version

Summary of OsREG500 (All List)

OrganismOryza sativa  
IDOsREG500  
SequenceCACCGCAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1784  

Entry Sequences (1784 entries)

LocusGene modelSequenceDescription
Os01g0170300J065161B03GTGCGGTGProtein kinase-like domain containing protein. 
Os01g0188400AK072842CACCGCACNONE 
AK121770CACCGCACNONE 
D16499CACCGCACNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23CACCGCACNONE 
J100060J17CACCGCACNONE 
Os01g0253400AK108904CACCGCACProtein of unknown function DUF1218 family protein. 
Os01g0276700011-014-A12CACCGCACCGCNONE 
012-092-G12CACCGCACCGCNONE 
AK103164CACCGCACCGCNONE 
AK103465CACCGCACCGCSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CACCGCACCGCNONE 
J023084I02CACCGCACCGCNONE 
J033027F20CACCGCACCGCNONE 
J033029M06CACCGCACCGCNONE 
J033039K13CACCGCACCGCNONE 
J033057C24CACCGCACCGCNONE 
J033058G20CACCGCACCGCNONE 
J033060A14CACCGCACCGCNONE 
J033061M21CACCGCACCGCNONE 
J033068M10CACCGCACCGCNONE 
J033074K16CACCGCACCGCNONE 
J033076C11CACCGCACCGCNONE 
J033093O13CACCGCACCGCNONE 
J033119H20CACCGCACCGCNONE 
J033121D22CACCGCACCGCNONE 
J033129N11CACCGCACCGCNONE 
J033131E12CACCGCACCGCNONE 
J033150L07CACCGCACCGCNONE 
J053024N17CACCGCACCGCNONE 
J053034G19CACCGCACCGCNONE 
J053035E18CACCGCACCGCNONE 
J053046M01CACCGCACCGCNONE 
J053047P04CACCGCACCGCNONE 
J053048B06CACCGCACCGCNONE 
J053050M22CACCGCACCGCNONE 
J053053E09CACCGCACCGCNONE 
J053053I07CACCGCACCGCNONE 
J053059K03CACCGCACCGCNONE 
J053059P12CACCGCACCGCNONE 
J053060C12CACCGCACCGCNONE 
J053060H24CACCGCACCGCNONE 
J053064D19CACCGCACCGCNONE 
J053066L15CACCGCACCGCNONE 
J053073I02CACCGCACCGCNONE 
J053083E15CACCGCACCGCNONE 
J053094D05CACCGCACCGCNONE 
J053094P18CACCGCACCGCNONE 
J053095C15CACCGCACCGCNONE 
J053095C21CACCGCACCGCNONE 
J053099N16CACCGCACCGCNONE 
J090025O19CACCGCACCGCNONE 
J090049N22CACCGCACCGCNONE 
J090050F17CACCGCACCGCNONE 
Os01g0332100AK120720CACCGCACSimilar to Neutral invertase-like protein (Fragment). 
AY187621CACCGCACNONE 
J080021I24CACCGCACNONE 
Os01g0571000AK121334CGCACCGCACCGCNONE 
Os01g0584900AK108522CACCGCACGCGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846CACCGCACGCGNONE 
J065161G19CACCGCACGCGNONE 
J065193D14CACCGCACGCGNONE 
J065193L05CACCGCACGCGNONE 
J065196K16CACCGCACGCGNONE 
Os01g0633000006-075-A01GTGCGGTGNONE 
009-064-A11GTGCGGTGNONE 
009-153-F07GTGCGGTGNONE 
AK062051GTGCGGTGSimilar to 50S ribosomal protein L31. 
J013073B08GTGCGGTGNONE 
J065006K19GTGCGGTGNONE 
J065053P08GTGCGGTGNONE 
J065057D08GTGCGGTGNONE 
J065086P07GTGCGGTGNONE 
J065095C14GTGCGGTGNONE 
J065116B05GTGCGGTGNONE 
J065164L20GTGCGGTGNONE 
J065185K19GTGCGGTGNONE 
J065191E21GTGCGGTGNONE 
J065199P21GTGCGGTGNONE 
J065216M12GTGCGGTGNONE 
J075002M09GTGCGGTGNONE 
J075016N10GTGCGGTGNONE 
J075041K05GTGCGGTGNONE 
J075094E04GTGCGGTGNONE 
J075154O04GTGCGGTGNONE 
J075176D22GTGCGGTGNONE 
J075186M09GTGCGGTGNONE 
J075191H20GTGCGGTGNONE 
Os01g0673600AK122067CACCGCACSimilar to Ubiquitin-conjugating enzyme E2. 
J013036H06CACCGCACNONE 
J013110B18CACCGCACNONE 
J013162K06CACCGCACNONE 
J023121H14CACCGCACNONE 
J033061M10CACCGCACNONE 
J033117D10CACCGCACNONE 
J033145L07CACCGCACNONE 
J043027L23CACCGCACNONE 
J053032D15CACCGCACNONE 
J053046J22CACCGCACNONE 
J065026F01CACCGCACNONE 
J065160C17CACCGCACNONE 
J065207H23CACCGCACNONE 
J075019E11CACCGCACNONE 
J075073M16CACCGCACNONE 
J075101K09CACCGCACNONE 
J075114I09CACCGCACNONE 
J075165J18CACCGCACNONE 
J075195P10CACCGCACNONE 
J100049H06CACCGCACNONE 
J100052A10CACCGCACNONE 
J100066D15CACCGCACNONE 
Os01g0678100AK099717GTGCGGTGConserved hypothetical protein. 
Os01g0678900AK107736GTGCGGTGHypothetical protein. 
J075173H08GTGCGGTGNONE 
Os01g0716200AK062106GTGCGGTGCGIQ calmodulin-binding region domain containing protein. 
AK098920GTGCGGTGCGNONE 
AK120664GTGCGGTGCGNONE 
J013002N06GTGCGGTGCGNONE 
J013050O19GTGCGGTGCGNONE 
J013074N19GTGCGGTGCGNONE 
J013098J01GTGCGGTGCGNONE 
J013127F17GTGCGGTGCGNONE 
J013155C17GTGCGGTGCGNONE 
J013158K07GTGCGGTGCGNONE 
J013159J10GTGCGGTGCGNONE 
J053086D01GTGCGGTGCGNONE 
Os01g0764000006-021-G03CACCGCACNONE 
006-025-C07CACCGCACNONE 
006-029-G11CACCGCACNONE 
006-030-C04CACCGCACNONE 
006-035-E05CACCGCACNONE 
006-037-G01CACCGCACNONE 
006-038-C01CACCGCACNONE 
006-039-G05CACCGCACNONE 
006-042-E11CACCGCACNONE 
006-044-H04CACCGCACNONE 
006-045-A10CACCGCACNONE 
006-045-C05CACCGCACNONE 
006-047-A11CACCGCACNONE 
006-048-H10CACCGCACNONE 
006-050-C01CACCGCACNONE 
006-050-H11CACCGCACNONE 
006-051-G10CACCGCACNONE 
006-051-G11CACCGCACNONE 
006-056-B04CACCGCACNONE 
006-063-F04CACCGCACNONE 
006-063-H12CACCGCACNONE 
006-065-G09CACCGCACNONE 
006-067-F11CACCGCACNONE 
006-073-D10CACCGCACNONE 
006-074-G09CACCGCACNONE 
006-075-D04CACCGCACNONE 
006-077-C10CACCGCACNONE 
006-082-A10CACCGCACNONE 
006-084-C12CACCGCACNONE 
006-085-F05CACCGCACNONE 
006-087-H12CACCGCACNONE 
006-092-E10CACCGCACNONE 
006-094-C06CACCGCACNONE 
006-096-G11CACCGCACNONE 
006-097-H11CACCGCACNONE 
006-101-A07CACCGCACNONE 
006-101-G08CACCGCACNONE 
006-110-E08CACCGCACNONE 
006-111-D04CACCGCACNONE 
006-116-H04CACCGCACNONE 
AK058894CACCGCACNONE 
AK059818CACCGCACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142CACCGCACNONE 
J013119N15CACCGCACNONE 
J013123P15CACCGCACNONE 
J023055F24CACCGCACNONE 
J023125K17CACCGCACNONE 
J053050A20CACCGCACNONE 
J053056P10CACCGCACNONE 
J053074D19CACCGCACNONE 
J053078A14CACCGCACNONE 
J053086P10CACCGCACNONE 
J053094N23CACCGCACNONE 
J053095M23CACCGCACNONE 
J065006D02CACCGCACNONE 
J065030A17CACCGCACNONE 
J065030K04CACCGCACNONE 
J065035L12CACCGCACNONE 
J065046E12CACCGCACNONE 
J065065H19CACCGCACNONE 
J065073C01CACCGCACNONE 
J065105F01CACCGCACNONE 
J065131N16CACCGCACNONE 
J065144O13CACCGCACNONE 
J065160E12CACCGCACNONE 
J065160K02CACCGCACNONE 
J065163F09CACCGCACNONE 
J065165E18CACCGCACNONE 
J065174E04CACCGCACNONE 
J065175O08CACCGCACNONE 
J065191N24CACCGCACNONE 
J065193D19CACCGCACNONE 
J065198D04CACCGCACNONE 
J065200G09CACCGCACNONE 
J075016L06CACCGCACNONE 
J075017J11CACCGCACNONE 
J075019L08CACCGCACNONE 
J075028M08CACCGCACNONE 
J075029K05CACCGCACNONE 
J075039K04CACCGCACNONE 
J075047J22CACCGCACNONE 
J075079H13CACCGCACNONE 
J075095K14CACCGCACNONE 
J075111D21CACCGCACNONE 
J075131A19CACCGCACNONE 
J075147G20CACCGCACNONE 
J075158F11CACCGCACNONE 
J075166N10CACCGCACNONE 
J075196G09CACCGCACNONE 
J075198I24CACCGCACNONE 
J090001L08CACCGCACNONE 
J090026G07CACCGCACNONE 
J090050M15CACCGCACNONE 
J090071A01CACCGCACNONE 
J090072P16CACCGCACNONE 
J090078D22CACCGCACNONE 
J090089C18CACCGCACNONE 
J100019B07CACCGCACNONE 
J100019H15CACCGCACNONE 
J100019P09CACCGCACNONE 
J100023A16CACCGCACNONE 
J100023B09CACCGCACNONE 
J100026O18CACCGCACNONE 
J100027E09CACCGCACNONE 
J100028F22CACCGCACNONE 
J100029P05CACCGCACNONE 
J100031M19CACCGCACNONE 
J100032A11CACCGCACNONE 
J100036G19CACCGCACNONE 
J100038E22CACCGCACNONE 
J100040A12CACCGCACNONE 
J100040L02CACCGCACNONE 
J100043O13CACCGCACNONE 
J100045E20CACCGCACNONE 
J100046H18CACCGCACNONE 
J100047E08CACCGCACNONE 
J100050E08CACCGCACNONE 
J100050P14CACCGCACNONE 
J100051G10CACCGCACNONE 
J100052L12CACCGCACNONE 
J100056G24CACCGCACNONE 
J100066B15CACCGCACNONE 
J100068O15CACCGCACNONE 
J100070J16CACCGCACNONE 
J100074I22CACCGCACNONE 
J100075M12CACCGCACNONE 
J100077M09CACCGCACNONE 
J100077O14CACCGCACNONE 
J100079J08CACCGCACNONE 
J100080I16CACCGCACNONE 
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE 
AK061253GTGCGGTGGGCCGGTNONE 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0774500AK069241CACCGCACConserved hypothetical protein. 
Os01g0780900J033069J11CACCGCACNONE 
J065054P18CACCGCACNONE 
J065163O05CACCGCACNONE 
J065165B05CACCGCACNONE 
J075097O22CACCGCACNONE 
J080029E07CACCGCACNONE 
J080093M08CACCGCACNONE 
J100025J07CACCGCACNONE 
J100029N22CACCGCACNONE 
J100041C23CACCGCACConserved hypothetical protein. 
J100041M22CACCGCACNONE 
J100058D11CACCGCACNONE 
J100064E15CACCGCACNONE 
J100066M09CACCGCACNONE 
J100067H14CACCGCACNONE 
Os01g0781000006-077-C12GTGCGGTGNONE 
009-156-E02GTGCGGTGNONE 
AK059870GTGCGGTGVacuolar protein sorting-associated, VPS28 family protein. 
AK099116GTGCGGTGNONE 
AK104274GTGCGGTGNONE 
J023034E12GTGCGGTGNONE 
J075074G06GTGCGGTGNONE 
J090041H03GTGCGGTGNONE 
J100045K08GTGCGGTGNONE 
Os01g0814200AK070675CACCGCACNONE 
AK073107CACCGCACSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19CACCGCACNONE 
Os01g0823200AK066097CCCACCACCGCACConserved hypothetical protein. 
J013056K15CCCACCACCGCACNONE 
Os01g0830000012-056-G03GTGCGGTGNONE 
015-092-H05GTGCGGTGNONE 
AK121100GTGCGGTGSimilar to Plastid sufB (Fragment). 
J023069G03GTGCGGTGNONE 
J090047G13GTGCGGTGNONE 
J090059K22GTGCGGTGNONE 
Os01g0830100AK069755CACCGCACPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0844400AK070434CGCACCGCACNONE 
AK071686CGCACCGCACZinc finger, DHHC-type domain containing protein. 
J065037E10CGCACCGCACNONE 
J065165F17CGCACCGCACNONE 
Os01g0847300AK071164GCCCCACCGCACProtein of unknown function DUF588 family protein. 
AK104027GCCCCACCGCACNONE 
Os01g0875000AK058560CACCGCACConserved hypothetical protein. 
Os01g0891300AK063674CACCGCACSimilar to Allyl alcohol dehydrogenase. 
AK099151CACCGCACNONE 
Os01g0940800006-047-A06GTGCGGTGNONE 
006-061-E09GTGCGGTGNONE 
006-084-B10GTGCGGTGNONE 
AK068247GTGCGGTGSimilar to Beta-1,3-glucanase precursor. 
AK105972GTGCGGTGNONE 
J065039F20GTGCGGTGNONE 
J065045A17GTGCGGTGNONE 
J065104A16GTGCGGTGNONE 
J065134E18GTGCGGTGNONE 
J065138O04GTGCGGTGNONE 
J065182H04GTGCGGTGNONE 
J065192M07GTGCGGTGNONE 
J075003C07GTGCGGTGNONE 
J075019O07GTGCGGTGNONE 
J075020F10GTGCGGTGNONE 
J075031J07GTGCGGTGNONE 
J075076J15GTGCGGTGNONE 
J075080C23GTGCGGTGNONE 
J075124A05GTGCGGTGNONE 
J075147G11GTGCGGTGNONE 
J075155A17GTGCGGTGNONE 
J075166P16GTGCGGTGNONE 
J075170M23GTGCGGTGNONE 
J075178H20GTGCGGTGNONE 
J075180H22GTGCGGTGNONE 
J100019P17GTGCGGTGNONE 
J100030E12GTGCGGTGNONE 
J100037C07GTGCGGTGNONE 
J100048F24GTGCGGTGNONE 
Os01g0971100009-033-D02CACCGCACNONE 
AK069516CACCGCACDrought induced 19 family protein. 
J023022E04CACCGCACNONE 
J023067L15CACCGCACNONE 
J023110D22CACCGCACNONE 
J075034M07CACCGCACNONE 
J075107K18CACCGCACNONE 
J075172M23CACCGCACNONE 
J100067J03CACCGCACNONE 
Os01g0973500AK069546CCCCACACCGCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os02g0125300006-047-E06CGCACCGCACCGCACNONE 
006-088-F09CGCACCGCACCGCACNONE 
006-106-F10CGCACCGCACCGCACNONE 
AB025926CGCACCGCACCGCACNONE 
AK061564CGCACCGCACCGCACNONE 
AK061953CGCACCGCACCGCACNONE 
AK101060CGCACCGCACCGCACBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CGCACCGCACCGCACNONE 
J023097A08CGCACCGCACCGCACNONE 
J023133F03CGCACCGCACCGCACNONE 
J033022C21CGCACCGCACCGCACNONE 
J033073C21CGCACCGCACCGCACNONE 
J033116O09CGCACCGCACCGCACNONE 
J033120E01CGCACCGCACCGCACNONE 
J065088M19CGCACCGCACCGCACNONE 
J065135O04CGCACCGCACCGCACNONE 
J080304J03CGCACCGCACCGCACNONE 
J090001K14CGCACCGCACCGCACNONE 
J090038D04CGCACCGCACCGCACNONE 
J090045G09CGCACCGCACCGCACNONE 
J090076E12CGCACCGCACCGCACNONE 
J090077D21CGCACCGCACCGCACNONE 
J100018J19CGCACCGCACCGCACNONE 
J100029M12CGCACCGCACCGCACNONE 
J100049D07CGCACCGCACCGCACNONE 
J100067G21CGCACCGCACCGCACNONE 
J100090D05CGCACCGCACCGCACNONE 
Os02g0160200AK109618GTGCGGTGCGGTGCGGTGCGGTGCyclin-like F-box domain containing protein. 
Os02g0282900AK121560CGCACCGCACCGCSimilar to 68 kDa protein HP68. 
Os02g0302200Os02g0302200CACCGCACConserved hypothetical protein. 
Os02g0437800AK064288GTGCGGTGNONE 
AK066001GTGCGGTGSimilar to Vacuolar protein-sorting protein 45 homolog (AtVPS45). 
AK067724GTGCGGTGNONE 
Os02g0471500AK120615CGCACCGCACCGCNONE 
AK120927CGCACCGCACCGCProtein phosphatase 2C-like domain containing protein. 
Os02g0496500AK071406GTGCGGTGDNA glycosylase family protein. 
J023092H13GTGCGGTGNONE 
Os02g0497700011-094-A10CACCGCACCGCNONE 
012-073-H02CACCGCACCGCNONE 
016-056-G05CACCGCACCGCNONE 
AK070143CACCGCACCGCNONE 
J023041O14CACCGCACCGCNONE 
J023092H01CACCGCACCGCNONE 
J033048A17CACCGCACCGCNONE 
J033051K21CACCGCACCGCNONE 
J033122D01CACCGCACCGCNONE 
J090032E23CACCGCACCGCNONE 
J090055K13CACCGCACCGCNONE 
Os02g0509500009-117-G07CGCACCGCACNONE 
009-122-G08CGCACCGCACNONE 
AK105187CGCACCGCACConserved hypothetical protein. 
J065025C04CGCACCGCACNONE 
J065030F10CGCACCGCACNONE 
J065112P22CGCACCGCACNONE 
J065116I22CGCACCGCACNONE 
J065127F24CGCACCGCACNONE 
J065176E11CGCACCGCACNONE 
J065186F02CGCACCGCACNONE 
J075041F12CGCACCGCACNONE 
J075118L20CGCACCGCACNONE 
J075181D20CGCACCGCACNONE 
J090023P12CGCACCGCACNONE 
Os02g0562300AK073250GCGGTGCGGTGGGCTCalmodulin binding protein-like family protein. 
Os02g0574900AK073087GTGCGGTGCyclin-like F-box domain containing protein. 
J033023M04GTGCGGTGNONE 
J033117N08GTGCGGTGNONE 
J075008F16GTGCGGTGNONE 
J075075I19GTGCGGTGNONE 
J075079A06GTGCGGTGNONE 
J075086I07GTGCGGTGNONE 
J075088F13GTGCGGTGNONE 
J075093D04GTGCGGTGNONE 
J075163C10GTGCGGTGNONE 
Os02g0586400006-066-D08CGCACCGCACCGTTGGATNONE 
006-073-A01CGCACCGCACCGTTGGATNONE 
J065088B17CGCACCGCACCGTTGGATNONE 
J075065L07CGCACCGCACCGTTGGATNONE 
J100017B20CGCACCGCACCGTTGGATNONE 
J100025B03CGCACCGCACCGTTGGATNONE 
Os02g0621500AK120798CACCGCACZinc finger, RING-type domain containing protein. 
Os02g0693000009-079-C03GTGCGGTGNONE 
009-088-D02GTGCGGTGNONE 
AK062683GTGCGGTGConserved hypothetical protein. 
Os02g0694100J090034G11CGCACCGCACCyclin-like F-box domain containing protein. 
Os02g0709900AB110204CGCACCGCACPrefoldin domain containing protein. 
AK109259CGCACCGCACNONE 
J013093N22CGCACCGCACNONE 
J033116F21CGCACCGCACNONE 
Os02g0715300006-052-F10CACCGCACNONE 
006-099-G08CACCGCACNONE 
006-120-A02CACCGCACNONE 
009-114-D11CACCGCACNONE 
009-134-G11CACCGCACNONE 
009-151-H05CACCGCACNONE 
009-194-A09CACCGCACNONE 
AK059816CACCGCACConserved hypothetical protein. 
AK069489CACCGCACNONE 
J023024J01CACCGCACNONE 
J065087M04CACCGCACNONE 
J065089E20CACCGCACNONE 
J065137K15CACCGCACNONE 
Os02g0725300AK120054CACCGCACNONE 
AK120054CACCGCACNONE 
J013000L05CACCGCACNONE 
J013000L05CACCGCACNONE 
J065194M19CACCGCACNONE 
J065194M19CACCGCACNONE 
Os02g0741100AK068712CACCGCACSimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144CACCGCACNONE 
J065056A02CACCGCACNONE 
J065212F10CACCGCACNONE 
J080005J10CACCGCACNONE 
J080013A11CACCGCACNONE 
J080015E01CACCGCACNONE 
J080022G23CACCGCACNONE 
J080025C13CACCGCACNONE 
J080026P14CACCGCACNONE 
J080027D22CACCGCACNONE 
J080027G13CACCGCACNONE 
J080027L23CACCGCACNONE 
J080027N23CACCGCACNONE 
J080028F21CACCGCACNONE 
J080028J18CACCGCACNONE 
J080028P22CACCGCACNONE 
J080038P04CACCGCACNONE 
J080042M11CACCGCACNONE 
J080043B19CACCGCACNONE 
J080045J23CACCGCACNONE 
J080047B06CACCGCACNONE 
J080052F04CACCGCACNONE 
J080057F01CACCGCACNONE 
J080057G03CACCGCACNONE 
J080060H12CACCGCACNONE 
J080061L12CACCGCACNONE 
J080062J17CACCGCACNONE 
J080062M22CACCGCACNONE 
J080072C01CACCGCACNONE 
J080075F01CACCGCACNONE 
J080076A09CACCGCACNONE 
J080076I01CACCGCACNONE 
J080077D01CACCGCACNONE 
J080077F19CACCGCACNONE 
J080079L19CACCGCACNONE 
J080088B03CACCGCACNONE 
J080090J15CACCGCACNONE 
J080092J21CACCGCACNONE 
J080095J12CACCGCACNONE 
J090012C05CACCGCACNONE 
J090039K19CACCGCACNONE 
J090078L12CACCGCACNONE 
Os02g0741800AK073562GTGCGGTGGTGGGSimilar to Permease 1. 
J033048K09GTGCGGTGGTGGGNONE 
J065002G12GTGCGGTGGTGGGNONE 
J065174P12GTGCGGTGGTGGGNONE 
J065208H13GTGCGGTGGTGGGNONE 
J065218J01GTGCGGTGGTGGGNONE 
Os02g0758200AK111266CACCGCACConserved hypothetical protein. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0795900012-075-B04AATGGGCCACCGCACNONE 
AK105305AATGGGCCACCGCACSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21AATGGGCCACCGCACNONE 
Os02g0828800AK062497CGCACCGCACConserved hypothetical protein. 
Os03g0120300AK066854CACCGCACProtein of unknown function DUF1084 family protein. 
AK104882CACCGCACNONE 
J013075C10CACCGCACNONE 
J090012B18CACCGCACNONE 
J090087J08CACCGCACNONE 
Os03g0132000AK105769CGCACCGCACSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGCACCGCACNONE 
Os03g0136200004-011-E10CACCGCACCGCNONE 
006-067-A08CACCGCACCGCNONE 
011-007-E02CACCGCACCGCNONE 
011-099-H10CACCGCACCGCNONE 
012-044-D08CACCGCACCGCNONE 
013-045-G12CACCGCACCGCNONE 
013-062-C09CACCGCACCGCNONE 
013-072-F09CACCGCACCGCNONE 
013-085-B12CACCGCACCGCNONE 
013-097-E09CACCGCACCGCNONE 
013-097-F09CACCGCACCGCNONE 
014-013-C09CACCGCACCGCNONE 
014-082-D08CACCGCACCGCNONE 
015-071-A09CACCGCACCGCNONE 
AF042333CACCGCACCGCNONE 
AK060887CACCGCACCGCNONE 
AK121681CACCGCACCGC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14CACCGCACCGCNONE 
J013123F01CACCGCACCGCNONE 
J023050A02CACCGCACCGCNONE 
J033046H22CACCGCACCGCNONE 
J033070A11CACCGCACCGCNONE 
J065059G11CACCGCACCGCNONE 
J065068F10CACCGCACCGCNONE 
J065164A10CACCGCACCGCNONE 
J075031F07CACCGCACCGCNONE 
J075054J01CACCGCACCGCNONE 
J075086M04CACCGCACCGCNONE 
J075118K23CACCGCACCGCNONE 
J075122A09CACCGCACCGCNONE 
J075123D06CACCGCACCGCNONE 
J075129A22CACCGCACCGCNONE 
J075161E07CACCGCACCGCNONE 
J075179H04CACCGCACCGCNONE 
J075181C06CACCGCACCGCNONE 
J075186A12CACCGCACCGCNONE 
J090014H16CACCGCACCGCNONE 
J090045G17CACCGCACCGCNONE 
J090048B09CACCGCACCGCNONE 
J090052J23CACCGCACCGCNONE 
J090052K22CACCGCACCGCNONE 
J090059F10CACCGCACCGCNONE 
J090080F19CACCGCACCGCNONE 
J100039J08CACCGCACCGCNONE 
J100044K02CACCGCACCGCNONE 
J100051E16CACCGCACCGCNONE 
J100053F08CACCGCACCGCNONE 
J100056F07CACCGCACCGCNONE 
J100058A10CACCGCACCGCNONE 
Os03g0140700AK070000CACCGCACTetratricopeptide-like helical domain containing protein. 
Os03g0149400AK111396GCGGTGCGGTGCGProtein prenyltransferase domain containing protein. 
Os03g0152100AY224589CACCGCACE2F dimerization factor. 
J075118G09CACCGCACNONE 
J075172D06CACCGCACNONE 
J075175O16CACCGCACNONE 
Os03g0177100AK068092GTGCGGTGConserved hypothetical protein. 
J100036F01GTGCGGTGNONE 
J100040N06GTGCGGTGNONE 
J100043E08GTGCGGTGNONE 
Os03g0181100AK067971GCCCAACCGCACCGCACNONE 
AK120087GCCCAACCGCACCGCACZIM domain containing protein. 
J013123K19GCCCAACCGCACCGCACNONE 
J100077H14GCCCAACCGCACCGCACNONE 
Os03g0192600006-033-B01CACCGCACNONE 
006-079-H12CACCGCACNONE 
009-092-E03CACCGCACNONE 
AK061461CACCGCACNONE 
AK105970CACCGCACPlant lipid transfer protein/Par allergen family protein. 
J065152D05CACCGCACNONE 
J100056I22CACCGCACNONE 
Os03g0238300AK059494CACCGCACGCGInositol polyphosphate related phosphatase domain containing protein. 
AK122075CACCGCACGCGNONE 
J033118P13CACCGCACGCGNONE 
Os03g0251500AK101151CACCGCACNONE 
AK119298CACCGCACSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0292100Os03g0292100CACCGCACGCGTCCProtein phosphatase 2C family protein. 
Os03g0293500015-054-D06CGCACCGCACNONE 
AK101594CGCACCGCACSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500CGCACCGCACNONE 
J033051F01CGCACCGCACNONE 
J090058D14CGCACCGCACNONE 
J100037N18CGCACCGCACNONE 
J100042J23CGCACCGCACNONE 
J100053E20CGCACCGCACNONE 
J100060G07CGCACCGCACNONE 
U27350CGCACCGCACNONE 
Os03g0307900AK072469GTGCGGTGConserved hypothetical protein. 
Os03g0308000016-023-H09CACCGCACNONE 
AK100355CACCGCACUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CACCGCACNONE 
J023043K04CACCGCACNONE 
J023083I20CACCGCACNONE 
J033068F22CACCGCACNONE 
J033125P21CACCGCACNONE 
J065207A22CACCGCACNONE 
J100018D20CACCGCACNONE 
J100026L17CACCGCACNONE 
J100055D14CACCGCACNONE 
J100060P03CACCGCACNONE 
J100078A20CACCGCACNONE 
Os03g0333800AK066413GTGCGGTGProtein of unknown function DUF1618 domain containing protein. 
J013059N02GTGCGGTGNONE 
J013065M24GTGCGGTGNONE 
J023090L08GTGCGGTGNONE 
J065098J08GTGCGGTGNONE 
J065154I19GTGCGGTGNONE 
J065170N05GTGCGGTGNONE 
J075012D14GTGCGGTGNONE 
J075014D07GTGCGGTGNONE 
J075032H09GTGCGGTGNONE 
J075041E06GTGCGGTGNONE 
J075050D17GTGCGGTGNONE 
J075184M21GTGCGGTGNONE 
J075199J06GTGCGGTGNONE 
J090043F07GTGCGGTGNONE 
J090074F11GTGCGGTGNONE 
Os03g0347700AK110492CACCGCACNPH3 domain containing protein. 
Os03g0596800AK073603CACCGCACConserved hypothetical protein. 
J033052N01CACCGCACNONE 
Os03g0655700AK120254GTGCGGTGSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0656500AK121052CGCACCGCACGCGSimilar to K-exchanger-like protein. 
J065195N11CGCACCGCACGCGNONE 
J065197F16CGCACCGCACGCGNONE 
J075022O03CGCACCGCACGCGNONE 
J075056N16CGCACCGCACGCGNONE 
J075139P11CGCACCGCACGCGNONE 
Os03g0659300J065130F16GTGCGGTGCGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
Os03g0663800011-023-B06CACCGCACNONE 
011-033-C06CACCGCACNONE 
012-011-E03CACCGCACNONE 
012-014-F04CACCGCACNONE 
012-027-C01CACCGCACNONE 
012-027-H07CACCGCACNONE 
012-031-A02CACCGCACNONE 
012-044-E05CACCGCACNONE 
012-045-G10CACCGCACNONE 
012-049-H02CACCGCACNONE 
012-053-G08CACCGCACNONE 
012-058-D07CACCGCACNONE 
012-061-H02CACCGCACNONE 
012-066-A02CACCGCACNONE 
012-074-F12CACCGCACNONE 
012-079-D08CACCGCACNONE 
012-081-E05CACCGCACNONE 
012-083-F04CACCGCACNONE 
012-084-F08CACCGCACNONE 
012-086-E08CACCGCACNONE 
012-086-F01CACCGCACNONE 
012-087-F03CACCGCACNONE 
012-087-H02CACCGCACNONE 
012-088-E05CACCGCACNONE 
012-089-B02CACCGCACNONE 
014-016-A04CACCGCACNONE 
AK105347CACCGCACNONE 
J075032I06CACCGCACNONE 
J075041O22CACCGCACNONE 
J075093E24CACCGCACNONE 
J075094E06CACCGCACNONE 
U45322CACCGCACCupin region domain containing protein. 
Os03g0675300015-081-H08CGCACCGCACCGCNONE 
AK106417CGCACCGCACCGCAntihaemostatic protein domain containing protein. 
Os03g0699600AK070428CACCGCACGCGCyclin-like F-box domain containing protein. 
Os03g0701200006-042-B09CACCGCACNONE 
006-097-E12CACCGCACNONE 
AK061528CACCGCACNONE 
AK061982CACCGCACNONE 
AK099563CACCGCACSimilar to Sugar-starvation induced protein (Fragment). 
J065034C24CACCGCACNONE 
J075007L05CACCGCACNONE 
J075104M20CACCGCACNONE 
J075127H03CACCGCACNONE 
Os03g0716200Os03g0716200GCGACGCGCACCGCACCGCConserved hypothetical protein. 
Os03g0745000AK109590CGCCACGTCACCGCACNONE 
AY332465CGCCACGTCACCGCACNONE 
AY344486CGCCACGTCACCGCACNONE 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0752700011-093-A02GTGCGGTGCGNONE 
AK122157GTGCGGTGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03GTGCGGTGCGNONE 
J033096O19GTGCGGTGCGNONE 
J033145P19GTGCGGTGCGNONE 
J065008K09GTGCGGTGCGNONE 
J065027J08GTGCGGTGCGNONE 
J065073H12GTGCGGTGCGNONE 
J065078G14GTGCGGTGCGNONE 
J065092L12GTGCGGTGCGNONE 
J065108D11GTGCGGTGCGNONE 
J065140G10GTGCGGTGCGNONE 
J065161D24GTGCGGTGCGNONE 
J065170F04GTGCGGTGCGNONE 
J075004K20GTGCGGTGCGNONE 
J075069F16GTGCGGTGCGNONE 
J075085B12GTGCGGTGCGNONE 
J075087D24GTGCGGTGCGNONE 
J075102G15GTGCGGTGCGNONE 
J075123M06GTGCGGTGCGNONE 
J090058D24GTGCGGTGCGNONE 
J090068I12GTGCGGTGCGNONE 
J090094A19GTGCGGTGCGNONE 
Os03g0762400AK071181CATCCACCGCACCGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20CATCCACCGCACCGCNONE 
J033039C18CATCCACCGCACCGCNONE 
J033108N03CATCCACCGCACCGCNONE 
J043017N16CATCCACCGCACCGCNONE 
J065026C13CATCCACCGCACCGCNONE 
J065045C01CATCCACCGCACCGCNONE 
J065045D11CATCCACCGCACCGCNONE 
J065050N09CATCCACCGCACCGCNONE 
J065058P21CATCCACCGCACCGCNONE 
J065075I20CATCCACCGCACCGCNONE 
J065077I17CATCCACCGCACCGCNONE 
J065081I20CATCCACCGCACCGCNONE 
J065085B14CATCCACCGCACCGCNONE 
J065101K21CATCCACCGCACCGCNONE 
J065112A17CATCCACCGCACCGCNONE 
J065112N13CATCCACCGCACCGCNONE 
J065118J02CATCCACCGCACCGCNONE 
J065123E01CATCCACCGCACCGCNONE 
J065134N12CATCCACCGCACCGCNONE 
J065139L04CATCCACCGCACCGCNONE 
J065141I11CATCCACCGCACCGCNONE 
J065161J24CATCCACCGCACCGCNONE 
J065164I10CATCCACCGCACCGCNONE 
J065171L01CATCCACCGCACCGCNONE 
J065178P21CATCCACCGCACCGCNONE 
J065185L24CATCCACCGCACCGCNONE 
J065219C04CATCCACCGCACCGCNONE 
J075029B07CATCCACCGCACCGCNONE 
J075033G20CATCCACCGCACCGCNONE 
J075054N01CATCCACCGCACCGCNONE 
J075068B22CATCCACCGCACCGCNONE 
J075096N11CATCCACCGCACCGCNONE 
J075098C11CATCCACCGCACCGCNONE 
J075115J22CATCCACCGCACCGCNONE 
J075127D11CATCCACCGCACCGCNONE 
J075156J21CATCCACCGCACCGCNONE 
J075166G08CATCCACCGCACCGCNONE 
J075166P17CATCCACCGCACCGCNONE 
J075170O18CATCCACCGCACCGCNONE 
J075181A16CATCCACCGCACCGCNONE 
J075195J11CATCCACCGCACCGCNONE 
Os03g0808300006-053-B11CGCACCGCACCGCNONE 
006-057-A01CGCACCGCACCGCNONE 
006-090-F05CGCACCGCACCGCNONE 
006-106-G01CGCACCGCACCGCNONE 
006-120-D10CGCACCGCACCGCNONE 
009-139-H09CGCACCGCACCGCNONE 
AK109389CGCACCGCACCGCRemorin, C-terminal region domain containing protein. 
J033065F13CGCACCGCACCGCNONE 
J053045H15CGCACCGCACCGCNONE 
J065021C02CGCACCGCACCGCNONE 
J065021D01CGCACCGCACCGCNONE 
J065039B14CGCACCGCACCGCNONE 
J065064J22CGCACCGCACCGCNONE 
J065167I09CGCACCGCACCGCNONE 
J065170A13CGCACCGCACCGCNONE 
J065183J10CGCACCGCACCGCNONE 
J065202K10CGCACCGCACCGCNONE 
J065218F21CGCACCGCACCGCNONE 
J075028D07CGCACCGCACCGCNONE 
J100048J08CGCACCGCACCGCNONE 
J100050H06CGCACCGCACCGCNONE 
J100054M24CGCACCGCACCGCNONE 
J100068G07CGCACCGCACCGCNONE 
J100079F23CGCACCGCACCGCNONE 
Os03g0851700AK068082GTGCGGTGSimilar to TGB12K interacting protein 3. 
Os03g0856500AK061449GTGCGGTGCGSimilar to Plastid-specific 30S ribosomal protein 1, chloroplast precursor (CS- S5) (CS5) (S22) (Ribosomal protein 1) (PSRP-1). 
AK071750GTGCGGTGCGNONE 
AK104733GTGCGGTGCGNONE 
Os04g0119500AJ698084CACCGCACNONE 
AK061898CACCGCACNONE 
AK065035CACCGCACSimilar to Membrane related protein-like. 
J013001H07CACCGCACNONE 
J013128B11CACCGCACNONE 
J013153L13CACCGCACNONE 
J013157F08CACCGCACNONE 
J065140L14CACCGCACNONE 
J075147J12CACCGCACNONE 
J090087C14CACCGCACNONE 
J100048O09CACCGCACNONE 
J100051O16CACCGCACNONE 
J100083H22CACCGCACNONE 
Os04g0281900006-042-E01CACCGCACNONE 
006-085-B12CACCGCACNONE 
009-029-B04CACCGCACNONE 
009-092-C08CACCGCACNONE 
009-168-H08CACCGCACNONE 
AK060229CACCGCACNONE 
AK061149CACCGCACProtein of unknown function DUF588 family protein. 
J065056F11CACCGCACNONE 
J065136G17CACCGCACNONE 
J065142I09CACCGCACNONE 
J065163L07CACCGCACNONE 
J065191F15CACCGCACNONE 
J065202P13CACCGCACNONE 
J075046E09CACCGCACNONE 
J075086M19CACCGCACNONE 
J075116D21CACCGCACNONE 
J075118N02CACCGCACNONE 
J075181M06CACCGCACNONE 
J075190I20CACCGCACNONE 
J075197D04CACCGCACNONE 
J090047D09CACCGCACNONE 
Os04g0306400AK103443CACCGCACRibose 5-phosphate isomerase family protein. 
J075058M23CACCGCACNONE 
J090003E11CACCGCACNONE 
Os04g0317500AK069922CACCGCACPollen allergen Lol p2 family protein. 
Os04g0352200AK103395GTGCGGTGConserved hypothetical protein. 
J033127M23GTGCGGTGNONE 
Os04g0412700AK108347CACCGCACCarbonic anhydrase, eukaryotic family protein. 
J090084I06CACCGCACNONE 
Os04g0477500AK063950CGCACCGCACCGCNONE 
AK067372CGCACCGCACCGCGlycosyl transferase, family 17 protein. 
AK100897CGCACCGCACCGCNONE 
J013106K01CGCACCGCACCGCNONE 
J043012L06CGCACCGCACCGCNONE 
J065025M07CGCACCGCACCGCNONE 
J065025M08CGCACCGCACCGCNONE 
Os04g0489600003-130-E01CGCACCGCACNONE 
AK062301CGCACCGCACNONE 
AK068039CGCACCGCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0503800J065116G03GTGCGGTGNONE 
Os04g0546800014-054-C05CACCGCACNONE 
015-034-B06CACCGCACNONE 
015-060-H04CACCGCACNONE 
015-098-G01CACCGCACNONE 
015-099-G05CACCGCACNONE 
016-062-D01CACCGCACNONE 
016-078-G01CACCGCACNONE 
J023002C20CACCGCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
J065038P12CACCGCACNONE 
J100039E18CACCGCACNONE 
Os04g0561200AK107862CCCCACACCGCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCCACACCGCACNONE 
J065042H13CCCCACACCGCACNONE 
J065079N01CCCCACACCGCACNONE 
J065190N16CCCCACACCGCACNONE 
J065191H22CCCCACACCGCACNONE 
Os04g0613700AK064783CACCGCACUTP--glucose-1-phosphate uridylyltransferase family protein. 
J013000B13CACCGCACNONE 
J100067C04CACCGCACNONE 
J100089M21CACCGCACNONE 
Os04g0617050J065197A20GTGCGGTGNONE 
J090067K01GTGCGGTGAuxin responsive SAUR protein family protein. 
Os04g0630800AK067411CGCACCGCACSimilar to Anthocyanidin reductase. 
J013104E10CGCACCGCACNONE 
J065017A11CGCACCGCACNONE 
J065042H18CGCACCGCACNONE 
J065058D07CGCACCGCACNONE 
J065079F24CGCACCGCACNONE 
J065114F06CGCACCGCACNONE 
J065131N19CGCACCGCACNONE 
J065160M03CGCACCGCACNONE 
J075033N11CGCACCGCACNONE 
J075065B11CGCACCGCACNONE 
J075074A20CGCACCGCACNONE 
J075108C15CGCACCGCACNONE 
J100065B08CGCACCGCACNONE 
J100083G02CGCACCGCACNONE 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0638800AK070319CACCGCACGCGProtein of unknown function DUF617, plant family protein. 
AK071753CACCGCACGCGNONE 
Os04g0662900AK061921CACCGCACNONE 
AK065171CACCGCACCurculin-like (mannose-binding) lectin domain containing protein. 
AK099504CACCGCACNONE 
J053055I07CACCGCACNONE 
Os04g0672600AK070283GTGCGGTGLeucine rich repeat, N-terminal domain containing protein. 
J023048N04GTGCGGTGNONE 
Os04g0679400004-018-E07CACCGCACGTCACNONE 
006-039-G08CACCGCACGTCACNONE 
006-045-D06CACCGCACGTCACNONE 
006-048-B12CACCGCACGTCACNONE 
006-061-C05CACCGCACGTCACNONE 
006-062-A03CACCGCACGTCACNONE 
006-063-A06CACCGCACGTCACNONE 
006-066-B04CACCGCACGTCACNONE 
006-068-H12CACCGCACGTCACNONE 
006-075-C08CACCGCACGTCACNONE 
006-076-A02CACCGCACGTCACNONE 
006-083-B04CACCGCACGTCACNONE 
006-090-F04CACCGCACGTCACNONE 
006-099-H12CACCGCACGTCACNONE 
006-105-F10CACCGCACGTCACNONE 
006-106-G03CACCGCACGTCACNONE 
006-107-B05CACCGCACGTCACNONE 
006-108-F06CACCGCACGTCACNONE 
006-109-E09CACCGCACGTCACNONE 
006-111-B02CACCGCACGTCACNONE 
006-113-C10CACCGCACGTCACNONE 
009-128-G11CACCGCACGTCACNONE 
009-150-B02CACCGCACGTCACNONE 
009-156-E08CACCGCACGTCACNONE 
012-015-E07CACCGCACGTCACNONE 
012-027-B04CACCGCACGTCACNONE 
012-030-A03CACCGCACGTCACNONE 
012-066-E06CACCGCACGTCACNONE 
012-083-A09CACCGCACGTCACNONE 
012-088-E07CACCGCACGTCACNONE 
012-097-F08CACCGCACGTCACNONE 
013-010-D04CACCGCACGTCACNONE 
013-012-A01CACCGCACGTCACNONE 
013-016-D04CACCGCACGTCACNONE 
013-041-B01CACCGCACGTCACNONE 
013-043-F10CACCGCACGTCACNONE 
013-047-C12CACCGCACGTCACNONE 
013-058-E10CACCGCACGTCACNONE 
013-063-B07CACCGCACGTCACNONE 
013-076-A01CACCGCACGTCACNONE 
013-081-D04CACCGCACGTCACNONE 
013-090-D05CACCGCACGTCACNONE 
013-091-B07CACCGCACGTCACNONE 
014-030-A04CACCGCACGTCACNONE 
014-055-A04CACCGCACGTCACNONE 
014-070-A04CACCGCACGTCACNONE 
015-033-C10CACCGCACGTCACNONE 
015-040-H10CACCGCACGTCACNONE 
016-006-F03CACCGCACGTCACNONE 
016-090-B03CACCGCACGTCACNONE 
AK065314CACCGCACGTCACNONE 
AK068608CACCGCACGTCACNONE 
AK099009CACCGCACGTCACNONE 
AK099087CACCGCACGTCACNONE 
AK099368CACCGCACGTCACNONE 
AK099653CACCGCACGTCACNONE 
AK099975CACCGCACGTCACNONE 
AK104249CACCGCACGTCACNONE 
AK104376CACCGCACGTCACNONE 
AK106133CACCGCACGTCACNONE 
AK119666CACCGCACGTCACNONE 
AK120508CACCGCACGTCACNONE 
AK121152CACCGCACGTCACSimilar to Ripening-associated protein (Fragment). 
J013002O24CACCGCACGTCACNONE 
J013023H15CACCGCACGTCACNONE 
J013036E15CACCGCACGTCACNONE 
J013042D22CACCGCACGTCACNONE 
J013045A07CACCGCACGTCACNONE 
J013056D24CACCGCACGTCACNONE 
J013057D10CACCGCACGTCACNONE 
J013059B08CACCGCACGTCACNONE 
J013059D01CACCGCACGTCACNONE 
J013060C02CACCGCACGTCACNONE 
J013070N22CACCGCACGTCACNONE 
J013071K02CACCGCACGTCACNONE 
J013073G04CACCGCACGTCACNONE 
J013096J17CACCGCACGTCACNONE 
J013098G08CACCGCACGTCACNONE 
J013123H02CACCGCACGTCACNONE 
J013135I23CACCGCACGTCACNONE 
J013149G08CACCGCACGTCACNONE 
J013155N04CACCGCACGTCACNONE 
J013156C23CACCGCACGTCACNONE 
J013157C07CACCGCACGTCACNONE 
J013157D23CACCGCACGTCACNONE 
J023001K19CACCGCACGTCACNONE 
J023002H21CACCGCACGTCACNONE 
J023003H14CACCGCACGTCACNONE 
J023006D09CACCGCACGTCACNONE 
J023010E07CACCGCACGTCACNONE 
J023014E18CACCGCACGTCACNONE 
J023024G16CACCGCACGTCACNONE 
J023034F13CACCGCACGTCACNONE 
J023034F17CACCGCACGTCACNONE 
J023045C18CACCGCACGTCACNONE 
J023058P17CACCGCACGTCACNONE 
J023061H18CACCGCACGTCACNONE 
J023064H05CACCGCACGTCACNONE 
J023078J16CACCGCACGTCACNONE 
J023079L03CACCGCACGTCACNONE 
J023085N10CACCGCACGTCACNONE 
J023087G10CACCGCACGTCACNONE 
J023088I02CACCGCACGTCACNONE 
J023093K24CACCGCACGTCACNONE 
J023095H05CACCGCACGTCACNONE 
J023097C02CACCGCACGTCACNONE 
J023101P15CACCGCACGTCACNONE 
J023106C22CACCGCACGTCACNONE 
J023121B08CACCGCACGTCACNONE 
J023121N13CACCGCACGTCACNONE 
J023123F01CACCGCACGTCACNONE 
J023128E14CACCGCACGTCACNONE 
J023128M11CACCGCACGTCACNONE 
J023135L14CACCGCACGTCACNONE 
J023141H20CACCGCACGTCACNONE 
J023150A12CACCGCACGTCACNONE 
J033035G16CACCGCACGTCACNONE 
J033037N04CACCGCACGTCACNONE 
J033041D20CACCGCACGTCACNONE 
J033052O07CACCGCACGTCACNONE 
J033061D19CACCGCACGTCACNONE 
J033068M01CACCGCACGTCACNONE 
J033090I15CACCGCACGTCACNONE 
J033103G06CACCGCACGTCACNONE 
J033117F16CACCGCACGTCACNONE 
J033120H02CACCGCACGTCACNONE 
J033126N05CACCGCACGTCACNONE 
J033136C13CACCGCACGTCACNONE 
J033139H08CACCGCACGTCACNONE 
J043024N03CACCGCACGTCACNONE 
J043027G07CACCGCACGTCACNONE 
J065103L02CACCGCACGTCACNONE 
J065108G02CACCGCACGTCACNONE 
J065175N11CACCGCACGTCACNONE 
J080003B03CACCGCACGTCACNONE 
J080007J02CACCGCACGTCACNONE 
J080008D02CACCGCACGTCACNONE 
J080008E04CACCGCACGTCACNONE 
J080015H20CACCGCACGTCACNONE 
J080017J09CACCGCACGTCACNONE 
J080020O09CACCGCACGTCACNONE 
J080021F06CACCGCACGTCACNONE 
J080027L11CACCGCACGTCACNONE 
J080028J11CACCGCACGTCACNONE 
J080030G17CACCGCACGTCACNONE 
J080035E09CACCGCACGTCACNONE 
J080035F20CACCGCACGTCACNONE 
J080036H18CACCGCACGTCACNONE 
J080039M19CACCGCACGTCACNONE 
J080042A21CACCGCACGTCACNONE 
J080043A07CACCGCACGTCACNONE 
J080052A16CACCGCACGTCACNONE 
J080055G22CACCGCACGTCACNONE 
J080061O12CACCGCACGTCACNONE 
J080062I05CACCGCACGTCACNONE 
J080068K18CACCGCACGTCACNONE 
J080070G01CACCGCACGTCACNONE 
J080077F11CACCGCACGTCACNONE 
J080079N14CACCGCACGTCACNONE 
J080084G11CACCGCACGTCACNONE 
J080093C04CACCGCACGTCACNONE 
J090056G10CACCGCACGTCACNONE 
J090091H01CACCGCACGTCACNONE 
J100025J03CACCGCACGTCACNONE 
J100027L16CACCGCACGTCACNONE 
J100030B22CACCGCACGTCACNONE 
J100048H23CACCGCACGTCACNONE 
J100050C24CACCGCACGTCACNONE 
J100055F22CACCGCACGTCACNONE 
J100057L08CACCGCACGTCACNONE 
J100065E17CACCGCACGTCACNONE 
J100072C03CACCGCACGTCACNONE 
Os05g0103300009-149-B02CACCGCACNONE 
AK062996CACCGCACNONE 
AK071540CACCGCACSimilar to AT.I.24-5 protein (Fragment). 
J065041E04CACCGCACNONE 
J065053J17CACCGCACNONE 
J065092B22CACCGCACNONE 
J065102J24CACCGCACNONE 
J065113A08CACCGCACNONE 
J065149D07CACCGCACNONE 
J065169B02CACCGCACNONE 
J075150C06CACCGCACNONE 
Os05g0161400AK105485GTGCGGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0188500AK069089CACCGCACArmadillo-like helical domain containing protein. 
AK100219CACCGCACNONE 
Os05g0408300AK068553CACCGCACConserved hypothetical protein. 
Os05g0438500006-102-F01CACCGCACNONE 
AK059951CACCGCACSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0442700014-053-G09CACCGCACNONE 
AK063703CACCGCACNo apical meristem (NAM) protein domain containing protein. 
J100033L06CACCGCACNONE 
J100069H02CACCGCACNONE 
J100079B15CACCGCACNONE 
Os05g0455600AK060152CGCACCGCACGCGPrenylated rab acceptor PRA1 family protein. 
AK103269CGCACCGCACGCGNONE 
AK105995CGCACCGCACGCGNONE 
J023109E13CGCACCGCACGCGNONE 
J023120K13CGCACCGCACGCGNONE 
J033124H03CGCACCGCACGCGNONE 
Os05g0457800Os05g0457800GGTGTGTGCGGTGSimilar to Glycerol-3-phosphate acyltransferase 5 (EC 2.3.1.15) (AtGPAT5). 
Os05g0481100AK068900GTGCGGTGNONE 
Os05g0494600AK108158CACCGCACConserved hypothetical protein. 
Os05g0499800016-065-G04CACCGCACNONE 
AK064392CACCGCACNONE 
AK103146CACCGCACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11CACCGCACNONE 
J033120I02CACCGCACNONE 
Os05g0522500AF372831CGCACCGCACNONE 
AK065207CGCACCGCACSimilar to Hexokinase 1 (EC 2.7.1.1). 
J013002F14CGCACCGCACNONE 
J013059E21CGCACCGCACNONE 
J023039E02CGCACCGCACNONE 
J023061P10CGCACCGCACNONE 
J023093D12CGCACCGCACNONE 
J023093H05CGCACCGCACNONE 
J033052F21CGCACCGCACNONE 
J043012F23CGCACCGCACNONE 
Os05g0553000015-052-H09CACCGCACCCACTCTNONE 
AK061681CACCGCACCCACTCTATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143CACCGCACCCACTCTNONE 
J013068H04CACCGCACCCACTCTNONE 
J013124C06CACCGCACCCACTCTNONE 
J033127N11CACCGCACCCACTCTNONE 
J100056O04CACCGCACCCACTCTNONE 
Os05g0554400AK102948GTGCGGTGNONE 
AK107427GTGCGGTGPhosphatidyl serine synthase family protein. 
J023089D16GTGCGGTGNONE 
Os05g0576300015-055-B11CACCGCACNONE 
AK106354CACCGCACZinc finger, CCCH-type domain containing protein. 
Os06g0114700AK061552CACCGCACProtein of unknown function DUF1218 family protein. 
AK098848CACCGCACNONE 
AK122142CACCGCACNONE 
J013000D16CACCGCACNONE 
Os06g0136900AK107405GTGGGTCCCACCGCACProtein of unknown function DUF296 domain containing protein. 
Os06g0217300AK111859CGCACCGCACSimilar to Transcription factor MADS55. 
AY345223CGCACCGCACNONE 
Os06g0266800009-057-G11CACCGCACNONE 
009-057-G11CACCGCACNONE 
AK062516CACCGCACSimilar to GAST1 protein precursor. 
AK062516CACCGCACSimilar to GAST1 protein precursor. 
Os06g0348800AF318581CACCGCACNONE 
AK061946CACCGCACNONE 
AK065184CACCGCACNONE 
AK098909CACCGCACNONE 
AK098915CACCGCACHomeodomain-like containing protein. 
AK122161CACCGCACNONE 
J013002D22CACCGCACNONE 
J013002F22CACCGCACNONE 
J013002I19CACCGCACNONE 
J013022A07CACCGCACNONE 
J013135J08CACCGCACNONE 
J033147G01CACCGCACNONE 
J075012G19CACCGCACNONE 
J075049L03CACCGCACNONE 
J075068G02CACCGCACNONE 
J075145E15CACCGCACNONE 
J075145J09CACCGCACNONE 
J075155B11CACCGCACNONE 
J075173E22CACCGCACNONE 
J075180B11CACCGCACNONE 
J075195D12CACCGCACNONE 
Os06g0476200AK065566CACCGCACNONE 
AK068502CACCGCACSimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0636700AK058562CACCGCACLipolytic enzyme, G-D-S-L family protein. 
Os06g0648200009-150-E06CACCGCACNONE 
014-034-H10CACCGCACNONE 
015-035-E11CACCGCACNONE 
AK063001CACCGCACNONE 
AK063675CACCGCACNONE 
AK106303CACCGCACConserved hypothetical protein. 
Os06g0660400AK111110GTGCGGTGConserved hypothetical protein. 
Os06g0683800AK110639CACCGCACConserved hypothetical protein. 
Os07g0267300AK071612CACCGCACHypothetical protein. 
J065115L02CACCGCACNONE 
J075013O04CACCGCACNONE 
Os07g0406300AK064867CACCGCACSimilar to Glucose-6-phosphate 1-dehydrogenase precursor (EC 1.1.1.49). 
AK099891CACCGCACNONE 
AY339367CACCGCACNONE 
Os07g0410300AK108503GCGGGCCCCACCGCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0432800012-025-C05CACCGCACNONE 
AK063456CACCGCACMyb, DNA-binding domain containing protein. 
J053025J09CACCGCACNONE 
J053052K16CACCGCACNONE 
J053060G01CACCGCACNONE 
J053096H11CACCGCACNONE 
J075033O13CACCGCACNONE 
Os07g0437500AK103253CACCGCACSimilar to Tyrosine decarboxylase 1 (EC 4.1.1.25). 
Os07g0438800AK060412CGCGTGCGGTGNONE 
AK100065CGCGTGCGGTGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CGCGTGCGGTGNONE 
AY224478CGCGTGCGGTGNONE 
J013160O05CGCGTGCGGTGNONE 
J023030C05CGCGTGCGGTGNONE 
J033025O04CGCGTGCGGTGNONE 
J033121P15CGCGTGCGGTGNONE 
J043034I23CGCGTGCGGTGNONE 
J065022N01CGCGTGCGGTGNONE 
J065022N02CGCGTGCGGTGNONE 
J065023M01CGCGTGCGGTGNONE 
J065101G13CGCGTGCGGTGNONE 
J075058P13CGCGTGCGGTGNONE 
J075186K10CGCGTGCGGTGNONE 
J075199F17CGCGTGCGGTGNONE 
Os07g0529700AK073731CACCGCACNONE 
AK111340CACCGCACSimilar to Xyloglucan endo-transglycosylase-like protein. 
J033064P12CACCGCACNONE 
J065038N06CACCGCACNONE 
J075150L14CACCGCACNONE 
J075178H22CACCGCACNONE 
J075188N19CACCGCACNONE 
Os07g0546400AK069172GTGCGGTGNPH3 domain containing protein. 
J013147K21GTGCGGTGNONE 
J023004J07GTGCGGTGNONE 
Os07g0568700005-009-E12CACCGCACCGCNONE 
006-100-D05CACCGCACCGCNONE 
AF466357CACCGCACCGCNONE 
AK061685CACCGCACCGCNONE 
AK101897CACCGCACCGCPolygalacturonase inhibitor 1 precursor (Polygalacturonase-inhibiting protein) (Floral organ regulator 1). 
J013067A12CACCGCACCGCNONE 
J013129M22CACCGCACCGCNONE 
J013170I15CACCGCACCGCNONE 
J023008C13CACCGCACCGCNONE 
J023010N01CACCGCACCGCNONE 
J023024B08CACCGCACCGCNONE 
J023026P11CACCGCACCGCNONE 
J023030D12CACCGCACCGCNONE 
J023031A19CACCGCACCGCNONE 
J023061K19CACCGCACCGCNONE 
J023065P08CACCGCACCGCNONE 
J023074J10CACCGCACCGCNONE 
J023078B17CACCGCACCGCNONE 
J023080N22CACCGCACCGCNONE 
J023098E21CACCGCACCGCNONE 
J023101G13CACCGCACCGCNONE 
J023106D07CACCGCACCGCNONE 
J023123F20CACCGCACCGCNONE 
J023133B22CACCGCACCGCNONE 
J023148C22CACCGCACCGCNONE 
J033060O10CACCGCACCGCNONE 
J033068F12CACCGCACCGCNONE 
J033070P18CACCGCACCGCNONE 
J033075F21CACCGCACCGCNONE 
J033079P04CACCGCACCGCNONE 
J033082B10CACCGCACCGCNONE 
J033086E07CACCGCACCGCNONE 
J033108N11CACCGCACCGCNONE 
J033122I16CACCGCACCGCNONE 
J033145B19CACCGCACCGCNONE 
J043040A18CACCGCACCGCNONE 
J065081A15CACCGCACCGCNONE 
J080004O13CACCGCACCGCNONE 
J080005J19CACCGCACCGCNONE 
J080011E13CACCGCACCGCNONE 
J080014F24CACCGCACCGCNONE 
J080021L01CACCGCACCGCNONE 
J080025E09CACCGCACCGCNONE 
J080037I21CACCGCACCGCNONE 
J080039G24CACCGCACCGCNONE 
J080044I04CACCGCACCGCNONE 
J080053A18CACCGCACCGCNONE 
J080053C03CACCGCACCGCNONE 
J080054D10CACCGCACCGCNONE 
J080058J03CACCGCACCGCNONE 
J080068I04CACCGCACCGCNONE 
J080077G15CACCGCACCGCNONE 
J080086L13CACCGCACCGCNONE 
J080092F14CACCGCACCGCNONE 
J080092I21CACCGCACCGCNONE 
J080094G12CACCGCACCGCNONE 
J090003H04CACCGCACCGCNONE 
J090031A07CACCGCACCGCNONE 
Os07g0584900AK058404CACCGCACNONE 
AK059561CACCGCACArmadillo-like helical domain containing protein. 
J023062J12CACCGCACNONE 
J075199M03CACCGCACNONE 
Os07g0605200AF091458AGCCCACCGCACNONE 
AF139665AGCCCACCGCACNONE 
AJ011675AGCCCACCGCACNONE 
AK064704AGCCCACCGCACMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15AGCCCACCGCACNONE 
J090034M06AGCCCACCGCACNONE 
J090079L24AGCCCACCGCACNONE 
Os07g0620800AK063671CACCGCACCyclin-like domain containing protein. 
Os07g0623300AK070292GTGCGGTGSimilar to Splicing factor SC35. 
J023050C05GTGCGGTGNONE 
J090025O12GTGCGGTGNONE 
Os07g0623600AK063642GTGGTGGGTGGGGGCGCGGGTGCGGTGConserved hypothetical protein. 
Os07g0672500AK067432CACCGCACSMAD/FHA domain containing protein. 
AK067432CGCACCGCACCGCACSMAD/FHA domain containing protein. 
AK119940CACCGCACNONE 
AK119940CGCACCGCACCGCACNONE 
Os07g0691200AK068807CACCGCACNONE 
AK072158CACCGCACNONE 
J013001D13CACCGCACNONE 
J013022D09CACCGCACNONE 
J013028C24CACCGCACNONE 
J013032M14CACCGCACNONE 
J023097E13CACCGCACNONE 
J065095A22CACCGCACNONE 
Os08g0116500009-007-E05CACCGCACNONE 
009-074-C07CACCGCACNONE 
009-098-A07CACCGCACNONE 
009-100-C03CACCGCACNONE 
009-136-E04CACCGCACNONE 
009-138-B08CACCGCACNONE 
009-144-B06CACCGCACNONE 
009-184-E04CACCGCACNONE 
009-189-F01CACCGCACNONE 
013-006-E05CACCGCACNONE 
013-015-C10CACCGCACNONE 
013-019-F09CACCGCACNONE 
013-020-C01CACCGCACNONE 
013-021-F05CACCGCACNONE 
013-035-D08CACCGCACNONE 
013-038-C09CACCGCACNONE 
013-054-B07CACCGCACNONE 
013-061-G10CACCGCACNONE 
013-074-B01CACCGCACNONE 
013-079-B06CACCGCACNONE 
013-099-B09CACCGCACNONE 
013-099-G11CACCGCACNONE 
014-023-F04CACCGCACNONE 
014-032-C07CACCGCACNONE 
014-045-E02CACCGCACNONE 
014-085-C02CACCGCACNONE 
014-087-F04CACCGCACNONE 
014-089-C04CACCGCACNONE 
014-090-E01CACCGCACNONE 
014-094-G11CACCGCACNONE 
014-097-B07CACCGCACNONE 
015-024-A12CACCGCACNONE 
015-032-C06CACCGCACNONE 
016-053-E09CACCGCACNONE 
016-081-F10CACCGCACNONE 
AK058240CACCGCACSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09CACCGCACNONE 
J023107O19CACCGCACNONE 
J053029K21CACCGCACNONE 
J053073P11CACCGCACNONE 
J053074B04CACCGCACNONE 
J053078M14CACCGCACNONE 
J065001E12CACCGCACNONE 
J065006J12CACCGCACNONE 
J065015C06CACCGCACNONE 
J065025D13CACCGCACNONE 
J065029A04CACCGCACNONE 
J065031D23CACCGCACNONE 
J065032E24CACCGCACNONE 
J065034P16CACCGCACNONE 
J065043B04CACCGCACNONE 
J065044A15CACCGCACNONE 
J065062D18CACCGCACNONE 
J065079G13CACCGCACNONE 
J065080A19CACCGCACNONE 
J065080A20CACCGCACNONE 
J065089N19CACCGCACNONE 
J065111O07CACCGCACNONE 
J065115N15CACCGCACNONE 
J065131A04CACCGCACNONE 
J065138H02CACCGCACNONE 
J065139K10CACCGCACNONE 
J065144A02CACCGCACNONE 
J065155J17CACCGCACNONE 
J065159D18CACCGCACNONE 
J065159I18CACCGCACNONE 
J065167H12CACCGCACNONE 
J065174C22CACCGCACNONE 
J065184A05CACCGCACNONE 
J065188M15CACCGCACNONE 
J065191D23CACCGCACNONE 
J065203C07CACCGCACNONE 
J065207C23CACCGCACNONE 
J065207L16CACCGCACNONE 
J065212F01CACCGCACNONE 
J065212F05CACCGCACNONE 
J075037B07CACCGCACNONE 
J075042F15CACCGCACNONE 
J075059J03CACCGCACNONE 
J075068M18CACCGCACNONE 
J075079E13CACCGCACNONE 
J075081F12CACCGCACNONE 
J075083I05CACCGCACNONE 
J075123K23CACCGCACNONE 
J075142F16CACCGCACNONE 
J075156N03CACCGCACNONE 
J075162K05CACCGCACNONE 
J075171E08CACCGCACNONE 
J075177N03CACCGCACNONE 
J075182K17CACCGCACNONE 
J075186K02CACCGCACNONE 
J075191K05CACCGCACNONE 
J080011E10CACCGCACNONE 
J080016M21CACCGCACNONE 
J080017A17CACCGCACNONE 
J080031O09CACCGCACNONE 
J080039G21CACCGCACNONE 
J080041B01CACCGCACNONE 
J080050G20CACCGCACNONE 
J080054A12CACCGCACNONE 
J080058O08CACCGCACNONE 
J080061N04CACCGCACNONE 
J080064L23CACCGCACNONE 
J080064P05CACCGCACNONE 
J080069I17CACCGCACNONE 
J080070E07CACCGCACNONE 
J080071B20CACCGCACNONE 
J080074L08CACCGCACNONE 
J080076N08CACCGCACNONE 
J080081A14CACCGCACNONE 
J080081J17CACCGCACNONE 
J080085N14CACCGCACNONE 
J080090B09CACCGCACNONE 
J080097L11CACCGCACNONE 
J080306H13CACCGCACNONE 
J080307H13CACCGCACNONE 
J080311F12CACCGCACNONE 
J080316L23CACCGCACNONE 
J080318H02CACCGCACNONE 
J090016L15CACCGCACNONE 
J090019I02CACCGCACNONE 
J090031G21CACCGCACNONE 
J090066C15CACCGCACNONE 
J100032I02CACCGCACNONE 
J100032N07CACCGCACNONE 
J100032N16CACCGCACNONE 
J100041P21CACCGCACNONE 
J100048M04CACCGCACNONE 
J100048M14CACCGCACNONE 
J100063B08CACCGCACNONE 
J100088E20CACCGCACNONE 
J100090I08CACCGCACNONE 
Os08g0345700012-051-H01CGCACCGCACNONE 
AK099939CGCACCGCACSimilar to Fructose-6-phosphate 1-phosphotransferase (Fragment). 
AK101073CGCACCGCACNONE 
AY224499CGCACCGCACNONE 
J023023P15CGCACCGCACNONE 
J023150I11CGCACCGCACNONE 
J033027K12CGCACCGCACNONE 
J033096J12CGCACCGCACNONE 
J033120O05CGCACCGCACNONE 
J033128J22CGCACCGCACNONE 
J033135H10CGCACCGCACNONE 
J033148L22CGCACCGCACNONE 
J065112J19CGCACCGCACNONE 
J065132K06CGCACCGCACNONE 
J065141B09CGCACCGCACNONE 
J090069F12CGCACCGCACNONE 
J100022K08CGCACCGCACNONE 
J100025F21CGCACCGCACNONE 
J100026I24CGCACCGCACNONE 
J100057F02CGCACCGCACNONE 
J100074F15CGCACCGCACNONE 
Os08g0409500AK109792CGCACCGCACVQ domain containing protein. 
Os08g0430000AK120950CACCGCACConserved hypothetical protein. 
Os08g0436100012-038-F12CACCGCACNONE 
AK065062CACCGCACNucleoside phosphatase GDA1/CD39 family protein. 
J065037G17CACCGCACNONE 
J075177H04CACCGCACNONE 
J100024G15CACCGCACNONE 
Os08g0459100AK121795CACCGCACLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0380400009-200-D01CACCGCACGGACGGACNONE 
AK063909CACCGCACGGACGGACNONE 
AK072517CACCGCACGGACGGACConserved hypothetical protein. 
AK073073CACCGCACGGACGGACNONE 
J065205F20CACCGCACGGACGGACNONE 
J100036D22CACCGCACGGACGGACNONE 
J100047M01CACCGCACGGACGGACNONE 
J100071G04CACCGCACGGACGGACNONE 
Os09g0402100009-119-F11CACCGCACNONE 
009-166-C09CACCGCACNONE 
AK068506CACCGCACPF1 protein. 
J065130I01CACCGCACNONE 
L24390CACCGCACNONE 
Os09g0418000006-022-F01CGCACCGCACNONE 
006-038-G10CGCACCGCACNONE 
006-089-G04CGCACCGCACNONE 
006-098-F07CGCACCGCACNONE 
AK061220CGCACCGCACNONE 
AK061493CGCACCGCACNONE 
AK100881CGCACCGCACNONE 
AK119760CGCACCGCACProtein kinase-like domain containing protein. 
J023127H10CGCACCGCACNONE 
J033122J01CGCACCGCACNONE 
J065162D08CGCACCGCACNONE 
J065214P03CGCACCGCACNONE 
J090009B17CGCACCGCACNONE 
J090093C21CGCACCGCACNONE 
J100067C01CGCACCGCACNONE 
J100067P06CGCACCGCACNONE 
Os09g0438000AK109935CACCGCACNONE 
AK109935CACCGCACNONE 
AK109935CGCACCGCACCGCNONE 
AK120739CACCGCACSimilar to RbohAOsp (Fragment). 
AK120739CACCGCACSimilar to RbohAOsp (Fragment). 
AK120739CGCACCGCACCGCSimilar to RbohAOsp (Fragment). 
Os09g0456800006-028-A04CACCGCACNONE 
AK061433CACCGCACSimilar to Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10). 
AK101182CACCGCACNONE 
J033029F08CACCGCACNONE 
J065006I18CACCGCACNONE 
J065078A03CACCGCACNONE 
J065079C11CACCGCACNONE 
J065088F02CACCGCACNONE 
J065105N17CACCGCACNONE 
J100044B07CACCGCACNONE 
J100047C02CACCGCACNONE 
Os09g0459900009-190-G09GCCCACCACACCGCACNONE 
AK063208GCCCACCACACCGCACCyclin-dependent kinase inhibitor family protein. 
AK111010GCCCACCACACCGCACNONE 
Os09g0461500006-107-E02GTGCGGTGCGCCCAGCCNONE 
011-089-D02GTGCGGTGCGCCCAGCCNONE 
AK063400GTGCGGTGCGCCCAGCCNONE 
AK102328GTGCGGTGCGCCCAGCCEsterase/lipase/thioesterase domain containing protein. 
J033090L22GTGCGGTGCGCCCAGCCNONE 
J065031O14GTGCGGTGCGCCCAGCCNONE 
J065083D22GTGCGGTGCGCCCAGCCNONE 
J065182N14GTGCGGTGCGCCCAGCCNONE 
J065190H22GTGCGGTGCGCCCAGCCNONE 
J065219H11GTGCGGTGCGCCCAGCCNONE 
J075007O22GTGCGGTGCGCCCAGCCNONE 
J075025E09GTGCGGTGCGCCCAGCCNONE 
J075041K24GTGCGGTGCGCCCAGCCNONE 
J075046F11GTGCGGTGCGCCCAGCCNONE 
J090032E12GTGCGGTGCGCCCAGCCNONE 
Os09g0476100AK099938CGCACCGCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0502500AK109664GTGCGGTGCGAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os09g0505300AK061352GCGGTGCGGTGSimilar to Br FatA1. 
Os09g0526800014-002-D10GTGCGGTGNONE 
AK060048GTGCGGTGNONE 
AK072174GTGCGGTGNONE 
AK105121GTGCGGTGNC domain containing protein. 
J013135P13GTGCGGTGNONE 
J033135C23GTGCGGTGNONE 
J043036C17GTGCGGTGNONE 
J065066N16GTGCGGTGNONE 
Os09g0532000AK105810ACCCCCCACCGCACCACGCGTNONE 
AY850134ACCCCCCACCGCACCACGCGTConserved hypothetical protein. 
J065022C05ACCCCCCACCGCACCACGCGTNONE 
J065054B06ACCCCCCACCGCACCACGCGTNONE 
J065072C03ACCCCCCACCGCACCACGCGTNONE 
J065121O09ACCCCCCACCGCACCACGCGTNONE 
J065163P22ACCCCCCACCGCACCACGCGTNONE 
J065192G01ACCCCCCACCGCACCACGCGTNONE 
J065194H12ACCCCCCACCGCACCACGCGTNONE 
Os09g0539100AK071977CACCGCACSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CACCGCACNONE 
Os09g0572200AK072621GTGCGGTGConserved hypothetical protein. 
AK109639GTGCGGTGNONE 
Os11g0139400AK107562CACCGCACProtein of unknown function DUF250 domain containing protein. 
Os11g0139500AK121845CACCGCACNONE 
Os11g0181500006-025-C02CGCGTGCGGTGNONE 
AK060074CGCGTGCGGTGNONE 
AK067601CGCGTGCGGTGSimilar to Nitrogen fixation like protein. 
Os11g0215100AK107711CACCGCACPlant disease resistance response protein family protein. 
J065038L01CACCGCACNONE 
Os11g0219000AK066071GTGCGGTGConserved hypothetical protein. 
J013056B11GTGCGGTGNONE 
J080302O12GTGCGGTGNONE 
J080317C21GTGCGGTGNONE 
Os11g0297800AK109882CACCGCACSimilar to Beta-D-xylosidase. 
Os11g0619800016-094-C06GTGCGGTGNONE 
AK107437GTGCGGTGTRAF-like domain containing protein. 
Os11g0671000006-058-H07GTGCGGTGNONE 
006-118-C09GTGCGGTGNONE 
009-030-C11GTGCGGTGNONE 
009-037-A10GTGCGGTGNONE 
009-111-C01GTGCGGTGNONE 
009-122-E10GTGCGGTGNONE 
009-129-C01GTGCGGTGNONE 
009-150-B01GTGCGGTGNONE 
009-156-H02GTGCGGTGNONE 
009-176-C07GTGCGGTGNONE 
009-183-F09GTGCGGTGNONE 
013-044-B09GTGCGGTGNONE 
014-006-D10GTGCGGTGNONE 
AF467730GTGCGGTGNONE 
AK060981GTGCGGTGSimilar to Dormancy-associated protein. 
AK119708GTGCGGTGNONE 
J013026K14GTGCGGTGNONE 
J013029E24GTGCGGTGNONE 
J013037C02GTGCGGTGNONE 
J013048L08GTGCGGTGNONE 
J013059G17GTGCGGTGNONE 
J013064F22GTGCGGTGNONE 
J013065H17GTGCGGTGNONE 
J013073P06GTGCGGTGNONE 
J013088C20GTGCGGTGNONE 
J013112J04GTGCGGTGNONE 
J013130M20GTGCGGTGNONE 
J013151K02GTGCGGTGNONE 
J013156F09GTGCGGTGNONE 
J013158K18GTGCGGTGNONE 
J023014E17GTGCGGTGNONE 
J023024L23GTGCGGTGNONE 
J023031E15GTGCGGTGNONE 
J023034B13GTGCGGTGNONE 
J023036E05GTGCGGTGNONE 
J023041J11GTGCGGTGNONE 
J023078J24GTGCGGTGNONE 
J023111N19GTGCGGTGNONE 
J023128D13GTGCGGTGNONE 
J033033O18GTGCGGTGNONE 
J033100D07GTGCGGTGNONE 
J033106F13GTGCGGTGNONE 
J033117O14GTGCGGTGNONE 
J033120J07GTGCGGTGNONE 
J033127D20GTGCGGTGNONE 
J043001C22GTGCGGTGNONE 
J043005E23GTGCGGTGNONE 
J053042O16GTGCGGTGNONE 
J053056C11GTGCGGTGNONE 
J053101M12GTGCGGTGNONE 
J065007A21GTGCGGTGNONE 
J065013M02GTGCGGTGNONE 
J065027G01GTGCGGTGNONE 
J065056C04GTGCGGTGNONE 
J065065D03GTGCGGTGNONE 
J065073E12GTGCGGTGNONE 
J065082A09GTGCGGTGNONE 
J065086G19GTGCGGTGNONE 
J065092N05GTGCGGTGNONE 
J065095F15GTGCGGTGNONE 
J065120E16GTGCGGTGNONE 
J065156D13GTGCGGTGNONE 
J065194E19GTGCGGTGNONE 
J065199C22GTGCGGTGNONE 
J075018O06GTGCGGTGNONE 
J075019J16GTGCGGTGNONE 
J075023E09GTGCGGTGNONE 
J075029J11GTGCGGTGNONE 
J075034G03GTGCGGTGNONE 
J075047N07GTGCGGTGNONE 
J075062L20GTGCGGTGNONE 
J075068J07GTGCGGTGNONE 
J075072B20GTGCGGTGNONE 
J075072G02GTGCGGTGNONE 
J075078I22GTGCGGTGNONE 
J075101F15GTGCGGTGNONE 
J075109M15GTGCGGTGNONE 
J075125K22GTGCGGTGNONE 
J075141N08GTGCGGTGNONE 
J075144G13GTGCGGTGNONE 
J075148G17GTGCGGTGNONE 
J075148H01GTGCGGTGNONE 
J075150F10GTGCGGTGNONE 
J075157K03GTGCGGTGNONE 
J075163I10GTGCGGTGNONE 
J075167H10GTGCGGTGNONE 
J075169L06GTGCGGTGNONE 
J080001I18GTGCGGTGNONE 
J080001M12GTGCGGTGNONE 
J080002L21GTGCGGTGNONE 
J080008A04GTGCGGTGNONE 
J080008B12GTGCGGTGNONE 
J080010E22GTGCGGTGNONE 
J080010I21GTGCGGTGNONE 
J080010L23GTGCGGTGNONE 
J080011O11GTGCGGTGNONE 
J080012L13GTGCGGTGNONE 
J080012N20GTGCGGTGNONE 
J080015A12GTGCGGTGNONE 
J080018H15GTGCGGTGNONE 
J080018I20GTGCGGTGNONE 
J080018O12GTGCGGTGNONE 
J080020N06GTGCGGTGNONE 
J080021P07GTGCGGTGNONE 
J080023A02GTGCGGTGNONE 
J080023E16GTGCGGTGNONE 
J080023M20GTGCGGTGNONE 
J080024F18GTGCGGTGNONE 
J080026C02GTGCGGTGNONE 
J080027D15GTGCGGTGNONE 
J080034B05GTGCGGTGNONE 
J080038C10GTGCGGTGNONE 
J080038H03GTGCGGTGNONE 
J080040C18GTGCGGTGNONE 
J080041E20GTGCGGTGNONE 
J080043E02GTGCGGTGNONE 
J080047E11GTGCGGTGNONE 
J080052A18GTGCGGTGNONE 
J080052N19GTGCGGTGNONE 
J080054P17GTGCGGTGNONE 
J080056K07GTGCGGTGNONE 
J080058A06GTGCGGTGNONE 
J080060E11GTGCGGTGNONE 
J080060G07GTGCGGTGNONE 
J080062H10GTGCGGTGNONE 
J080062L19GTGCGGTGNONE 
J080062M17GTGCGGTGNONE 
J080063D04GTGCGGTGNONE 
J080064A08GTGCGGTGNONE 
J080066L20GTGCGGTGNONE 
J080069P18GTGCGGTGNONE 
J080070C10GTGCGGTGNONE 
J080070P06GTGCGGTGNONE 
J080075H10GTGCGGTGNONE 
J080075M02GTGCGGTGNONE 
J080077I19GTGCGGTGNONE 
J080081D09GTGCGGTGNONE 
J080082A21GTGCGGTGNONE 
J080085A14GTGCGGTGNONE 
J080085C04GTGCGGTGNONE 
J080087G01GTGCGGTGNONE 
J080087O10GTGCGGTGNONE 
J080088F22GTGCGGTGNONE 
J080088K20GTGCGGTGNONE 
J080090M02GTGCGGTGNONE 
J080090N05GTGCGGTGNONE 
J080091F24GTGCGGTGNONE 
J080091I21GTGCGGTGNONE 
J080092J24GTGCGGTGNONE 
J080095A20GTGCGGTGNONE 
J080096I17GTGCGGTGNONE 
J080306C12GTGCGGTGNONE 
J080306N23GTGCGGTGNONE 
J080307P10GTGCGGTGNONE 
J080309G13GTGCGGTGNONE 
J080313I09GTGCGGTGNONE 
J080316E16GTGCGGTGNONE 
J080318I22GTGCGGTGNONE 
J090027C05GTGCGGTGNONE 
J090036H07GTGCGGTGNONE 
J090038L13GTGCGGTGNONE 
J100019E05GTGCGGTGNONE 
J100025G24GTGCGGTGNONE 
J100027G03GTGCGGTGNONE 
J100027L13GTGCGGTGNONE 
J100027M18GTGCGGTGNONE 
J100029I18GTGCGGTGNONE 
J100031G09GTGCGGTGNONE 
J100034J21GTGCGGTGNONE 
J100037D12GTGCGGTGNONE 
J100037L20GTGCGGTGNONE 
J100037O06GTGCGGTGNONE 
J100039D24GTGCGGTGNONE 
J100042D03GTGCGGTGNONE 
J100045K03GTGCGGTGNONE 
J100049G12GTGCGGTGNONE 
J100050K09GTGCGGTGNONE 
J100052J09GTGCGGTGNONE 
J100052J10GTGCGGTGNONE 
J100053B16GTGCGGTGNONE 
J100053L02GTGCGGTGNONE 
J100058C24GTGCGGTGNONE 
J100059J20GTGCGGTGNONE 
J100060J05GTGCGGTGNONE 
J100063E12GTGCGGTGNONE 
J100063H06GTGCGGTGNONE 
J100065G19GTGCGGTGNONE 
J100068G05GTGCGGTGNONE 
J100069M12GTGCGGTGNONE 
J100070H19GTGCGGTGNONE 
J100074K11GTGCGGTGNONE 
J100077J18GTGCGGTGNONE 
J100078M20GTGCGGTGNONE 
J100080C05GTGCGGTGNONE 
J100082J07GTGCGGTGNONE 
J100082P10GTGCGGTGNONE 
J100083G01GTGCGGTGNONE 
J100083G15GTGCGGTGNONE 
J100083M24GTGCGGTGNONE 
J100085L06GTGCGGTGNONE 
J100087N18GTGCGGTGNONE 
J100089C04GTGCGGTGNONE 
J100090K17GTGCGGTGNONE 
Os11g0704800AK109134CACCGCACSimilar to Membrane protein. 
Os11g0708600AK066096CGCACCGCACNONE 
AK072117CGCACCGCACSimilar to RECQL1 protein. 
J075092G05CGCACCGCACNONE 
J075093M01CGCACCGCACNONE 
J075147H14CGCACCGCACNONE 
J075158E01CGCACCGCACNONE 
J075194L18CGCACCGCACNONE 
J090085H06CGCACCGCACNONE 
Os12g0206700AK071313CACCGCACConserved hypothetical protein. 
J065179M24CACCGCACNONE 
Os12g0270300AK070311CACCGCACDisease resistance protein family protein. 
AK103036CACCGCACNONE 
Os12g0510500AK066140GTGCGGTGCGDisease resistance protein family protein. 
AK098997GTGCGGTGCGNONE 
J013051F22GTGCGGTGCGNONE 
Os12g0565100AK065775GTGCGGTGDisease resistance protein family protein. 
AK073176GTGCGGTGNONE 
Os12g0565800AK072828GCTGGGCCACCGCACZinc finger, TTF-type domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.