version

Summary of OsREG501 (All List)

OrganismOryza sativa  
IDOsREG501  
SequenceCACCTGTC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1739  

Entry Sequences (1739 entries)

LocusGene modelSequenceDescription
Os01g0139900AK121677CACCTGTCConserved hypothetical protein. 
J033069D19CACCTGTCNONE 
Os01g0144600009-164-E06GGTCCCACCTGTCNONE 
AK063058GGTCCCACCTGTCNONE 
J065061I15GGTCCCACCTGTCNONE 
J065128M13GGTCCCACCTGTCNONE 
J065152N15GGTCCCACCTGTCNONE 
J075170M11GGTCCCACCTGTCNONE 
J090071M11GGTCCCACCTGTCNONE 
J090073B22GGTCCCACCTGTCNONE 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0172200AK100326CCCACCACCACCTGTCGCGTCWW/Rsp5/WWP domain containing protein. 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0258700AK111633GACAGGTGNONE 
AK111727GACAGGTGNONE 
AK111903GACAGGTGZinc finger, CCCH-type domain containing protein. 
J065027O19GACAGGTGNONE 
J065028C04GACAGGTGNONE 
J065185H14GACAGGTGNONE 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein. 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0561600AK069494GACAGGTGGCytochrome P450 family protein. 
J023025F12GACAGGTGGNONE 
J023036E02GACAGGTGGNONE 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0654500013-057-E05GACAGGTGGGACCCANONE 
AF155333GACAGGTGGGACCCANONE 
AK061752GACAGGTGGGACCCASimilar to NADP-isocitrate dehydrogenase. 
D21069GACAGGTGGGACCCANONE 
Os01g0663400016-054-B01CACCTGTCNONE 
AK072283CACCTGTCSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CACCTGTCNONE 
J065180A21CACCTGTCNONE 
J075026E13CACCTGTCNONE 
J075109M23CACCTGTCNONE 
J075151A02CACCTGTCNONE 
J090004B07CACCTGTCNONE 
J090023O22CACCTGTCNONE 
J090054G09CACCTGTCNONE 
J090058H13CACCTGTCNONE 
J090076G13CACCTGTCNONE 
J100057F11CACCTGTCNONE 
Os01g0663500006-024-H09CCACCTGTCAGTGNONE 
AK058452CCACCTGTCAGTGNONE 
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein. 
Os01g0664500J075157K10CACCTGTCNONE 
J100023K08CACCTGTCNONE 
J100052N02CACCTGTCNONE 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0693800006-060-A01GCCCCACCTGTCNONE 
006-074-B11GCCCCACCTGTCNONE 
AK073138GCCCCACCTGTCSimilar to Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS). 
AK109336GCCCCACCTGTCNONE 
J033024E01GCCCCACCTGTCNONE 
Os01g0695200015-090-F01GTCCCACCTGTCNONE 
AK064145GTCCCACCTGTCProtein of unknown function DUF266, plant family protein. 
J065163N10GTCCCACCTGTCNONE 
J100051F21GTCCCACCTGTCNONE 
Os01g0742000009-105-F08CACCTGTCNONE 
AK062779CACCTGTCtRNA/rRNA methyltransferase, SpoU domain containing protein. 
Os01g0742100AK110930GACAGGTGConserved hypothetical protein. 
Os01g0763600AK061563GACAGGTGGGTCCNONE 
AK066596GACAGGTGGGTCCGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15GACAGGTGGGTCCNONE 
J065016A16GACAGGTGGGTCCNONE 
J065039L06GACAGGTGGGTCCNONE 
J090001E03GACAGGTGGGTCCNONE 
J090012J18GACAGGTGGGTCCNONE 
J090085E15GACAGGTGGGTCCNONE 
Os01g0780500AF225922GGCCCCACCTGTCNONE 
AK068498GGCCCCACCTGTCSCAMP family protein. 
J013157H06GGCCCCACCTGTCNONE 
J033088P18GGCCCCACCTGTCNONE 
Os01g0787000006-035-E12GACAGGTGNONE 
015-056-B07GACAGGTGNONE 
AK101743GACAGGTGSimilar to Peroxidase (EC 1.11.1.7). 
AK109348GACAGGTGNONE 
J065096L02GACAGGTGNONE 
J065185H10GACAGGTGNONE 
J065186E06GACAGGTGNONE 
J090081I17GACAGGTGNONE 
Os01g0797800013-017-E01CACCTGTCAGNONE 
AK122155CACCTGTCAGConserved hypothetical protein. 
Os01g0858900AK107493GACGGCCCCACCTGTCGlycosyl transferase, family 29 protein. 
J065097H23GACGGCCCCACCTGTCNONE 
J100070A02GACGGCCCCACCTGTCNONE 
J100072M10GACGGCCCCACCTGTCNONE 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK103428CACTGACAGGTGGGGCNONE 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0917100AK107234GACAGGTGConserved hypothetical protein. 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0138200AK068239GACAGGTGNONE 
J013147K19GACAGGTGNONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0282100AK058480CCACCTGTCConserved hypothetical protein. 
J065102L06CCACCTGTCNONE 
J065152P10CCACCTGTCNONE 
J100043L06CCACCTGTCNONE 
J100044G06CCACCTGTCNONE 
J100052L20CCACCTGTCNONE 
Os02g0302900AK110752CCCACCTGTCReticulon family protein. 
Os02g0318400AK064642GGTCCCACCTGTCConserved hypothetical protein. 
J075032B17GGTCCCACCTGTCNONE 
Os02g0491300J065205O09CCCACCTGTCAGConserved hypothetical protein. 
Os02g0491400AK073233CCCGGCCCCACCTGTCSimilar to Peptidylprolyl isomerase. 
J090046J15CCCGGCCCCACCTGTCNONE 
Os02g0506500AK062572GACAGGTGGGACCNONE 
AK063549GACAGGTGGGACCNONE 
AK101016GACAGGTGGGACCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318GACAGGTGGGACCNONE 
J013000C16GACAGGTGGGACCNONE 
J013155N06GACAGGTGGGACCNONE 
J023067A02GACAGGTGGGACCNONE 
J023149E02GACAGGTGGGACCNONE 
J033033J18GACAGGTGGGACCNONE 
J033051O15GACAGGTGGGACCNONE 
J075034C22GACAGGTGGGACCNONE 
J075054O10GACAGGTGGGACCNONE 
J075108L14GACAGGTGGGACCNONE 
J090043O06GACAGGTGGGACCNONE 
J100024P03GACAGGTGGGACCNONE 
Os02g0510100AK058487GACAGGTGGGNONE 
AK122107GACAGGTGGGSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06GACAGGTGGGNONE 
J053077L04GACAGGTGGGNONE 
J065010C11GACAGGTGGGNONE 
J075104O14GACAGGTGGGNONE 
J080003G03GACAGGTGGGNONE 
J080014K05GACAGGTGGGNONE 
J080026F03GACAGGTGGGNONE 
J080027O05GACAGGTGGGNONE 
J080037K15GACAGGTGGGNONE 
J080039D24GACAGGTGGGNONE 
J080043G19GACAGGTGGGNONE 
J080047P05GACAGGTGGGNONE 
J080048D22GACAGGTGGGNONE 
J080049F23GACAGGTGGGNONE 
J080062A21GACAGGTGGGNONE 
J080063H20GACAGGTGGGNONE 
J080067P15GACAGGTGGGNONE 
J080068P19GACAGGTGGGNONE 
J080079J15GACAGGTGGGNONE 
J080092K19GACAGGTGGGNONE 
J080096M04GACAGGTGGGNONE 
Os02g0511500AK105023GACAGGTGSimilar to Squamous-cell carcinoma T-cell-recognized antigen (Fragment). 
Os02g0512400AK073461GACAGGTGSimilar to Glutaredoxin. 
J065073L11GACAGGTGNONE 
Os02g0523500AK063159CACCTGTCNONE 
J013001J15CACCTGTCNONE 
J013041N20CACCTGTCNONE 
J013064I20CACCTGTCNONE 
J013114C13CACCTGTCNONE 
J023009O10CACCTGTCNONE 
J023026M10CACCTGTCNONE 
J023041F11CACCTGTCNONE 
J023120M12CACCTGTCNONE 
J023148D20CACCTGTCNONE 
J033023D01CACCTGTCNONE 
J033025A16CACCTGTCNONE 
J033027P14CACCTGTCNONE 
J033045B18CACCTGTCNONE 
J033050N01CACCTGTCNONE 
J033057D08CACCTGTCNONE 
J033058O09CACCTGTCNONE 
J033060F20CACCTGTCNONE 
J033067F20CACCTGTCNONE 
J033073B09CACCTGTCNONE 
J033092D16CACCTGTCNONE 
J033103K19CACCTGTCNONE 
J033105F14CACCTGTCNONE 
J033111K02CACCTGTCNONE 
J033120K12CACCTGTCNONE 
J033126N03CACCTGTCNONE 
J043005J11CACCTGTCNONE 
J043010C12CACCTGTCNONE 
J043012F20CACCTGTCNONE 
J043016C06CACCTGTCNONE 
J043020O16CACCTGTCNONE 
J043040E03CACCTGTCNONE 
J065054B01CACCTGTCNONE 
J065057J23CACCTGTCNONE 
J065081F16CACCTGTCNONE 
J065098C10CACCTGTCNONE 
J065103A05CACCTGTCNONE 
J065149D16CACCTGTCNONE 
J065197I21CACCTGTCNONE 
J065203G07CACCTGTCNONE 
J065205M15CACCTGTCNONE 
J065214P09CACCTGTCNONE 
J075031G19CACCTGTCNONE 
J075033B22CACCTGTCNONE 
J075034A04CACCTGTCNONE 
J075042G24CACCTGTCNONE 
J075070A10CACCTGTCNONE 
J075104E04CACCTGTCNONE 
J075120H02CACCTGTCNONE 
J090004K16CACCTGTCNONE 
J090006K13CACCTGTCNONE 
J090009M21CACCTGTCNONE 
J090013D10CACCTGTCNONE 
J090016B11CACCTGTCNONE 
J090030I06CACCTGTCNONE 
J090037F16CACCTGTCNONE 
J090039N08CACCTGTCNONE 
J090039N15CACCTGTCNONE 
J090048L22CACCTGTCNONE 
J090049A13CACCTGTCNONE 
J090053E13CACCTGTCNONE 
J090057A19CACCTGTCNONE 
J090068F05CACCTGTCNONE 
J090070C23CACCTGTCNONE 
J090073G05CACCTGTCNONE 
J090080H19CACCTGTCNONE 
J090083C11CACCTGTCNONE 
J090084H01CACCTGTCNONE 
J090084O16CACCTGTCNONE 
J090085L23CACCTGTCNONE 
J090095E15CACCTGTCNONE 
J090099A09CACCTGTCNONE 
J100018D14CACCTGTCNONE 
J100019C08CACCTGTCNONE 
J100021F15CACCTGTCNONE 
J100025M04CACCTGTCNONE 
J100031O13CACCTGTCNONE 
J100036D01CACCTGTCNONE 
J100038M05CACCTGTCNONE 
J100039I06CACCTGTCNONE 
J100042O17CACCTGTCNONE 
J100043C05CACCTGTCNONE 
J100050L12CACCTGTCNONE 
J100081E08CACCTGTCNONE 
J100083D17CACCTGTCNONE 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0554000016-001-D09CACCTGTCNONE 
AK106534CACCTGTCNONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0574600AK059246CACCTGTCAGTConserved hypothetical protein. 
Os02g0593600AK069976CACCTGTCLeucine-rich repeat, typical subtype containing protein. 
Os02g0601800AB060276CACTGACAGGTGGNONE 
AK099539CACTGACAGGTGGNONE 
AK101873CACTGACAGGTGGBromodomain containing protein. 
AK106801CACTGACAGGTGGNONE 
AK121758CACTGACAGGTGGNONE 
AK121891CACTGACAGGTGGNONE 
J013059H01CACTGACAGGTGGNONE 
J013092F08CACTGACAGGTGGNONE 
J013146J04CACTGACAGGTGGNONE 
J023001K12CACTGACAGGTGGNONE 
J023002H16CACTGACAGGTGGNONE 
J023013B10CACTGACAGGTGGNONE 
J023081I22CACTGACAGGTGGNONE 
J023084K19CACTGACAGGTGGNONE 
J023150E24CACTGACAGGTGGNONE 
J033023B18CACTGACAGGTGGNONE 
J033025F18CACTGACAGGTGGNONE 
J033048P08CACTGACAGGTGGNONE 
J033060M24CACTGACAGGTGGNONE 
J033070G06CACTGACAGGTGGNONE 
J033088P12CACTGACAGGTGGNONE 
J033105C13CACTGACAGGTGGNONE 
J043009N18CACTGACAGGTGGNONE 
J065103G21CACTGACAGGTGGNONE 
J075039H15CACTGACAGGTGGNONE 
J090014K10CACTGACAGGTGGNONE 
J090022N02CACTGACAGGTGGNONE 
J090033F18CACTGACAGGTGGNONE 
J090033I04CACTGACAGGTGGNONE 
J090041F11CACTGACAGGTGGNONE 
J090045P20CACTGACAGGTGGNONE 
J090054B01CACTGACAGGTGGNONE 
J090055M12CACTGACAGGTGGNONE 
J090071K09CACTGACAGGTGGNONE 
J090098O16CACTGACAGGTGGNONE 
J090099P15CACTGACAGGTGGNONE 
J100050I16CACTGACAGGTGGNONE 
Os02g0667300009-057-D01GACAGGTGNONE 
AK058228GACAGGTGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GACAGGTGNONE 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
Os02g0725100AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0726300006-025-H11GACAGGTGNONE 
009-066-B03GACAGGTGNONE 
AB028132GACAGGTGNONE 
AK061000GACAGGTGNONE 
AK100892GACAGGTGNONE 
AK101321GACAGGTGSimilar to AOBP (Ascorbate oxidase promoter-binding protein). 
J065152L01GACAGGTGNONE 
J075041D14GACAGGTGNONE 
J075192K22GACAGGTGNONE 
J100029I23GACAGGTGNONE 
J100029K14GACAGGTGNONE 
J100045M03GACAGGTGNONE 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0769200J065031C02GGTCCCACCTGTCNONE 
J065206E04GGTCCCACCTGTCNONE 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707CCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
AK104135CCACCTGTCNONE 
AK104135GACAGGTGGGCCCCNONE 
U46758ATGGCCCACCTGTCNONE 
U46758CCACCTGTCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104802GACAGGTGGGGCCCAGGNONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
Os03g0130400AK070255GACAGGTGGGACCAdenylate kinase, subfamily protein. 
Os03g0159600AK106743CACCTGTCSimilar to Rab28 protein. 
J075041K15CACCTGTCNONE 
J075051E03CACCTGTCNONE 
J075055P19CACCTGTCNONE 
J075096D01CACCTGTCNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
AK121425CTGACAGGTGGGNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CTGACAGGTGGGNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169500Os03g0169500CTGGGGCCCCACCTGTCSimilar to Cellulose synthase-like A4. 
Os03g0173700AK101161CCCACCTGTCAGNONE 
AK111195CCCACCTGTCAGConserved hypothetical protein. 
J090042G17CCCACCTGTCAGNONE 
Os03g0190100AK061907GACAGGTGGNONE 
AK066332GACAGGTGGUbiA prenyltransferase family protein. 
J013051N11GACAGGTGGNONE 
J013060C07GACAGGTGGNONE 
J065117L08GACAGGTGGNONE 
J100067H10GACAGGTGGNONE 
Os03g0199500J065099N05CCCACCTGTCAGTGNONE 
J065152P14CCCACCTGTCAGTGConserved hypothetical protein. 
J080009C14CCCACCTGTCAGTGNONE 
J080011K01CCCACCTGTCAGTGNONE 
J080015H12CCCACCTGTCAGTGNONE 
J080022K05CCCACCTGTCAGTGNONE 
J080034G01CCCACCTGTCAGTGNONE 
J080038I04CCCACCTGTCAGTGNONE 
J080039F20CCCACCTGTCAGTGNONE 
J080042J22CCCACCTGTCAGTGNONE 
J080042N23CCCACCTGTCAGTGNONE 
J080043E07CCCACCTGTCAGTGNONE 
J080050A12CCCACCTGTCAGTGNONE 
J080050C11CCCACCTGTCAGTGNONE 
J080052B01CCCACCTGTCAGTGNONE 
J080052H22CCCACCTGTCAGTGNONE 
J080060E02CCCACCTGTCAGTGNONE 
J080063K24CCCACCTGTCAGTGNONE 
J080067I07CCCACCTGTCAGTGNONE 
J080081H22CCCACCTGTCAGTGNONE 
J080085J10CCCACCTGTCAGTGNONE 
J080089E20CCCACCTGTCAGTGNONE 
J080092N04CCCACCTGTCAGTGNONE 
J080093B01CCCACCTGTCAGTGNONE 
J080093N04CCCACCTGTCAGTGNONE 
J080097B03CCCACCTGTCAGTGNONE 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0240800006-092-D05GACAGGTGGGNONE 
AK059292GACAGGTGGGNONE 
AK061178GACAGGTGGGSimilar to AGL157Cp. 
AK121552GACAGGTGGGNONE 
J023131D06GACAGGTGGGNONE 
J033033E14GACAGGTGGGNONE 
J033105B01GACAGGTGGGNONE 
J033114L18GACAGGTGGGNONE 
J033132N24GACAGGTGGGNONE 
J065032H03GACAGGTGGGNONE 
J065115J20GACAGGTGGGNONE 
J065150C05GACAGGTGGGNONE 
J080302A11GACAGGTGGGNONE 
J080302H16GACAGGTGGGNONE 
J080305M12GACAGGTGGGNONE 
J080306F13GACAGGTGGGNONE 
J080312A06GACAGGTGGGNONE 
J090088P09GACAGGTGGGNONE 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0278000014-078-B07CACCTGTCNONE 
AB079064CACCTGTCNONE 
AK060031CACCTGTCNONE 
AK100908CACCTGTCUDP-glucuronic acid decarboxylase. 
J023007P12CACCTGTCNONE 
J023045J24CACCTGTCNONE 
J023054L14CACCTGTCNONE 
J023085K21CACCTGTCNONE 
J023121H11CACCTGTCNONE 
J023125J04CACCTGTCNONE 
J023126B13CACCTGTCNONE 
J023132P15CACCTGTCNONE 
J033117K15CACCTGTCNONE 
J033140G17CACCTGTCNONE 
J043034K23CACCTGTCNONE 
J043037H03CACCTGTCNONE 
J053064B01CACCTGTCNONE 
J075146I22CACCTGTCNONE 
J090001H15CACCTGTCNONE 
J090043P06CACCTGTCNONE 
J090067M04CACCTGTCNONE 
J090095K23CACCTGTCNONE 
J100017L23CACCTGTCNONE 
J100031B08CACCTGTCNONE 
J100070O13CACCTGTCNONE 
J100088D21CACCTGTCNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0308800AK066789CCCACCTGTCAGNONE 
AK068534CCCACCTGTCAGProtein prenyltransferase domain containing protein. 
Os03g0324900014-018-F11CCACCTGTCNONE 
AK068144CCACCTGTCZinc finger, RING-type domain containing protein. 
Os03g0359100009-187-A08CACCTGTCNONE 
AK063182CACCTGTCNONE 
AK073091CACCTGTCConserved hypothetical protein. 
J033022E01CACCTGTCNONE 
J065084C06CACCTGTCNONE 
J075018D04CACCTGTCNONE 
J075025N22CACCTGTCNONE 
J075026D03CACCTGTCNONE 
J075068H06CACCTGTCNONE 
J075068M21CACCTGTCNONE 
J075081C20CACCTGTCNONE 
J075100C22CACCTGTCNONE 
J075101I05CACCTGTCNONE 
J075108D18CACCTGTCNONE 
J075114O09CACCTGTCNONE 
J075122L17CACCTGTCNONE 
J075128M02CACCTGTCNONE 
J075129E18CACCTGTCNONE 
J075150M15CACCTGTCNONE 
J075154L07CACCTGTCNONE 
J075173M03CACCTGTCNONE 
J090001I07CACCTGTCNONE 
J090055O18CACCTGTCNONE 
Os03g0370000AK100033CCCACCTGTCAGSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0383800009-149-G01CCCACCTGTCAGNONE 
AK062998CCCACCTGTCAGNONE 
AK065904CCCACCTGTCAGNONE 
Os03g0413100006-092-C09GACAGGTGNONE 
AK061832GACAGGTGNONE 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
Os03g0683700J013001J22CCACCTGTCNONE 
Os03g0687800AK106820CACCTGTCAGConserved hypothetical protein. 
AK106820GCCCCACCTGTCConserved hypothetical protein. 
Os03g0722500AK099926CCACCTGTCGlycoside hydrolase, family 17 protein. 
AK100108CCACCTGTCNONE 
J023004N24CCACCTGTCNONE 
J100018K24CCACCTGTCNONE 
J100032B22CCACCTGTCNONE 
J100036K14CCACCTGTCNONE 
J100043B05CCACCTGTCNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0780400011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0791700AK071881CACCTGTCNONE 
AK100700CACCTGTCProtein kinase domain containing protein. 
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0793500AK103407GGCCCCACCTGTCNONE 
AK121620GGCCCCACCTGTCSimilar to Casein kinase-like protein. 
Os03g0801900015-081-G06GACAGGTGGGCTCTCCCCCANONE 
AK106415GACAGGTGGGCTCTCCCCCAProtein of unknown function DUF569 family protein. 
J090099L17GACAGGTGGGCTCTCCCCCANONE 
J100024B03GACAGGTGGGCTCTCCCCCANONE 
J100088I08GACAGGTGGGCTCTCCCCCANONE 
Os03g0809200AK102250GACAGGTGGSimilar to Transcription factor EmBP-1 (Fragment). 
J033088G19GACAGGTGGNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0832600AK120137CCACCTGTCSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0844100AK067164CCCACCTGTCSimilar to Pti1 kinase-like protein. 
Os03g0848700AK065798GACAGGTGSimilar to TDRGA-1 (Fragment). 
J013039L06GACAGGTGNONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK066575CTGACAGGTGGGTCCNONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CTGACAGGTGGGTCCNONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CTGACAGGTGGGTCCNONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0438400AK067975CCACCTGTCSimilar to Pectin methylesterase-like protein. 
Os04g0462900006-094-A02AATGGGCCACCACCTGTCNONE 
006-097-F05AATGGGCCACCACCTGTCNONE 
009-129-A10AATGGGCCACCACCTGTCNONE 
015-042-F07AATGGGCCACCACCTGTCNONE 
AK058481AATGGGCCACCACCTGTCNONE 
AK059483AATGGGCCACCACCTGTCNONE 
AK061324AATGGGCCACCACCTGTCNONE 
AK099100AATGGGCCACCACCTGTCNONE 
AK102579AATGGGCCACCACCTGTCNONE 
AK106322AATGGGCCACCACCTGTCSimilar to Prohibitin. 
J065059J20AATGGGCCACCACCTGTCNONE 
J065085I02AATGGGCCACCACCTGTCNONE 
J065118N23AATGGGCCACCACCTGTCNONE 
J065208K24AATGGGCCACCACCTGTCNONE 
J075053B14AATGGGCCACCACCTGTCNONE 
J075097M22AATGGGCCACCACCTGTCNONE 
J075184B07AATGGGCCACCACCTGTCNONE 
J075194A15AATGGGCCACCACCTGTCNONE 
J080315G03AATGGGCCACCACCTGTCNONE 
J090088H19AATGGGCCACCACCTGTCNONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0498600006-068-G08CACCTGTCNONE 
006-095-H08CACCTGTCNONE 
006-108-E12CACCTGTCNONE 
009-194-E05CACCTGTCNONE 
AK062001CACCTGTCNONE 
Os04g0527900AK108116CCACCTGTCSimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09CCACCTGTCNONE 
J075023I21CCACCTGTCNONE 
Os04g0542000J090086F02CACCTGTCNONE 
Os04g0594100014-046-H12CACCTGTCGCGCGCNONE 
014-049-F01CACCTGTCGCGCGCNONE 
AK111960CACCTGTCGCGCGCSimilar to P-type R2R3 Myb protein (Fragment). 
Os04g0606400AK102588CACCTGTCSimilar to Mannosyl-oligosaccharide 1,2-alpha-mannosidase (EC 3.2.1.113). 
Os04g0613000AK069804CACCTGTCSimilar to Zinc transporter ZIP1 (Fragment). 
AY323915CACCTGTCNONE 
Os04g0619300AK061943GACAGGTGNONE 
Os04g0642100011-074-F06CCACCTGTCNONE 
J043006J10CCACCTGTCSimilar to Microtubule-associated protein EB1. 
J043006P09CCACCTGTCNONE 
Os04g0645100AK072140CCCACCTGTCTetratricopeptide-like helical domain containing protein. 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0671300AK072414GACAGGTGCCCATCCASimilar to Suppressor of presenilin 5 (P110b homolog). 
Os04g0676100Os04g0676100GACAGGTGGSimilar to Thioredoxin X, chloroplast precursor. 
Os04g0678300AK102779GGGCCCCACCTGTCWD40-like domain containing protein. 
J033107J24GGGCCCCACCTGTCNONE 
J065165H03GGGCCCCACCTGTCNONE 
J065186I23GGGCCCCACCTGTCNONE 
J065194C13GGGCCCCACCTGTCNONE 
J090039O08GGGCCCCACCTGTCNONE 
J100029O21GGGCCCCACCTGTCNONE 
Os04g0679800AK060662CCCACCTGTCSimilar to RNA-binding protein-like protein. 
AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987CCCACCTGTCNONE 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11CCCACCTGTCNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17CCCACCTGTCNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12CCCACCTGTCNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12CCCACCTGTCNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07CCCACCTGTCNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0122700J065185N19GACAGGTGNONE 
J065188N05GACAGGTGNONE 
J065198E09GACAGGTGNONE 
J065215H08GACAGGTGSimilar to Low-temperature induced protein lt101.2. 
Os05g0137400AK065206CACCTGTCSimilar to Aspartic protease precursor. 
D12777CACCTGTCNONE 
J013002F13CACCTGTCNONE 
J013029I15CACCTGTCNONE 
J013033A10CACCTGTCNONE 
J013035H24CACCTGTCNONE 
J013051H21CACCTGTCNONE 
J013098H05CACCTGTCNONE 
J023060B04CACCTGTCNONE 
J023130D23CACCTGTCNONE 
J033140N08CACCTGTCNONE 
J053039L22CACCTGTCNONE 
J080007K21CACCTGTCNONE 
Os05g0148600003-016-C11GACAGGTGGNONE 
AK066168GACAGGTGGNONE 
AK104336GACAGGTGGSimilar to Na+/H+ antiporter. 
AY360145GACAGGTGGNONE 
J013055J22GACAGGTGGNONE 
J013057M24GACAGGTGGNONE 
J013074N03GACAGGTGGNONE 
J013158A22GACAGGTGGNONE 
J075118H09GACAGGTGGNONE 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0183100AK066252GACAGGTGWRKY transcription factor 67. 
J075002P11GACAGGTGNONE 
J100026O15GACAGGTGNONE 
J100035H10GACAGGTGNONE 
J100058M18GACAGGTGNONE 
J100061D08GACAGGTGNONE 
J100066K19GACAGGTGNONE 
J100068I20GACAGGTGNONE 
J100073N08GACAGGTGNONE 
J100075K18GACAGGTGNONE 
J100085P18GACAGGTGNONE 
J100087E07GACAGGTGNONE 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein. 
Os05g0462400AK099608CCACCTGTCLipin, N-terminal conserved region domain containing protein. 
J033138E12CCACCTGTCNONE 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0503000AK068335CCCACCTGTCSimilar to Secretory carrier membrane protein. 
AK104049CCCACCTGTCNONE 
J013149D04CCCACCTGTCNONE 
J075085A06CCCACCTGTCNONE 
Os05g0503300011-013-H12GGCCCCACCTGTCNONE 
012-072-B03GGCCCCACCTGTCNONE 
AK073969GGCCCCACCTGTCSimilar to Sulfite reductase (Fragment). 
AK100773GGCCCCACCTGTCNONE 
AK103289GGCCCCACCTGTCNONE 
J013045K07GGCCCCACCTGTCNONE 
J033075F01GGCCCCACCTGTCNONE 
J033125N07GGCCCCACCTGTCNONE 
J033130G12GGCCCCACCTGTCNONE 
Os05g0535100AK063362CCACCTGTCAGSimilar to Beta-1,3-glucanase-like protein. 
Os05g0535700009-067-F01CCACCTGTCNONE 
AK061590CCACCTGTCNONE 
AK062545CCACCTGTCConserved hypothetical protein. 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
Os05g0584900012-044-B12GTCCCACCTGTCNONE 
012-082-A03GTCCCACCTGTCNONE 
AK105309GTCCCACCTGTCC4-dicarboxylate transporter/malic acid transport protein family protein. 
J053069A10GTCCCACCTGTCNONE 
J065070I05GTCCCACCTGTCNONE 
J075096O04GTCCCACCTGTCNONE 
J075136D21GTCCCACCTGTCNONE 
Os05g0585900AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK098854GACAGGTGGGCCCCNONE 
J013000H16GACAGGTGGGCCCCNONE 
J033118D07GACAGGTGGGCCCCNONE 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
AK122132GACAGGTGGGCCCGNONE 
J033133F04GACAGGTGGGCCCGNONE 
J065094M24GACAGGTGGGCCCGNONE 
J065122J07GACAGGTGGGCCCGNONE 
J065137G10GACAGGTGGGCCCGNONE 
J065178L09GACAGGTGGGCCCGNONE 
J080011E11GACAGGTGGGCCCGNONE 
J080020G21GACAGGTGGGCCCGNONE 
J080039H03GACAGGTGGGCCCGNONE 
J080039J04GACAGGTGGGCCCGNONE 
Os06g0134500012-014-A02CCACCTGTCNONE 
AK063440CCACCTGTCConserved hypothetical protein. 
Os06g0157000009-109-H03CACCTGTCNONE 
AK066113CACCTGTCLipolytic enzyme, G-D-S-L family protein. 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0194000006-041-H12CCACCTGTCCCACGTGGACCNONE 
006-077-B02CCACCTGTCCCACGTGGACCNONE 
013-029-A09CCACCTGTCCCACGTGGACCNONE 
AF190770CCACCTGTCCCACGTGGACCNONE 
AK060742CCACCTGTCCCACGTGGACCNONE 
AK069833CCACCTGTCCCACGTGGACCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCACCTGTCCCACGTGGACCNONE 
J013060G01CCACCTGTCCCACGTGGACCNONE 
J013069I06CCACCTGTCCCACGTGGACCNONE 
J013134D15CCACCTGTCCCACGTGGACCNONE 
J013149A16CCACCTGTCCCACGTGGACCNONE 
J023031B06CCACCTGTCCCACGTGGACCNONE 
J023074E17CCACCTGTCCCACGTGGACCNONE 
J023091C14CCACCTGTCCCACGTGGACCNONE 
J023101P18CCACCTGTCCCACGTGGACCNONE 
J023106O14CCACCTGTCCCACGTGGACCNONE 
J023110J17CCACCTGTCCCACGTGGACCNONE 
J023110N02CCACCTGTCCCACGTGGACCNONE 
J023128D07CCACCTGTCCCACGTGGACCNONE 
J033024O19CCACCTGTCCCACGTGGACCNONE 
J033068G19CCACCTGTCCCACGTGGACCNONE 
J033095G01CCACCTGTCCCACGTGGACCNONE 
J033108C12CCACCTGTCCCACGTGGACCNONE 
J033114C23CCACCTGTCCCACGTGGACCNONE 
J043003E04CCACCTGTCCCACGTGGACCNONE 
J053023J03CCACCTGTCCCACGTGGACCNONE 
J053026B01CCACCTGTCCCACGTGGACCNONE 
J065172F15CCACCTGTCCCACGTGGACCNONE 
J075036K13CCACCTGTCCCACGTGGACCNONE 
J090020A10CCACCTGTCCCACGTGGACCNONE 
J090073E10CCACCTGTCCCACGTGGACCNONE 
J100034P18CCACCTGTCCCACGTGGACCNONE 
J100048O18CCACCTGTCCCACGTGGACCNONE 
J100064K09CCACCTGTCCCACGTGGACCNONE 
Os06g0211200011-063-B02CACCTGTCNONE 
AK103188CACCTGTCSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312CACCTGTCNONE 
J065214N03CACCTGTCNONE 
J090046C13CACCTGTCNONE 
J090049L03CACCTGTCNONE 
J100074P03CACCTGTCNONE 
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein. 
Os06g0246500AK105105GACAGGTGSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0252300003-106-B07GACAGGTGGNONE 
AK061625GACAGGTGGNONE 
Os06g0603000AK068856TCCGGGCCCACCTGTCNONE 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0633100AK107791CCACCTGTCConserved hypothetical protein. 
J065001N11CCACCTGTCNONE 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0668200011-004-A12CTGACAGGTGGNONE 
AK070705CTGACAGGTGGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
AK101622CTGACAGGTGGNONE 
D10408CTGACAGGTGGNONE 
J033044L05CTGACAGGTGGNONE 
J033052L01CTGACAGGTGGNONE 
J033086F09CTGACAGGTGGNONE 
J033096I19CTGACAGGTGGNONE 
J053072J20CTGACAGGTGGNONE 
J065074N09CTGACAGGTGGNONE 
J065075K09CTGACAGGTGGNONE 
J065130L15CTGACAGGTGGNONE 
J065136P12CTGACAGGTGGNONE 
J065137M09CTGACAGGTGGNONE 
J065139O15CTGACAGGTGGNONE 
J075003J03CTGACAGGTGGNONE 
J075021J20CTGACAGGTGGNONE 
Os06g0696400011-019-C01CCACCTGTCNONE 
011-027-D04CCACCTGTCNONE 
013-051-H10CCACCTGTCNONE 
013-054-A06CCACCTGTCNONE 
013-061-D06CCACCTGTCNONE 
013-088-F04CCACCTGTCNONE 
014-018-C07CCACCTGTCNONE 
014-026-E10CCACCTGTCNONE 
AK058291CCACCTGTCNONE 
AK066125CCACCTGTCNONE 
AK104912CCACCTGTCNONE 
BT014685CCACCTGTCSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCACCTGTCNONE 
J065065L22CCACCTGTCNONE 
J065084O06CCACCTGTCNONE 
J075006O13CCACCTGTCNONE 
J075013J18CCACCTGTCNONE 
J075018L23CCACCTGTCNONE 
J075036E14CCACCTGTCNONE 
J075039K21CCACCTGTCNONE 
J075075H13CCACCTGTCNONE 
J075091A14CCACCTGTCNONE 
J075093I09CCACCTGTCNONE 
J075136L17CCACCTGTCNONE 
J075156M24CCACCTGTCNONE 
J075174J01CCACCTGTCNONE 
J075179P15CCACCTGTCNONE 
J075181F02CCACCTGTCNONE 
J075194L24CCACCTGTCNONE 
J080302J02CCACCTGTCNONE 
J080304J11CCACCTGTCNONE 
J080308A15CCACCTGTCNONE 
J100041B09CCACCTGTCNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE 
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin. 
J013052B11AGGGCCCACCTGTCAGNONE 
J013052B13AGGGCCCACCTGTCAGNONE 
J065214H07AGGGCCCACCTGTCAGNONE 
J075192D20AGGGCCCACCTGTCAGNONE 
J090090C15AGGGCCCACCTGTCAGNONE 
J100051J18AGGGCCCACCTGTCAGNONE 
J100055A07AGGGCCCACCTGTCAGNONE 
J100060B10AGGGCCCACCTGTCAGNONE 
J100061D02AGGGCCCACCTGTCAGNONE 
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein. 
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein. 
J023020A02CCCACCTGTCAGTNONE 
J023020A02CCCACCTGTCAGTGNONE 
J023039H03CCCACCTGTCAGTNONE 
J023039H03CCCACCTGTCAGTGNONE 
J100042E23CCCACCTGTCAGTNONE 
J100042E23CCCACCTGTCAGTGNONE 
J100069N01CCCACCTGTCAGTNONE 
J100069N01CCCACCTGTCAGTGNONE 
J100089L13CCCACCTGTCAGTNONE 
J100089L13CCCACCTGTCAGTGNONE 
Os06g0714500AK100047GACAGGTGAAA ATPase domain containing protein. 
AK119628GACAGGTGNONE 
J013120N13GACAGGTGNONE 
J013154C19GACAGGTGNONE 
J023031A09GACAGGTGNONE 
J023073G20GACAGGTGNONE 
J023086A06GACAGGTGNONE 
J023086L11GACAGGTGNONE 
J033045N11GACAGGTGNONE 
J065124D11GACAGGTGNONE 
J065135A15GACAGGTGNONE 
J065146E06GACAGGTGNONE 
J065175E12GACAGGTGNONE 
J075004A21GACAGGTGNONE 
J075072C20GACAGGTGNONE 
J075078O21GACAGGTGNONE 
J075145E13GACAGGTGNONE 
J075196K08GACAGGTGNONE 
J090095L18GACAGGTGNONE 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
AK069558GACAGGTGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0124600AK073437GTGGGACCCACCTGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GTGGGACCCACCTGTCNONE 
J033136G07GTGGGACCCACCTGTCNONE 
J065092I12GTGGGACCCACCTGTCNONE 
J065132F04GTGGGACCCACCTGTCNONE 
J065143I11GTGGGACCCACCTGTCNONE 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0150100AK065241CCACCTGTCProtein of unknown function DUF221 domain containing protein. 
AK098912CCACCTGTCNONE 
Os07g0173200AK061624CCCACCTGTCFrigida-like family protein. 
AK061624CCCACCTGTCFrigida-like family protein. 
AK065275CCCACCTGTCNONE 
AK065275CCCACCTGTCNONE 
AK098856CCCACCTGTCNONE 
AK098856CCCACCTGTCNONE 
AK098899CCCACCTGTCNONE 
AK098899CCCACCTGTCNONE 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0185000015-028-H12GACAGGTGGGACNONE 
AK072273GACAGGTGGGACNONE 
AK100930GACAGGTGGGACSimilar to MAP kinase (Ser/Thr kinase). 
J100026K08GACAGGTGGGACNONE 
J100062M04GACAGGTGGGACNONE 
J100073N07GACAGGTGGGACNONE 
J100088M04GACAGGTGGGACNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0190800J065011L18GACAGGTGGGNONE 
J065143M23GACAGGTGGGNONE 
J065182M05GACAGGTGGGNONE 
J065200H08GACAGGTGGGSimilar to Thioredoxin h. 
Os07g0209100AK120944CACCTGTCSimilar to Seed imbibition protein (Fragment). 
Os07g0240300AK072205GGCCCCACCTGTCConserved hypothetical protein. 
AK098977GGCCCCACCTGTCNONE 
Os07g0245100J023048C16GGGCCCCACCTGTCAGTNONE 
J023110L14GGGCCCCACCTGTCAGTNONE 
J053023B18GGGCCCCACCTGTCAGTNONE 
J053031L17GGGCCCCACCTGTCAGTNONE 
J065035I22GGGCCCCACCTGTCAGTNONE 
J065043D21GGGCCCCACCTGTCAGTNONE 
J065072L16GGGCCCCACCTGTCAGTNONE 
J065214I23GGGCCCCACCTGTCAGTNONE 
Os07g0438800AK060412CCCGGCCCCACCTGTCAGNONE 
AK100065CCCGGCCCCACCTGTCAGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCGGCCCCACCTGTCAGNONE 
AY224478CCCGGCCCCACCTGTCAGNONE 
J013160O05CCCGGCCCCACCTGTCAGNONE 
J023030C05CCCGGCCCCACCTGTCAGNONE 
J033025O04CCCGGCCCCACCTGTCAGNONE 
J033121P15CCCGGCCCCACCTGTCAGNONE 
J043034I23CCCGGCCCCACCTGTCAGNONE 
J065022N01CCCGGCCCCACCTGTCAGNONE 
J065022N02CCCGGCCCCACCTGTCAGNONE 
J065023M01CCCGGCCCCACCTGTCAGNONE 
J065101G13CCCGGCCCCACCTGTCAGNONE 
J075058P13CCCGGCCCCACCTGTCAGNONE 
J075186K10CCCGGCCCCACCTGTCAGNONE 
J075199F17CCCGGCCCCACCTGTCAGNONE 
Os07g0459400AK101767CTGACAGGTGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0496700016-057-A12TGGGGCCCACCTGTCNONE 
AK064235TGGGGCCCACCTGTCPhosphate-induced protein 1 conserved region family protein. 
Os07g0531600015-098-E11AGTGGGCCCACCTGTCNONE 
AK067845AGTGGGCCCACCTGTCPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01AGTGGGCCCACCTGTCNONE 
J065008E15AGTGGGCCCACCTGTCNONE 
J065052K14AGTGGGCCCACCTGTCNONE 
J065052L13AGTGGGCCCACCTGTCNONE 
J065058M02AGTGGGCCCACCTGTCNONE 
J065069M10AGTGGGCCCACCTGTCNONE 
J065135A14AGTGGGCCCACCTGTCNONE 
J065168O18AGTGGGCCCACCTGTCNONE 
J075070D14AGTGGGCCCACCTGTCNONE 
J075169B16AGTGGGCCCACCTGTCNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK099740GCCCCCACCTGTCAGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
AK110717GCCCCCACCTGTCAGNONE 
Os07g0597000009-013-A01GACAGGTGGGNONE 
009-077-A02GACAGGTGGGNONE 
009-195-H04GACAGGTGGGNONE 
AF094773GACAGGTGGGNONE 
AK062134GACAGGTGGGNONE 
AK103429GACAGGTGGGSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19GACAGGTGGGNONE 
J013152D01GACAGGTGGGNONE 
J023024K09GACAGGTGGGNONE 
J023058J15GACAGGTGGGNONE 
J023097I07GACAGGTGGGNONE 
J023132B05GACAGGTGGGNONE 
J033065L11GACAGGTGGGNONE 
J033086B12GACAGGTGGGNONE 
J033128M07GACAGGTGGGNONE 
J043010M23GACAGGTGGGNONE 
J043024A05GACAGGTGGGNONE 
J053057P08GACAGGTGGGNONE 
J065022G24GACAGGTGGGNONE 
J065028I10GACAGGTGGGNONE 
J065065D08GACAGGTGGGNONE 
J065103D22GACAGGTGGGNONE 
J065153K16GACAGGTGGGNONE 
J065210B16GACAGGTGGGNONE 
J075015H18GACAGGTGGGNONE 
J075102C14GACAGGTGGGNONE 
J080302G09GACAGGTGGGNONE 
J080302L20GACAGGTGGGNONE 
J080303K11GACAGGTGGGNONE 
J080312C18GACAGGTGGGNONE 
J080316F08GACAGGTGGGNONE 
J090023I05GACAGGTGGGNONE 
J090023I07GACAGGTGGGNONE 
J090053C21GACAGGTGGGNONE 
J090067J22GACAGGTGGGNONE 
J090070E24GACAGGTGGGNONE 
J090078H04GACAGGTGGGNONE 
J090089P06GACAGGTGGGNONE 
J090092E21GACAGGTGGGNONE 
J100014G01GACAGGTGGGNONE 
J100022L20GACAGGTGGGNONE 
J100024I05GACAGGTGGGNONE 
J100025L08GACAGGTGGGNONE 
J100030J03GACAGGTGGGNONE 
J100031K12GACAGGTGGGNONE 
J100036N01GACAGGTGGGNONE 
J100050C23GACAGGTGGGNONE 
J100062G12GACAGGTGGGNONE 
J100067L17GACAGGTGGGNONE 
J100074O09GACAGGTGGGNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0626100009-127-G03GACAGGTGGGCCACNONE 
AK062899GACAGGTGGGCCACSimilar to 50S ribosomal protein L7/L12. 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0657500AK058476GACAGGTGGNONE 
AK102906GACAGGTGGConserved hypothetical protein. 
J065191C23GACAGGTGGNONE 
J090053N13GACAGGTGGNONE 
J100042D17GACAGGTGGNONE 
J100042M11GACAGGTGGNONE 
J100045M20GACAGGTGGNONE 
Os07g0682400014-055-G10CACCTGTCNONE 
AK111514CACCTGTCNONE 
AK111556CACCTGTCNONE 
AK119893CACCTGTCZinc finger, CCCH-type domain containing protein. 
Os07g0690400AK108661CACCTGTCNONE 
Os08g0103300009-140-A11CACCTGTCNONE 
009-140-A11CACCTGTCNONE 
J013023D20CACCTGTCNONE 
J013023D20CACCTGTCNONE 
J013048G04CACCTGTCNONE 
J013048G04CACCTGTCNONE 
J013058F14CACCTGTCNONE 
J013058F14CACCTGTCNONE 
J013157I10CACCTGTCNONE 
J013157I10CACCTGTCNONE 
J023001B21CACCTGTCNONE 
J023001B21CACCTGTCNONE 
J023001J17CACCTGTCNONE 
J023001J17CACCTGTCNONE 
J023014K05CACCTGTCNONE 
J023014K05CACCTGTCNONE 
J023045D01CACCTGTCNONE 
J023045D01CACCTGTCNONE 
J023129J17CACCTGTCNONE 
J023129J17CACCTGTCNONE 
J033135C01CACCTGTCNONE 
J033135C01CACCTGTCNONE 
J043016J17CACCTGTCNONE 
J043016J17CACCTGTCNONE 
J043022O04CACCTGTCNONE 
J043022O04CACCTGTCNONE 
J043034I04CACCTGTCNONE 
J043034I04CACCTGTCNONE 
J065160I18CACCTGTCNONE 
J065160I18CACCTGTCNONE 
J090081A05CACCTGTCNONE 
J090081A05CACCTGTCNONE 
J100031J23CACCTGTCNONE 
J100031J23CACCTGTCNONE 
J100032A06CACCTGTCNONE 
J100032A06CACCTGTCNONE 
J100071B16CACCTGTCNONE 
J100071B16CACCTGTCNONE 
Os08g0121900AK101512CCCGTGGGACCCACCTGTCProtein of unknown function DUF23 family protein. 
AK101512GACAGGTGProtein of unknown function DUF23 family protein. 
Os08g0138500AK102951GGTGGGCCCCACCTGTCATCCACCSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GGTGGGCCCCACCTGTCATCCACCNONE 
J033115D14GGTGGGCCCCACCTGTCATCCACCNONE 
J065013F04GGTGGGCCCCACCTGTCATCCACCNONE 
J065050P11GGTGGGCCCCACCTGTCATCCACCNONE 
J065063K18GGTGGGCCCCACCTGTCATCCACCNONE 
J090054H10GGTGGGCCCCACCTGTCATCCACCNONE 
J100083F11GGTGGGCCCCACCTGTCATCCACCNONE 
Os08g0191900AK067587CTGACAGGTGGGCCCCProtein prenyltransferase domain containing protein. 
AK099016CTGACAGGTGGGCCCCNONE 
J013032I08CTGACAGGTGGGCCCCNONE 
J013050I24CTGACAGGTGGGCCCCNONE 
J013128E05CTGACAGGTGGGCCCCNONE 
Os08g0202200AK058765CCACCTGTCConserved hypothetical protein. 
Os08g0263100AK121216CCACCTGTCConserved hypothetical protein. 
J023090A04CCACCTGTCNONE 
Os08g0326600AK065219TGGGTCCCACCTGTCAGSimilar to GMP synthetase. 
Os08g0353700AK058799CACCTGTCConserved hypothetical protein. 
Os08g0366100AK061882AGGTGGGCCCCACCTGTCAGNONE 
AK120339AGGTGGGCCCCACCTGTCAGSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10AGGTGGGCCCCACCTGTCAGNONE 
J023135H23AGGTGGGCCCCACCTGTCAGNONE 
J033095L23AGGTGGGCCCCACCTGTCAGNONE 
J065010L09AGGTGGGCCCCACCTGTCAGNONE 
J065016A02AGGTGGGCCCCACCTGTCAGNONE 
J065041H14AGGTGGGCCCCACCTGTCAGNONE 
J065043F09AGGTGGGCCCCACCTGTCAGNONE 
J065045E03AGGTGGGCCCCACCTGTCAGNONE 
J065058F23AGGTGGGCCCCACCTGTCAGNONE 
J065075L19AGGTGGGCCCCACCTGTCAGNONE 
J065078N12AGGTGGGCCCCACCTGTCAGNONE 
J065105J19AGGTGGGCCCCACCTGTCAGNONE 
J065162I03AGGTGGGCCCCACCTGTCAGNONE 
J065164D10AGGTGGGCCCCACCTGTCAGNONE 
J065170B05AGGTGGGCCCCACCTGTCAGNONE 
J075039K19AGGTGGGCCCCACCTGTCAGNONE 
J075039M06AGGTGGGCCCCACCTGTCAGNONE 
J075057L17AGGTGGGCCCCACCTGTCAGNONE 
J075059F17AGGTGGGCCCCACCTGTCAGNONE 
J075109J04AGGTGGGCCCCACCTGTCAGNONE 
J075120B14AGGTGGGCCCCACCTGTCAGNONE 
J075153I11AGGTGGGCCCCACCTGTCAGNONE 
J075156C19AGGTGGGCCCCACCTGTCAGNONE 
J075166J20AGGTGGGCCCCACCTGTCAGNONE 
J090052H04AGGTGGGCCCCACCTGTCAGNONE 
J100051E13AGGTGGGCCCCACCTGTCAGNONE 
J100057L03AGGTGGGCCCCACCTGTCAGNONE 
J100059G23AGGTGGGCCCCACCTGTCAGNONE 
Os08g0379300AK103923CTGACAGGTGNONE 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
Os08g0479400AK109528GACAGGTGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
J090044L24GACAGGTGNONE 
J090063I11GACAGGTGNONE 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0504600AK064868GACAGGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013051G08GACAGGTGNONE 
Os08g0519600012-027-B02CACCTGTCNONE 
AK072374CACCTGTCNONE 
AK105273CACCTGTCProtein of unknown function DUF1666 family protein. 
Os08g0525000AK103220AGTGGGCCCCACCTGTCAGRas GTPase family protein. 
J033122O18AGTGGGCCCCACCTGTCAGNONE 
J065026M15AGTGGGCCCCACCTGTCAGNONE 
J075007I01AGTGGGCCCCACCTGTCAGNONE 
J075031E01AGTGGGCCCCACCTGTCAGNONE 
J075043N14AGTGGGCCCCACCTGTCAGNONE 
J075074O16AGTGGGCCCCACCTGTCAGNONE 
J075092O04AGTGGGCCCCACCTGTCAGNONE 
J075141D16AGTGGGCCCCACCTGTCAGNONE 
J075172C22AGTGGGCCCCACCTGTCAGNONE 
J075173A05AGTGGGCCCCACCTGTCAGNONE 
Os08g0531000AK072408AGTGGGCCCCACCTGTCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os09g0109600013-044-D05GACAGGTGNONE 
AK063582GACAGGTGConserved hypothetical protein. 
Os09g0122500J065067B01GGCCCCACCTGTCNONE 
J065113L16GGCCCCACCTGTCHypothetical protein. 
Os09g0306650Os09g0306650GACAGGTGSimilar to DVL12. 
Os09g0306700J023045A19GGCCCCACCTGTCNONE 
Os09g0323000AK121426CGCGTGGGCCCCACTCCACCTGTCSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0325700011-041-G03CCCACCACCTGTCNONE 
AK063334CCCACCACCTGTCSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CCCACCACCTGTCNONE 
Os09g0363700AK103667CTGACAGGTGGGCCCCConserved hypothetical protein. 
AK103667GACAGGTGGGConserved hypothetical protein. 
J075001L14CTGACAGGTGGGCCCCNONE 
J075001L14GACAGGTGGGNONE 
J075049M23CTGACAGGTGGGCCCCNONE 
J075049M23GACAGGTGGGNONE 
J075051I04CTGACAGGTGGGCCCCNONE 
J075051I04GACAGGTGGGNONE 
J075073L04CTGACAGGTGGGCCCCNONE 
J075073L04GACAGGTGGGNONE 
J075077E03CTGACAGGTGGGCCCCNONE 
J075077E03GACAGGTGGGNONE 
J075083J11CTGACAGGTGGGCCCCNONE 
J075083J11GACAGGTGGGNONE 
J075094J22CTGACAGGTGGGCCCCNONE 
J075094J22GACAGGTGGGNONE 
J075112E08CTGACAGGTGGGCCCCNONE 
J075112E08GACAGGTGGGNONE 
J075137J23CTGACAGGTGGGCCCCNONE 
J075137J23GACAGGTGGGNONE 
J075192E02CTGACAGGTGGGCCCCNONE 
J075192E02GACAGGTGGGNONE 
J100039K04CTGACAGGTGGGCCCCNONE 
J100039K04GACAGGTGGGNONE 
Os09g0380400009-200-D01GACAGGTGGGTCCCACTTGNONE 
AK063909GACAGGTGGGTCCCACTTGNONE 
AK072517GACAGGTGGGTCCCACTTGConserved hypothetical protein. 
AK073073GACAGGTGGGTCCCACTTGNONE 
J065205F20GACAGGTGGGTCCCACTTGNONE 
J100036D22GACAGGTGGGTCCCACTTGNONE 
J100047M01GACAGGTGGGTCCCACTTGNONE 
J100071G04GACAGGTGGGTCCCACTTGNONE 
Os09g0397200J065178K08GGTCCCACCTGTCConserved hypothetical protein. 
J065178L07GGTCCCACCTGTCNONE 
Os09g0401300AK059728GACAGGTGGNONE 
J023075J15GACAGGTGGNONE 
J023084B22GACAGGTGGNONE 
J065060C01GACAGGTGGNONE 
J065103N21GACAGGTGGNONE 
J065107F10GACAGGTGGNONE 
J065183K02GACAGGTGGNONE 
J065184B15GACAGGTGGNONE 
J075003G10GACAGGTGGNONE 
J075119D10GACAGGTGGNONE 
J080003L07GACAGGTGGNONE 
J080076D17GACAGGTGGNONE 
J090018O14GACAGGTGGNONE 
J090021M07GACAGGTGGNONE 
J090023G15GACAGGTGGNONE 
J090030H14GACAGGTGGNONE 
J090038A01GACAGGTGGNONE 
J090075M09GACAGGTGGNONE 
J090099J11GACAGGTGGNONE 
J100044K19GACAGGTGGNONE 
J100057B17GACAGGTGGNONE 
J100084F15GACAGGTGGNONE 
Os09g0402100009-119-F11GACAGGTGGGCCCCACTCCNONE 
009-166-C09GACAGGTGGGCCCCACTCCNONE 
AK068506GACAGGTGGGCCCCACTCCPF1 protein. 
J065130I01GACAGGTGGGCCCCACTCCNONE 
L24390GACAGGTGGGCCCCACTCCNONE 
Os09g0409000AK107676GGTCCCACCTGTCConserved hypothetical protein. 
Os09g0426800AK060786ACTGACAGGTGNONE 
AK120227ACTGACAGGTGSimilar to Glossy1 protein. 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0484800AK071962CACCTGTCNONE 
AK109548CACCTGTCSimilar to Pirin-like protein. 
Os09g0493400AK102021CACCTGTCFerritin/ribonucleotide reductase-like family protein. 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0528000AK072633GACAGGTGGGCCCCGTGGGNONE 
AK100918GACAGGTGGGCCCCGTGGGKinesin, motor region domain containing protein. 
Os09g0554000J065123C23CACTGACAGGTGGSimilar to Mitochondrial phosphate transporter. 
Os11g0140300009-175-B06GACAGGTGGNONE 
AK063105GACAGGTGGConserved hypothetical protein. 
Os11g0187500012-002-D06CTGACAGGTGGGGCCNONE 
012-035-H04CTGACAGGTGGGGCCNONE 
012-065-F08CTGACAGGTGGGGCCNONE 
AK063977CTGACAGGTGGGGCCSimilar to Heat shock protein 70. 
AK103083CTGACAGGTGGGGCCNONE 
J033118G15CTGACAGGTGGGGCCNONE 
J065115E02CTGACAGGTGGGGCCNONE 
J065178K04CTGACAGGTGGGGCCNONE 
J065178L03CTGACAGGTGGGGCCNONE 
J090064A22CTGACAGGTGGGGCCNONE 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
AK098929GACAGGTGGGCCCCACCACNONE 
J013026M18GACAGGTGGGCCCCACCACNONE 
J013050K16GACAGGTGGGCCCCACCACNONE 
J013156L24GACAGGTGGGCCCCACCACNONE 
J023022H22GACAGGTGGGCCCCACCACNONE 
J023065I09GACAGGTGGGCCCCACCACNONE 
J023084F23GACAGGTGGGCCCCACCACNONE 
J033111G01GACAGGTGGGCCCCACCACNONE 
J053026C09GACAGGTGGGCCCCACCACNONE 
J053027J02GACAGGTGGGCCCCACCACNONE 
J053061N23GACAGGTGGGCCCCACCACNONE 
J053086A13GACAGGTGGGCCCCACCACNONE 
J053094C15GACAGGTGGGCCCCACCACNONE 
J075094C03GACAGGTGGGCCCCACCACNONE 
J075150B17GACAGGTGGGCCCCACCACNONE 
J090097L07GACAGGTGGGCCCCACCACNONE 
J100025O15GACAGGTGGGCCCCACCACNONE 
J100077N15GACAGGTGGGCCCCACCACNONE 
Os11g0527000J065137N17CATGGGCCCCACCTGTCConserved hypothetical protein. 
J065137N17GTGGGTCCCACCTGTCConserved hypothetical protein. 
Os11g0568300016-075-B02CCACCTGTCAGNONE 
AK064398CCACCTGTCAGHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282CCACCTGTCAGNONE 
J033124M10CCACCTGTCAGNONE 
J065120I21CCACCTGTCAGNONE 
J065144H16CCACCTGTCAGNONE 
Os11g0578500AK121330CACCTGTCHeat shock protein DnaJ family protein. 
Os11g0580000AK119421CTGACAGGTGGGCCCCAGArmadillo-like helical domain containing protein. 
AK121905CTGACAGGTGGGCCCCAGNONE 
J033105I06CTGACAGGTGGGCCCCAGNONE 
J090022C10CTGACAGGTGGGCCCCAGNONE 
J090024J23CTGACAGGTGGGCCCCAGNONE 
J090044F24CTGACAGGTGGGCCCCAGNONE 
Os11g0591000J065047F12CACCTGTCHypothetical protein. 
J065080M18CACCTGTCNONE 
Os11g0672900014-017-A02GGTCCCACCTGTCAGNONE 
AK105350GGTCCCACCTGTCAGProtein of unknown function DUF1645 family protein. 
Os11g0704600015-027-B02CACCTGTCNONE 
015-071-C03CACCTGTCNONE 
AK059271CACCTGTCNONE 
AK100931CACCTGTCNONE 
AK102883CACCTGTCSimilar to Beta-1,3 glucanase precursor (EC 3.2.1.39). 
J065117H11CACCTGTCNONE 
J090003L01CACCTGTCNONE 
Os12g0120000011-024-E09CCCACCTGTCNONE 
AK105399CCCACCTGTCProtein of unknown function DUF936, plant family protein. 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0197400J013068J02CTGGGGCCCACCTGTCAGNONE 
J013074K04CTGGGGCCCACCTGTCAGNONE 
J013089J21CTGGGGCCCACCTGTCAGNONE 
J013170B12CTGGGGCCCACCTGTCAGNONE 
J033029L11CTGGGGCCCACCTGTCAGNONE 
J033051A07CTGGGGCCCACCTGTCAGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18CTGGGGCCCACCTGTCAGNONE 
J065101D01CTGGGGCCCACCTGTCAGNONE 
J065144J23CTGGGGCCCACCTGTCAGNONE 
J065206D18CTGGGGCCCACCTGTCAGNONE 
Os12g0244000AK106408GACAGGTGGHypothetical protein. 
AK106408GGCCCCACCTGTCAGHypothetical protein. 
Os12g0405300AK070969GTGGGACCCACCTGTCConserved hypothetical protein. 
Os12g0472800AK063278AGGGCCCACCTGTCAGB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0500700AK073408CCCACCTGTCAGTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.