version

Summary of OsREG497 (All List)

OrganismOryza sativa  
IDOsREG497  
SequenceCAAGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1646  

Entry Sequences (1646 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683CAAGGCCCGCANONE 
AK100613CAAGGCCCGCASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06CAAGGCCCGCANONE 
J090042G02CAAGGCCCGCANONE 
Os01g0171200AK107515ACGTGGGCCTTGNONE 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
Os01g0232700AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12CAAGGCCCAACANONE 
J075146A12CAAGGCCCAACANONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0555800009-069-D11CAAGGCCCNONE 
AK062551CAAGGCCCFormylmethionine deformylase family protein. 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0681100016-048-E04TTTTGGGCCTTGNONE 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
J023002D21TTTTGGGCCTTGNONE 
J033136O22TTTTGGGCCTTGNONE 
Os01g0704700AK100296CAAGGCCCSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os01g0742000009-105-F08GGGCCTTGNONE 
AK062779GGGCCTTGtRNA/rRNA methyltransferase, SpoU domain containing protein. 
Os01g0742100AK110930CAAGGCCCConserved hypothetical protein. 
Os01g0749400AK064990CAAGGCCCNONE 
AK067731CAAGGCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775CAAGGCCCNONE 
J023001B06CAAGGCCCNONE 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
J033067K14TTCGGCCCAAGGCCCNONE 
Os01g0805800006-057-H04CAAGGCCCAATNONE 
006-106-H01CAAGGCCCAATNONE 
AK059963CAAGGCCCAATNONE 
AK103408CAAGGCCCAATRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0810300009-073-E02CAAGGCCCNONE 
AF231026CAAGGCCCSimilar to Calmodulin-like protein. 
AK070889CAAGGCCCNONE 
J013123F15CAAGGCCCNONE 
J023074P12CAAGGCCCNONE 
U37936CAAGGCCCNONE 
Os01g0853700AK111988CAAGGCCCAATSimilar to MCB1 protein. 
J075050N16CAAGGCCCAATNONE 
J075117H23CAAGGCCCAATNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0889800003-107-A06CAAGGCCCATATNONE 
005-016-H12CAAGGCCCATATNONE 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK104708CAAGGCCCATATNONE 
J013035D13CAAGGCCCATATNONE 
J013068K01CAAGGCCCATATNONE 
J023042J18CAAGGCCCATATNONE 
J053023F13CAAGGCCCATATNONE 
J053026M13CAAGGCCCATATNONE 
J053033N15CAAGGCCCATATNONE 
J053035I16CAAGGCCCATATNONE 
J053039A11CAAGGCCCATATNONE 
J053039K22CAAGGCCCATATNONE 
J053043B08CAAGGCCCATATNONE 
J053068K09CAAGGCCCATATNONE 
J053082D11CAAGGCCCATATNONE 
J053092N12CAAGGCCCATATNONE 
J053099A19CAAGGCCCATATNONE 
J065027F17CAAGGCCCATATNONE 
J065039B13CAAGGCCCATATNONE 
J065139N16CAAGGCCCATATNONE 
J065205B22CAAGGCCCATATNONE 
Os01g0939700AK059803CAAGGCCCAGGNONE 
AK070588CAAGGCCCAGGSimilar to Esterase D (EC 3.1.1.1). 
AK111469CAAGGCCCAGGNONE 
J090021L11CAAGGCCCAGGNONE 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
J090089O16CAAGGCCCAGATNONE 
Os01g0948300009-023-A03AGATGGGCCTTGNONE 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGATGGGCCTTGNONE 
J023019C13AGATGGGCCTTGNONE 
J023049L21AGATGGGCCTTGNONE 
J023066H02AGATGGGCCTTGNONE 
J033050A07AGATGGGCCTTGNONE 
J033086E01AGATGGGCCTTGNONE 
J033086F11AGATGGGCCTTGNONE 
J090047I04AGATGGGCCTTGNONE 
J100035E10AGATGGGCCTTGNONE 
J100040L06AGATGGGCCTTGNONE 
J100044G21AGATGGGCCTTGNONE 
J100045F13AGATGGGCCTTGNONE 
J100046G12AGATGGGCCTTGNONE 
J100075N10AGATGGGCCTTGNONE 
J100077I01AGATGGGCCTTGNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0971600AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0130300011-005-D07CAAGGCCCGCCCATCCNONE 
011-041-B06CAAGGCCCGCCCATCCNONE 
015-099-D11CAAGGCCCGCCCATCCNONE 
016-049-D06CAAGGCCCGCCCATCCNONE 
AK102708CAAGGCCCGCCCATCCZinc finger, RING-type domain containing protein. 
Os02g0146700AK105609CAAGGCCCACASimilar to PSMD2 subunit (Fragment). 
AK119490CAAGGCCCACANONE 
AK121963CAAGGCCCACANONE 
Os02g0169000AK101628CAAGGCCCAAGConserved hypothetical protein. 
Os02g0220600AK061944CAAGGCCCGTTElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946CAAGGCCCGTTNONE 
D89802CAAGGCCCGTTNONE 
J013042L22CAAGGCCCGTTNONE 
J013056A14CAAGGCCCGTTNONE 
J013120G13CAAGGCCCGTTNONE 
J013155K19CAAGGCCCGTTNONE 
J023002B10CAAGGCCCGTTNONE 
J023080J19CAAGGCCCGTTNONE 
J023081C08CAAGGCCCGTTNONE 
J023090H05CAAGGCCCGTTNONE 
J023091M07CAAGGCCCGTTNONE 
J023115F09CAAGGCCCGTTNONE 
J033025I23CAAGGCCCGTTNONE 
J033026G12CAAGGCCCGTTNONE 
J033035E15CAAGGCCCGTTNONE 
J033040N13CAAGGCCCGTTNONE 
J033046C17CAAGGCCCGTTNONE 
J033069F02CAAGGCCCGTTNONE 
J033071B16CAAGGCCCGTTNONE 
J033071N22CAAGGCCCGTTNONE 
J033088J02CAAGGCCCGTTNONE 
J033092N24CAAGGCCCGTTNONE 
J033093I09CAAGGCCCGTTNONE 
J033126G06CAAGGCCCGTTNONE 
J043003G15CAAGGCCCGTTNONE 
J043010M11CAAGGCCCGTTNONE 
J043024O20CAAGGCCCGTTNONE 
J065092N03CAAGGCCCGTTNONE 
J080004D17CAAGGCCCGTTNONE 
J080010L09CAAGGCCCGTTNONE 
J080021I11CAAGGCCCGTTNONE 
J080022L01CAAGGCCCGTTNONE 
J080029B01CAAGGCCCGTTNONE 
J080032D11CAAGGCCCGTTNONE 
J080039B11CAAGGCCCGTTNONE 
J080040K17CAAGGCCCGTTNONE 
J080041B21CAAGGCCCGTTNONE 
J080052L24CAAGGCCCGTTNONE 
J080054M12CAAGGCCCGTTNONE 
J080057B15CAAGGCCCGTTNONE 
J080078G15CAAGGCCCGTTNONE 
J080078H06CAAGGCCCGTTNONE 
J080079M03CAAGGCCCGTTNONE 
J080088H16CAAGGCCCGTTNONE 
J080093C11CAAGGCCCGTTNONE 
J080095K09CAAGGCCCGTTNONE 
J080095O20CAAGGCCCGTTNONE 
J090009J19CAAGGCCCGTTNONE 
J090040D04CAAGGCCCGTTNONE 
J090052E14CAAGGCCCGTTNONE 
J090063B14CAAGGCCCGTTNONE 
J090071K04CAAGGCCCGTTNONE 
J090075E12CAAGGCCCGTTNONE 
J090087A06CAAGGCCCGTTNONE 
J090094P03CAAGGCCCGTTNONE 
J090098M14CAAGGCCCGTTNONE 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09AGCCCAAGGCCCAGCNONE 
J100038E09AGCCCAAGGCCCAGCNONE 
J100076G11AGCCCAAGGCCCAGCNONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01CAAGGCCCAAGNONE 
AK065368CAAGGCCCAAGSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAAGGCCCAAGNONE 
J033046H10CAAGGCCCAAGNONE 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
J033039F09CAAGGCCCATTTNONE 
J065041E15CAAGGCCCATTTNONE 
J075087I24CAAGGCCCATTTNONE 
J100079A10CAAGGCCCATTTNONE 
Os02g0686600AK102917GGGCCTTGMetal-dependent protein hydrolase family protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK111254GGATGGGCCTTGNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
J100086K17CAAGGCCCACACGNONE 
Os02g0824400AK121390GTTTGGGCCTTGConserved hypothetical protein. 
J023128P21GTTTGGGCCTTGNONE 
J053097O16GTTTGGGCCTTGNONE 
J065012I02GTTTGGGCCTTGNONE 
J065049C06GTTTGGGCCTTGNONE 
J065051H02GTTTGGGCCTTGNONE 
J065069A13GTTTGGGCCTTGNONE 
J065082E04GTTTGGGCCTTGNONE 
J065102N09GTTTGGGCCTTGNONE 
J065157O10GTTTGGGCCTTGNONE 
J065188N23GTTTGGGCCTTGNONE 
J065190J11GTTTGGGCCTTGNONE 
J065202M09GTTTGGGCCTTGNONE 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os03g0133100013-080-E12CAAGGCCCGCANONE 
AK063608CAAGGCCCGCAHypothetical protein. 
AK119680CAAGGCCCGCANONE 
J075192B05CAAGGCCCGCANONE 
Os03g0136200004-011-E10AACGGGCCTTGNONE 
006-067-A08AACGGGCCTTGNONE 
011-007-E02AACGGGCCTTGNONE 
011-099-H10AACGGGCCTTGNONE 
012-044-D08AACGGGCCTTGNONE 
013-045-G12AACGGGCCTTGNONE 
013-062-C09AACGGGCCTTGNONE 
013-072-F09AACGGGCCTTGNONE 
013-085-B12AACGGGCCTTGNONE 
013-097-E09AACGGGCCTTGNONE 
013-097-F09AACGGGCCTTGNONE 
014-013-C09AACGGGCCTTGNONE 
014-082-D08AACGGGCCTTGNONE 
015-071-A09AACGGGCCTTGNONE 
AF042333AACGGGCCTTGNONE 
AK060887AACGGGCCTTGNONE 
AK121681AACGGGCCTTG24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14AACGGGCCTTGNONE 
J013123F01AACGGGCCTTGNONE 
J023050A02AACGGGCCTTGNONE 
J033046H22AACGGGCCTTGNONE 
J033070A11AACGGGCCTTGNONE 
J065059G11AACGGGCCTTGNONE 
J065068F10AACGGGCCTTGNONE 
J065164A10AACGGGCCTTGNONE 
J075031F07AACGGGCCTTGNONE 
J075054J01AACGGGCCTTGNONE 
J075086M04AACGGGCCTTGNONE 
J075118K23AACGGGCCTTGNONE 
J075122A09AACGGGCCTTGNONE 
J075123D06AACGGGCCTTGNONE 
J075129A22AACGGGCCTTGNONE 
J075161E07AACGGGCCTTGNONE 
J075179H04AACGGGCCTTGNONE 
J075181C06AACGGGCCTTGNONE 
J075186A12AACGGGCCTTGNONE 
J090014H16AACGGGCCTTGNONE 
J090045G17AACGGGCCTTGNONE 
J090048B09AACGGGCCTTGNONE 
J090052J23AACGGGCCTTGNONE 
J090052K22AACGGGCCTTGNONE 
J090059F10AACGGGCCTTGNONE 
J090080F19AACGGGCCTTGNONE 
J100039J08AACGGGCCTTGNONE 
J100044K02AACGGGCCTTGNONE 
J100051E16AACGGGCCTTGNONE 
J100053F08AACGGGCCTTGNONE 
J100056F07AACGGGCCTTGNONE 
J100058A10AACGGGCCTTGNONE 
Os03g0143600AB110188CAAGGCCCACANONE 
AK068424CAAGGCCCACASimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464CAAGGCCCACANONE 
AY224545CAAGGCCCACANONE 
J013154F02CAAGGCCCACANONE 
Os03g0149400AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0152800AK066205GCTGGGCCTTGProtein kinase-like domain containing protein. 
AK100518GCTGGGCCTTGNONE 
Os03g0219400AK100702GGGCCTTGGlycoside hydrolase, family 20 protein. 
AK121985GGGCCTTGNONE 
J023114O06GGGCCTTGNONE 
J100043M20GGGCCTTGNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0292800012-077-B05CAAGGCCCATCCNONE 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J065138F22CAAGGCCCATCCNONE 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0352800009-030-G08AAGGCCCACAAGGCCCNONE 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17AAGGCCCACAAGGCCCNONE 
J075050N19AAGGCCCACAAGGCCCNONE 
J075104J18AAGGCCCACAAGGCCCNONE 
J075142K05AAGGCCCACAAGGCCCNONE 
J100050I19AAGGCCCACAAGGCCCNONE 
J100057N04AAGGCCCACAAGGCCCNONE 
Os03g0563300006-086-B06GGGCCTTGNONE 
006-102-B09GGGCCTTGNONE 
AK060389GGGCCTTGNONE 
AK070720GGGCCTTGSimilar to Mg-chelatase subunit (Fragment). 
AK071134GGGCCTTGNONE 
AK104435GGGCCTTGNONE 
J013128N14GGGCCTTGNONE 
J023041F09GGGCCTTGNONE 
J023056M13GGGCCTTGNONE 
J023078K03GGGCCTTGNONE 
J023132N12GGGCCTTGNONE 
J023134B01GGGCCTTGNONE 
J033093B14GGGCCTTGNONE 
Os03g0566800AK103270CAAGGCCCAGTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CAAGGCCCAGTNONE 
J023136P06CAAGGCCCAGTNONE 
J033081A22CAAGGCCCAGTNONE 
J033109N12CAAGGCCCAGTNONE 
J033124H10CAAGGCCCAGTNONE 
J033141B09CAAGGCCCAGTNONE 
J090026G23CAAGGCCCAGTNONE 
J090077J20CAAGGCCCAGTNONE 
Os03g0569900009-027-A11CAAGGCCCATTANONE 
AK063783CAAGGCCCATTANONE 
Os03g0681900006-042-F08ATCTGGGCCTTGNONE 
009-043-F12ATCTGGGCCTTGNONE 
AK061750ATCTGGGCCTTGNONE 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
J033034F01ATCTGGGCCTTGNONE 
J033131F11ATCTGGGCCTTGNONE 
J033143N03ATCTGGGCCTTGNONE 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0699200005-016-G07TCAGCCCAACCCAAGGCCCNONE 
AK066652TCAGCCCAACCCAAGGCCCPescadillo, N-terminal domain containing protein. 
AK099383TCAGCCCAACCCAAGGCCCNONE 
J013069A12TCAGCCCAACCCAAGGCCCNONE 
J033085M11TCAGCCCAACCCAAGGCCCNONE 
J033111P09TCAGCCCAACCCAAGGCCCNONE 
J033128H17TCAGCCCAACCCAAGGCCCNONE 
Os03g0712400AK111063GGGCCTTGNONE 
Os03g0787100006-022-G04CAAGGCCCATGANONE 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
J065197C24CAAGGCCCATGANONE 
J075147E03CAAGGCCCATGANONE 
J100065K06CAAGGCCCATGANONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0835800AK102903GGGCCTTGGalactose oxidase, central domain containing protein. 
J023091D05GGGCCTTGNONE 
J023140O09GGGCCTTGNONE 
J033113E15GGGCCTTGNONE 
J075011K06GGGCCTTGNONE 
J075039P05GGGCCTTGNONE 
J075043D19GGGCCTTGNONE 
J075066G05GGGCCTTGNONE 
J075126A20GGGCCTTGNONE 
J075134E14GGGCCTTGNONE 
J075165G14GGGCCTTGNONE 
J075189I23GGGCCTTGNONE 
Os03g0845700009-075-D05AATTGGGCCTTGNONE 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
J065068H03AATTGGGCCTTGNONE 
J065075A18AATTGGGCCTTGNONE 
J065118C19AATTGGGCCTTGNONE 
J075001B15AATTGGGCCTTGNONE 
J075048D11AATTGGGCCTTGNONE 
J075056D01AATTGGGCCTTGNONE 
J075092P03AATTGGGCCTTGNONE 
J075111I04AATTGGGCCTTGNONE 
Os03g0854000009-186-C03CAAGGCCCNONE 
AK061374CAAGGCCCProtein of unknown function UPF0131 family protein. 
J065138B11CAAGGCCCNONE 
Os03g0858700006-024-D11TTTTGGGCCTTGNONE 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK064976TTTTGGGCCTTGNONE 
J013001B23TTTTGGGCCTTGNONE 
Os04g0103200003-106-F06CAAGGCCCACANONE 
015-058-G03CAAGGCCCACANONE 
AK060850CAAGGCCCACANONE 
AK066032CAAGGCCCACAProteasome component region PCI domain containing protein. 
J013046D12CAAGGCCCACANONE 
J013088L18CAAGGCCCACANONE 
J013093J06CAAGGCCCACANONE 
J013111I01CAAGGCCCACANONE 
J013120B15CAAGGCCCACANONE 
J013149K17CAAGGCCCACANONE 
J023010J08CAAGGCCCACANONE 
J023034J10CAAGGCCCACANONE 
J023055D05CAAGGCCCACANONE 
J033023L03CAAGGCCCACANONE 
J033025N21CAAGGCCCACANONE 
J033026A19CAAGGCCCACANONE 
J033026M14CAAGGCCCACANONE 
J033046J22CAAGGCCCACANONE 
J033052H11CAAGGCCCACANONE 
J033058P05CAAGGCCCACANONE 
J033064A11CAAGGCCCACANONE 
J033067K11CAAGGCCCACANONE 
J033076H02CAAGGCCCACANONE 
J033094E04CAAGGCCCACANONE 
J033106A02CAAGGCCCACANONE 
J033108N14CAAGGCCCACANONE 
J033114I06CAAGGCCCACANONE 
J033118H18CAAGGCCCACANONE 
J033148C05CAAGGCCCACANONE 
J043010I24CAAGGCCCACANONE 
J043037C07CAAGGCCCACANONE 
J053025M02CAAGGCCCACANONE 
J053026N08CAAGGCCCACANONE 
J053027O14CAAGGCCCACANONE 
J065038N11CAAGGCCCACANONE 
J065219C03CAAGGCCCACANONE 
J090011F14CAAGGCCCACANONE 
J090027C03CAAGGCCCACANONE 
J090067M19CAAGGCCCACANONE 
J090069C17CAAGGCCCACANONE 
J090070P21CAAGGCCCACANONE 
J090075N11CAAGGCCCACANONE 
J090095C22CAAGGCCCACANONE 
J100027O14CAAGGCCCACANONE 
J100055E01CAAGGCCCACANONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
J033101G08AATTGGGCCTTGNONE 
J090084B18AATTGGGCCTTGNONE 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0372400AK107450CAAGGCCCConserved hypothetical protein. 
J080097M03CAAGGCCCNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0436800015-053-A06CAAGGCCCAAAANONE 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
J033025G14CAAGGCCCAAAANONE 
J033073N23CAAGGCCCAAAANONE 
J033097L19CAAGGCCCAAAANONE 
Os04g0479000AK106344CAAGGCCCAGGSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0551800016-049-G12CAAGGCCCATCANONE 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CAAGGCCCATCANONE 
J013111B11CAAGGCCCATCANONE 
J013121H23CAAGGCCCATCANONE 
J023012A17CAAGGCCCATCANONE 
J023092M05CAAGGCCCATCANONE 
J033026P14CAAGGCCCATCANONE 
J033033C10CAAGGCCCATCANONE 
J033033M10CAAGGCCCATCANONE 
J033035C24CAAGGCCCATCANONE 
J033052E19CAAGGCCCATCANONE 
J033140K19CAAGGCCCATCANONE 
J065036F18CAAGGCCCATCANONE 
J065067L12CAAGGCCCATCANONE 
J065095G09CAAGGCCCATCANONE 
J065115B08CAAGGCCCATCANONE 
J065218E24CAAGGCCCATCANONE 
J090002N13CAAGGCCCATCANONE 
J090008B12CAAGGCCCATCANONE 
J090016F24CAAGGCCCATCANONE 
J090019H14CAAGGCCCATCANONE 
J090020G20CAAGGCCCATCANONE 
J090029L18CAAGGCCCATCANONE 
J090057C23CAAGGCCCATCANONE 
J090073H23CAAGGCCCATCANONE 
J090081C16CAAGGCCCATCANONE 
J090081E21CAAGGCCCATCANONE 
J090084L14CAAGGCCCATCANONE 
J090086M01CAAGGCCCATCANONE 
J090089E16CAAGGCCCATCANONE 
J100031P12CAAGGCCCATCANONE 
J100090N23CAAGGCCCATCANONE 
Os04g0573200AK065277CAAGGCCCATCTNONE 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0626400006-050-B09CAAGGCCCTGGCCCAGCNONE 
006-072-C12CAAGGCCCTGGCCCAGCNONE 
006-092-C11CAAGGCCCTGGCCCAGCNONE 
AK059851CAAGGCCCTGGCCCAGCCalycin-like family protein. 
AK100069CAAGGCCCTGGCCCAGCNONE 
AK104062CAAGGCCCTGGCCCAGCNONE 
AK104663CAAGGCCCTGGCCCAGCNONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0649600009-019-A10GGGCCTTGNONE 
009-059-G07GGGCCTTGNONE 
009-068-D06GGGCCTTGNONE 
AK105164GGGCCTTGConserved hypothetical protein. 
J100056J15GGGCCTTGNONE 
Os04g0660600009-113-A11CAAGGCCCAGATNONE 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
J023030J05CAAGGCCCAGATNONE 
J065068M07CAAGGCCCAGATNONE 
J065120G22CAAGGCCCAGATNONE 
J065168J18CAAGGCCCAGATNONE 
J065211M10CAAGGCCCAGATNONE 
J075175E21CAAGGCCCAGATNONE 
J090021C06CAAGGCCCAGATNONE 
J090032P15CAAGGCCCAGATNONE 
J090082E05CAAGGCCCAGATNONE 
J100090O11CAAGGCCCAGATNONE 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CAAGGCCCAGTANONE 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0323100AK109472CAAGGCCCRhodanese-like domain containing protein. 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0386900009-015-C03TTTGGGCCTTGNONE 
AK059319TTTGGGCCTTGNONE 
Os05g0411600AK101609CAAGGCCCSingle-stranded nucleic acid binding R3H domain containing protein. 
AY224459CAAGGCCCNONE 
J065042L01CAAGGCCCNONE 
J100068I05CAAGGCCCNONE 
J100075L14CAAGGCCCNONE 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
Os05g0458100006-084-A05CAAGGCCCNONE 
009-091-H05CAAGGCCCNONE 
AJ557547CAAGGCCCNONE 
AK059467CAAGGCCCNONE 
AK061127CAAGGCCCNONE 
AK101652CAAGGCCCSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06CAAGGCCCNONE 
J033057B20CAAGGCCCNONE 
J033087A05CAAGGCCCNONE 
J043009C05CAAGGCCCNONE 
J090009E10CAAGGCCCNONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0487600AK100817CAAGGCCCAAACNONE 
AK103104CAAGGCCCAAACNONE 
J043027P10CAAGGCCCAAACNONE 
J065183N17CAAGGCCCAAACNONE 
Os05g0501300006-075-B11CTTGGGCCTTGNONE 
006-083-H08CTTGGGCCTTGNONE 
AK059889CTTGGGCCTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CTTGGGCCTTGNONE 
Os05g0502800016-060-H05CAAGGCCCATAANONE 
AK064242CAAGGCCCATAANONE 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE 
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein. 
J013047J05CAAGGCCCCACACGTCACNONE 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0580900AK108609GGGCCTTGNONE 
AK120030GGGCCTTGConserved hypothetical protein. 
Os05g0592400AB037144CAAGGCCCACACNONE 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
J013069J24CAAGGCCCACACNONE 
J013075H15CAAGGCCCACACNONE 
J013095H04CAAGGCCCACACNONE 
J013105L19CAAGGCCCACACNONE 
J013152P13CAAGGCCCACACNONE 
J023072O05CAAGGCCCACACNONE 
J033024J22CAAGGCCCACACNONE 
J033030D07CAAGGCCCACACNONE 
J033041D09CAAGGCCCACACNONE 
J033051M16CAAGGCCCACACNONE 
J033126M01CAAGGCCCACACNONE 
J033145H24CAAGGCCCACACNONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0113900AK067430CAAGGCCCNONE 
AK102259CAAGGCCCNONE 
AK120464CAAGGCCCConserved hypothetical protein. 
J065144I06CAAGGCCCNONE 
Os06g0116800AK058985AATGGGCCTTGSimilar to GFA2. 
AK120746AATGGGCCTTGNONE 
Os06g0119300AK067271CAAGGCCCAGTProtein of unknown function DUF594 family protein. 
Os06g0129200AK061998CAAGGCCCCAGNONE 
AK102435CAAGGCCCCAGConserved hypothetical protein. 
J013020E23CAAGGCCCCAGNONE 
J013156N13CAAGGCCCCAGNONE 
J023004K16CAAGGCCCCAGNONE 
J023030K17CAAGGCCCCAGNONE 
J033042G24CAAGGCCCCAGNONE 
J033042K20CAAGGCCCCAGNONE 
J033093J06CAAGGCCCCAGNONE 
J033101D07CAAGGCCCCAGNONE 
J033103H15CAAGGCCCCAGNONE 
J033119L13CAAGGCCCCAGNONE 
J033131F18CAAGGCCCCAGNONE 
J065163G16CAAGGCCCCAGNONE 
J090088B06CAAGGCCCCAGNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0320000009-030-C04CAAGGCCCAATTNONE 
009-135-F08CAAGGCCCAATTNONE 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CAAGGCCCAATTNONE 
Os06g0567000009-166-G12CAAGGCCCAACANONE 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
J013122F01CAAGGCCCAACANONE 
J023080N12CAAGGCCCAACANONE 
J023120F03CAAGGCCCAACANONE 
J065013B18CAAGGCCCAACANONE 
J065039P21CAAGGCCCAACANONE 
J065089E06CAAGGCCCAACANONE 
J065095N19CAAGGCCCAACANONE 
J065119H03CAAGGCCCAACANONE 
J065121D18CAAGGCCCAACANONE 
J065149G04CAAGGCCCAACANONE 
J075012J04CAAGGCCCAACANONE 
J075021G13CAAGGCCCAACANONE 
J075106I23CAAGGCCCAACANONE 
J075107F19CAAGGCCCAACANONE 
J075152J22CAAGGCCCAACANONE 
J075186J20CAAGGCCCAACANONE 
J075188F16CAAGGCCCAACANONE 
J080001G06CAAGGCCCAACANONE 
J080002O09CAAGGCCCAACANONE 
J080006E10CAAGGCCCAACANONE 
J080006F24CAAGGCCCAACANONE 
J080012L07CAAGGCCCAACANONE 
J080016A10CAAGGCCCAACANONE 
J080017D11CAAGGCCCAACANONE 
J080017I04CAAGGCCCAACANONE 
J080017I10CAAGGCCCAACANONE 
J080020P06CAAGGCCCAACANONE 
J080024A20CAAGGCCCAACANONE 
J080027B10CAAGGCCCAACANONE 
J080027E03CAAGGCCCAACANONE 
J080027I01CAAGGCCCAACANONE 
J080027K20CAAGGCCCAACANONE 
J080041L12CAAGGCCCAACANONE 
J080043D21CAAGGCCCAACANONE 
J080044K11CAAGGCCCAACANONE 
J080048I08CAAGGCCCAACANONE 
J080049M12CAAGGCCCAACANONE 
J080050C14CAAGGCCCAACANONE 
J080050N21CAAGGCCCAACANONE 
J080053F04CAAGGCCCAACANONE 
J080054O16CAAGGCCCAACANONE 
J080058O21CAAGGCCCAACANONE 
J080059M11CAAGGCCCAACANONE 
J080061A11CAAGGCCCAACANONE 
J080063B15CAAGGCCCAACANONE 
J080063F22CAAGGCCCAACANONE 
J080066M18CAAGGCCCAACANONE 
J080068D12CAAGGCCCAACANONE 
J080070D22CAAGGCCCAACANONE 
J080071B06CAAGGCCCAACANONE 
J080072B17CAAGGCCCAACANONE 
J080081O04CAAGGCCCAACANONE 
J080089H05CAAGGCCCAACANONE 
J080093K13CAAGGCCCAACANONE 
J080095I05CAAGGCCCAACANONE 
J080097F19CAAGGCCCAACANONE 
J080304C03CAAGGCCCAACANONE 
J080304H11CAAGGCCCAACANONE 
J080308M21CAAGGCCCAACANONE 
J080313O15CAAGGCCCAACANONE 
J090020N23CAAGGCCCAACANONE 
J100023C12CAAGGCCCAACANONE 
Os06g0607800012-010-G03CAAGGCCCAAATNONE 
AB070254CAAGGCCCAAATNONE 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAAGGCCCAAATNONE 
J013074G13CAAGGCCCAAATNONE 
J090015C16CAAGGCCCAAATNONE 
J090069H10CAAGGCCCAAATNONE 
Os06g0633500AK108505GGGCCTTGZinc finger, RING-type domain containing protein. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
Os06g0711600016-047-G09CATGGGCCTTGNONE 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
AK102831CATGGGCCTTGNONE 
J013072P18CATGGGCCTTGNONE 
J023049G01CATGGGCCTTGNONE 
J023088I01CATGGGCCTTGNONE 
J033023I22CATGGGCCTTGNONE 
J033106I12CATGGGCCTTGNONE 
J033109G07CATGGGCCTTGNONE 
J065030F22CATGGGCCTTGNONE 
J065132H19CATGGGCCTTGNONE 
J080301D07CATGGGCCTTGNONE 
J080305C09CATGGGCCTTGNONE 
J080312C03CATGGGCCTTGNONE 
J080313I15CATGGGCCTTGNONE 
J080315B09CATGGGCCTTGNONE 
J090056N21CATGGGCCTTGNONE 
J100027B07CATGGGCCTTGNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0725400J065086O07AGTGGGCCTTGSimilar to BLE1 protein. 
J065114J19AGTGGGCCTTGNONE 
Os06g0726800AK070518GGGCCTTGG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GGGCCTTGNONE 
J053032B13GGGCCTTGNONE 
X82036GGGCCTTGNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0224000009-060-E01CAAGGCCCNONE 
J065042D20CAAGGCCCNONE 
J065127D14CAAGGCCCNONE 
J065176C24CAAGGCCCNONE 
J065188M12CAAGGCCCNONE 
J065194L14CAAGGCCCNONE 
J075060P09CAAGGCCCNONE 
J075134C14CAAGGCCCRibosomal protein L24E family protein. 
J075192M12CAAGGCCCNONE 
J100032N01CAAGGCCCNONE 
Os07g0242000AK107347CAAGGCCCACCConserved hypothetical protein. 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0424400AK062154CAAGGCCCNONE 
AK071976CAAGGCCCNONE 
J043010P16CAAGGCCCNONE 
J075196L02CAAGGCCCNONE 
Os07g0462700009-033-D05TTTTGGGCCTTGNONE 
AK073834TTTTGGGCCTTGNONE 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
J065104G16TTTTGGGCCTTGNONE 
J065197C14TTTTGGGCCTTGNONE 
J065213E17TTTTGGGCCTTGNONE 
J065215D11TTTTGGGCCTTGNONE 
J075001J15TTTTGGGCCTTGNONE 
J075026M11TTTTGGGCCTTGNONE 
J075142G03TTTTGGGCCTTGNONE 
J075178H04TTTTGGGCCTTGNONE 
J100069P18TTTTGGGCCTTGNONE 
Os07g0515700AK103117GGGCCTTGAnkyrin repeat containing protein. 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0572500AK108612CAAGGCCCConserved hypothetical protein. 
Os07g0573700AK070473CAAGGCCCAAGNucleotide-sugar transporter family protein. 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0611600AK059431TTTTGGGCCTTGNONE 
J033096O12TTTTGGGCCTTGNONE 
J075143O21TTTTGGGCCTTGNONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os08g0130500006-024-B12CAAGGCCCATACNONE 
006-032-F11CAAGGCCCATACNONE 
006-047-B12CAAGGCCCATACNONE 
006-058-H06CAAGGCCCATACNONE 
006-062-D07CAAGGCCCATACNONE 
006-083-F11CAAGGCCCATACNONE 
006-084-A11CAAGGCCCATACNONE 
006-096-F12CAAGGCCCATACNONE 
006-105-A04CAAGGCCCATACNONE 
006-110-D11CAAGGCCCATACNONE 
011-022-D11CAAGGCCCATACNONE 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
D21130CAAGGCCCATACNONE 
J013000H12CAAGGCCCATACNONE 
J013024M17CAAGGCCCATACNONE 
J013028H09CAAGGCCCATACNONE 
J013045N22CAAGGCCCATACNONE 
J013092K19CAAGGCCCATACNONE 
J013106L12CAAGGCCCATACNONE 
J013107A03CAAGGCCCATACNONE 
J013109E12CAAGGCCCATACNONE 
J013114N08CAAGGCCCATACNONE 
J013120J12CAAGGCCCATACNONE 
J013121E21CAAGGCCCATACNONE 
J013135P20CAAGGCCCATACNONE 
J023006J08CAAGGCCCATACNONE 
J023014L16CAAGGCCCATACNONE 
J023020N03CAAGGCCCATACNONE 
J023027M24CAAGGCCCATACNONE 
J023029D18CAAGGCCCATACNONE 
J023030A14CAAGGCCCATACNONE 
J023041G23CAAGGCCCATACNONE 
J023049H05CAAGGCCCATACNONE 
J023060I23CAAGGCCCATACNONE 
J023099D07CAAGGCCCATACNONE 
J023104A20CAAGGCCCATACNONE 
J023105F18CAAGGCCCATACNONE 
J023112D21CAAGGCCCATACNONE 
J023122M18CAAGGCCCATACNONE 
J023139J20CAAGGCCCATACNONE 
J023149L20CAAGGCCCATACNONE 
J023150G04CAAGGCCCATACNONE 
J033036G02CAAGGCCCATACNONE 
J033045P13CAAGGCCCATACNONE 
J033046A22CAAGGCCCATACNONE 
J033086H16CAAGGCCCATACNONE 
J033087D07CAAGGCCCATACNONE 
J033089M14CAAGGCCCATACNONE 
J033095F14CAAGGCCCATACNONE 
J033108M01CAAGGCCCATACNONE 
J033117A17CAAGGCCCATACNONE 
J033122F03CAAGGCCCATACNONE 
J033126A04CAAGGCCCATACNONE 
J033144D13CAAGGCCCATACNONE 
J033145D13CAAGGCCCATACNONE 
J043022M09CAAGGCCCATACNONE 
J053025I11CAAGGCCCATACNONE 
J053027K06CAAGGCCCATACNONE 
J053029D15CAAGGCCCATACNONE 
J053048I22CAAGGCCCATACNONE 
J053055I01CAAGGCCCATACNONE 
J053079P07CAAGGCCCATACNONE 
J053090J23CAAGGCCCATACNONE 
J053094C24CAAGGCCCATACNONE 
J065023F18CAAGGCCCATACNONE 
J065029I12CAAGGCCCATACNONE 
J065044B18CAAGGCCCATACNONE 
J065045C07CAAGGCCCATACNONE 
J065063K22CAAGGCCCATACNONE 
J065093D11CAAGGCCCATACNONE 
J065096P09CAAGGCCCATACNONE 
J065099N04CAAGGCCCATACNONE 
J065103K24CAAGGCCCATACNONE 
J065110H12CAAGGCCCATACNONE 
J065132F24CAAGGCCCATACNONE 
J065157K16CAAGGCCCATACNONE 
J065185D11CAAGGCCCATACNONE 
J065202E16CAAGGCCCATACNONE 
J065217D07CAAGGCCCATACNONE 
J075053I19CAAGGCCCATACNONE 
J075055L24CAAGGCCCATACNONE 
J075056H24CAAGGCCCATACNONE 
J075070D02CAAGGCCCATACNONE 
J075084O15CAAGGCCCATACNONE 
J075090F24CAAGGCCCATACNONE 
J075135E03CAAGGCCCATACNONE 
J075174A01CAAGGCCCATACNONE 
J075188F05CAAGGCCCATACNONE 
J075192C17CAAGGCCCATACNONE 
J080001B02CAAGGCCCATACNONE 
J080001C08CAAGGCCCATACNONE 
J080002D15CAAGGCCCATACNONE 
J080002I03CAAGGCCCATACNONE 
J080003E24CAAGGCCCATACNONE 
J080004M10CAAGGCCCATACNONE 
J080005C18CAAGGCCCATACNONE 
J080006A12CAAGGCCCATACNONE 
J080006F04CAAGGCCCATACNONE 
J080006M11CAAGGCCCATACNONE 
J080008J11CAAGGCCCATACNONE 
J080008J22CAAGGCCCATACNONE 
J080009F14CAAGGCCCATACNONE 
J080010B12CAAGGCCCATACNONE 
J080010G14CAAGGCCCATACNONE 
J080010N07CAAGGCCCATACNONE 
J080011D04CAAGGCCCATACNONE 
J080011G10CAAGGCCCATACNONE 
J080011O19CAAGGCCCATACNONE 
J080013K23CAAGGCCCATACNONE 
J080013M09CAAGGCCCATACNONE 
J080013N12CAAGGCCCATACNONE 
J080013O15CAAGGCCCATACNONE 
J080014C13CAAGGCCCATACNONE 
J080014D21CAAGGCCCATACNONE 
J080014F08CAAGGCCCATACNONE 
J080014N08CAAGGCCCATACNONE 
J080014P19CAAGGCCCATACNONE 
J080015L09CAAGGCCCATACNONE 
J080015P15CAAGGCCCATACNONE 
J080018P10CAAGGCCCATACNONE 
J080020C06CAAGGCCCATACNONE 
J080022C14CAAGGCCCATACNONE 
J080022E01CAAGGCCCATACNONE 
J080022P04CAAGGCCCATACNONE 
J080022P10CAAGGCCCATACNONE 
J080023B20CAAGGCCCATACNONE 
J080023G19CAAGGCCCATACNONE 
J080024N15CAAGGCCCATACNONE 
J080025E11CAAGGCCCATACNONE 
J080025G24CAAGGCCCATACNONE 
J080026B01CAAGGCCCATACNONE 
J080026B05CAAGGCCCATACNONE 
J080027L17CAAGGCCCATACNONE 
J080028K02CAAGGCCCATACNONE 
J080029L23CAAGGCCCATACNONE 
J080030D08CAAGGCCCATACNONE 
J080031C03CAAGGCCCATACNONE 
J080031K02CAAGGCCCATACNONE 
J080032C16CAAGGCCCATACNONE 
J080033F10CAAGGCCCATACNONE 
J080033G12CAAGGCCCATACNONE 
J080033K03CAAGGCCCATACNONE 
J080034B03CAAGGCCCATACNONE 
J080034N21CAAGGCCCATACNONE 
J080034O03CAAGGCCCATACNONE 
J080035G10CAAGGCCCATACNONE 
J080038E14CAAGGCCCATACNONE 
J080039A19CAAGGCCCATACNONE 
J080039G10CAAGGCCCATACNONE 
J080039J01CAAGGCCCATACNONE 
J080039J09CAAGGCCCATACNONE 
J080040F07CAAGGCCCATACNONE 
J080040H18CAAGGCCCATACNONE 
J080041E08CAAGGCCCATACNONE 
J080041E16CAAGGCCCATACNONE 
J080041L08CAAGGCCCATACNONE 
J080042A07CAAGGCCCATACNONE 
J080044E02CAAGGCCCATACNONE 
J080045K03CAAGGCCCATACNONE 
J080046O03CAAGGCCCATACNONE 
J080047F08CAAGGCCCATACNONE 
J080048H01CAAGGCCCATACNONE 
J080048I05CAAGGCCCATACNONE 
J080048N06CAAGGCCCATACNONE 
J080050A07CAAGGCCCATACNONE 
J080050B04CAAGGCCCATACNONE 
J080050E21CAAGGCCCATACNONE 
J080051J01CAAGGCCCATACNONE 
J080051K02CAAGGCCCATACNONE 
J080051L02CAAGGCCCATACNONE 
J080052C20CAAGGCCCATACNONE 
J080052I22CAAGGCCCATACNONE 
J080052J21CAAGGCCCATACNONE 
J080052K22CAAGGCCCATACNONE 
J080055A05CAAGGCCCATACNONE 
J080055I12CAAGGCCCATACNONE 
J080056A21CAAGGCCCATACNONE 
J080056N11CAAGGCCCATACNONE 
J080057D02CAAGGCCCATACNONE 
J080058H21CAAGGCCCATACNONE 
J080058P16CAAGGCCCATACNONE 
J080059M03CAAGGCCCATACNONE 
J080059N17CAAGGCCCATACNONE 
J080060F13CAAGGCCCATACNONE 
J080060H06CAAGGCCCATACNONE 
J080060J03CAAGGCCCATACNONE 
J080060O09CAAGGCCCATACNONE 
J080060P22CAAGGCCCATACNONE 
J080061F06CAAGGCCCATACNONE 
J080061H21CAAGGCCCATACNONE 
J080061O13CAAGGCCCATACNONE 
J080062J07CAAGGCCCATACNONE 
J080063A08CAAGGCCCATACNONE 
J080063F19CAAGGCCCATACNONE 
J080063O18CAAGGCCCATACNONE 
J080065D15CAAGGCCCATACNONE 
J080066E13CAAGGCCCATACNONE 
J080068L01CAAGGCCCATACNONE 
J080068P07CAAGGCCCATACNONE 
J080069I21CAAGGCCCATACNONE 
J080070M04CAAGGCCCATACNONE 
J080071E01CAAGGCCCATACNONE 
J080071J08CAAGGCCCATACNONE 
J080071M23CAAGGCCCATACNONE 
J080072A03CAAGGCCCATACNONE 
J080072G18CAAGGCCCATACNONE 
J080075A04CAAGGCCCATACNONE 
J080075E19CAAGGCCCATACNONE 
J080075P18CAAGGCCCATACNONE 
J080076N11CAAGGCCCATACNONE 
J080077A11CAAGGCCCATACNONE 
J080077D22CAAGGCCCATACNONE 
J080077H18CAAGGCCCATACNONE 
J080077L03CAAGGCCCATACNONE 
J080078D02CAAGGCCCATACNONE 
J080078L05CAAGGCCCATACNONE 
J080078N20CAAGGCCCATACNONE 
J080079I20CAAGGCCCATACNONE 
J080081D04CAAGGCCCATACNONE 
J080082A07CAAGGCCCATACNONE 
J080082E24CAAGGCCCATACNONE 
J080084A22CAAGGCCCATACNONE 
J080084E15CAAGGCCCATACNONE 
J080084G06CAAGGCCCATACNONE 
J080086A05CAAGGCCCATACNONE 
J080086F09CAAGGCCCATACNONE 
J080087B11CAAGGCCCATACNONE 
J080087H12CAAGGCCCATACNONE 
J080088I05CAAGGCCCATACNONE 
J080088N08CAAGGCCCATACNONE 
J080088P07CAAGGCCCATACNONE 
J080089A09CAAGGCCCATACNONE 
J080089D21CAAGGCCCATACNONE 
J080089F24CAAGGCCCATACNONE 
J080089H22CAAGGCCCATACNONE 
J080089I04CAAGGCCCATACNONE 
J080090D01CAAGGCCCATACNONE 
J080091F09CAAGGCCCATACNONE 
J080091G18CAAGGCCCATACNONE 
J080091L24CAAGGCCCATACNONE 
J080091M12CAAGGCCCATACNONE 
J080091N12CAAGGCCCATACNONE 
J080093A15CAAGGCCCATACNONE 
J080093C08CAAGGCCCATACNONE 
J080093I08CAAGGCCCATACNONE 
J080093P21CAAGGCCCATACNONE 
J080094E18CAAGGCCCATACNONE 
J080094F15CAAGGCCCATACNONE 
J080094J21CAAGGCCCATACNONE 
J080095A09CAAGGCCCATACNONE 
J080096G05CAAGGCCCATACNONE 
J080096K07CAAGGCCCATACNONE 
J080097M17CAAGGCCCATACNONE 
J080097P21CAAGGCCCATACNONE 
J080302B15CAAGGCCCATACNONE 
J080306J15CAAGGCCCATACNONE 
J080306O13CAAGGCCCATACNONE 
J080307C15CAAGGCCCATACNONE 
J080307I04CAAGGCCCATACNONE 
J080307L05CAAGGCCCATACNONE 
J080308F11CAAGGCCCATACNONE 
J080311C04CAAGGCCCATACNONE 
J080311I07CAAGGCCCATACNONE 
J080312C01CAAGGCCCATACNONE 
J080312O08CAAGGCCCATACNONE 
J080315F14CAAGGCCCATACNONE 
J080318K13CAAGGCCCATACNONE 
J080319A17CAAGGCCCATACNONE 
J090001I01CAAGGCCCATACNONE 
J090002O18CAAGGCCCATACNONE 
J090007A08CAAGGCCCATACNONE 
J090007F22CAAGGCCCATACNONE 
J090008D09CAAGGCCCATACNONE 
J090008L07CAAGGCCCATACNONE 
J090008O08CAAGGCCCATACNONE 
J090012N11CAAGGCCCATACNONE 
J090013M05CAAGGCCCATACNONE 
J090020E08CAAGGCCCATACNONE 
J090020O20CAAGGCCCATACNONE 
J090021I10CAAGGCCCATACNONE 
J090023D07CAAGGCCCATACNONE 
J090023K22CAAGGCCCATACNONE 
J090023O08CAAGGCCCATACNONE 
J090028D21CAAGGCCCATACNONE 
J090029H14CAAGGCCCATACNONE 
J090029L12CAAGGCCCATACNONE 
J090030C05CAAGGCCCATACNONE 
J090031D18CAAGGCCCATACNONE 
J090032G10CAAGGCCCATACNONE 
J090034J22CAAGGCCCATACNONE 
J090034K16CAAGGCCCATACNONE 
J090036D10CAAGGCCCATACNONE 
J090037N17CAAGGCCCATACNONE 
J090043P17CAAGGCCCATACNONE 
J090044L20CAAGGCCCATACNONE 
J090045N16CAAGGCCCATACNONE 
J090048K03CAAGGCCCATACNONE 
J090048K10CAAGGCCCATACNONE 
J090049O07CAAGGCCCATACNONE 
J090055H23CAAGGCCCATACNONE 
J090056G12CAAGGCCCATACNONE 
J090056G16CAAGGCCCATACNONE 
J090059B16CAAGGCCCATACNONE 
J090066H21CAAGGCCCATACNONE 
J090067D22CAAGGCCCATACNONE 
J090072M07CAAGGCCCATACNONE 
J090073J21CAAGGCCCATACNONE 
J090075A15CAAGGCCCATACNONE 
J090079J09CAAGGCCCATACNONE 
J090080L07CAAGGCCCATACNONE 
J090084A03CAAGGCCCATACNONE 
J090085B07CAAGGCCCATACNONE 
J090088H11CAAGGCCCATACNONE 
J090090J12CAAGGCCCATACNONE 
J090091I21CAAGGCCCATACNONE 
J090091L02CAAGGCCCATACNONE 
J090093G18CAAGGCCCATACNONE 
J090094D23CAAGGCCCATACNONE 
J090098L19CAAGGCCCATACNONE 
J100017I22CAAGGCCCATACNONE 
J100018F08CAAGGCCCATACNONE 
J100018G19CAAGGCCCATACNONE 
J100019B05CAAGGCCCATACNONE 
J100019J18CAAGGCCCATACNONE 
J100019L04CAAGGCCCATACNONE 
J100023M06CAAGGCCCATACNONE 
J100024J23CAAGGCCCATACNONE 
J100024P09CAAGGCCCATACNONE 
J100027I05CAAGGCCCATACNONE 
J100029G03CAAGGCCCATACNONE 
J100029K08CAAGGCCCATACNONE 
J100031J17CAAGGCCCATACNONE 
J100037L16CAAGGCCCATACNONE 
J100038C05CAAGGCCCATACNONE 
J100039D19CAAGGCCCATACNONE 
J100041L02CAAGGCCCATACNONE 
J100045B08CAAGGCCCATACNONE 
J100045B15CAAGGCCCATACNONE 
J100047G07CAAGGCCCATACNONE 
J100047P19CAAGGCCCATACNONE 
J100048I15CAAGGCCCATACNONE 
J100049M16CAAGGCCCATACNONE 
J100049P18CAAGGCCCATACNONE 
J100050E21CAAGGCCCATACNONE 
J100051N02CAAGGCCCATACNONE 
J100052M02CAAGGCCCATACNONE 
J100055M24CAAGGCCCATACNONE 
J100056K11CAAGGCCCATACNONE 
J100059F20CAAGGCCCATACNONE 
J100059J15CAAGGCCCATACNONE 
J100068C19CAAGGCCCATACNONE 
J100068G06CAAGGCCCATACNONE 
J100069N02CAAGGCCCATACNONE 
J100073N04CAAGGCCCATACNONE 
J100074B05CAAGGCCCATACNONE 
J100080P13CAAGGCCCATACNONE 
J100083P09CAAGGCCCATACNONE 
J100084B11CAAGGCCCATACNONE 
J100085B07CAAGGCCCATACNONE 
J100086O20CAAGGCCCATACNONE 
J100087B02CAAGGCCCATACNONE 
J100089B14CAAGGCCCATACNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0192900AK103422CAAGGCCCATATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CAAGGCCCATATNONE 
Os08g0359500003-107-F09CAAGGCCCACGANONE 
006-091-E08CAAGGCCCACGANONE 
006-096-E12CAAGGCCCACGANONE 
006-111-F11CAAGGCCCACGANONE 
009-090-H10CAAGGCCCACGANONE 
014-013-B02CAAGGCCCACGANONE 
014-083-E03CAAGGCCCACGANONE 
014-100-F05CAAGGCCCACGANONE 
AK104798CAAGGCCCACGANONE 
AK112034CAAGGCCCACGAHSP20-like chaperone domain containing protein. 
J013060J18CAAGGCCCACGANONE 
J033042C22CAAGGCCCACGANONE 
J065168I06CAAGGCCCACGANONE 
J075077E12CAAGGCCCACGANONE 
J075094M21CAAGGCCCACGANONE 
J090068D17CAAGGCCCACGANONE 
J100027E21CAAGGCCCACGANONE 
J100058D21CAAGGCCCACGANONE 
J100067B02CAAGGCCCACGANONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0502700AK064774CAAGGCCCAminotransferase, class V family protein. 
AK065126CAAGGCCCNONE 
AK099206CAAGGCCCNONE 
J013001P06CAAGGCCCNONE 
J013033N17CAAGGCCCNONE 
J013070L14CAAGGCCCNONE 
J013104J15CAAGGCCCNONE 
J013159L20CAAGGCCCNONE 
J033068M20CAAGGCCCNONE 
J065039M22CAAGGCCCNONE 
J065057C23CAAGGCCCNONE 
J065069O15CAAGGCCCNONE 
J065080A01CAAGGCCCNONE 
J065081F08CAAGGCCCNONE 
J065117F05CAAGGCCCNONE 
J065178C01CAAGGCCCNONE 
J065178C02CAAGGCCCNONE 
J065212F12CAAGGCCCNONE 
J075015K06CAAGGCCCNONE 
J075062J08CAAGGCCCNONE 
J075063O17CAAGGCCCNONE 
J075072G05CAAGGCCCNONE 
J075098H11CAAGGCCCNONE 
J075098J11CAAGGCCCNONE 
J075098P09CAAGGCCCNONE 
J075133G18CAAGGCCCNONE 
J075137G02CAAGGCCCNONE 
J075169K02CAAGGCCCNONE 
J080007M21CAAGGCCCNONE 
J080009M17CAAGGCCCNONE 
J080011J02CAAGGCCCNONE 
J080012I10CAAGGCCCNONE 
J080021K10CAAGGCCCNONE 
J080023P13CAAGGCCCNONE 
J080024C08CAAGGCCCNONE 
J080025P11CAAGGCCCNONE 
J080027B13CAAGGCCCNONE 
J080032P16CAAGGCCCNONE 
J080033G07CAAGGCCCNONE 
J080041F17CAAGGCCCNONE 
J080041N19CAAGGCCCNONE 
J080042C20CAAGGCCCNONE 
J080046J24CAAGGCCCNONE 
J080047L14CAAGGCCCNONE 
J080049O11CAAGGCCCNONE 
J080051E15CAAGGCCCNONE 
J080052F01CAAGGCCCNONE 
J080054A08CAAGGCCCNONE 
J080054K14CAAGGCCCNONE 
J080057G21CAAGGCCCNONE 
J080059L15CAAGGCCCNONE 
J080063H12CAAGGCCCNONE 
J080070M24CAAGGCCCNONE 
J080071D24CAAGGCCCNONE 
J080077O19CAAGGCCCNONE 
J080078E08CAAGGCCCNONE 
J080078N12CAAGGCCCNONE 
J080081I08CAAGGCCCNONE 
J080082A17CAAGGCCCNONE 
J080087A09CAAGGCCCNONE 
J080087F22CAAGGCCCNONE 
J080088I08CAAGGCCCNONE 
J080090F19CAAGGCCCNONE 
J080091H16CAAGGCCCNONE 
J080091N06CAAGGCCCNONE 
J080092H08CAAGGCCCNONE 
J080097H19CAAGGCCCNONE 
J080302C09CAAGGCCCNONE 
J080302G05CAAGGCCCNONE 
J080302K14CAAGGCCCNONE 
J080303L01CAAGGCCCNONE 
J080304D07CAAGGCCCNONE 
J080305G03CAAGGCCCNONE 
J080306B12CAAGGCCCNONE 
J080307G07CAAGGCCCNONE 
J080315A14CAAGGCCCNONE 
J080318H14CAAGGCCCNONE 
J100029P15CAAGGCCCNONE 
J100042C22CAAGGCCCNONE 
J100063F24CAAGGCCCNONE 
J100087P16CAAGGCCCNONE 
J100088A12CAAGGCCCNONE 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0558400AK071334GGGCCTTGSimilar to Kinesin heavy chain (Fragment). 
Os08g0567200AK067161CAAGGCCCATTTNONE 
J013094H15CAAGGCCCATTTNONE 
J065209H08CAAGGCCCATTTNONE 
Os09g0306700J023045A19TTATGGGCCTTGNONE 
Os09g0307800AK060843ACTGGGCCTTGNuclear protein SET domain containing protein. 
Os09g0397100J075141L14CAAGGCCCAACANONE 
J100063H17CAAGGCCCAACAConserved hypothetical protein. 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0436700AK070597CAAGGCCCACCAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os09g0471900AK073815CAAGGCCCAACABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0476100AK099938CAAGGCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0488800Os09g0488800GGGCCTTGRetrovirus capsid, C-terminal domain containing protein. 
Os09g0559600AK109214CAAGGCCCGGCThioredoxin domain 2 containing protein. 
Os09g0567400AK072521GGGCCTTGSimilar to Histidine-containing phosphotransfer protein. 
AK104879GGGCCTTGNONE 
AY345241GGGCCTTGNONE 
J013055N16GGGCCTTGNONE 
J023131B06GGGCCTTGNONE 
J023149P12GGGCCTTGNONE 
J033074B19GGGCCTTGNONE 
J053024J01GGGCCTTGNONE 
J053054M07GGGCCTTGNONE 
J053059A11GGGCCTTGNONE 
J053060K04GGGCCTTGNONE 
J053063F20GGGCCTTGNONE 
J053089G08GGGCCTTGNONE 
J053094D10GGGCCTTGNONE 
J065012B16GGGCCTTGNONE 
J065014F12GGGCCTTGNONE 
J065032O04GGGCCTTGNONE 
J065045J12GGGCCTTGNONE 
J065065J10GGGCCTTGNONE 
J065106C19GGGCCTTGNONE 
J065135I07GGGCCTTGNONE 
J065144G01GGGCCTTGNONE 
J065178E14GGGCCTTGNONE 
J065190M08GGGCCTTGNONE 
J065201L17GGGCCTTGNONE 
J075010O13GGGCCTTGNONE 
J075031L11GGGCCTTGNONE 
J075041A15GGGCCTTGNONE 
J075080E07GGGCCTTGNONE 
J075108A09GGGCCTTGNONE 
J075125M20GGGCCTTGNONE 
J075131L03GGGCCTTGNONE 
J075163J08GGGCCTTGNONE 
J090033B10GGGCCTTGNONE 
J100043J24GGGCCTTGNONE 
J100052K01GGGCCTTGNONE 
J100062C17GGGCCTTGNONE 
Os09g0571500AK106610CAAGGCCCLipase, class 3 family protein. 
Os11g0130300AK059597ACATGGGCCTTGNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224ACATGGGCCTTGNONE 
J033031D09ACATGGGCCTTGNONE 
J033135B02ACATGGGCCTTGNONE 
J100021A17ACATGGGCCTTGNONE 
J100066G09ACATGGGCCTTGNONE 
Os11g0138300AK103307CAAGGCCCCytochrome P450 family protein. 
J033125E14CAAGGCCCNONE 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
Os11g0473000AK060156AAGGCCCAAGGCCCATCANONE 
AK065994AAGGCCCAAGGCCCATCASimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759AAGGCCCAAGGCCCATCANONE 
Os11g0482000006-056-D12GGCTGGGCCTTGNONE 
006-102-C10GGCTGGGCCTTGNONE 
009-005-E07GGCTGGGCCTTGNONE 
014-088-D03GGCTGGGCCTTGNONE 
AK059558GGCTGGGCCTTGSimilar to 40S ribosomal protein S5-1. 
AK103918GGCTGGGCCTTGNONE 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0557900009-196-H11CAAGGCCCATCCANONE 
009-196-H11CAAGGCCCATTTNONE 
AK063232CAAGGCCCATCCAARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
AK063232CAAGGCCCATTTARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os12g0118900009-090-F10CAAGGCCCNONE 
AK062692CAAGGCCCCytochrome P450 family protein. 
Os12g0133600AK103096TTGTGGGCCTTGConserved hypothetical protein. 
J033118M03TTGTGGGCCTTGNONE 
Os12g0136600AK064762ATTGGGCCTTGConserved hypothetical protein. 
J075198J21ATTGGGCCTTGNONE 
J080024B04ATTGGGCCTTGNONE 
J080042H13ATTGGGCCTTGNONE 
J080042J18ATTGGGCCTTGNONE 
J080068A13ATTGGGCCTTGNONE 
J080076G10ATTGGGCCTTGNONE 
J080076H12ATTGGGCCTTGNONE 
J080097E20ATTGGGCCTTGNONE 
J080097L07ATTGGGCCTTGNONE 
J090049I08ATTGGGCCTTGNONE 
Os12g0165700AK099823CAAGGCCCCCACTranscription factors TFIIS, elongin A, CRSP70, conserved domain containing protein. 
Os12g0190100AK109819CAAGGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.