version

Summary of OsREG498 (All List)

OrganismOryza sativa  
IDOsREG498  
SequenceCAAGTGGG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1169  

Entry Sequences (1169 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07CAAGTGGGNONE 
AK063774CAAGTGGGTranslocon-associated beta family protein. 
AK099081CAAGTGGGNONE 
AK099360CAAGTGGGNONE 
J013096O20CAAGTGGGNONE 
J023002P14CAAGTGGGNONE 
J033046F10CAAGTGGGNONE 
J033084K08CAAGTGGGNONE 
J065011H22CAAGTGGGNONE 
J090017O18CAAGTGGGNONE 
J090047F15CAAGTGGGNONE 
J090049G20CAAGTGGGNONE 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0209000AK103701CAAGTGGGCCTAAlg9-like mannosyltransferase family protein. 
J065104C04CAAGTGGGCCTANONE 
J090083C01CAAGTGGGCCTANONE 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0248800009-103-G11CAAGTGGGNONE 
AK062766CAAGTGGGConserved hypothetical protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0271700J065184P16CCCACTTGNONE 
J075182E21CCCACTTGNONE 
J075191M19CCCACTTGNONE 
J090021E22CCCACTTGNONE 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0309800AK110758CCCACTTGSimilar to Hydrogenase expression/formation protein hypB. 
J065065I19CCCACTTGNONE 
J065167H24CCCACTTGNONE 
J065173I11CCCACTTGNONE 
J075055J21CCCACTTGNONE 
Os01g0391100012-001-B05CCTGGGCCCACTTGNONE 
012-053-F01CCTGGGCCCACTTGNONE 
AK063499CCTGGGCCCACTTGNONE 
J065021A04CCTGGGCCCACTTGNONE 
J065076H06CCTGGGCCCACTTGNONE 
J065181E05CCTGGGCCCACTTGNONE 
J065187A05CCTGGGCCCACTTGNONE 
J075036C17CCTGGGCCCACTTGNONE 
J075051C18CCTGGGCCCACTTGNONE 
J075063L16CCTGGGCCCACTTGNONE 
J075079M08CCTGGGCCCACTTGNONE 
J075112H15CCTGGGCCCACTTGNONE 
J075135F10CCTGGGCCCACTTGNONE 
J075164H06CCTGGGCCCACTTGNONE 
J075195N02CCTGGGCCCACTTGNONE 
Os01g0575200015-047-A07CCCACTTGNONE 
AK106333CCCACTTGConserved hypothetical protein. 
J065140I24CCCACTTGNONE 
J080013D19CCCACTTGNONE 
J080034P11CCCACTTGNONE 
J080043J20CCCACTTGNONE 
J080068H05CCCACTTGNONE 
J080070I24CCCACTTGNONE 
J080076D13CCCACTTGNONE 
J080086M10CCCACTTGNONE 
J080086M20CCCACTTGNONE 
J080096B02CCCACTTGNONE 
J080097C23CCCACTTGNONE 
J100050L16CCCACTTGNONE 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0631200J023080H07CCCACTTGNONE 
J023125G17CCCACTTGNONE 
J033132A13CCCACTTGNONE 
J065179I22CCCACTTGNONE 
J090027C06CCCACTTGNONE 
Os01g0652800006-085-A10GCCCCCACTTGNONE 
013-030-A12GCCCCCACTTGNONE 
AK061145GCCCCCACTTGProtein of unknown function DUF231, plant domain containing protein. 
AK103547GCCCCCACTTGNONE 
AK104312GCCCCCACTTGNONE 
J023039H04GCCCCCACTTGNONE 
J033132E17GCCCCCACTTGNONE 
J053023N09GCCCCCACTTGNONE 
J065052H05GCCCCCACTTGNONE 
J075058C12GCCCCCACTTGNONE 
J075058I03GCCCCCACTTGNONE 
J075128L08GCCCCCACTTGNONE 
J075170M10GCCCCCACTTGNONE 
J090011D14GCCCCCACTTGNONE 
J090043C02GCCCCCACTTGNONE 
J100040I15GCCCCCACTTGNONE 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0658400009-060-F03CAAGTGGGNONE 
009-061-B01CAAGTGGGNONE 
009-099-E05CAAGTGGGNONE 
009-155-E03CAAGTGGGNONE 
AB074411CAAGTGGGNONE 
AK063826CAAGTGGGUbiquitin-conjugating enzyme OsUBC5a. 
AK099284CAAGTGGGNONE 
J023129D13CAAGTGGGNONE 
J065033C05CAAGTGGGNONE 
J065037H04CAAGTGGGNONE 
J065130E05CAAGTGGGNONE 
J065171F18CAAGTGGGNONE 
J090003M23CAAGTGGGNONE 
J090090M13CAAGTGGGNONE 
J090095A08CAAGTGGGNONE 
J100053H08CAAGTGGGNONE 
J100065C23CAAGTGGGNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0673500AK065017CAAGTGGGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899CAAGTGGGNONE 
Os01g0719400012-066-H10GGCCCCACTTGNONE 
AK063516GGCCCCACTTGConserved hypothetical protein. 
Os01g0741900014-012-B05GCCCCCACTTGNONE 
AK068600GCCCCCACTTGSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1). 
J013035G23GCCCCCACTTGNONE 
J013154A18GCCCCCACTTGNONE 
J033092G10GCCCCCACTTGNONE 
J043020A20GCCCCCACTTGNONE 
J100041K22GCCCCCACTTGNONE 
J100066E16GCCCCCACTTGNONE 
J100081J06GCCCCCACTTGNONE 
Os01g0833500AK073320CCCACTTGSimilar to Serine carboxypeptidase II-1 precursor (EC 3.4.16.6) (CP-MII.1) (Fragment). 
Os01g0844200AK109255CAAGTGGGTCCDVL family protein. 
Os01g0846600AK070193GGACCCACTTGProtein of unknown function DUF248, methyltransferase putative family protein. 
J023041I24GGACCCACTTGNONE 
J065002B03GGACCCACTTGNONE 
J065140C09GGACCCACTTGNONE 
J090052A18GGACCCACTTGNONE 
J090081O13GGACCCACTTGNONE 
J100056L06GGACCCACTTGNONE 
Os01g0869300AK059347GCAGCCCACTTGConserved hypothetical protein. 
Os01g0912900AK119446CAAGTGGGProtein prenyltransferase domain containing protein. 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os02g0105800012-067-G09CAAGTGGGNONE 
AK102217CAAGTGGGCyclin-like F-box domain containing protein. 
J023057D08CAAGTGGGNONE 
Os02g0137100015-082-A12ACCCCCCACTTGNONE 
016-013-D11ACCCCCCACTTGNONE 
AK073353ACCCCCCACTTGConserved hypothetical protein 1589, plant family protein. 
J013026D20ACCCCCCACTTGNONE 
J013111M05ACCCCCCACTTGNONE 
J023099B09ACCCCCCACTTGNONE 
J033025E21ACCCCCCACTTGNONE 
J033082H04ACCCCCCACTTGNONE 
J065110E11ACCCCCCACTTGNONE 
Os02g0162500009-181-F03GGTCCCACTTGNONE 
AK058907GGTCCCACTTGNONE 
AK121223GGTCCCACTTGSimilar to 40S ribosomal protein S14. 
J023090I10GGTCCCACTTGNONE 
J023136J11GGTCCCACTTGNONE 
J053097J20GGTCCCACTTGNONE 
J053098F01GGTCCCACTTGNONE 
J065065B09GGTCCCACTTGNONE 
J065082M04GGTCCCACTTGNONE 
J065188O05GGTCCCACTTGNONE 
J075057P15GGTCCCACTTGNONE 
J075061J08GGTCCCACTTGNONE 
J075061N15GGTCCCACTTGNONE 
J075131I08GGTCCCACTTGNONE 
J075141H13GGTCCCACTTGNONE 
J080062E14GGTCCCACTTGNONE 
J080062P15GGTCCCACTTGNONE 
J080318G17GGTCCCACTTGNONE 
J080319G19GGTCCCACTTGNONE 
J090001L10GGTCCCACTTGNONE 
J090024I18GGTCCCACTTGNONE 
J090033F24GGTCCCACTTGNONE 
J090036M16GGTCCCACTTGNONE 
J090040I24GGTCCCACTTGNONE 
J090048P06GGTCCCACTTGNONE 
J090049B12GGTCCCACTTGNONE 
J090068C02GGTCCCACTTGNONE 
J090069O04GGTCCCACTTGNONE 
J090084H22GGTCCCACTTGNONE 
J100022L03GGTCCCACTTGNONE 
J100028O14GGTCCCACTTGNONE 
J100028O18GGTCCCACTTGNONE 
J100032A15GGTCCCACTTGNONE 
J100033D21GGTCCCACTTGNONE 
J100034J23GGTCCCACTTGNONE 
J100043K22GGTCCCACTTGNONE 
J100052M22GGTCCCACTTGNONE 
J100053N03GGTCCCACTTGNONE 
J100074N24GGTCCCACTTGNONE 
J100082J10GGTCCCACTTGNONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0192500AK059580CAAGTGGGGCCNONE 
Os02g0218400AK068947CAAGTGGGUspA domain containing protein. 
Os02g0303200AK107731GTGGGACCCACTTGHypothetical protein. 
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit. 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
Os02g0562300AK061441CAAGTGGGNONE 
AK104737CAAGTGGGNONE 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0581300AK071553CAAGTGGGTRAM, LAG1 and CLN8 homology domain containing protein. 
J023105G15CAAGTGGGNONE 
J065044A01CAAGTGGGNONE 
J065089D11CAAGTGGGNONE 
J065098K16CAAGTGGGNONE 
J065119D04CAAGTGGGNONE 
J065190M10CAAGTGGGNONE 
J090029F16CAAGTGGGNONE 
J090040K10CAAGTGGGNONE 
J090058J09CAAGTGGGNONE 
J090080C19CAAGTGGGNONE 
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE 
AK058978CACTGACAAGTGGGTCCAGANONE 
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein. 
Os02g0611400AK101310GGTCCCACTTGProtein prenyltransferase domain containing protein. 
J033024H21GGTCCCACTTGNONE 
J033033O21GGTCCCACTTGNONE 
J065134H24GGTCCCACTTGNONE 
J090087E02GGTCCCACTTGNONE 
Os02g0629900AK108563CAAGTGGGConserved hypothetical protein. 
J065138O07CAAGTGGGNONE 
Os02g0653800J023002B17CAAGTGGGCCTTNONE 
J033067E03CAAGTGGGCCTTSimilar to GTP-binding protein. 
J033105M04CAAGTGGGCCTTNONE 
J053039E15CAAGTGGGCCTTNONE 
J065026L07CAAGTGGGCCTTNONE 
J065038B03CAAGTGGGCCTTNONE 
J065087J15CAAGTGGGCCTTNONE 
J065121B22CAAGTGGGCCTTNONE 
J065128N12CAAGTGGGCCTTNONE 
J065189E19CAAGTGGGCCTTNONE 
J100058B03CAAGTGGGCCTTNONE 
Os02g0712600AK107391CAAGTGGGConcanavalin A-like lectin/glucanase domain containing protein. 
Os02g0725100AK071759CACTGACAAGTGGGACCCNONE 
Os02g0744700AF395537GGTGGGGCCCACTTGNONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0780800J090080O19GGACCCACTTGNONE 
J090091I06GGACCCACTTGNONE 
Os02g0782300AK109297CAAGTGGGNONE 
Os02g0782500013-043-A07CAAGTGGGNONE 
013-068-B10CAAGTGGGNONE 
013-093-A08CAAGTGGGNONE 
014-083-C12CAAGTGGGNONE 
AK063602CAAGTGGGNONE 
AK119261CAAGTGGGSimilar to Small heat stress protein class CIII. 
J065013N12CAAGTGGGNONE 
J075136E01CAAGTGGGNONE 
J075149G04CAAGTGGGNONE 
Os02g0789600AK101046CAAGTGGGCCCTNONE 
AK112100CAAGTGGGCCCTSimilar to DEM2. 
Os03g0109400AJ556802CAAGTGGGNONE 
AK059498CAAGTGGGNONE 
Os03g0111100AK102025GGGACCCACTTGSimilar to Dihydrofolate synthetase /folylpolyglutamate synthetase. 
Os03g0119100AK069519CAAGTGGGCCCTSimilar to Phospholipase D beta 2. 
J023024E17CAAGTGGGCCCTNONE 
J023122B02CAAGTGGGCCCTNONE 
J090094E15CAAGTGGGCCCTNONE 
Os03g0125100Os03g0125100CCCACTTGSimilar to Beta-ring hydroxylase (Fragment). 
Os03g0161000AK121425CAAGTGGGCCGGGNONE 
J023135K12CAAGTGGGCCGGGNONE 
Os03g0161900AK066844CCCACTTGNONE 
AY344489CCCACTTGSimilar to Heat shock factor 1 (Fragment). 
J013088J01CCCACTTGNONE 
J023114N08CCCACTTGNONE 
Os03g0174200AK060616CAAGTGGGTCCCACNONE 
AK103762CAAGTGGGTCCCACConserved hypothetical protein. 
J033143G15CAAGTGGGTCCCACNONE 
J090025L02CAAGTGGGTCCCACNONE 
Os03g0183300003-107-A07CAAGTGGGNONE 
003-113-H10CAAGTGGGNONE 
003-118-G01CAAGTGGGNONE 
006-028-A09CAAGTGGGNONE 
006-047-D01CAAGTGGGNONE 
006-052-D04CAAGTGGGNONE 
006-087-H06CAAGTGGGNONE 
006-089-B03CAAGTGGGNONE 
006-092-D08CAAGTGGGNONE 
006-093-E07CAAGTGGGNONE 
009-029-H07CAAGTGGGNONE 
009-067-B05CAAGTGGGNONE 
009-091-F04CAAGTGGGNONE 
009-101-C10CAAGTGGGNONE 
009-113-A06CAAGTGGGNONE 
009-140-E12CAAGTGGGNONE 
009-145-E10CAAGTGGGNONE 
009-196-F02CAAGTGGGNONE 
011-054-E07CAAGTGGGNONE 
012-074-E10CAAGTGGGNONE 
012-076-E11CAAGTGGGNONE 
014-006-C07CAAGTGGGNONE 
014-085-G11CAAGTGGGNONE 
015-049-C04CAAGTGGGNONE 
015-062-E10CAAGTGGGNONE 
016-063-E02CAAGTGGGNONE 
AK058349CAAGTGGGHypothetical protein. 
AK105922CAAGTGGGNONE 
AK106163CAAGTGGGNONE 
AK119553CAAGTGGGNONE 
AY831395CAAGTGGGNONE 
Os03g0198400AK059522CCCACTTGNONE 
AK103101CCCACTTGSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CCCACTTGNONE 
J075036K08CCCACTTGNONE 
J075040J23CCCACTTGNONE 
J075041H18CCCACTTGNONE 
J075053H18CCCACTTGNONE 
J075055K15CCCACTTGNONE 
J075111K03CCCACTTGNONE 
J075125B22CCCACTTGNONE 
J075195L10CCCACTTGNONE 
Os03g0253100AK119618TAGGCCCACAGCCCACTTGPhosphomevalonate kinase Erg8 family protein. 
J033052A14TAGGCCCACAGCCCACTTGNONE 
Os03g0259300AK063394CCCACTTGTetratricopeptide-like helical domain containing protein. 
Os03g0266100AK058507CCCACTTGLIM, zinc-binding domain containing protein. 
J033099G10CCCACTTGNONE 
J065196N19CCCACTTGNONE 
Os03g0313600AK067474CCCACTTGSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0318500AK121967CAAGTGGGSimilar to Glucose-6-phosphate 1-dehydrogenase, chloroplast precursor (EC 1.1.1.49) (G6PD). 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0339100AK111641GCGGCCCACTTGSimilar to PRL1 protein. 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
J023031G06CAAGTGGGCCCCNONE 
J023089N19CAAGTGGGCCCCNONE 
J023099N13CAAGTGGGCCCCNONE 
J065026N17CAAGTGGGCCCCNONE 
J065045N16CAAGTGGGCCCCNONE 
J065163L12CAAGTGGGCCCCNONE 
Os03g0643300AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
AK108010CAAGTGGGCCCAGANONE 
Os03g0726200AK110903CCCACTTGNONE 
Os03g0744600AB110189CCCACTTGSimilar to Ripening-associated protein (Fragment). 
AK065730CCCACTTGNONE 
Os03g0798400AK109070CCCACTTGPrenylated rab acceptor PRA1 family protein. 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0820100011-030-A10CCCACTTGNONE 
011-031-C01CCCACTTGNONE 
AK111534CCCACTTGSimilar to Auxin-resistance protein AXR1. 
J013033L14CCCACTTGNONE 
J013034D14CCCACTTGNONE 
J013065N20CCCACTTGNONE 
J013127A04CCCACTTGNONE 
J013146A11CCCACTTGNONE 
J023025D19CCCACTTGNONE 
J023083K15CCCACTTGNONE 
J033037N01CCCACTTGNONE 
J033041H02CCCACTTGNONE 
J043009M22CCCACTTGNONE 
J090039L03CCCACTTGNONE 
J090050L08CCCACTTGNONE 
J090053J21CCCACTTGNONE 
J090088G07CCCACTTGNONE 
Os03g0820400009-042-F06CCCACTTGNONE 
009-046-E08CCCACTTGNONE 
009-079-B08CCCACTTGNONE 
009-111-H09CCCACTTGNONE 
009-150-D10CCCACTTGNONE 
015-073-H11CCCACTTGNONE 
AK119690CCCACTTGSimilar to ZPT2-13. 
AY286473CCCACTTGNONE 
AY305864CCCACTTGNONE 
J100051O21CCCACTTGNONE 
Os03g0822100AK101094CAAGTGGGGCGGGTCGSimilar to Transposase (Fragment). 
J033024N05CAAGTGGGGCGGGTCGNONE 
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE 
014-009-H06CCACTGACAAGTGGGTCCCNONE 
014-025-G05CCACTGACAAGTGGGTCCCNONE 
014-033-G02CCACTGACAAGTGGGTCCCNONE 
014-038-G06CCACTGACAAGTGGGTCCCNONE 
014-047-H10CCACTGACAAGTGGGTCCCNONE 
014-054-H04CCACTGACAAGTGGGTCCCNONE 
014-055-F05CCACTGACAAGTGGGTCCCNONE 
014-075-E04CCACTGACAAGTGGGTCCCNONE 
014-084-B02CCACTGACAAGTGGGTCCCNONE 
014-087-F10CCACTGACAAGTGGGTCCCNONE 
014-098-D02CCACTGACAAGTGGGTCCCNONE 
014-099-B04CCACTGACAAGTGGGTCCCNONE 
014-100-H10CCACTGACAAGTGGGTCCCNONE 
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein. 
AK102425CCACTGACAAGTGGGTCCCNONE 
J065134M15CCACTGACAAGTGGGTCCCNONE 
J090053B16CCACTGACAAGTGGGTCCCNONE 
Os03g0832600AK120137CAAGTGGGTCCCACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0835400AK061773TAGGCCCACTTGSimilar to Uvs101. 
AK098986TAGGCCCACTTGNONE 
AK105896TAGGCCCACTTGNONE 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
Os03g0848700AK065798CCCACTTGSimilar to TDRGA-1 (Fragment). 
J013039L06CCCACTTGNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0313300AK121730GGACCCACTTGConserved hypothetical protein. 
J033082F07GGACCCACTTGNONE 
Os04g0350100009-159-E11CAAGTGGGNONE 
AK063869CAAGTGGGNONE 
AK102139CAAGTGGGProteinase inhibitor I25, cystatin domain containing protein. 
J100038M07CAAGTGGGNONE 
Os04g0419500J100059A06GCAGCCCACTTGZinc finger, RING-type domain containing protein. 
Os04g0445200009-034-A06CAAGTGGGCCTCNONE 
AK062427CAAGTGGGCCTCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720CAAGTGGGCCTCNONE 
J065022E20CAAGTGGGCCTCNONE 
J065062D16CAAGTGGGCCTCNONE 
J065081I02CAAGTGGGCCTCNONE 
J065087C10CAAGTGGGCCTCNONE 
J065116N16CAAGTGGGCCTCNONE 
J065132F10CAAGTGGGCCTCNONE 
J065140F18CAAGTGGGCCTCNONE 
J065143M22CAAGTGGGCCTCNONE 
J065158K17CAAGTGGGCCTCNONE 
J065162D07CAAGTGGGCCTCNONE 
J065207H19CAAGTGGGCCTCNONE 
J075155B20CAAGTGGGCCTCNONE 
J075167E24CAAGTGGGCCTCNONE 
J075178B19CAAGTGGGCCTCNONE 
J080301D22CAAGTGGGCCTCNONE 
J080301J15CAAGTGGGCCTCNONE 
J080308J02CAAGTGGGCCTCNONE 
Os04g0448600006-043-F06CCCACTTGNONE 
AK068709CCCACTTGChaC-like protein family protein. 
AK104134CCCACTTGNONE 
J065034G07CCCACTTGNONE 
J065071O11CCCACTTGNONE 
J065120F08CCCACTTGNONE 
J065143K01CCCACTTGNONE 
J065154B20CCCACTTGNONE 
J065158N11CCCACTTGNONE 
J065170A03CCCACTTGNONE 
J065180H19CCCACTTGNONE 
J065192D07CCCACTTGNONE 
J075004F21CCCACTTGNONE 
J075083D04CCCACTTGNONE 
J075092K14CCCACTTGNONE 
J075116G09CCCACTTGNONE 
J075156B11CCCACTTGNONE 
J075197L06CCCACTTGNONE 
J090020M13CCCACTTGNONE 
Os04g0461400AK066992CCCACTTGHypothetical protein. 
J013089P17CCCACTTGNONE 
Os04g0468600006-052-F07CAAGTGGGNONE 
006-057-C09CAAGTGGGNONE 
006-070-B03CAAGTGGGNONE 
006-079-B01CAAGTGGGNONE 
014-009-B09CAAGTGGGNONE 
AK061332CAAGTGGGNONE 
AK066718CAAGTGGGNONE 
AK102569CAAGTGGGNONE 
AK105886CAAGTGGGNONE 
AK109364CAAGTGGGHeavy metal transport/detoxification protein domain containing protein. 
J053054L19CAAGTGGGNONE 
J065039E17CAAGTGGGNONE 
J065056L23CAAGTGGGNONE 
J065093H19CAAGTGGGNONE 
J065102P09CAAGTGGGNONE 
J065137N06CAAGTGGGNONE 
J065142K09CAAGTGGGNONE 
J065162J01CAAGTGGGNONE 
J065163G24CAAGTGGGNONE 
J065180H22CAAGTGGGNONE 
J100024M22CAAGTGGGNONE 
J100024N13CAAGTGGGNONE 
J100026E19CAAGTGGGNONE 
J100028L03CAAGTGGGNONE 
J100030E23CAAGTGGGNONE 
J100031M16CAAGTGGGNONE 
J100038M04CAAGTGGGNONE 
J100043C02CAAGTGGGNONE 
J100046L17CAAGTGGGNONE 
J100049O20CAAGTGGGNONE 
J100052D13CAAGTGGGNONE 
J100062J03CAAGTGGGNONE 
J100065F08CAAGTGGGNONE 
J100081N16CAAGTGGGNONE 
J100084D19CAAGTGGGNONE 
J100086D02CAAGTGGGNONE 
J100087J17CAAGTGGGNONE 
J100090I22CAAGTGGGNONE 
Os04g0470300AK059742CAAGTGGGNONE 
AK070483CAAGTGGGProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06CAAGTGGGNONE 
J090047A18CAAGTGGGNONE 
Os04g0485200006-033-B07GTGGGTCCCACTTGNONE 
AK061463GTGGGTCCCACTTGNONE 
J023037H14GTGGGTCCCACTTGNONE 
J023083B19GTGGGTCCCACTTGNONE 
J023104H04GTGGGTCCCACTTGNONE 
J043022C03GTGGGTCCCACTTGNONE 
Os04g0577000AK073711CAAGTGGGCTTTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CAAGTGGGCTTTNONE 
J013127H04CAAGTGGGCTTTNONE 
J033035G06CAAGTGGGCTTTNONE 
J033061G23CAAGTGGGCTTTNONE 
J033127L07CAAGTGGGCTTTNONE 
J065015F17CAAGTGGGCTTTNONE 
J065062G08CAAGTGGGCTTTNONE 
J065132M07CAAGTGGGCTTTNONE 
J065155C12CAAGTGGGCTTTNONE 
J075055I08CAAGTGGGCTTTNONE 
J075140D07CAAGTGGGCTTTNONE 
J090055B21CAAGTGGGCTTTNONE 
J100031D23CAAGTGGGCTTTNONE 
Os04g0589600011-100-F04CAAGTGGGCCCACCNONE 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
AK098964CAAGTGGGCCCACCNONE 
AK100053CAAGTGGGCCCACCNONE 
Os04g0647900AK068809CCCACTTGLeucine rich repeat, N-terminal domain containing protein. 
J013160F13CCCACTTGNONE 
Os04g0649900006-036-D07TACGGCCCACTTGNONE 
013-084-F02TACGGCCCACTTGNONE 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
J100036B10TACGGCCCACTTGNONE 
J100058F04TACGGCCCACTTGNONE 
J100065C02TACGGCCCACTTGNONE 
Os04g0654700006-097-D06CAAGTGGGCCAANONE 
013-016-H01CAAGTGGGCCAANONE 
AB055495CAAGTGGGCCAANONE 
AF072849CAAGTGGGCCAANONE 
AK062107CAAGTGGGCCAANONE 
AK099088CAAGTGGGCCAASimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16CAAGTGGGCCAANONE 
J013038J23CAAGTGGGCCAANONE 
J013038L17CAAGTGGGCCAANONE 
J013038N18CAAGTGGGCCAANONE 
J013038O18CAAGTGGGCCAANONE 
J013124A09CAAGTGGGCCAANONE 
J023007N04CAAGTGGGCCAANONE 
J033023C02CAAGTGGGCCAANONE 
J033030M18CAAGTGGGCCAANONE 
J033068I09CAAGTGGGCCAANONE 
J033100E04CAAGTGGGCCAANONE 
J065153E19CAAGTGGGCCAANONE 
J065207I02CAAGTGGGCCAANONE 
J075007A07CAAGTGGGCCAANONE 
J075036M04CAAGTGGGCCAANONE 
J075147I03CAAGTGGGCCAANONE 
J075197L11CAAGTGGGCCAANONE 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065211M10ACATGGGCCCACTTGNONE 
J075175E21ACATGGGCCCACTTGNONE 
J090021C06ACATGGGCCCACTTGNONE 
J090032P15ACATGGGCCCACTTGNONE 
J090082E05ACATGGGCCCACTTGNONE 
J100090O11ACATGGGCCCACTTGNONE 
Os04g0687100006-102-H02CCCACTTGNONE 
006-117-F07CCCACTTGNONE 
AK061239CCCACTTGNONE 
AK073929CCCACTTGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
AY570726CCCACTTGNONE 
J023010H06CCCACTTGNONE 
J023014L04CCCACTTGNONE 
Os05g0113000AK067079CAAGTGGGCCCAACCAmino acid-binding ACT domain containing protein. 
Os05g0135200J100023D22CCCACTTGNONE 
J100049H03CCCACTTGNONE 
J100050K11CCCACTTGNONE 
J100053B03CCCACTTGHaem peroxidase family protein. 
J100072E18CCCACTTGNONE 
Os05g0367400AK108439CAAGTGGGThiamine pyrophosphokinase family protein. 
Os05g0414400AK102320CAAGTGGGCCCTNONE 
AK119358CAAGTGGGCCCTProtein of unknown function DUF659 domain containing protein. 
Os05g0476000AK073548CAAGTGGGConserved hypothetical protein. 
J033044C05CAAGTGGGNONE 
J033126E14CAAGTGGGNONE 
Os05g0506300006-067-B02CAAGTGGGNONE 
009-058-F09CAAGTGGGNONE 
AK061071CAAGTGGGConserved hypothetical protein. 
Os05g0509400AK108053CAAGTGGGCCCCACASimilar to DNA binding protein-like. 
Os05g0551100AK066555CCCACTTGConserved hypothetical protein. 
Os05g0551700AK071216CGGGTCCCCCACTTGtRNA isopentenyltransferase family protein. 
Os06g0101300013-080-G09GGCCCCACTTGNONE 
015-006-A01GGCCCCACTTGNONE 
015-044-F09GGCCCCACTTGNONE 
AK109515GGCCCCACTTGZinc finger, RING-type domain containing protein. 
AK121897GGCCCCACTTGNONE 
J033084O06GGCCCCACTTGNONE 
J033105E24GGCCCCACTTGNONE 
J033126H24GGCCCCACTTGNONE 
J065001F05GGCCCCACTTGNONE 
J065002H03GGCCCCACTTGNONE 
J065026B12GGCCCCACTTGNONE 
J065093E11GGCCCCACTTGNONE 
J065122E04GGCCCCACTTGNONE 
J065164O07GGCCCCACTTGNONE 
J065182M16GGCCCCACTTGNONE 
J065217N11GGCCCCACTTGNONE 
J090002P22GGCCCCACTTGNONE 
Os06g0194400AK102980CACTGACAAGTGGGCCCACTTranscriptional factor B3 family protein. 
Os06g0215100J090029F19CAAGTGGGProtein of unknown function DUF1645 family protein. 
Os06g0270900011-086-B03CAAGTGGGCCCCACANONE 
012-051-A02CAAGTGGGCCCCACANONE 
016-033-F07CAAGTGGGCCCCACANONE 
AB044537CAAGTGGGCCCCACANONE 
AF162665CAAGTGGGCCCCACANONE 
AK073079CAAGTGGGCCCCACASimilar to RF2 (EC 1.2.1.3) (T cytoplasm male sterility restorer factor 2). 
AK099248CAAGTGGGCCCCACANONE 
AK120296CAAGTGGGCCCCACANONE 
J013151K07CAAGTGGGCCCCACANONE 
J013156A10CAAGTGGGCCCCACANONE 
J023014D24CAAGTGGGCCCCACANONE 
J023148F09CAAGTGGGCCCCACANONE 
J033113C09CAAGTGGGCCCCACANONE 
J065138H22CAAGTGGGCCCCACANONE 
J090037C14CAAGTGGGCCCCACANONE 
J090053A17CAAGTGGGCCCCACANONE 
J090066L02CAAGTGGGCCCCACANONE 
J100017N17CAAGTGGGCCCCACANONE 
J100040I08CAAGTGGGCCCCACANONE 
Os06g0524500AK066466CAAGTGGGGCCConserved hypothetical protein. 
J065038H02CAAGTGGGGCCNONE 
J065052P14CAAGTGGGGCCNONE 
J065079D13CAAGTGGGGCCNONE 
J090002E19CAAGTGGGGCCNONE 
Os06g0683200AK060024CAAGTGGGCCAASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CAAGTGGGCCAANONE 
J023002B12CAAGTGGGCCAANONE 
J023054E10CAAGTGGGCCAANONE 
J023123F19CAAGTGGGCCAANONE 
J065035K13CAAGTGGGCCAANONE 
J065129P09CAAGTGGGCCAANONE 
J065184B14CAAGTGGGCCAANONE 
Os06g0714900AK071975CAAGTGGGAGACGCGNONE 
AK105337CAAGTGGGAGACGCGProtein kinase-like domain containing protein. 
Os07g0121000AK072975GGGCCGAAGAGGCCCACTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J023148M03GGGCCGAAGAGGCCCACTTGNONE 
Os07g0169600006-027-F04GGGGCCCACTTGNONE 
006-043-C10GGGGCCCACTTGNONE 
006-070-A04GGGGCCCACTTGNONE 
006-081-F03GGGGCCCACTTGNONE 
006-104-F02GGGGCCCACTTGNONE 
012-006-D12GGGGCCCACTTGNONE 
AK060318GGGGCCCACTTGNONE 
AK121818GGGGCCCACTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01GGGGCCCACTTGNONE 
J023086G17GGGGCCCACTTGNONE 
J023093G16GGGGCCCACTTGNONE 
J033024N04GGGGCCCACTTGNONE 
J033099A15GGGGCCCACTTGNONE 
J033107B14GGGGCCCACTTGNONE 
J043026F14GGGGCCCACTTGNONE 
J065043P20GGGGCCCACTTGNONE 
J075118L16GGGGCCCACTTGNONE 
J075162M22GGGGCCCACTTGNONE 
J080004K13GGGGCCCACTTGNONE 
J080024D10GGGGCCCACTTGNONE 
J080037C21GGGGCCCACTTGNONE 
J080039M17GGGGCCCACTTGNONE 
J080040A03GGGGCCCACTTGNONE 
J080044A07GGGGCCCACTTGNONE 
J080045I07GGGGCCCACTTGNONE 
J080052L06GGGGCCCACTTGNONE 
J080053A20GGGGCCCACTTGNONE 
J080060L15GGGGCCCACTTGNONE 
J080060N22GGGGCCCACTTGNONE 
J080062L23GGGGCCCACTTGNONE 
J080069B19GGGGCCCACTTGNONE 
J080086K15GGGGCCCACTTGNONE 
J080089H16GGGGCCCACTTGNONE 
J080089I23GGGGCCCACTTGNONE 
J080094P07GGGGCCCACTTGNONE 
J090032L18GGGGCCCACTTGNONE 
J100044E09GGGGCCCACTTGNONE 
J100045O03GGGGCCCACTTGNONE 
J100066B11GGGGCCCACTTGNONE 
J100069J24GGGGCCCACTTGNONE 
Os07g0181800AK121080TGTGGGCCCCACTTGTCTGGCCCConserved hypothetical protein. 
J023063D04TGTGGGCCCCACTTGTCTGGCCCNONE 
J033084A07TGTGGGCCCCACTTGTCTGGCCCNONE 
J075013C04TGTGGGCCCCACTTGTCTGGCCCNONE 
J075027H13TGTGGGCCCCACTTGTCTGGCCCNONE 
J075045P19TGTGGGCCCCACTTGTCTGGCCCNONE 
J090042L13TGTGGGCCCCACTTGTCTGGCCCNONE 
J090098E10TGTGGGCCCCACTTGTCTGGCCCNONE 
Os07g0198300006-052-H02CCCACTTGNONE 
009-097-B09CCCACTTGNONE 
009-116-E02CCCACTTGNONE 
009-186-A12CCCACTTGNONE 
AK060951CCCACTTGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830CCCACTTGNONE 
J023117F24CCCACTTGNONE 
J065073D24CCCACTTGNONE 
J065116O11CCCACTTGNONE 
J065122C11CCCACTTGNONE 
Os07g0240300AK072205CCCACTTGConserved hypothetical protein. 
AK098977CCCACTTGNONE 
Os07g0245100J023048C16CAAGTGGGGCCGGGNONE 
J023048C16CCATGGGCCCACTTGNONE 
J023110L14CAAGTGGGGCCGGGNONE 
J023110L14CCATGGGCCCACTTGNONE 
J053023B18CAAGTGGGGCCGGGNONE 
J053023B18CCATGGGCCCACTTGNONE 
J053031L17CAAGTGGGGCCGGGNONE 
J053031L17CCATGGGCCCACTTGNONE 
J065035I22CAAGTGGGGCCGGGNONE 
J065035I22CCATGGGCCCACTTGNONE 
J065043D21CAAGTGGGGCCGGGNONE 
J065043D21CCATGGGCCCACTTGNONE 
J065072L16CAAGTGGGGCCGGGNONE 
J065072L16CCATGGGCCCACTTGNONE 
J065214I23CAAGTGGGGCCGGGNONE 
J065214I23CCATGGGCCCACTTGNONE 
Os07g0408700004-019-E03CAAGTGGGACCCACNONE 
015-093-D01CAAGTGGGACCCACNONE 
AJ251298CAAGTGGGACCCACNONE 
AK060916CAAGTGGGACCCACNONE 
AK099606CAAGTGGGACCCACSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2). 
J013052G01CAAGTGGGACCCACNONE 
Os07g0495000015-070-F12CAAGTGGGGCCCACCTNONE 
AK060721CAAGTGGGGCCCACCTNONE 
AK073883CAAGTGGGGCCCACCTCupin, RmlC-type domain containing protein. 
AK119204CAAGTGGGGCCCACCTNONE 
J033071H20CAAGTGGGGCCCACCTNONE 
J090079B04CAAGTGGGGCCCACCTNONE 
Os07g0501900AK067791CACTGACAAGTGGGCCCCANONE 
AK120759CACTGACAAGTGGGCCCCANONE 
Os07g0504601J065068H15CAAGTGGGConserved hypothetical protein. 
J065095H08CAAGTGGGNONE 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
Os07g0656400011-061-F11CAAGTGGGConserved hypothetical protein. 
Os07g0670300006-085-D04CAAGTGGGTCCCACTCCNONE 
006-116-A08CAAGTGGGTCCCACTCCNONE 
AK061154CAAGTGGGTCCCACTCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK099020CAAGTGGGTCCCACTCCNONE 
J100056C05CAAGTGGGTCCCACTCCNONE 
Os08g0108100AK070037CCCACTTGPectinesterase inhibitor domain containing protein. 
J065163O22CCCACTTGNONE 
J065166N23CCCACTTGNONE 
Os08g0115800AK109860CCCACTTGSimilar to NAM (No apical meristem)-like protein (No apical meristem family protein). 
Os08g0126500AK110941GCCCCACGTATGGCCCACTTGProtein of unknown function DUF295 family protein. 
Os08g0143400015-006-A10CACTGACAAGTGGGACCCACNONE 
AK066792CACTGACAAGTGGGACCCACNONE 
AK120532CACTGACAAGTGGGACCCACSWIRM domain containing protein. 
J100083F02CACTGACAAGTGGGACCCACNONE 
Os08g0150800AK101530CTTGGGCCCACTTGSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0192900AK103422CCCACTTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CCCACTTGNONE 
Os08g0282000016-023-A09CAAGTGGGTGGGTCCNONE 
AK101411CAAGTGGGTGGGTCCCD9/CD37/CD63 antigen family protein. 
J033037J09CAAGTGGGTGGGTCCNONE 
J090047I07CAAGTGGGTGGGTCCNONE 
J100021H13CAAGTGGGTGGGTCCNONE 
Os08g0282400AK100935CCCACTTGSimilar to Alpha-SNAP (Fragment). 
Os08g0319900AK108030CAAGTGGGCCCCPutative cyclase family protein. 
Os08g0322600AK069839CAAGTGGGSimilar to PGT-2. 
AK119582CAAGTGGGNONE 
J023031A12CAAGTGGGNONE 
Os08g0337300AK099602CAAGTGGGNONE 
Os08g0557200AK108300CCCACTTGMetallophosphoesterase domain containing protein. 
Os09g0380400009-200-D01GACAGGTGGGTCCCACTTGNONE 
AK063909GACAGGTGGGTCCCACTTGNONE 
AK072517GACAGGTGGGTCCCACTTGConserved hypothetical protein. 
AK073073GACAGGTGGGTCCCACTTGNONE 
J065205F20GACAGGTGGGTCCCACTTGNONE 
J100036D22GACAGGTGGGTCCCACTTGNONE 
J100047M01GACAGGTGGGTCCCACTTGNONE 
J100071G04GACAGGTGGGTCCCACTTGNONE 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
Os09g0513900AK107699CAAGTGGGConserved hypothetical protein. 
Os09g0514400004-013-A02CAAGTGGGNONE 
AK060892CAAGTGGGSimilar to Protein farnesyltransferase/geranylgeranyltransferase type I alpha subunit (EC 2.5.1.58) (EC 2.5.1.59) (CAAX farnesyltransferase alpha subunit) (Ras proteins prenyltransferase alpha) (FTase-alpha) (Type I protein geranyl-geranyltransferase alpha subunit) (GGTase-I-alpha). 
AK098845CAAGTGGGNONE 
AK104483CAAGTGGGNONE 
J013000C07CAAGTGGGNONE 
Os09g0572900AK069270CAAGTGGGCCCCSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399GGGGCCCACTTGProtein prenyltransferase domain containing protein. 
Os11g0109500015-062-C02CCCACTTGNONE 
AK064326CCCACTTGStaphylococcus nuclease (SNase-like) domain containing protein. 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0176000AK105568CAAGTGGGWD40-like domain containing protein. 
Os11g0298400AK068577CAAGTGGGCCAARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0459200AK070697CAAGTGGGConserved hypothetical protein. 
Os11g0697400J065021C03AGGGCCCACTTGNONE 
J065022A14AGGGCCCACTTGNONE 
J065024I05AGGGCCCACTTGHypothetical protein. 
J065031A20AGGGCCCACTTGNONE 
J065046D17AGGGCCCACTTGNONE 
J065060A09AGGGCCCACTTGNONE 
J065078H18AGGGCCCACTTGNONE 
J065088L16AGGGCCCACTTGNONE 
J065134F20AGGGCCCACTTGNONE 
J065139F22AGGGCCCACTTGNONE 
J065149C20AGGGCCCACTTGNONE 
J065164L09AGGGCCCACTTGNONE 
J065167K11AGGGCCCACTTGNONE 
J065178O09AGGGCCCACTTGNONE 
J065185M03AGGGCCCACTTGNONE 
J065188H02AGGGCCCACTTGNONE 
J065203C12AGGGCCCACTTGNONE 
J075013G16AGGGCCCACTTGNONE 
J075046J24AGGGCCCACTTGNONE 
J075062A07AGGGCCCACTTGNONE 
J075083F01AGGGCCCACTTGNONE 
J075110I16AGGGCCCACTTGNONE 
J075132E17AGGGCCCACTTGNONE 
J075150H03AGGGCCCACTTGNONE 
J075166H11AGGGCCCACTTGNONE 
J080001H24AGGGCCCACTTGNONE 
J080001O03AGGGCCCACTTGNONE 
J080025J03AGGGCCCACTTGNONE 
J080027H04AGGGCCCACTTGNONE 
J080034B17AGGGCCCACTTGNONE 
J080037K21AGGGCCCACTTGNONE 
J080042A08AGGGCCCACTTGNONE 
J080054D03AGGGCCCACTTGNONE 
J080054M18AGGGCCCACTTGNONE 
J080068K02AGGGCCCACTTGNONE 
J080070E24AGGGCCCACTTGNONE 
J080317K04AGGGCCCACTTGNONE 
Os11g0703900011-004-D05GACGGCCCACTTGNONE 
011-014-C03GACGGCCCACTTGNONE 
011-016-C01GACGGCCCACTTGNONE 
011-017-B04GACGGCCCACTTGNONE 
011-017-E09GACGGCCCACTTGNONE 
011-019-E12GACGGCCCACTTGNONE 
011-021-H12GACGGCCCACTTGNONE 
011-025-H02GACGGCCCACTTGNONE 
011-027-B09GACGGCCCACTTGNONE 
011-039-G07GACGGCCCACTTGNONE 
011-044-G07GACGGCCCACTTGNONE 
011-046-F11GACGGCCCACTTGNONE 
011-070-F02GACGGCCCACTTGNONE 
011-071-A07GACGGCCCACTTGNONE 
011-082-A03GACGGCCCACTTGNONE 
011-086-B09GACGGCCCACTTGNONE 
011-092-C04GACGGCCCACTTGNONE 
012-006-F02GACGGCCCACTTGNONE 
012-011-G08GACGGCCCACTTGNONE 
012-026-C06GACGGCCCACTTGNONE 
012-026-G06GACGGCCCACTTGNONE 
012-028-E05GACGGCCCACTTGNONE 
012-040-A05GACGGCCCACTTGNONE 
012-045-C01GACGGCCCACTTGNONE 
012-046-A10GACGGCCCACTTGNONE 
012-047-H09GACGGCCCACTTGNONE 
012-059-A12GACGGCCCACTTGNONE 
012-072-D06GACGGCCCACTTGNONE 
012-073-D05GACGGCCCACTTGNONE 
012-076-D08GACGGCCCACTTGNONE 
012-079-G05GACGGCCCACTTGNONE 
012-080-A04GACGGCCCACTTGNONE 
012-080-E01GACGGCCCACTTGNONE 
012-083-C03GACGGCCCACTTGNONE 
012-083-G06GACGGCCCACTTGNONE 
012-086-G02GACGGCCCACTTGNONE 
012-091-A07GACGGCCCACTTGNONE 
012-094-G10GACGGCCCACTTGNONE 
012-098-A07GACGGCCCACTTGNONE 
012-100-G04GACGGCCCACTTGNONE 
015-001-A11GACGGCCCACTTGNONE 
015-033-E01GACGGCCCACTTGNONE 
015-047-F12GACGGCCCACTTGNONE 
015-054-E05GACGGCCCACTTGNONE 
015-063-H02GACGGCCCACTTGNONE 
015-075-E10GACGGCCCACTTGNONE 
015-086-F05GACGGCCCACTTGNONE 
016-031-A08GACGGCCCACTTGNONE 
016-053-A03GACGGCCCACTTGNONE 
016-054-C09GACGGCCCACTTGNONE 
016-079-C08GACGGCCCACTTGNONE 
AK065431GACGGCCCACTTGHeat shock protein 70. 
AK119255GACGGCCCACTTGNONE 
J013021C12GACGGCCCACTTGNONE 
J013021C17GACGGCCCACTTGNONE 
J023027B08GACGGCCCACTTGNONE 
J023078A21GACGGCCCACTTGNONE 
J023097M06GACGGCCCACTTGNONE 
J023100O04GACGGCCCACTTGNONE 
J023107B17GACGGCCCACTTGNONE 
J023108L24GACGGCCCACTTGNONE 
J023109L05GACGGCCCACTTGNONE 
J033022M22GACGGCCCACTTGNONE 
J033023K21GACGGCCCACTTGNONE 
J033031L11GACGGCCCACTTGNONE 
J033034H10GACGGCCCACTTGNONE 
J033037B16GACGGCCCACTTGNONE 
J033037F16GACGGCCCACTTGNONE 
J033037H07GACGGCCCACTTGNONE 
J033046E22GACGGCCCACTTGNONE 
J033050N12GACGGCCCACTTGNONE 
J033064F10GACGGCCCACTTGNONE 
J033064N10GACGGCCCACTTGNONE 
J033066O09GACGGCCCACTTGNONE 
J033068H01GACGGCCCACTTGNONE 
J033068J07GACGGCCCACTTGNONE 
J033070B10GACGGCCCACTTGNONE 
J033070G13GACGGCCCACTTGNONE 
J033073O13GACGGCCCACTTGNONE 
J033075B07GACGGCCCACTTGNONE 
J033079L15GACGGCCCACTTGNONE 
J033081J06GACGGCCCACTTGNONE 
J033086G13GACGGCCCACTTGNONE 
J033086N07GACGGCCCACTTGNONE 
J033086O05GACGGCCCACTTGNONE 
J033091A15GACGGCCCACTTGNONE 
J033091D05GACGGCCCACTTGNONE 
J033094C12GACGGCCCACTTGNONE 
J033099P03GACGGCCCACTTGNONE 
J033107L09GACGGCCCACTTGNONE 
J033108D16GACGGCCCACTTGNONE 
J033109E12GACGGCCCACTTGNONE 
J033109K14GACGGCCCACTTGNONE 
J033112P22GACGGCCCACTTGNONE 
J033116F12GACGGCCCACTTGNONE 
J033116K01GACGGCCCACTTGNONE 
J033118F19GACGGCCCACTTGNONE 
J033121J10GACGGCCCACTTGNONE 
J033126H04GACGGCCCACTTGNONE 
J033131G17GACGGCCCACTTGNONE 
J033131L05GACGGCCCACTTGNONE 
J033136A08GACGGCCCACTTGNONE 
J033136H22GACGGCCCACTTGNONE 
J033143F01GACGGCCCACTTGNONE 
J065040M10GACGGCCCACTTGNONE 
J065046F17GACGGCCCACTTGNONE 
J065048G20GACGGCCCACTTGNONE 
J065071N06GACGGCCCACTTGNONE 
J065084I24GACGGCCCACTTGNONE 
J065171B01GACGGCCCACTTGNONE 
J065191J21GACGGCCCACTTGNONE 
J065199I20GACGGCCCACTTGNONE 
J075076C02GACGGCCCACTTGNONE 
J090002P12GACGGCCCACTTGNONE 
J090003A11GACGGCCCACTTGNONE 
J090003H11GACGGCCCACTTGNONE 
J090009M22GACGGCCCACTTGNONE 
J090009O11GACGGCCCACTTGNONE 
J090014N09GACGGCCCACTTGNONE 
J090015A18GACGGCCCACTTGNONE 
J090016E16GACGGCCCACTTGNONE 
J090016I07GACGGCCCACTTGNONE 
J090017O07GACGGCCCACTTGNONE 
J090019E10GACGGCCCACTTGNONE 
J090020D24GACGGCCCACTTGNONE 
J090021M16GACGGCCCACTTGNONE 
J090022F13GACGGCCCACTTGNONE 
J090023H03GACGGCCCACTTGNONE 
J090024E15GACGGCCCACTTGNONE 
J090024G19GACGGCCCACTTGNONE 
J090026J19GACGGCCCACTTGNONE 
J090030E20GACGGCCCACTTGNONE 
J090030I15GACGGCCCACTTGNONE 
J090032F04GACGGCCCACTTGNONE 
J090033N22GACGGCCCACTTGNONE 
J090033O19GACGGCCCACTTGNONE 
J090036F08GACGGCCCACTTGNONE 
J090039A13GACGGCCCACTTGNONE 
J090042N07GACGGCCCACTTGNONE 
J090043C15GACGGCCCACTTGNONE 
J090043N09GACGGCCCACTTGNONE 
J090053J10GACGGCCCACTTGNONE 
J090054F14GACGGCCCACTTGNONE 
J090057N12GACGGCCCACTTGNONE 
J090061P13GACGGCCCACTTGNONE 
J090062F17GACGGCCCACTTGNONE 
J090065H15GACGGCCCACTTGNONE 
J090067P11GACGGCCCACTTGNONE 
J090068M09GACGGCCCACTTGNONE 
J090069E24GACGGCCCACTTGNONE 
J090069K16GACGGCCCACTTGNONE 
J090070N07GACGGCCCACTTGNONE 
J090072M09GACGGCCCACTTGNONE 
J090075I24GACGGCCCACTTGNONE 
J090075M04GACGGCCCACTTGNONE 
J090077D24GACGGCCCACTTGNONE 
J090080M17GACGGCCCACTTGNONE 
J090080O14GACGGCCCACTTGNONE 
J090081C12GACGGCCCACTTGNONE 
J090084N21GACGGCCCACTTGNONE 
J090084O21GACGGCCCACTTGNONE 
J090087J18GACGGCCCACTTGNONE 
J090092L17GACGGCCCACTTGNONE 
J090097A08GACGGCCCACTTGNONE 
J100017E24GACGGCCCACTTGNONE 
J100018K11GACGGCCCACTTGNONE 
J100019A16GACGGCCCACTTGNONE 
J100023I23GACGGCCCACTTGNONE 
J100024D07GACGGCCCACTTGNONE 
J100025H12GACGGCCCACTTGNONE 
J100027K19GACGGCCCACTTGNONE 
J100028C23GACGGCCCACTTGNONE 
J100029A14GACGGCCCACTTGNONE 
J100029O19GACGGCCCACTTGNONE 
J100030I09GACGGCCCACTTGNONE 
J100030J16GACGGCCCACTTGNONE 
J100031C01GACGGCCCACTTGNONE 
J100031N06GACGGCCCACTTGNONE 
J100033H04GACGGCCCACTTGNONE 
J100034L20GACGGCCCACTTGNONE 
J100036K13GACGGCCCACTTGNONE 
J100039M02GACGGCCCACTTGNONE 
J100040J01GACGGCCCACTTGNONE 
J100042O21GACGGCCCACTTGNONE 
J100042P20GACGGCCCACTTGNONE 
J100047K22GACGGCCCACTTGNONE 
J100049B16GACGGCCCACTTGNONE 
J100052M10GACGGCCCACTTGNONE 
J100053B05GACGGCCCACTTGNONE 
J100053B20GACGGCCCACTTGNONE 
J100055I11GACGGCCCACTTGNONE 
J100056A13GACGGCCCACTTGNONE 
J100057C08GACGGCCCACTTGNONE 
J100057N11GACGGCCCACTTGNONE 
J100057P07GACGGCCCACTTGNONE 
J100059E16GACGGCCCACTTGNONE 
J100063N14GACGGCCCACTTGNONE 
J100069H01GACGGCCCACTTGNONE 
J100071C17GACGGCCCACTTGNONE 
J100071K09GACGGCCCACTTGNONE 
J100077D07GACGGCCCACTTGNONE 
J100078P22GACGGCCCACTTGNONE 
J100080F11GACGGCCCACTTGNONE 
J100081L07GACGGCCCACTTGNONE 
J100083B10GACGGCCCACTTGNONE 
J100083K17GACGGCCCACTTGNONE 
J100085B22GACGGCCCACTTGNONE 
J100085L21GACGGCCCACTTGNONE 
J100086B11GACGGCCCACTTGNONE 
J100087E06GACGGCCCACTTGNONE 
J100087P07GACGGCCCACTTGNONE 
J100089H24GACGGCCCACTTGNONE 
Os12g0108500AK122171CCCACTTGCyclin-like F-box domain containing protein. 
Os12g0109200AK103380CCCACTTGSimilar to Ca(2+)-dependent nuclease. 
J033127E15CCCACTTGNONE 
J090085H16CCCACTTGNONE 
Os12g0151500AK058389CCCACTTGSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CCCACTTGNONE 
Os12g0175400009-157-A08CAAGTGGGACCCACTCCNONE 
011-089-A10CAAGTGGGACCCACTCCNONE 
AK063027CAAGTGGGACCCACTCCNONE 
D88618CAAGTGGGACCCACTCCHomeodomain-like containing protein. 
Os12g0413201J065083D05GGACCCACTTGNONE 
J065095J19GGACCCACTTGNONE 
J065118H21GGACCCACTTGNONE 
J065162E19GGACCCACTTGNONE 
J065196J19GGACCCACTTGConserved hypothetical protein. 
J065196M07GGACCCACTTGNONE 
J075041N09GGACCCACTTGNONE 
J075054K04GGACCCACTTGNONE 
Os12g0507600009-155-B05TCCGGCCCACTTGTCGGCCCATGANONE 
AK070613TCCGGCCCACTTGTCGGCCCATGAConserved hypothetical protein. 
J023063G03TCCGGCCCACTTGTCGGCCCATGANONE 
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein. 
J013158L10ACCGGCCCATCCACCCACTTGNONE 
J065083J02ACCGGCCCATCCACCCACTTGNONE 
J075079D02ACCGGCCCATCCACCCACTTGNONE 
J100037H16ACCGGCCCATCCACCCACTTGNONE 
J100075P13ACCGGCCCATCCACCCACTTGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.