version

Summary of OsREG499 (All List)

OrganismOryza sativa  
IDOsREG499  
SequenceCACACACC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1132  

Entry Sequences (1132 entries)

LocusGene modelSequenceDescription
Os01g0222700009-031-G02CACACACCNONE 
009-033-G12CACACACCNONE 
009-033-H11CACACACCNONE 
009-035-E10CACACACCNONE 
009-055-G02CACACACCNONE 
009-099-D04CACACACCNONE 
009-102-D04CACACACCNONE 
009-106-H11CACACACCNONE 
009-128-D01CACACACCNONE 
009-136-D06CACACACCNONE 
009-138-E08CACACACCNONE 
009-144-F01CACACACCNONE 
009-151-B02CACACACCNONE 
009-161-C09CACACACCNONE 
009-165-F03CACACACCNONE 
009-174-A02CACACACCNONE 
009-180-E12CACACACCNONE 
009-190-H06CACACACCNONE 
013-068-G04CACACACCNONE 
016-031-B06CACACACCNONE 
AK121276CACACACCNONE 
J013153J15CACACACCNONE 
J023107H23CACACACCNONE 
J065042L22CACACACCNONE 
J065065H04CACACACCNONE 
J065066E12CACACACCNONE 
J065141H05CACACACCNONE 
J075086C16CACACACCNONE 
J075094J10CACACACCNONE 
J075130A15CACACACCNONE 
J075149N13CACACACCNONE 
J075179H08CACACACCNONE 
J075191H11CACACACCNONE 
J080010J01CACACACCNONE 
Os01g0222900J065200K10GGTGTGTGCurculin-like (mannose-binding) lectin domain containing protein. 
Os01g0242200AK107468GGTGTGTGZinc finger, C2H2-type domain containing protein. 
Os01g0249200006-022-H03CACACACCNONE 
006-036-F06CACACACCNONE 
006-060-A10CACACACCNONE 
006-083-D05CACACACCNONE 
006-086-A07CACACACCNONE 
006-091-B12CACACACCNONE 
009-104-G06CACACACCNONE 
009-112-C06CACACACCNONE 
009-135-H08CACACACCNONE 
009-144-D05CACACACCNONE 
AK061046CACACACCSimilar to Nectarin 1 precursor (EC 1.15.1.1) (Superoxide dismutase [Mn]). 
J065043L18CACACACCNONE 
J075015O18CACACACCNONE 
Os01g0613800AK110832CACACACCPeptidase C1A, papain family protein. 
J100028O13CACACACCNONE 
J100087H15CACACACCNONE 
Os01g0689900AK064656CACACACCNONE 
AK102164CACACACCProtein kinase-like domain containing protein. 
J033043D15CACACACCNONE 
J033060J20CACACACCNONE 
J033086H03CACACACCNONE 
J033117B10CACACACCNONE 
J053023O03CACACACCNONE 
J053055P21CACACACCNONE 
J053078A20CACACACCNONE 
J053082K03CACACACCNONE 
J053086A16CACACACCNONE 
J080027C22CACACACCNONE 
J080062G19CACACACCNONE 
J080065M03CACACACCNONE 
J100068P17CACACACCNONE 
Os01g0690800AK066430CACACACCProtein kinase-like domain containing protein. 
AK073248CACACACCNONE 
J065001D22CACACACCNONE 
J065116J04CACACACCNONE 
J100044K03CACACACCNONE 
Os01g0693400015-096-D03CACACACCNONE 
J065109K09CACACACCTranscriptional factor B3 family protein. 
J075002K23CACACACCNONE 
J075083L02CACACACCNONE 
J075097P17CACACACCNONE 
J100025E16CACACACCNONE 
J100055O20CACACACCNONE 
J100068B21CACACACCNONE 
Os01g0765300AK101759CACACACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0775600AK060390GGTGTGTGNONE 
AK122081GGTGTGTGLissencephaly type-1-like homology motif domain containing protein. 
Os01g0844200AK109255CACACACCDVL family protein. 
Os01g0885600AK059523CACACACCEsterase/lipase/thioesterase domain containing protein. 
J065013G01CACACACCNONE 
J065063D03CACACACCNONE 
J065143H01CACACACCNONE 
J065146F08CACACACCNONE 
J065153D14CACACACCNONE 
J065170E02CACACACCNONE 
J065175M22CACACACCNONE 
J065186E13CACACACCNONE 
J075023J16CACACACCNONE 
J075176J06CACACACCNONE 
Os02g0179200AK111348CACACACCGlutamine amidotransferase class-I domain containing protein. 
J065218O07CACACACCNONE 
Os02g0199900AB033536CACACACCNONE 
AK099357CACACACCSimilar to 26S proteasome regulatory complex subunit p42D. 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0221900AK064029GGTGTGTGNONE 
AK122077GGTGTGTGNONE 
AK122138GGTGTGTGCytochrome P450 family protein. 
Os02g0497700011-094-A10GGTGTGTGNONE 
012-073-H02GGTGTGTGNONE 
016-056-G05GGTGTGTGNONE 
AK070143GGTGTGTGNONE 
J023041O14GGTGTGTGNONE 
J023092H01GGTGTGTGNONE 
J033048A17GGTGTGTGNONE 
J033051K21GGTGTGTGNONE 
J033122D01GGTGTGTGNONE 
J090032E23GGTGTGTGNONE 
J090055K13GGTGTGTGNONE 
Os02g0551600009-174-H09CACACACCNONE 
AK063102CACACACCConserved hypothetical protein. 
Os02g0593600AK069976GGTGTGTGLeucine-rich repeat, typical subtype containing protein. 
Os02g0595800Os02g0595800CACACACCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0605600016-017-B02GGTGTGTGGGGNONE 
AK066104GGTGTGTGGGGLUC7 related family protein. 
J013052G16GGTGTGTGGGGNONE 
J043022E03GGTGTGTGGGGNONE 
J065105P10GGTGTGTGGGGNONE 
Os02g0630300AK108598CACACACCCCCACACNONE 
Os02g0663800AK069605CACACACCSimilar to Actin-depolymerizing factor (ADF). 
J023022O15CACACACCNONE 
J023138H18CACACACCNONE 
Os02g0663900AK068885CACACACCSimilar to Phosphoribosyltransferase (Fragment). 
Os02g0675000AK109532CACACACCConserved hypothetical protein. 
Os02g0682200AK069103GGTGTGTGSimilar to MADS box protein. 
J023006N09GGTGTGTGNONE 
J023055B08GGTGTGTGNONE 
J023103J04GGTGTGTGNONE 
J023122I21GGTGTGTGNONE 
J023146H12GGTGTGTGNONE 
J090033B14GGTGTGTGNONE 
J090088D07GGTGTGTGNONE 
U78782GGTGTGTGNONE 
Os02g0715300006-052-F10CACACACCNONE 
006-099-G08CACACACCNONE 
006-120-A02CACACACCNONE 
009-114-D11CACACACCNONE 
009-134-G11CACACACCNONE 
009-151-H05CACACACCNONE 
009-194-A09CACACACCNONE 
AK059816CACACACCConserved hypothetical protein. 
AK069489CACACACCNONE 
J023024J01CACACACCNONE 
J065087M04CACACACCNONE 
J065089E20CACACACCNONE 
J065137K15CACACACCNONE 
Os02g0811000AK111446CACACACCProtein of unknown function DUF640 domain containing protein. 
Os02g0819600AK062188GGTGTGTGProtein kinase domain containing protein. 
AK098868GGTGTGTGNONE 
Os03g0112800AK100572GGTGTGTGProtein of unknown function DUF726 family protein. 
Os03g0124200AK102524CACACACCSimilar to Pto-like protein kinase F. 
AK105735CACACACCNONE 
J033096A14CACACACCNONE 
J090082I09CACACACCNONE 
Os03g0152900Os03g0152900CACACACCKinesin, motor region domain containing protein. 
Os03g0160200AK064836CACACACCConserved hypothetical protein. 
AK071081CACACACCNONE 
AK100712CACACACCNONE 
AK104859CACACACCNONE 
J013000F21CACACACCNONE 
J013024G05CACACACCNONE 
J013035E12CACACACCNONE 
J013041A17CACACACCNONE 
J013045D10CACACACCNONE 
J013045F04CACACACCNONE 
J013046F04CACACACCNONE 
J013047F10CACACACCNONE 
J013051E10CACACACCNONE 
J013059J07CACACACCNONE 
J013059O17CACACACCNONE 
J013060A20CACACACCNONE 
J013063J23CACACACCNONE 
J013066D19CACACACCNONE 
J013069O08CACACACCNONE 
J013088K24CACACACCNONE 
J013098G04CACACACCNONE 
J013100I15CACACACCNONE 
J013102E18CACACACCNONE 
J013102O09CACACACCNONE 
J013119M18CACACACCNONE 
J013123I19CACACACCNONE 
J013146H15CACACACCNONE 
J013149A14CACACACCNONE 
J023003A05CACACACCNONE 
J023013O19CACACACCNONE 
J023044M05CACACACCNONE 
J023048O03CACACACCNONE 
J023049L17CACACACCNONE 
J023060D22CACACACCNONE 
J023060F20CACACACCNONE 
J023069G09CACACACCNONE 
J023086E11CACACACCNONE 
J023091I09CACACACCNONE 
J023091M19CACACACCNONE 
J023101D06CACACACCNONE 
J023109B03CACACACCNONE 
J023113B14CACACACCNONE 
J023114B19CACACACCNONE 
J023115H16CACACACCNONE 
J023134F22CACACACCNONE 
J023139I06CACACACCNONE 
J023150C02CACACACCNONE 
J033033A14CACACACCNONE 
J033058O11CACACACCNONE 
J033060H13CACACACCNONE 
J033075P14CACACACCNONE 
J033084O05CACACACCNONE 
J033087G04CACACACCNONE 
J033092E18CACACACCNONE 
J033101G23CACACACCNONE 
J033112I05CACACACCNONE 
J033118E14CACACACCNONE 
J033118P04CACACACCNONE 
J033123C07CACACACCNONE 
J043003C01CACACACCNONE 
J043024B21CACACACCNONE 
J043030N04CACACACCNONE 
J043039J02CACACACCNONE 
J043039N08CACACACCNONE 
J075006N21CACACACCNONE 
J075008A16CACACACCNONE 
J075018J16CACACACCNONE 
J075023G04CACACACCNONE 
J075134F18CACACACCNONE 
J075181B05CACACACCNONE 
J090014O14CACACACCNONE 
J090020H22CACACACCNONE 
J090022G17CACACACCNONE 
J090023J24CACACACCNONE 
J090033H01CACACACCNONE 
J090038A03CACACACCNONE 
J090041O22CACACACCNONE 
J090049E10CACACACCNONE 
J090063E24CACACACCNONE 
J090080N12CACACACCNONE 
J100021G23CACACACCNONE 
J100028P06CACACACCNONE 
J100060L21CACACACCNONE 
J100077D16CACACACCNONE 
J100088I09CACACACCNONE 
Os03g0188400AK107555TCTCGGCCACACACCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0197300AK102651CACACACCCupin, RmlC-type domain containing protein. 
Os03g0218200AK073971GGTGTGTGCyclin-like F-box domain containing protein. 
Os03g0232600AK068218CACACACCU box domain containing protein. 
J013114N10CACACACCNONE 
J013146E12CACACACCNONE 
J023034C23CACACACCNONE 
J033030J03CACACACCNONE 
J033050L03CACACACCNONE 
J033122E16CACACACCNONE 
J090018C20CACACACCNONE 
J090053P15CACACACCNONE 
J090096C17CACACACCNONE 
Os03g0261800AK060717AAATGGGCACACACCNONE 
AK060717CACACACCNONE 
AK060717GGTGTGTGTGTGGGGGGTNONE 
AK121181AAATGGGCACACACCConserved hypothetical protein. 
AK121181CACACACCConserved hypothetical protein. 
J023084D19AAATGGGCACACACCNONE 
J023084D19CACACACCNONE 
J065127D11AAATGGGCACACACCNONE 
J065127D11CACACACCNONE 
J065179G15AAATGGGCACACACCNONE 
J065179G15CACACACCNONE 
J090050I07AAATGGGCACACACCNONE 
J090050I07CACACACCNONE 
Os03g0270000006-051-C05GGTGTGTGNONE 
006-100-A03GGTGTGTGNONE 
006-114-F11GGTGTGTGNONE 
AK061579GGTGTGTGNONE 
AK106069GGTGTGTGProtein of unknown function DUF296 domain containing protein. 
J023102O16GGTGTGTGNONE 
J065017C10GGTGTGTGNONE 
J065059M01GGTGTGTGNONE 
J065104I08GGTGTGTGNONE 
J065120B10GGTGTGTGNONE 
J065130K08GGTGTGTGNONE 
J065140F09GGTGTGTGNONE 
J065166E07GGTGTGTGNONE 
Os03g0274000AK060769CACACACCOxysterol-binding protein family protein. 
Os03g0302900011-005-H01CACACACCNONE 
AK069222CACACACCConserved hypothetical protein. 
J023014L15CACACACCNONE 
J033023G12CACACACCNONE 
J090008H16CACACACCNONE 
Os03g0308100AB116073GGTGTGTGPeptidase S14, ClpP family protein. 
AK060518GGTGTGTGNONE 
AK099107GGTGTGTGNONE 
AK105977GGTGTGTGNONE 
J065005O19GGTGTGTGNONE 
J065007L02GGTGTGTGNONE 
J065128G15GGTGTGTGNONE 
J065128N14GGTGTGTGNONE 
J075010E21GGTGTGTGNONE 
J075101J24GGTGTGTGNONE 
J075124O14GGTGTGTGNONE 
J075126O07GGTGTGTGNONE 
Os03g0320800AK103265GCCCACACACCNONE 
Os03g0323100009-108-G02GGTGTGTGNONE 
AK062803GGTGTGTGHypothetical protein. 
AK070776GGTGTGTGNONE 
Os03g0323200AK067323CACACACCSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0328900AK102616GGTGTGTGZinc finger, CCCH-type domain containing protein. 
Os03g0366100AK103302CACACACCHypothetical protein. 
J033125C23CACACACCNONE 
Os03g0635800AK121696CACACACCProtein of unknown function DUF828, plant family protein. 
Os03g0640800AK060584GGTGTGTGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0673600009-011-C08CACACACCNONE 
009-033-C05CACACACCNONE 
AK062334CACACACCNONE 
AK068539CACACACCConserved hypothetical protein. 
Os03g0685000009-031-F08CACACACCNONE 
AK059896CACACACCSimilar to Ferredoxin. 
AK098989CACACACCNONE 
AK099303CACACACCNONE 
J065041E14CACACACCNONE 
J065085G22CACACACCNONE 
Os03g0698900013-074-A08CACACACCNONE 
AK073303CACACACCAlkaline phytoceramidase family protein. 
AK103953CACACACCNONE 
J033024P22CACACACCNONE 
J065194N16CACACACCNONE 
J065195O11CACACACCNONE 
J075020F03CACACACCNONE 
J075032P18CACACACCNONE 
J075037H13CACACACCNONE 
J075147I01CACACACCNONE 
J075187B13CACACACCNONE 
J100043G08CACACACCNONE 
J100060L06CACACACCNONE 
J100063O21CACACACCNONE 
J100066O13CACACACCNONE 
J100072K20CACACACCNONE 
J100083G21CACACACCNONE 
J100085D07CACACACCNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0710000006-023-G11CACACACCCGCGCNONE 
006-050-E05CACACACCCGCGCNONE 
AK060065CACACACCCGCGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364CACACACCCGCGCNONE 
AK104418CACACACCCGCGCNONE 
J033051P12CACACACCCGCGCNONE 
J065046L09CACACACCCGCGCNONE 
J075021F06CACACACCCGCGCNONE 
J075106P12CACACACCCGCGCNONE 
Os03g0712800AK063913GCAGCCCACACACACACCSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290GCAGCCCACACACACACCNONE 
J023127P21GCAGCCCACACACACACCNONE 
Os03g0758500016-015-D02CACACACCNONE 
AK059403CACACACCNONE 
AK102002CACACACCPlastocyanin-like domain containing protein. 
J033079N03CACACACCNONE 
J065012M05CACACACCNONE 
J065045H19CACACACCNONE 
J065050J08CACACACCNONE 
J075189D02CACACACCNONE 
J090018L03CACACACCNONE 
J100043O22CACACACCNONE 
J100088G17CACACACCNONE 
Os03g0773600AK103310GGTGTGTGGTGGGKinesin, motor region domain containing protein. 
Os03g0788600AK069046CACACACCBeta-Ig-H3/fasciclin domain containing protein. 
AK106114CACACACCNONE 
J023009K09CACACACCNONE 
J033022M06CACACACCNONE 
J033033H18CACACACCNONE 
J033098E16CACACACCNONE 
J065138K19CACACACCNONE 
J065163G19CACACACCNONE 
J090029F21CACACACCNONE 
J100031D24CACACACCNONE 
J100047O10CACACACCNONE 
J100052E07CACACACCNONE 
J100055F20CACACACCNONE 
J100055O09CACACACCNONE 
J100065I23CACACACCNONE 
Os03g0791700AK071881GGTGTGTGNONE 
AK100700GGTGTGTGProtein kinase domain containing protein. 
Os03g0801700AK069505CACACACCRiboflavin kinase / FAD synthetase family protein. 
J065102O06CACACACCNONE 
Os03g0821900AK070847CACACACCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0823800AK071234CACACACCSimilar to Permease 1. 
J075062C14CACACACCNONE 
J075135D03CACACACCNONE 
J075135E09CACACACCNONE 
J090001A09CACACACCNONE 
J090039N06CACACACCNONE 
J090050I17CACACACCNONE 
J090053L05CACACACCNONE 
J090064A07CACACACCNONE 
J090094M16CACACACCNONE 
Os03g0854800J090007D13CACACACCACGCGTCCNONE 
J090085N22CACACACCACGCGTCCNONE 
Os03g0857900006-028-G11GGTGTGTGNONE 
006-049-H11GGTGTGTGNONE 
006-096-A08GGTGTGTGNONE 
006-118-C04GGTGTGTGNONE 
009-035-G02GGTGTGTGNONE 
009-170-E03GGTGTGTGNONE 
AK059762GGTGTGTGNONE 
AK061341GGTGTGTGNONE 
AK071705GGTGTGTGSimilar to Lysine decarboxylase-like protein. 
AK104022GGTGTGTGNONE 
J023098F03GGTGTGTGNONE 
J065060N11GGTGTGTGNONE 
J065093A06GGTGTGTGNONE 
J065117J24GGTGTGTGNONE 
J065163O16GGTGTGTGNONE 
J065182K06GGTGTGTGNONE 
J065198J24GGTGTGTGNONE 
J075055M14GGTGTGTGNONE 
J075094O09GGTGTGTGNONE 
J075149I10GGTGTGTGNONE 
J075150F21GGTGTGTGNONE 
J075157O14GGTGTGTGNONE 
J075158C24GGTGTGTGNONE 
Os04g0119500AJ698084CACACACCNONE 
AK061898CACACACCNONE 
AK065035CACACACCSimilar to Membrane related protein-like. 
J013001H07CACACACCNONE 
J013128B11CACACACCNONE 
J013153L13CACACACCNONE 
J013157F08CACACACCNONE 
J065140L14CACACACCNONE 
J075147J12CACACACCNONE 
J090087C14CACACACCNONE 
J100048O09CACACACCNONE 
J100051O16CACACACCNONE 
J100083H22CACACACCNONE 
Os04g0316200AK110725GGTGTGTGProtein of unknown function DUF26 domain containing protein. 
AY576676GGTGTGTGNONE 
J100043J22GGTGTGTGNONE 
J100049F15GGTGTGTGNONE 
J100081M23GGTGTGTGNONE 
Os04g0322100J075093H10GGTGTGTGProtein of unknown function DUF26 domain containing protein. 
J100044L06GGTGTGTGNONE 
J100048J12GGTGTGTGNONE 
J100073D10GGTGTGTGNONE 
Os04g0405500011-007-D12CACACACCNONE 
AK063263CACACACCConserved hypothetical protein. 
J065166G19CACACACCNONE 
J075180M09CACACACCNONE 
Os04g0419600Os04g0419600CACACACCHistone H3. 
Os04g0437600AK061622CACACACCNONE 
Os04g0579700AK065545CACACACCSimilar to Predicted protein. 
J013034F23CACACACCNONE 
J023056P03CACACACCNONE 
J033108M23CACACACCNONE 
J065061L24CACACACCNONE 
J065062K23CACACACCNONE 
J090038B10CACACACCNONE 
J090043L24CACACACCNONE 
J090080J08CACACACCNONE 
J090082E14CACACACCNONE 
Os04g0627000AK101563GGTGTGTGNONE 
Os04g0679800AK060662CACACACCSimilar to RNA-binding protein-like protein. 
AK099987CACACACCNONE 
J013130B11CACACACCNONE 
J065049C17CACACACCNONE 
J075191N12CACACACCNONE 
J075191P12CACACACCNONE 
J100031C07CACACACCNONE 
Os04g0685300004-013-B09CACACACCNONE 
006-021-B12CACACACCNONE 
006-021-F10CACACACCNONE 
006-026-C01CACACACCNONE 
006-031-B06CACACACCNONE 
006-038-H03CACACACCNONE 
006-040-B07CACACACCNONE 
006-058-C03CACACACCNONE 
006-062-B02CACACACCNONE 
006-067-B11CACACACCNONE 
006-069-H12CACACACCNONE 
006-072-D01CACACACCNONE 
006-081-E05CACACACCNONE 
006-086-B07CACACACCNONE 
006-092-G07CACACACCNONE 
006-095-G09CACACACCNONE 
006-098-A06CACACACCNONE 
006-099-G01CACACACCNONE 
006-102-E01CACACACCNONE 
006-103-E10CACACACCNONE 
006-114-A05CACACACCNONE 
006-115-B09CACACACCNONE 
006-118-F06CACACACCNONE 
006-119-E10CACACACCNONE 
006-120-A01CACACACCNONE 
AF039532CACACACCNONE 
AK070446CACACACCHarpin-induced 1 domain containing protein. 
AK104363CACACACCNONE 
J013039E18CACACACCNONE 
J013056F20CACACACCNONE 
J013131C19CACACACCNONE 
J013153O17CACACACCNONE 
J023054G10CACACACCNONE 
J023067E19CACACACCNONE 
J033027N17CACACACCNONE 
J065016D15CACACACCNONE 
J065110L17CACACACCNONE 
J065127H09CACACACCNONE 
J065128G08CACACACCNONE 
J065144I11CACACACCNONE 
J065157E01CACACACCNONE 
J075017K12CACACACCNONE 
J075025L07CACACACCNONE 
J075045F11CACACACCNONE 
J075052C08CACACACCNONE 
J075070M16CACACACCNONE 
J075142H09CACACACCNONE 
J080001L06CACACACCNONE 
J080014O08CACACACCNONE 
J080015D20CACACACCNONE 
J080016M09CACACACCNONE 
J080017L03CACACACCNONE 
J080018B13CACACACCNONE 
J080031O11CACACACCNONE 
J080032P12CACACACCNONE 
J080034G03CACACACCNONE 
J080034G17CACACACCNONE 
J080034K17CACACACCNONE 
J080036K13CACACACCNONE 
J080057I07CACACACCNONE 
J080058N24CACACACCNONE 
J080063M08CACACACCNONE 
J080067C21CACACACCNONE 
J080070D01CACACACCNONE 
J080075H16CACACACCNONE 
J080078F06CACACACCNONE 
J080082L03CACACACCNONE 
J080083D21CACACACCNONE 
J080083F23CACACACCNONE 
J080086F13CACACACCNONE 
J080086N16CACACACCNONE 
J080090C17CACACACCNONE 
J080097I15CACACACCNONE 
J080097N15CACACACCNONE 
J100051G03CACACACCNONE 
J100071H01CACACACCNONE 
J100080G18CACACACCNONE 
Os05g0103200006-040-F03GGTGTGTGNONE 
006-046-E07GGTGTGTGNONE 
006-048-H01GGTGTGTGNONE 
006-051-D11GGTGTGTGNONE 
006-073-E11GGTGTGTGNONE 
006-083-D01GGTGTGTGNONE 
006-085-F04GGTGTGTGNONE 
006-101-A02GGTGTGTGNONE 
006-104-F07GGTGTGTGNONE 
006-107-D10GGTGTGTGNONE 
006-117-D06GGTGTGTGNONE 
AK061557GGTGTGTGNONE 
AK104195GGTGTGTGNONE 
AK104478GGTGTGTGNONE 
AK104627GGTGTGTGNONE 
AK104772GGTGTGTGNONE 
AK119201GGTGTGTGPeptidyl-prolyl cis-trans isomerase, cyclophilin type domain containing protein. 
J013027B22GGTGTGTGNONE 
J013055A01GGTGTGTGNONE 
J013098L03GGTGTGTGNONE 
J013102L10GGTGTGTGNONE 
J013120K16GGTGTGTGNONE 
J023003O11GGTGTGTGNONE 
J023041K07GGTGTGTGNONE 
J023055G17GGTGTGTGNONE 
J023079K07GGTGTGTGNONE 
J023090N20GGTGTGTGNONE 
J023103J15GGTGTGTGNONE 
J023108H02GGTGTGTGNONE 
J033082M02GGTGTGTGNONE 
J065141L15GGTGTGTGNONE 
J090005I09GGTGTGTGNONE 
J090030J04GGTGTGTGNONE 
J090081B19GGTGTGTGNONE 
J090081F21GGTGTGTGNONE 
J100019G08GGTGTGTGNONE 
Os05g0123100AK120892GGTGTGTGGlycosyl transferase, family 43 protein. 
Os05g0130200009-050-F12CACACACCNONE 
AK062489CACACACCConserved hypothetical protein. 
J090094E13CACACACCNONE 
J100039G01CACACACCNONE 
Os05g0134700011-030-A12GGTGTGTGNONE 
015-059-H11GGTGTGTGNONE 
016-009-A08GGTGTGTGNONE 
AK064360GGTGTGTGHaem peroxidase family protein. 
AK099362GGTGTGTGNONE 
AK102034GGTGTGTGNONE 
J065153B09GGTGTGTGNONE 
J100058F19GGTGTGTGNONE 
J100061F11GGTGTGTGNONE 
Os05g0144100AK069280GGTGTGTGWD40-like domain containing protein. 
J023010M10GGTGTGTGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0160000009-155-H11CACACACCNONE 
AK063865CACACACCSimilar to Ferric leghemoglobin reductase. 
Os05g0163300AK105598CACACACCSimilar to Arabinogalactan protein-like. 
Os05g0245300AB091471GGTGTGTGProtein of unknown function DUF588 family protein. 
J100023O13GGTGTGTGNONE 
J100063B05GGTGTGTGNONE 
Os05g0277500014-017-G01GGTGTGTGNONE 
AK105351GGTGTGTGSimilar to Germin-like protein subfamily 2 member 4 precursor. 
Os05g0300700014-079-G07CACACACCNONE 
AK063728CACACACCNONE 
AK067846CACACACCConserved hypothetical protein. 
Os05g0339000016-094-B12CACACACCNONE 
J075038J09CACACACCNONE 
J075124F11CACACACCNONE 
J075143E13CACACACCVHS domain containing protein. 
J075165E01CACACACCNONE 
J075185F12CACACACCNONE 
J100060N16CACACACCNONE 
J100066M21CACACACCNONE 
J100089K17CACACACCNONE 
Os05g0349000AK070681GGTGTGTGConserved hypothetical protein. 
AK120753GGTGTGTGNONE 
J023006K02GGTGTGTGNONE 
J023063E02GGTGTGTGNONE 
J043003J19GGTGTGTGNONE 
Os05g0367400AK108439CCCCACACACCThiamine pyrophosphokinase family protein. 
Os05g0417500AK068601CACACACCConserved hypothetical protein. 
Os05g0417700Os05g0417700CACACACCConserved hypothetical protein. 
Os05g0428600AK106696CACACACCSimilar to HSP70 precursor. 
Os05g0437900AK069622GGTGTGTGNONE 
AK074017GGTGTGTGNONE 
AK103583GGTGTGTGTubby family protein. 
Os05g0457800Os05g0457800GGTGTGTGCGGTGSimilar to Glycerol-3-phosphate acyltransferase 5 (EC 2.3.1.15) (AtGPAT5). 
Os05g0465000AK111286CACACACCConserved hypothetical protein. 
Os05g0476100011-031-E09ACAGCCCACACACCNONE 
011-033-E05ACAGCCCACACACCNONE 
011-038-E02ACAGCCCACACACCNONE 
012-053-A09ACAGCCCACACACCNONE 
012-057-E02ACAGCCCACACACCNONE 
AK064010ACAGCCCACACACCProtein of unknown function DUF827, plant family protein. 
AK102615ACAGCCCACACACCNONE 
J033057J03ACAGCCCACACACCNONE 
J033099E14ACAGCCCACACACCNONE 
Os05g0551700AK071216CACACACCtRNA isopentenyltransferase family protein. 
Os05g0560600011-097-B07CACACACCNONE 
AK067862CACACACCNONE 
AK122091CACACACCHomeodomain-like containing protein. 
J013124K11CACACACCNONE 
J033124C04CACACACCNONE 
J065013L06CACACACCNONE 
J065117J23CACACACCNONE 
Os05g0563000AK100983GGTGTGTGNo apical meristem (NAM) protein domain containing protein. 
J023145A15GGTGTGTGNONE 
Os06g0110100AB028887GGTGTGTGNONE 
AK068889GGTGTGTGOSEYA1. 
AK099255GGTGTGTGNONE 
J065214J06GGTGTGTGNONE 
Os06g0115200J100029D05CACACACCNONE 
J100048P05CACACACCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0163000AK069245CACACACCNONE 
AK069675CACACACCSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CACACACCNONE 
Os06g0202300AK063905GGTGTGTGConserved hypothetical protein. 
Os06g0208700AK065860CACACACCNONE 
AY669072CACACACCPutative tyrosine phosphatase family protein. 
J013043L18CACACACCNONE 
Os06g0213400012-003-C10CACACACCNONE 
AK071478CACACACCProtein of unknown function DUF829, eukaryotic family protein. 
J023092B08CACACACCNONE 
Os06g0218800011-007-B09CACACACCNONE 
AK073565CACACACCNONE 
AK104975CACACACCConserved hypothetical protein. 
J033041B13CACACACCNONE 
Os06g0328800AK065974CACACACCNONE 
AK101557CACACACCProtein of unknown function DUF23 family protein. 
J013049H12CACACACCNONE 
J033050C11CACACACCNONE 
Os06g0332900006-075-A08GGTGTGTGNONE 
AK059857GGTGTGTGZinc finger, RanBP2-type domain containing protein. 
J090059P11GGTGTGTGNONE 
J100064O04GGTGTGTGNONE 
Os06g0553200004-015-B06CACACACCNONE 
006-026-G11CACACACCNONE 
006-042-C08CACACACCNONE 
006-054-F08CACACACCNONE 
006-089-G06CACACACCNONE 
006-098-A03CACACACCNONE 
006-099-D11CACACACCNONE 
006-102-G11CACACACCNONE 
006-105-E09CACACACCNONE 
006-109-D07CACACACCNONE 
009-121-F11CACACACCNONE 
009-187-D06CACACACCNONE 
009-197-G07CACACACCNONE 
013-018-C04CACACACCNONE 
014-076-F02CACACACCNONE 
AK060896CACACACCConserved hypothetical protein. 
AK104528CACACACCNONE 
AK104638CACACACCNONE 
AK121675CACACACCNONE 
J013063E23CACACACCNONE 
J023121H15CACACACCNONE 
J033068F09CACACACCNONE 
J043016P10CACACACCNONE 
J043027P20CACACACCNONE 
J065036N04CACACACCNONE 
J075100H09CACACACCNONE 
J075171H04CACACACCNONE 
J075176F05CACACACCNONE 
J090008B16CACACACCNONE 
J090010M11CACACACCNONE 
J090023C18CACACACCNONE 
J090063J02CACACACCNONE 
J090068I11CACACACCNONE 
J090071L09CACACACCNONE 
J090083M21CACACACCNONE 
Os06g0561200AK120422CACACACCSimilar to Potassium/proton antiporter-like protein. 
Os06g0611000AK062173CACACACCNONE 
Os06g0683900011-042-B09CCCACCACACACCNONE 
011-042-F07CCCACCACACACCNONE 
015-047-H05CCCACCACACACCNONE 
016-011-D06CCCACCACACACCNONE 
AK063941CCCACCACACACCConserved hypothetical protein. 
AK102096CCCACCACACACCNONE 
J090059F01CCCACCACACACCNONE 
Os06g0717400AK072887GGTGTGTGPseudouridine synthase, Rlu family protein. 
Os06g0726200006-026-B05CACACACCNONE 
006-056-A08CACACACCNONE 
006-073-E01CACACACCNONE 
006-117-C07CACACACCNONE 
011-085-B05CACACACCNONE 
AK061042CACACACCEndochitinase precursor (EC 3.2.1.14). 
AK099339CACACACCNONE 
AK104020CACACACCNONE 
AK105798CACACACCNONE 
AY378172CACACACCNONE 
D10423CACACACCNONE 
J033028I21CACACACCNONE 
J053091K20CACACACCNONE 
J065079P07CACACACCNONE 
J065085J16CACACACCNONE 
J065135C05CACACACCNONE 
J065167C04CACACACCNONE 
J065183C21CACACACCNONE 
J065183J09CACACACCNONE 
J100034O08CACACACCNONE 
J100047I08CACACACCNONE 
X56063CACACACCNONE 
Z29961CACACACCNONE 
Os07g0110000AK066728GGTGTGTGHypothetical protein. 
Os07g0240600AK107471CACACACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os07g0252400AK100914GCCCACACACCSimilar to Cellulose synthase-8. 
Os07g0252800AK107878CACACACCConserved hypothetical protein. 
Os07g0467200009-103-G05CACACACCNONE 
009-109-G02CACACACCNONE 
AK070358CACACACCSimilar to Clone ZZD536 mRNA sequence. 
J100026N23CACACACCNONE 
J100038B09CACACACCNONE 
Os07g0475700006-025-E06GCCCCACACACACCNONE 
AK060076GCCCCACACACACCAuxin responsive SAUR protein family protein. 
Os07g0509800Os07g0509800CACACACCSimilar to APS reductase (Fragment). 
Os07g0614000015-078-C05GGTGTGTGNONE 
AK069163GGTGTGTGNONE 
AK109489GGTGTGTGStrictosidine synthase family protein. 
J065123D15GGTGTGTGNONE 
J065124L12GGTGTGTGNONE 
J065180F02GGTGTGTGNONE 
J075143N04GGTGTGTGNONE 
J080014B10GGTGTGTGNONE 
J080026L16GGTGTGTGNONE 
J080044H09GGTGTGTGNONE 
J080071M17GGTGTGTGNONE 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0630800AK059570GGTGTGTGNONE 
AK068064GGTGTGTGNONE 
AK071297GGTGTGTGSimilar to Nodule-enhanced malate dehydrogenase. 
AK106083GGTGTGTGNONE 
J013130E16GGTGTGTGNONE 
J080024I02GGTGTGTGNONE 
J080037G22GGTGTGTGNONE 
J080047G13GGTGTGTGNONE 
J080060J19GGTGTGTGNONE 
J080075A13GGTGTGTGNONE 
J080088F01GGTGTGTGNONE 
J080094F14GGTGTGTGNONE 
Os07g0633600AK061698GGTGTGTGNONE 
Os07g0637300AF323611CACACACCNONE 
AK069157CACACACCNONE 
J023007C01CACACACCNONE 
Os07g0640900011-054-A08CACACACCNONE 
011-054-A08CACACACCNONE 
AK063952CACACACCSimilar to Heat shock transcription factor 33 (Fragment). 
AK063952CACACACCSimilar to Heat shock transcription factor 33 (Fragment). 
AK099354CACACACCNONE 
AK099354CACACACCNONE 
AK099354GGTGTGTGNONE 
AK102159CACACACCNONE 
AK102159CACACACCNONE 
AY344494CACACACCNONE 
AY344494CACACACCNONE 
J033086G01CACACACCNONE 
J033086G01CACACACCNONE 
J075001L10CACACACCNONE 
J075001L10CACACACCNONE 
J090075I17CACACACCNONE 
J090075I17CACACACCNONE 
Os07g0664400006-092-E02GGTGTGTGNONE 
J065053N04GGTGTGTGGlucose/ribitol dehydrogenase family protein. 
J065057F09GGTGTGTGNONE 
J065105C24GGTGTGTGNONE 
J065192I04GGTGTGTGNONE 
J065199L10GGTGTGTGNONE 
J065200C14GGTGTGTGNONE 
J065214L10GGTGTGTGNONE 
Os08g0109300AK061825CACACACCNONE 
AK066688CACACACCSimilar to Adenylate kinase, chloroplast (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
J023013L12CACACACCNONE 
Os08g0110000AK071992CACACACCNONE 
AK073752CACACACCEsterase/lipase/thioesterase domain containing protein. 
Os08g0127100003-104-H01CGGACGGCACACACCNONE 
015-032-F08CGGACGGCACACACCNONE 
AK065217CGGACGGCACACACCNONE 
AK102015CGGACGGCACACACCAmino acid transporter, transmembrane family protein. 
J013002G10CGGACGGCACACACCNONE 
J013152E01CGGACGGCACACACCNONE 
J023007G24CGGACGGCACACACCNONE 
J023019F17CGGACGGCACACACCNONE 
J023074N19CGGACGGCACACACCNONE 
J023120E22CGGACGGCACACACCNONE 
J023120J05CGGACGGCACACACCNONE 
J023125E14CGGACGGCACACACCNONE 
J023145J12CGGACGGCACACACCNONE 
J033092G02CGGACGGCACACACCNONE 
J065019M06CGGACGGCACACACCNONE 
J065029J04CGGACGGCACACACCNONE 
J065031G24CGGACGGCACACACCNONE 
J065043J15CGGACGGCACACACCNONE 
J065049A17CGGACGGCACACACCNONE 
J065055N20CGGACGGCACACACCNONE 
J065062O05CGGACGGCACACACCNONE 
J065083A02CGGACGGCACACACCNONE 
J065086H21CGGACGGCACACACCNONE 
J065109F15CGGACGGCACACACCNONE 
J065121C11CGGACGGCACACACCNONE 
J065132J19CGGACGGCACACACCNONE 
J065135C06CGGACGGCACACACCNONE 
J065194N14CGGACGGCACACACCNONE 
J065201A20CGGACGGCACACACCNONE 
J100027B05CGGACGGCACACACCNONE 
J100036C02CGGACGGCACACACCNONE 
J100043G09CGGACGGCACACACCNONE 
J100048A10CGGACGGCACACACCNONE 
J100056I17CGGACGGCACACACCNONE 
J100062N21CGGACGGCACACACCNONE 
J100064N15CGGACGGCACACACCNONE 
J100082K15CGGACGGCACACACCNONE 
Os08g0156033J065134J15CACACACCNONE 
J100019J19CACACACCConserved hypothetical protein. 
J100053A18CACACACCNONE 
J100056B17CACACACCNONE 
Os08g0173300J065196D12CACACACCConserved hypothetical protein. 
Os08g0276100006-086-B08CACACACCNONE 
AK068157CACACACCNONE 
AK104325CACACACCNONE 
AK105984CACACACCConserved hypothetical protein. 
J013134G12CACACACCNONE 
J013160J03CACACACCNONE 
J065128E08CACACACCNONE 
J065170A10CACACACCNONE 
Os08g0280100AK072150CACACACCNONE 
AK119420CACACACCSimilar to Phytase. 
Os08g0327501J065211N12CACACACCConserved hypothetical protein. 
Os08g0411500J013050J08CACACACCNONE 
Os08g0414300AK072217CCCCACACACCConserved hypothetical protein. 
J065039C07CCCCACACACCNONE 
J065098N11CCCCACACACCNONE 
J065120J15CCCCACACACCNONE 
J075076H12CCCCACACACCNONE 
J075101N16CCCCACACACCNONE 
J080010A07CCCCACACACCNONE 
J080023C16CCCCACACACCNONE 
J080027G22CCCCACACACCNONE 
J080053D02CCCCACACACCNONE 
J080065E17CCCCACACACCNONE 
J080068C15CCCCACACACCNONE 
J090061J10CCCCACACACCNONE 
Os08g0479400AK109528CACACACCSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK109528GGTGTGTGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
J090044L24CACACACCNONE 
J090044L24GGTGTGTGNONE 
J090063I11CACACACCNONE 
J090063I11GGTGTGTGNONE 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0564300015-019-C05CACACACCNONE 
AK063134CACACACCNONE 
AK106260CACACACCNONE 
AK119880CACACACCABC transporter, transmembrane region domain containing protein. 
AK121506CACACACCNONE 
J033022P13CACACACCNONE 
Os09g0127300AK100234GGTGTGTGNAD-dependent epimerase/dehydratase family protein. 
J065025J06GGTGTGTGNONE 
J065026I05GGTGTGTGNONE 
J065042L03GGTGTGTGNONE 
J065061B18GGTGTGTGNONE 
J065121H13GGTGTGTGNONE 
J065183N10GGTGTGTGNONE 
Os09g0297000AK068174GGTGTGTGSimilar to Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (Heme synthetase). 
Os09g0403000AK109933CACACACCNONE 
AK111051CACACACCConserved hypothetical protein. 
Os09g0418000006-022-F01CCCCCGCGCCCACACACCNONE 
006-038-G10CCCCCGCGCCCACACACCNONE 
006-089-G04CCCCCGCGCCCACACACCNONE 
006-098-F07CCCCCGCGCCCACACACCNONE 
AK061220CCCCCGCGCCCACACACCNONE 
AK061493CCCCCGCGCCCACACACCNONE 
AK100881CCCCCGCGCCCACACACCNONE 
AK119760CCCCCGCGCCCACACACCProtein kinase-like domain containing protein. 
J023127H10CCCCCGCGCCCACACACCNONE 
J033122J01CCCCCGCGCCCACACACCNONE 
J065162D08CCCCCGCGCCCACACACCNONE 
J065214P03CCCCCGCGCCCACACACCNONE 
J090009B17CCCCCGCGCCCACACACCNONE 
J090093C21CCCCCGCGCCCACACACCNONE 
J100067C01CCCCCGCGCCCACACACCNONE 
J100067P06CCCCCGCGCCCACACACCNONE 
Os09g0434900AK109104CACACACCNONE 
AK120863CACACACCZinc finger, RING-type domain containing protein. 
Os09g0455200J065041I12CCCCACACACCWinged helix repressor DNA-binding domain containing protein. 
J065120N14CCCCACACACCNONE 
Os09g0465800009-106-E01CACACACCNONE 
AK062785CACACACCConserved hypothetical protein. 
J065122K21CACACACCNONE 
Os09g0466300AK102696CACACACCGRAM domain containing protein. 
J033103F22CACACACCNONE 
Os09g0517600015-042-F02CACACACCNONE 
AK101828CACACACCSimilar to FH protein NFH1. 
J033050C23CACACACCNONE 
J033068F13CACACACCNONE 
J065138F02CACACACCNONE 
J075110L12CACACACCNONE 
Os09g0533900003-104-E05CACACACCNONE 
003-104-E05CACACACCCCCACGCGNONE 
012-076-C03CACACACCNONE 
012-076-C03CACACACCCCCACGCGNONE 
AK067774CACACACCNONE 
AK067774CACACACCCCCACGCGNONE 
AK100449CACACACCSimilar to CEL5=CELLULASE 5 (Fragment). 
AK100449CACACACCCCCACGCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07CACACACCNONE 
J013048F07CACACACCCCCACGCGNONE 
J023026E11CACACACCNONE 
J023026E11CACACACCCCCACGCGNONE 
J023028B20CACACACCNONE 
J023028B20CACACACCCCCACGCGNONE 
J023050P11CACACACCNONE 
J023050P11CACACACCCCCACGCGNONE 
J023052K08CACACACCNONE 
J023052K08CACACACCCCCACGCGNONE 
J023075J03CACACACCNONE 
J023075J03CACACACCCCCACGCGNONE 
J023078E15CACACACCNONE 
J023078E15CACACACCCCCACGCGNONE 
J023090P12CACACACCNONE 
J023090P12CACACACCCCCACGCGNONE 
J023120E01CACACACCNONE 
J023120E01CACACACCCCCACGCGNONE 
J023142K01CACACACCNONE 
J023142K01CACACACCCCCACGCGNONE 
J033027K23CACACACCNONE 
J033027K23CACACACCCCCACGCGNONE 
J033058A09CACACACCNONE 
J033058A09CACACACCCCCACGCGNONE 
J033058C12CACACACCNONE 
J033058C12CACACACCCCCACGCGNONE 
J033125A04CACACACCNONE 
J033125A04CACACACCCCCACGCGNONE 
J043040L01CACACACCNONE 
J043040L01CACACACCCCCACGCGNONE 
J053061D06CACACACCNONE 
J053061D06CACACACCCCCACGCGNONE 
J053096N13CACACACCNONE 
J053096N13CACACACCCCCACGCGNONE 
J065193H10CACACACCNONE 
J065193H10CACACACCCCCACGCGNONE 
J090075L17CACACACCNONE 
J090075L17CACACACCCCCACGCGNONE 
J100050D10CACACACCNONE 
J100050D10CACACACCCCCACGCGNONE 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os11g0111200AK109277GGTGTGTGConserved hypothetical protein. 
Os11g0143300AK058585CACACACCSimilar to Type-A response regulator. 
AK120926CACACACCNONE 
Os11g0152900AK109321GGTGTGTGConserved hypothetical protein. 
Os11g0156600Os11g0156600CACACACCTB2/DP1 and HVA22 related protein family protein. 
Os11g0157400AK066482CACACACCExo70 exocyst complex subunit family protein. 
Os11g0484000012-001-D04CACACACCNONE 
AK065321CACACACCClass II aldolase/adducin, N-terminal family protein. 
J013002P15CACACACCNONE 
Os11g0508600011-004-E02CACACACCNONE 
013-016-B05CACACACCNONE 
AK101913CACACACCSimilar to MtN3 protein precursor. 
J013155F21CACACACCNONE 
J033071H09CACACACCNONE 
Os11g0528400AK069554CACACACCConserved hypothetical protein. 
J023022D15CACACACCNONE 
J090046M17CACACACCNONE 
Os11g0534300AK069995CACACACCZinc finger, DHHC-type domain containing protein. 
Os11g0580000AK119421CACACACCArmadillo-like helical domain containing protein. 
AK121905CACACACCNONE 
J033105I06CACACACCNONE 
J090022C10CACACACCNONE 
J090024J23CACACACCNONE 
J090044F24CACACACCNONE 
Os11g0621000AK099685CACACACCNONE 
AK106377CACACACCProtein of unknown function DUF716 family protein. 
Os11g0630900AK107482GGTGTGTGMATH domain containing protein. 
Os12g0151500AK058389GCAGCCCAACCACACACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GCAGCCCAACCACACACCNONE 
Os12g0164600J065163H24CACACACCProtein of unknown function DUF793 family protein. 
J065192D23CACACACCNONE 
Os12g0170100AK120125CACACACCSimilar to DNA-binding protein. 
Os12g0180900AK110994GGTGTGTGHypothetical protein. 
Os12g0288000AK069283GGTGTGTGProtein of unknown function DUF6, transmembrane domain containing protein. 
AK100993GGTGTGTGNONE 
J080302K21GGTGTGTGNONE 
J080309K03GGTGTGTGNONE 
J080311D18GGTGTGTGNONE 
J080312M01GGTGTGTGNONE 
J080317J17GGTGTGTGNONE 
J080318J16GGTGTGTGNONE 
J080319M08GGTGTGTGNONE 
J080319P03GGTGTGTGNONE 
Os12g0479400AK065254CACACACCCCCACACCCACCACCCCACACNONE 
AK067061CACACACCCCCACACCCACCACCCCACACSimilar to Auxin response factor 1. 
Os12g0532600AK066369GGTGTGTGHypothetical protein. 
J013059K17GGTGTGTGNONE 
J065082J04GGTGTGTGNONE 
J065158C15GGTGTGTGNONE 
J090017A09GGTGTGTGNONE 
Os12g0534700AK122037CACACACCProtein kinase-like domain containing protein. 
J033112P03CACACACCNONE 
J090022G02CACACACCNONE 
J090066N06CACACACCNONE 
J100064H18CACACACCNONE 
J100074N21CACACACCNONE 
J100081P16CACACACCNONE 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.