F06CAAGCCCAGNONE 
J090054A05CAAGCCCAGNONE 
J090085O04CAAGCCCAGNONE 
J100023C04CAAGCCCAGNONE 
J100023H23CAAGCCCAGNONE 
J100026A16CAAGCCCAGNONE 
J100035K13CAAGCCCAGNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0186700AK064492CTTGGGCTTGConserved hypothetical protein. 
J065210K09CTTGGGCTTGNONE 
J075006A17CTTGGGCTTGNONE 
J075108C18CTTGGGCTTGNONE 
J075153E08CTTGGGCTTGNONE 
Os02g0193600AK060499CCAAGCCCAACTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0198600005-012-D12TTTTGGGCTTGNONE 
AK058299TTTTGGGCTTGNONE 
Os02g0499300AK106994CAAGCCCAATTConserved hypothetical protein. 
Os02g0610700014-008-A03GCTGGGCTTGGNONE 
AK059205GCTGGGCTTGGConserved hypothetical protein. 
AK100281GCTGGGCTTGGNONE 
J023074H03GCTGGGCTTGGNONE 
J065002J16GCTGGGCTTGGNONE 
J065032I20GCTGGGCTTGGNONE 
J065076A07GCTGGGCTTGGNONE 
J065142O21GCTGGGCTTGGNONE 
J065203A03GCTGGGCTTGGNONE 
J075017F24GCTGGGCTTGGNONE 
J075017G24GCTGGGCTTGGNONE 
Os02g0618250009-115-E10CAAGCCCATCANONE 
009-115-E10CCAAGCCCATGTNONE 
014-076-A03CAAGCCCATCANONE 
014-076-A03CCAAGCCCATGTNONE 
J065096D10CAAGCCCATCASimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J065096D10CCAAGCCCATGTSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CAAGCCCATCANONE 
J075045G01CCAAGCCCATGTNONE 
J075092J11CAAGCCCATCANONE 
J075092J11CCAAGCCCATGTNONE 
J075134F02CAAGCCCATCANONE 
J075134F02CCAAGCCCATGTNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0679500AK067772GGTGGGCTTGSimilar to Rac GTPase activating protein 1. 
AY364311GGTGGGCTTGNONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0689200011-024-D04TGTGGGCTTGGNONE 
AK065336TGTGGGCTTGGNONE 
AK071254TGTGGGCTTGGNONE 
J013000O22TGTGGGCTTGGNONE 
J023087G23TGTGGGCTTGGNONE 
J033095E21TGTGGGCTTGGNONE 
J033113F12TGTGGGCTTGGNONE 
J033124F02TGTGGGCTTGGNONE 
J065070A01TGTGGGCTTGGNONE 
J065129C05TGTGGGCTTGGNONE 
J065165M19TGTGGGCTTGGNONE 
J090015K07TGTGGGCTTGGNONE 
J090016L11TGTGGGCTTGGNONE 
J090066D21TGTGGGCTTGGNONE 
J090075M20TGTGGGCTTGGNONE 
Os02g0744000AK064898CCAAGCCCAAAAConserved hypothetical protein. 
AK104827CCAAGCCCAAAANONE 
J013000L12CCAAGCCCAAAANONE 
J013156N02CCAAGCCCAAAANONE 
J065001H14CCAAGCCCAAAANONE 
J065038D18CCAAGCCCAAAANONE 
J065039I18CCAAGCCCAAAANONE 
J065047C13CCAAGCCCAAAANONE 
J065053J09CCAAGCCCAAAANONE 
J065064G03CCAAGCCCAAAANONE 
J065066M05CCAAGCCCAAAANONE 
J065068O10CCAAGCCCAAAANONE 
J065090H22CCAAGCCCAAAANONE 
J065113L19CCAAGCCCAAAANONE 
J065121M02CCAAGCCCAAAANONE 
J065122K23CCAAGCCCAAAANONE 
J065138C12CCAAGCCCAAAANONE 
J065153E14CCAAGCCCAAAANONE 
J065156N12CCAAGCCCAAAANONE 
J065158L20CCAAGCCCAAAANONE 
J065166I06CCAAGCCCAAAANONE 
J065174L15CCAAGCCCAAAANONE 
J065175N03CCAAGCCCAAAANONE 
J090092C23CCAAGCCCAAAANONE 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0754700AK066904TCAGCCCAAGCCCAAGSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TCAGCCCAAGCCCAAGNONE 
Os02g0765600011-044-C02CAAGCCCAGCCNONE 
011-059-H12CAAGCCCAGCCNONE 
012-010-G07CAAGCCCAGCCNONE 
012-040-D02CAAGCCCAGCCNONE 
012-048-F02CAAGCCCAGCCNONE 
012-055-C12CAAGCCCAGCCNONE 
012-065-C04CAAGCCCAGCCNONE 
012-086-D01CAAGCCCAGCCNONE 
012-099-G02CAAGCCCAGCCNONE 
015-002-D01CAAGCCCAGCCNONE 
015-067-D08CAAGCCCAGCCNONE 
016-060-E08CAAGCCCAGCCNONE 
AK101744CAAGCCCAGCCAlpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B). 
J033023N15CAAGCCCAGCCNONE 
J033061O03CAAGCCCAGCCNONE 
J033107J03CAAGCCCAGCCNONE 
J033119C02CAAGCCCAGCCNONE 
J043001H07CAAGCCCAGCCNONE 
J043003H07CAAGCCCAGCCNONE 
J043003I05CAAGCCCAGCCNONE 
J043009K22CAAGCCCAGCCNONE 
J043009L08CAAGCCCAGCCNONE 
J043012J02CAAGCCCAGCCNONE 
J043015P13CAAGCCCAGCCNONE 
J043016H11CAAGCCCAGCCNONE 
J043020F17CAAGCCCAGCCNONE 
J053027C06CAAGCCCAGCCNONE 
J053099F07CAAGCCCAGCCNONE 
J065025M06CAAGCCCAGCCNONE 
J065029M17CAAGCCCAGCCNONE 
J065044H20CAAGCCCAGCCNONE 
J065089P12CAAGCCCAGCCNONE 
J065098N21CAAGCCCAGCCNONE 
J065143N20CAAGCCCAGCCNONE 
J065161C24CAAGCCCAGCCNONE 
J065170A09CAAGCCCAGCCNONE 
J065197N16CAAGCCCAGCCNONE 
J065214E11CAAGCCCAGCCNONE 
J065216J23CAAGCCCAGCCNONE 
J100026D11CAAGCCCAGCCNONE 
J100062F01CAAGCCCAGCCNONE 
J100080O15CAAGCCCAGCCNONE 
J100082F09CAAGCCCAGCCNONE 
M24286CAAGCCCAGCCNONE 
Os02g0769800009-140-D12TTTTGGGCTTGNONE 
AK062956TTTTGGGCTTGSimilar to Mitogen-activated protein kinase kinase kinase 1 (EC 2.7.1.-) (Arabidospsis NPK1-related protein kinase 1). Splice isoform 1S. 
Os02g0775300AK111093CCAAGCCCAAGConserved hypothetical protein. 
J100039N18CCAAGCCCAAGNONE 
Os02g0787100Os02g0787100CAAGCCCAATAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0797600004-004-A08CAAGCCCAGNONE 
006-050-H07CAAGCCCAGNONE 
006-092-B02CAAGCCCAGNONE 
006-100-B08CAAGCCCAGNONE 
013-037-D09CAAGCCCAGNONE 
013-068-H02CAAGCCCAGNONE 
AK060857CAAGCCCAGNONE 
AK098882CAAGCCCAGNONE 
AK104474CAAGCCCAGNONE 
AK120644CAAGCCCAGConserved hypothetical protein. 
J013001F21CAAGCCCAGNONE 
J013074D07CAAGCCCAGNONE 
J013096H23CAAGCCCAGNONE 
J013098H07CAAGCCCAGNONE 
J013132L13CAAGCCCAGNONE 
J013134K05CAAGCCCAGNONE 
J013155B15CAAGCCCAGNONE 
J023002L17CAAGCCCAGNONE 
J023013B08CAAGCCCAGNONE 
J023087I01CAAGCCCAGNONE 
J033071O04CAAGCCCAGNONE 
J065161N23CAAGCCCAGNONE 
J075055G11CAAGCCCAGNONE 
J075106J02CAAGCCCAGNONE 
J080009D06CAAGCCCAGNONE 
J080009N22CAAGCCCAGNONE 
J080016L03CAAGCCCAGNONE 
J080023E17CAAGCCCAGNONE 
J080027A12CAAGCCCAGNONE 
J080036M24CAAGCCCAGNONE 
J080038N07CAAGCCCAGNONE 
J080041A04CAAGCCCAGNONE 
J080042K11CAAGCCCAGNONE 
J080050A04CAAGCCCAGNONE 
J080053G16CAAGCCCAGNONE 
J080063D03CAAGCCCAGNONE 
J080063F07CAAGCCCAGNONE 
J080067H13CAAGCCCAGNONE 
J080068F12CAAGCCCAGNONE 
J080072G17CAAGCCCAGNONE 
J080072I06CAAGCCCAGNONE 
J080072J24CAAGCCCAGNONE 
J080076G09CAAGCCCAGNONE 
J080085H10CAAGCCCAGNONE 
J080092I17CAAGCCCAGNONE 
J080092N20CAAGCCCAGNONE 
J080093G10CAAGCCCAGNONE 
J090074C23CAAGCCCAGNONE 
J090083O18CAAGCCCAGNONE 
J100046M05CAAGCCCAGNONE 
J100050N16CAAGCCCAGNONE 
J100054D07CAAGCCCAGNONE 
J100054O11CAAGCCCAGNONE 
J100055F04CAAGCCCAGNONE 
J100055H22CAAGCCCAGNONE 
J100063A05CAAGCCCAGNONE 
J100063I24CAAGCCCAGNONE 
J100067I12CAAGCCCAGNONE 
J100074A22CAAGCCCAGNONE 
J100078B22CAAGCCCAGNONE 
J100079B03CAAGCCCAGNONE 
Os02g0813700Os02g0813700CAAGCCCATGANONE 
Os02g0818900AK107997CCAAGCCCAGCHeavy metal transport/detoxification protein domain containing protein. 
J065112M01CCAAGCCCAGCNONE 
J065152N01CCAAGCCCAGCNONE 
J100052D19CCAAGCCCAGCNONE 
J100085M12CCAAGCCCAGCNONE 
J100087A05CCAAGCCCAGCNONE 
J100088H04CCAAGCCCAGCNONE 
Os03g0108600AK065776CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAAGCCCAAACNONE 
Os03g0109600005-005-D08TACTGGGCTTGNONE 
AK061661TACTGGGCTTGNONE 
Os03g0124300AK069148CAAGCCCAACCConserved hypothetical protein. 
AK106076CAAGCCCAACCNONE 
J023003G19CAAGCCCAACCNONE 
Os03g0169700AK066912TACTGGGCTTGConserved hypothetical protein. 
Os03g0181400012-051-B05CAAGCCCAATANONE 
015-065-E09CAAGCCCAATANONE 
AK064006CAAGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0192400009-081-A03CAAGCCCACTCTNONE 
009-159-B02CAAGCCCACTCTNONE 
AK070573CAAGCCCACTCTGRIM-19 family protein. 
J023056B01CAAGCCCACTCTNONE 
J023075G06CAAGCCCACTCTNONE 
J033048K16CAAGCCCACTCTNONE 
J033048L16CAAGCCCACTCTNONE 
J053031H23CAAGCCCACTCTNONE 
J065002H14CAAGCCCACTCTNONE 
J065006G22CAAGCCCACTCTNONE 
J065032G13CAAGCCCACTCTNONE 
J065056A09CAAGCCCACTCTNONE 
J065078I01CAAGCCCACTCTNONE 
J065095G01CAAGCCCACTCTNONE 
J065095I18CAAGCCCACTCTNONE 
J065134M18CAAGCCCACTCTNONE 
J065158P07CAAGCCCACTCTNONE 
J065165K17CAAGCCCACTCTNONE 
J065181J12CAAGCCCACTCTNONE 
J065189N09CAAGCCCACTCTNONE 
J065200D13CAAGCCCACTCTNONE 
J065202H20CAAGCCCACTCTNONE 
J065215K20CAAGCCCACTCTNONE 
J075049N19CAAGCCCACTCTNONE 
J075147J16CAAGCCCACTCTNONE 
J090081E19CAAGCCCACTCTNONE 
J100017C16CAAGCCCACTCTNONE 
J100039M16CAAGCCCACTCTNONE 
J100043E23CAAGCCCACTCTNONE 
J100063L12CAAGCCCACTCTNONE 
J100079F22CAAGCCCACTCTNONE 
Os03g0248000AK070612CAAGCCCAAGCCCNONE 
AK071419CAAGCCCAAGCCCNONE 
AK100304CAAGCCCAAGCCCAutophagy protein Apg9 family protein. 
Os03g0262400014-013-D09CAAGCCCAGTANONE 
AK059989CAAGCCCAGTASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18CAAGCCCAGTANONE 
J033025J23CAAGCCCAGTANONE 
J065047G10CAAGCCCAGTANONE 
J065153H03CAAGCCCAGTANONE 
J065155J08CAAGCCCAGTANONE 
J075025C05CAAGCCCAGTANONE 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0272400009-134-B08CAAGCCCATCANONE 
AK070454CAAGCCCATCAHypothetical protein. 
J023050K07CAAGCCCATCANONE 
J075075P06CAAGCCCATCANONE 
J090098L07CAAGCCCATCANONE 
Os03g0276800015-062-A05TTATGGGCTTGNONE 
AK106371TTATGGGCTTGHeat shock protein Hsp70 family protein. 
Os03g0309800004-019-H07CTTGGGCCCAAGCCCAACNONE 
AK060922CTTGGGCCCAAGCCCAACNONE 
AK098942CTTGGGCCCAAGCCCAACNONE 
AK106141CTTGGGCCCAAGCCCAACNONE 
AK111530CTTGGGCCCAAGCCCAACNONE 
AK111624CTTGGGCCCAAGCCCAACSimilar to PPR2. 
J013024C10CTTGGGCCCAAGCCCAACNONE 
J013043D15CTTGGGCCCAAGCCCAACNONE 
J013108I11CTTGGGCCCAAGCCCAACNONE 
J100058L07CTTGGGCCCAAGCCCAACNONE 
J100071I19CTTGGGCCCAAGCCCAACNONE 
Os03g0321000AK103653CAAGCCCACAASimilar to Steroid membrane binding protein-like. 
Os03g0331900AK063044ATTTGGGCTTGNONE 
AK099570ATTTGGGCTTGConserved hypothetical protein. 
J065064G01ATTTGGGCTTGNONE 
Os03g0395000AK073283CCAAGCCCAAAASimilar to Heme oxygenase 2 (Fragment). 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0574300AK072541CCAAGCCCACGGCCHypothetical protein. 
J023134M10CCAAGCCCACGGCCNONE 
Os03g0610800AK107194CAAGCCCATACSimilar to Protein zx. 
Os03g0612600009-073-H01CCAAGCCCAACTNONE 
AK071403CCAAGCCCAACTRibosomal protein L25-like domain containing protein. 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0656900AK066416AGATGGGCTTGNusB/RsmB/TIM44 domain containing protein. 
J065157L23AGATGGGCTTGNONE 
J065166P22AGATGGGCTTGNONE 
Os03g0701500009-150-F12CCAAGCCCACTCCNONE 
AK063166CCAAGCCCACTCCGNS1/SUR4 membrane protein family protein. 
Os03g0708600AK069199CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CAAGCCCAAACNONE 
J023008E04CAAGCCCAAACNONE 
J023030D22CAAGCCCAAACNONE 
J033027E16CAAGCCCAAACNONE 
J033046D09CAAGCCCAAACNONE 
J033068I10CAAGCCCAAACNONE 
J033135A12CAAGCCCAAACNONE 
J065027E22CAAGCCCAAACNONE 
J065191K23CAAGCCCAAACNONE 
J090054D15CAAGCCCAAACNONE 
J090058J15CAAGCCCAAACNONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0737600014-094-E01CCAAGCCCAGCNONE 
AB038234CCAAGCCCAGCNONE 
AK101854CCAAGCCCAGCCyclin H-1. 
AK105468CCAAGCCCAGCNONE 
J033069N12CCAAGCCCAGCNONE 
J043017A22CCAAGCCCAGCNONE 
J065154A20CCAAGCCCAGCNONE 
Os03g0746400AK063445TGTTGGGCTTGProtein prenyltransferase domain containing protein. 
AK070923TGTTGGGCTTGNONE 
J065008K24TGTTGGGCTTGNONE 
Os03g0766000AK070596CCAAGCCCATGANONE 
AK104743CCAAGCCCATGANONE 
AK106079CCAAGCCCATGANONE 
J013063M09CCAAGCCCATGANONE 
J023056A03CCAAGCCCATGANONE 
J043038L07CCAAGCCCATGANONE 
J053067N16CCAAGCCCATGANONE 
J053073G09CCAAGCCCATGANONE 
J053075I19CCAAGCCCATGANONE 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0786000AK061286CCAAGCCCACCTConserved hypothetical protein. 
AK073187CCAAGCCCACCTNONE 
Os03g0787200AK103438CAAGCCCACCIQ calmodulin-binding region domain containing protein. 
J065009F06CAAGCCCACCNONE 
J065046F02CAAGCCCACCNONE 
J065127L12CAAGCCCACCNONE 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0823800AK058223ATCTGGGCTTGNONE 
Os04g0259200AK119366CCAAGCCCAAGHypothetical protein. 
Os04g0416000J065041L09CCAAGCCCAGNONE 
J065050F15CCAAGCCCAGNONE 
J065053M14CCAAGCCCAGProtein of unknown function DUF1279 domain containing protein. 
J065057I09CCAAGCCCAGNONE 
J065132E14CCAAGCCCAGNONE 
J065144L23CCAAGCCCAGNONE 
J065154N13CCAAGCCCAGNONE 
J065158P16CCAAGCCCAGNONE 
J080302F01CCAAGCCCAGNONE 
J080308G20CCAAGCCCAGNONE 
Os04g0437600AK061622CAAGCCCATTNONE 
Os04g0481100AK119297ATTTGGGCTTGNONE 
Os04g0552700AK121993GGTTGGGCTTGGZinc finger, C2H2-type domain containing protein. 
J053047K15GGTTGGGCTTGGNONE 
Os04g0564700AK111615GCTGGGCTTGNONE 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0583101005-010-A06GCTGGGCTTGNONE 
AK065769GCTGGGCTTGProtein prenyltransferase domain containing protein. 
J013040G18GCTGGGCTTGNONE 
J023100E21GCTGGGCTTGNONE 
J075041E15GCTGGGCTTGNONE 
J075056L11GCTGGGCTTGNONE 
J075081F19GCTGGGCTTGNONE 
J075126J10GCTGGGCTTGNONE 
J075148G19GCTGGGCTTGNONE 
J075178A14GCTGGGCTTGNONE 
J100085H06GCTGGGCTTGNONE 
Os04g0584600006-042-D11CAAGCCCATCANONE 
006-065-G07CAAGCCCATCANONE 
AB042550CAAGCCCATCANONE 
AK059786CAAGCCCATCANONE 
AK061881CAAGCCCATCANONE 
AK066495CAAGCCCATCASimilar to Calcium dependent protein kinase. 
J090067J05CAAGCCCATCANONE 
J100037I23CAAGCCCATCANONE 
Os04g0595000AK106907TCATGGGCTTGPeptidase A1, pepsin family protein. 
Os04g0636900011-028-G03CAAGCCCAGCNONE 
012-040-G03CAAGCCCAGCNONE 
AK058405CAAGCCCAGCNONE 
AK065789CAAGCCCAGCNONE 
AK101408CAAGCCCAGCNONE 
AK119286CAAGCCCAGCNONE 
J013042J24CAAGCCCAGCNONE 
J033037I12CAAGCCCAGCNONE 
J043031B12CAAGCCCAGCNONE 
J065152N10CAAGCCCAGCNONE 
J090060K17CAAGCCCAGCNONE 
J090083K14CAAGCCCAGCNONE 
J100046O13CAAGCCCAGCNONE 
J100066G22CAAGCCCAGCNONE 
Os04g0681600AK105243CAAGCCCATCAProtein of unknown function DUF580 family protein. 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0103100AK103317GGATGGGCTTGTranslocon-associated beta family protein. 
J033125H15GGATGGGCTTGNONE 
J065021L01GGATGGGCTTGNONE 
J065029M01GGATGGGCTTGNONE 
J065089F17GGATGGGCTTGNONE 
J065112N04GGATGGGCTTGNONE 
J065163L03GGATGGGCTTGNONE 
J065175B04GGATGGGCTTGNONE 
J065192E02GGATGGGCTTGNONE 
J075046C20GGATGGGCTTGNONE 
J075192A01GGATGGGCTTGNONE 
J100018H13GGATGGGCTTGNONE 
J100067K20GGATGGGCTTGNONE 
J100080N03GGATGGGCTTGNONE 
Os05g0110100009-015-D08AGGTGGGCTTGGNONE 
009-023-C09AGGTGGGCTTGGNONE 
009-031-B11AGGTGGGCTTGGNONE 
009-034-C02AGGTGGGCTTGGNONE 
009-050-B08AGGTGGGCTTGGNONE 
009-065-D12AGGTGGGCTTGGNONE 
009-090-G08AGGTGGGCTTGGNONE 
009-111-H07AGGTGGGCTTGGNONE 
009-136-F12AGGTGGGCTTGGNONE 
009-138-E06AGGTGGGCTTGGNONE 
009-138-G12AGGTGGGCTTGGNONE 
009-141-D08AGGTGGGCTTGGNONE 
009-143-D01AGGTGGGCTTGGNONE 
009-179-D09AGGTGGGCTTGGNONE 
009-179-E03AGGTGGGCTTGGNONE 
009-196-A09AGGTGGGCTTGGNONE 
009-199-F04AGGTGGGCTTGGNONE 
013-021-E05AGGTGGGCTTGGNONE 
013-076-C04AGGTGGGCTTGGNONE 
013-096-F06AGGTGGGCTTGGNONE 
014-071-A05AGGTGGGCTTGGNONE 
014-077-F09AGGTGGGCTTGGNONE 
AK099779AGGTGGGCTTGGNONE 
AK121142AGGTGGGCTTGGConserved hypothetical protein. 
J013095A16AGGTGGGCTTGGNONE 
J013111A17AGGTGGGCTTGGNONE 
J013132G04AGGTGGGCTTGGNONE 
J023077M04AGGTGGGCTTGGNONE 
J065001B11AGGTGGGCTTGGNONE 
J065001E11AGGTGGGCTTGGNONE 
J065057G10AGGTGGGCTTGGNONE 
J065057L08AGGTGGGCTTGGNONE 
J065080E07AGGTGGGCTTGGNONE 
J065087K10AGGTGGGCTTGGNONE 
J065091M15AGGTGGGCTTGGNONE 
J065167A15AGGTGGGCTTGGNONE 
J075018F02AGGTGGGCTTGGNONE 
J075063F20AGGTGGGCTTGGNONE 
J075064F18AGGTGGGCTTGGNONE 
J075066N19AGGTGGGCTTGGNONE 
J075073I02AGGTGGGCTTGGNONE 
J075080P17AGGTGGGCTTGGNONE 
J075081F11AGGTGGGCTTGGNONE 
J075085E03AGGTGGGCTTGGNONE 
J075101G18AGGTGGGCTTGGNONE 
J075149N08AGGTGGGCTTGGNONE 
J075158I21AGGTGGGCTTGGNONE 
J075161M20AGGTGGGCTTGGNONE 
J075190F12AGGTGGGCTTGGNONE 
J075194K16AGGTGGGCTTGGNONE 
J080001E08AGGTGGGCTTGGNONE 
J080001F21AGGTGGGCTTGGNONE 
J080001H19AGGTGGGCTTGGNONE 
J080001O15AGGTGGGCTTGGNONE 
J080005I22AGGTGGGCTTGGNONE 
J080006K23AGGTGGGCTTGGNONE 
J080014D20AGGTGGGCTTGGNONE 
J080014I05AGGTGGGCTTGGNONE 
J080014K21AGGTGGGCTTGGNONE 
J080017I24AGGTGGGCTTGGNONE 
J080017K11AGGTGGGCTTGGNONE 
J080018F11AGGTGGGCTTGGNONE 
J080022L18AGGTGGGCTTGGNONE 
J080024N23AGGTGGGCTTGGNONE 
J080027J23AGGTGGGCTTGGNONE 
J080029B14AGGTGGGCTTGGNONE 
J080032F14AGGTGGGCTTGGNONE 
J080032K19AGGTGGGCTTGGNONE 
J080032O21AGGTGGGCTTGGNONE 
J080033P17AGGTGGGCTTGGNONE 
J080034I06AGGTGGGCTTGGNONE 
J080039F24AGGTGGGCTTGGNONE 
J080040O13AGGTGGGCTTGGNONE 
J080042B02AGGTGGGCTTGGNONE 
J080043E12AGGTGGGCTTGGNONE 
J080043J15AGGTGGGCTTGGNONE 
J080043N09AGGTGGGCTTGGNONE 
J080052J08AGGTGGGCTTGGNONE 
J080053K01AGGTGGGCTTGGNONE 
J080053K19AGGTGGGCTTGGNONE 
J080055J09AGGTGGGCTTGGNONE 
J080058D07AGGTGGGCTTGGNONE 
J080062F11AGGTGGGCTTGGNONE 
J080063J24AGGTGGGCTTGGNONE 
J080066H04AGGTGGGCTTGGNONE 
J080066I09AGGTGGGCTTGGNONE 
J080067B02AGGTGGGCTTGGNONE 
J080067N09AGGTGGGCTTGGNONE 
J080068D22AGGTGGGCTTGGNONE 
J080068K13AGGTGGGCTTGGNONE 
J080069N19AGGTGGGCTTGGNONE 
J080070D07AGGTGGGCTTGGNONE 
J080070E05AGGTGGGCTTGGNONE 
J080071G04AGGTGGGCTTGGNONE 
J080077G05AGGTGGGCTTGGNONE 
J080077O06AGGTGGGCTTGGNONE 
J080085F05AGGTGGGCTTGGNONE 
J080086E07AGGTGGGCTTGGNONE 
J080089G16AGGTGGGCTTGGNONE 
J080092K15AGGTGGGCTTGGNONE 
J080094A08AGGTGGGCTTGGNONE 
J080097A09AGGTGGGCTTGGNONE 
J080097J07AGGTGGGCTTGGNONE 
J090027N01AGGTGGGCTTGGNONE 
J090081J05AGGTGGGCTTGGNONE 
Os05g0121000009-181-E02CAAGCCCACNONE 
AK058867CAAGCCCACNONE 
AK071341CAAGCCCACProtein of unknown function DUF1218 family protein. 
J023024H24CAAGCCCACNONE 
J023090B22CAAGCCCACNONE 
J023111G15CAAGCCCACNONE 
J023134K14CAAGCCCACNONE 
J033057C05CAAGCCCACNONE 
J033067J15CAAGCCCACNONE 
J033084L15CAAGCCCACNONE 
J033088B04CAAGCCCACNONE 
J043027A08CAAGCCCACNONE 
J043029L03CAAGCCCACNONE 
J053031K22CAAGCCCACNONE 
J053046I01CAAGCCCACNONE 
J053070B05CAAGCCCACNONE 
J053072C10CAAGCCCACNONE 
J065097M22CAAGCCCACNONE 
J065164I17CAAGCCCACNONE 
J075058I08CAAGCCCACNONE 
J075064C09CAAGCCCACNONE 
J080304C16CAAGCCCACNONE 
J080304H16CAAGCCCACNONE 
J080306E17CAAGCCCACNONE 
J080310L03CAAGCCCACNONE 
J080316J07CAAGCCCACNONE 
J080317L23CAAGCCCACNONE 
J080319A10CAAGCCCACNONE 
J090060F01CAAGCCCACNONE 
J100042N16CAAGCCCACNONE 
J100047F05CAAGCCCACNONE 
J100075J19CAAGCCCACNONE 
Os05g0128100009-051-B07ATTGGGCTTGNONE 
009-127-B08ATTGGGCTTGNONE 
009-144-H03ATTGGGCTTGNONE 
009-176-B05ATTGGGCTTGNONE 
AK108556ATTGGGCTTGNONE 
AK119308ATTGGGCTTGNONE 
AK120934ATTGGGCTTGConserved hypothetical protein. 
J023036J15ATTGGGCTTGNONE 
J065122L01ATTGGGCTTGNONE 
J075104P10ATTGGGCTTGNONE 
Os05g0129900AK060436GGTGGGCTTGGTetratricopeptide-like helical domain containing protein. 
AK102515GGTGGGCTTGGNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0178100AK120915CAAGCCCAAATGA 3beta-hydroxylase. 
Os05g0186000006-103-D10TCATGGGCTTGGNONE 
009-047-D06TCATGGGCTTGGNONE 
009-073-G05TCATGGGCTTGGNONE 
009-084-G09TCATGGGCTTGGNONE 
009-097-G04TCATGGGCTTGGNONE 
009-111-D11TCATGGGCTTGGNONE 
009-115-G01TCATGGGCTTGGNONE 
009-131-B04TCATGGGCTTGGNONE 
009-144-F05TCATGGGCTTGGNONE 
009-154-D08TCATGGGCTTGGNONE 
014-004-H02TCATGGGCTTGGNONE 
AK058675TCATGGGCTTGGNONE 
AK060420TCATGGGCTTGGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TCATGGGCTTGGNONE 
J065155C08TCATGGGCTTGGNONE 
J075143K12TCATGGGCTTGGNONE 
Os05g0205100AK111332CAAGCCCAGCNLI interacting factor domain containing protein. 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein. 
Os05g0267100009-106-H07ACATGGGCTTGNONE 
009-177-H02ACATGGGCTTGNONE 
AK062790ACATGGGCTTGNONE 
AK065811ACATGGGCTTGNONE 
J013026N17ACATGGGCTTGNONE 
J013039F07ACATGGGCTTGNONE 
Os05g0335800AK108393CCAAGCCCAACATGF-beta receptor, type I/II extracellular region family protein. 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0346400AK058872CCAAGCCCATCTNONE 
AK102727CCAAGCCCATCTProtein of unknown function DUF538 family protein. 
J033105N07CCAAGCCCATCTNONE 
J100077I17CCAAGCCCATCTNONE 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0414300AK120513TTTTGGGCTTGDisease resistance protein family protein. 
AK120791TTTTGGGCTTGNONE 
Os05g0429900AK066834CCAAGCCCAATANONE 
AK099108CCAAGCCCAATANONE 
AK104053CCAAGCCCAATANONE 
D88617CCAAGCCCAATASimilar to MybHv5 (Fragment). 
J090031E22CCAAGCCCAATANONE 
Os05g0430200J090095K16CAAGCCCACCACNONE 
Os05g0459900AK058918CAAGCCCACAASimilar to 60S ribosomal protein L36-1. 
AK111268CAAGCCCACAANONE 
J013129N08CAAGCCCACAANONE 
J065191E01CAAGCCCACAANONE 
J065216P03CAAGCCCACAANONE 
J075089K21CAAGCCCACAANONE 
Os05g0461000006-113-A06AATGGGCTTGNONE 
AB042259AATGGGCTTGNONE 
AK059189AATGGGCTTGNONE 
AK066739AATGGGCTTGClathrin adaptor complex, small chain family protein. 
AK099044AATGGGCTTGNONE 
AK104166AATGGGCTTGNONE 
Os05g0486200009-099-B03CAAGCCCACACNONE 
AK121022CAAGCCCACACConserved hypothetical protein. 
J023049I09CAAGCCCACACNONE 
J033029N07CAAGCCCACACNONE 
J075074I18CAAGCCCACACNONE 
Os05g0500500AK110627ATATGGGCTTGHSP20-like chaperone domain containing protein. 
Os05g0534400AK101368GGTGGGCTTGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13GGTGGGCTTGNONE 
J065045H07GGTGGGCTTGNONE 
Os05g0535700009-067-F01GCAGCCCAAGCCCAAGCCCAAGNONE 
AK061590GCAGCCCAAGCCCAAGCCCAAGNONE 
AK062545GCAGCCCAAGCCCAAGCCCAAGConserved hypothetical protein. 
Os05g0566800AK065748CAAGCCCAGATCold acclimation protein COR413-TM1. 
AY181210CAAGCCCAGATNONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0187900009-171-C09CAAGCCCAACCNONE 
AK063879CAAGCCCAACCNONE 
AK071765CAAGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CAAGCCCAACCNONE 
J033098E13CAAGCCCAACCNONE 
J100036J11CAAGCCCAACCNONE 
J100047B19CAAGCCCAACCNONE 
Os06g0202400009-101-G07CAAGCCCAAAANONE 
AK062755CAAGCCCAAAAConserved hypothetical protein. 
Os06g0219600AK060429CCAAGCCCAAGSimilar to Poly(A)-binding protein II-like. 
AK099019CCAAGCCCAAGNONE 
J013118A14CCAAGCCCAAGNONE 
Os06g0222900AK109820CTTGGGCTTGGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0274200009-090-A02AAAGCCCAAGCCCAGNONE 
AK073155AAAGCCCAAGCCCAGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08AAAGCCCAAGCCCAGNONE 
J065061C07AAAGCCCAAGCCCAGNONE 
J065105L08AAAGCCCAAGCCCAGNONE 
J075013C12AAAGCCCAAGCCCAGNONE 
J090010N17AAAGCCCAAGCCCAGNONE 
J090068K07AAAGCCCAAGCCCAGNONE 
J100058A21AAAGCCCAAGCCCAGNONE 
J100066C07AAAGCCCAAGCCCAGNONE 
Os06g0283300Os06g0283300CTGGGCTTGSimilar to Protein-serine/threonine kinase. 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0546500AK073833CAAGCCCAAGSimilar to Class III peroxidase GvPx2b (Fragment). 
J065042H02CAAGCCCAAGNONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0643000AK067701GTGTGGGCTTGPhox-like domain containing protein. 
J013032G04GTGTGGGCTTGNONE 
J013044B17GTGTGGGCTTGNONE 
J013114M13GTGTGGGCTTGNONE 
J023133A02GTGTGGGCTTGNONE 
J043022A07GTGTGGGCTTGNONE 
J075046O21GTGTGGGCTTGNONE 
J075142L01GTGTGGGCTTGNONE 
J090076I16GTGTGGGCTTGNONE 
J100056O17GTGTGGGCTTGNONE 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0681000009-105-G11AGATGGGCTTGNONE 
AK062780AGATGGGCTTGConserved hypothetical protein. 
J100021E01AGATGGGCTTGNONE 
Os06g0682800011-092-E01GTTTGGGCTTGNONE 
AK064816GTTTGGGCTTGZinc finger, CCCH-type domain containing protein. 
J013000E13GTTTGGGCTTGNONE 
J013035J22GTTTGGGCTTGNONE 
J013045M06GTTTGGGCTTGNONE 
J013120A07GTTTGGGCTTGNONE 
J033144H15GTTTGGGCTTGNONE 
J033145H15GTTTGGGCTTGNONE 
J033145N16GTTTGGGCTTGNONE 
J090019J02GTTTGGGCTTGNONE 
Os06g0709300AK108588ACGTGGGCTTGFAR1 domain containing protein. 
Os07g0122300015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0185700012-040-A11CAAGCCCACCACNONE 
AK070572CAAGCCCACCACConserved hypothetical protein. 
J065116D10CAAGCCCACCACNONE 
J065122F20CAAGCCCACCACNONE 
Os07g0191700AK066389CCAAGCCCATGSimilar to AT.I.24-9 protein (Fragment). 
AK103768CCAAGCCCATGNONE 
Os07g0231500AK109283CAAGCCCAAATCyclin-like domain containing protein. 
J075001D10CAAGCCCAAATNONE 
J075088P14CAAGCCCAAATNONE 
J075115C22CAAGCCCAAATNONE 
J075199L15CAAGCCCAAATNONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0296900J075050I18CCAAGCCCACGAConserved hypothetical protein. 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0558800AK100986CAAGCCCATGAMajor sperm protein domain containing protein. 
Os07g0564700AK059018TTTTGGGCTTGHypothetical protein. 
Os07g0568100AK099778CAAGCCCAGTTSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0577400AK100831TTGTGGGCTTGNONE 
J013095B12TTGTGGGCTTGNONE 
J023123D09TTGTGGGCTTGNONE 
J065002E19TTGTGGGCTTGNONE 
J065135H07TTGTGGGCTTGNONE 
J065150N01TTGTGGGCTTGNONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0617800AK060481CAAGCCCAGCSimilar to Alanine aminotransferase. 
Os07g0668200AK059051CAAGCCCAAATNONE 
AK101682CAAGCCCAAATConserved hypothetical protein. 
AK102839CAAGCCCAAATNONE 
Os07g0687300AK073043CAAGCCCAAACSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0116800AK063695CAAGCCCAAGExoribonuclease domain containing protein. 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0236900AK109597CTTGGGCTTGConserved hypothetical protein. 
Os08g0322400AK120116AAATGGGCTTGGNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20AAATGGGCTTGGNONE 
J013096J15AAATGGGCTTGGNONE 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0379000AK105647CCAAGCCCACCProtein prenyltransferase domain containing protein. 
Os08g0379300AK103923CTGGGCTTGNONE 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0500900AK102314GGTGGGCTTGGSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0517900015-019-D06CAAGCCCATTANONE 
AK064304CAAGCCCATTASimilar to 30S ribosomal protein S16. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0550100AB070258CAAGCCCAGTTNONE 
AK061287CAAGCCCAGTTSimilar to 26S proteasome subunit RPN3a. 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0347900AK071224CAAGCCCAATTConserved hypothetical protein. 
J023087B12CAAGCCCAATTNONE 
Os09g0364500J100031B16CAAGCCCAAAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07CAAGCCCAAANONE 
J100078G03CAAGCCCAAANONE 
Os09g0397900AK101306CAAGCCCAACCSimilar to FEG protein. 
Os09g0415700AK102287CAAGCCCATTProtein of unknown function DUF248, methyltransferase putative family protein. 
J013095G13CAAGCCCATTNONE 
J013128E08CAAGCCCATTNONE 
J023072N21CAAGCCCATTNONE 
J023083D13CAAGCCCATTNONE 
J023090E24CAAGCCCATTNONE 
J023097A14CAAGCCCATTNONE 
J023122E02CAAGCCCATTNONE 
J023130H06CAAGCCCATTNONE 
J033052I04CAAGCCCATTNONE 
J033071G04CAAGCCCATTNONE 
J033089J21CAAGCCCATTNONE 
J033090L16CAAGCCCATTNONE 
J033100P19CAAGCCCATTNONE 
J033102C11CAAGCCCATTNONE 
J033124H23CAAGCCCATTNONE 
J033129E23CAAGCCCATTNONE 
J043003I16CAAGCCCATTNONE 
J090029J24CAAGCCCATTNONE 
J090033P05CAAGCCCATTNONE 
J090068G20CAAGCCCATTNONE 
J090094K13CAAGCCCATTNONE 
Os09g0424850J065006K24CAAGCCCAATConserved hypothetical protein. 
Os09g0454900011-052-B02CCAAGCCCAACTNONE 
016-025-D09CCAAGCCCAACTNONE 
AK102152CCAAGCCCAACTCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22CCAAGCCCAACTNONE 
Os09g0456900AK073236TATGGGCTTGGNucleic acid-binding, OB-fold domain containing protein. 
Os09g0528100009-173-A08CCAAGCCCAATNONE 
009-190-G12CCAAGCCCAATNONE 
AK059096CCAAGCCCAATSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16CCAAGCCCATGTProtein prenyltransferase domain containing protein. 
Os09g0539100AK071977CCAAGCCCAACCTCTCCGCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CCAAGCCCAACCTCTCCGCNONE 
Os09g0547200016-021-H03CAAGCCCATGNONE 
AK073078CAAGCCCATGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CAAGCCCATGNONE 
J065005L05CAAGCCCATGNONE 
J065039C06CAAGCCCATGNONE 
J065116H17CAAGCCCATGNONE 
J100046A17CAAGCCCATGNONE 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os09g0573200J013027J02TATGGGCTTGGNONE 
J013034M08TATGGGCTTGGNONE 
J013037L03TATGGGCTTGGNONE 
J013041D10TATGGGCTTGGNONE 
J013042D15TATGGGCTTGGNONE 
J013109H17TATGGGCTTGGNONE 
J013132A18TATGGGCTTGGNONE 
J013160N13TATGGGCTTGGNONE 
J013169I09TATGGGCTTGGNONE 
J023029F18TATGGGCTTGGNONE 
J023041A02TATGGGCTTGGNONE 
J023097B14TATGGGCTTGGNONE 
J023142I04TATGGGCTTGGNONE 
J023142N06TATGGGCTTGGNONE 
J033023I21TATGGGCTTGGNONE 
J033032G15TATGGGCTTGGNONE 
J033042M17TATGGGCTTGGNONE 
J033070F09TATGGGCTTGGNONE 
J053063L09TATGGGCTTGGNONE 
J053064A09TATGGGCTTGGNONE 
J065073M19TATGGGCTTGGNONE 
J075005H11TATGGGCTTGGNONE 
J075026D12TATGGGCTTGGNONE 
J075043G07TATGGGCTTGGNONE 
J075084N05TATGGGCTTGGNONE 
J075092D05TATGGGCTTGGNONE 
J075110E24TATGGGCTTGGNONE 
J075176I05TATGGGCTTGGNONE 
J090009H19TATGGGCTTGGNONE 
J090025K11TATGGGCTTGGNONE 
J090049E20TATGGGCTTGGNONE 
J090070G02TATGGGCTTGGNONE 
Os11g0126900012-037-D04CCAAGCCCATNONE 
015-046-E12CCAAGCCCATNONE 
015-069-A05CCAAGCCCATNONE 
AK069257CCAAGCCCATSimilar to NAC domain transcription factor. 
J023011O06CCAAGCCCATNONE 
J065091E09CCAAGCCCATNONE 
J075021C14CCAAGCCCATNONE 
J075035D07CCAAGCCCATNONE 
J075084B04CCAAGCCCATNONE 
J075171O09CCAAGCCCATNONE 
J075199M23CCAAGCCCATNONE 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0153600AK065028CAAGCCCAGATGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13CAAGCCCAGATNONE 
Os11g0207000AK062074TTGTGGGCTTGNONE 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0641800AK066963ATATGGGCTTGGCupredoxin domain containing protein. 
J013023J11ATATGGGCTTGGNONE 
J013058D03ATATGGGCTTGGNONE 
J013093P21ATATGGGCTTGGNONE 
J013120G19ATATGGGCTTGGNONE 
Os11g0708000006-046-G03CCAAGCCCAATNONE 
AK072065CCAAGCCCAATNONE 
AK120102CCAAGCCCAATConserved hypothetical protein. 
J013022N13CCAAGCCCAATNONE 
J013062I09CCAAGCCCAATNONE 
J013066H01CCAAGCCCAATNONE 
J013067A19CCAAGCCCAATNONE 
J033107A16CCAAGCCCAATNONE 
J065068A18CCAAGCCCAATNONE 
J065118D08CCAAGCCCAATNONE 
J075056H13CCAAGCCCAATNONE 
J075156I15CCAAGCCCAATNONE 
J100045J12CCAAGCCCAATNONE 
Os12g0106000AF370029CAAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CAAGCCCAAAANONE 
AK102242CAAGCCCAAAANONE 
AY324879CAAGCCCAAAANONE 
J053063M21CAAGCCCAAAANONE 
J090080A16CAAGCCCAAAANONE 
Os12g0120400AK099904TGATGGGCTTGSimilar to ATPase-like protein. 
J065169A07TGATGGGCTTGNONE 
Os12g0133600AK103096AGATGGGCTTGConserved hypothetical protein. 
J033118M03AGATGGGCTTGNONE 
Os12g0164300AK120100TTTTGGGCTTGCyclin-like F-box domain containing protein. 
J013022J17TTTTGGGCTTGNONE 
J013040L22TTTTGGGCTTGNONE 
J013041G05TTTTGGGCTTGNONE 
J013096I02TTTTGGGCTTGNONE 
J013156F05TTTTGGGCTTGNONE 
J023122E20TTTTGGGCTTGNONE 
J065008K06TTTTGGGCTTGNONE 
J065073G14TTTTGGGCTTGNONE 
J065105H07TTTTGGGCTTGNONE 
J065117A15TTTTGGGCTTGNONE 
J075025K21TTTTGGGCTTGNONE 
J075051A13TTTTGGGCTTGNONE 
J075119C17TTTTGGGCTTGNONE 
J075143A02TTTTGGGCTTGNONE 
J075149K04TTTTGGGCTTGNONE 
J080304A20TTTTGGGCTTGNONE 
J080305H17TTTTGGGCTTGNONE 
J080306D14TTTTGGGCTTGNONE 
J080306N01TTTTGGGCTTGNONE 
J080308P13TTTTGGGCTTGNONE 
J080310C04TTTTGGGCTTGNONE 
J090048B12TTTTGGGCTTGNONE 
J090092A18TTTTGGGCTTGNONE 
J090099G20TTTTGGGCTTGNONE 
Os12g0167900005-004-A06CAAGCCCATTNONE 
006-024-H01CAAGCCCATTNONE 
006-044-H12CAAGCCCATTNONE 
006-053-B08CAAGCCCATTNONE 
015-080-F12CAAGCCCATTNONE 
AK060925CAAGCCCATT60S ribosomal protein L3. 
D10403CAAGCCCATTNONE 
D12630CAAGCCCATTNONE 
J013046A17CAAGCCCATTNONE 
J013048A16CAAGCCCATTNONE 
J013057L14CAAGCCCATTNONE 
J023058G08CAAGCCCATTNONE 
J023058I08CAAGCCCATTNONE 
J023078E17CAAGCCCATTNONE 
J023087E03CAAGCCCATTNONE 
J023097D18CAAGCCCATTNONE 
J023141E14CAAGCCCATTNONE 
J023150P21CAAGCCCATTNONE 
J033045K05CAAGCCCATTNONE 
J033071G03CAAGCCCATTNONE 
J033071I15CAAGCCCATTNONE 
J033136D08CAAGCCCATTNONE 
J043012M21CAAGCCCATTNONE 
J043015C13CAAGCCCATTNONE 
J053031L19CAAGCCCATTNONE 
J053050C01CAAGCCCATTNONE 
J053055I20CAAGCCCATTNONE 
J053074B18CAAGCCCATTNONE 
J053091I08CAAGCCCATTNONE 
J053097N01CAAGCCCATTNONE 
J065058A02CAAGCCCATTNONE 
J065141H11CAAGCCCATTNONE 
J075019D10CAAGCCCATTNONE 
J075078G18CAAGCCCATTNONE 
J075094C12CAAGCCCATTNONE 
J075165H12CAAGCCCATTNONE 
J090011E05CAAGCCCATTNONE 
J090021H18CAAGCCCATTNONE 
J090027N07CAAGCCCATTNONE 
J090035F04CAAGCCCATTNONE 
J090050F21CAAGCCCATTNONE 
J090051M02CAAGCCCATTNONE 
J090060F21CAAGCCCATTNONE 
J090075G15CAAGCCCATTNONE 
J090092P11CAAGCCCATTNONE 
J090097B18CAAGCCCATTNONE 
J100019C17CAAGCCCATTNONE 
J100022O04CAAGCCCATTNONE 
J100034G13CAAGCCCATTNONE 
J100048A13CAAGCCCATTNONE 
J100050P18CAAGCCCATTNONE 
J100054B21CAAGCCCATTNONE 
J100062L01CAAGCCCATTNONE 
J100065E11CAAGCCCATTNONE 
J100074P09CAAGCCCATTNONE 
J100086E10CAAGCCCATTNONE 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0182200AK099737CAAGCCCAAAASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0294100AK111535CAAGCCCACWD40-like domain containing protein. 
J013030D09CAAGCCCACNONE 
J013153J16CAAGCCCACNONE 
J033079N17CAAGCCCACNONE 
J090002M14CAAGCCCACNONE 
J090071M08CAAGCCCACNONE 
J090090E07CAAGCCCACNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0489400AK062351CATGGGCTTGHypothetical protein. 
Os12g0517100012-071-A03CAAGCCCAGATNONE 
AK073020CAAGCCCAGATCyclin-like F-box domain containing protein. 
J023149K21CAAGCCCAGATNONE 
Os12g0540000AK108630TAATGGGCTTGGGCTConserved hypothetical protein. 
J065046N02TAATGGGCTTGGGCTNONE 
J065100H24TAATGGGCTTGGGCTNONE 
J065142M24TAATGGGCTTGGGCTNONE 
Os12g0554800AK105676CCAAGCCCAATTSimilar to Polygalacturonase-like protein. 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0630600J100033A04CAAGCCCAGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.