version

Summary of OsREG502 (All List)

OrganismOryza sativa  
IDOsREG502  
SequenceCACGCCAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1279  

Entry Sequences (1279 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09ACGTGGCGTGNONE 
015-011-E06ACGTGGCGTGNONE 
016-083-H11ACGTGGCGTGNONE 
AK100002ACGTGGCGTGConserved hypothetical protein. 
J065063K05ACGTGGCGTGNONE 
J065191H24ACGTGGCGTGNONE 
J100079N16ACGTGGCGTGNONE 
Os01g0136300009-034-B11GTGGCGTGNONE 
AK062428GTGGCGTGConserved hypothetical protein. 
Os01g0144600006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0171200AK107515GTGGCGTGNONE 
AK109475GTGGCGTGConserved hypothetical protein. 
Os01g0233900011-038-E11GGCCGTGGCGTGNONE 
AK100714GGCCGTGGCGTGUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023115K12GGCCGTGGCGTGNONE 
J033103B07GGCCGTGGCGTGNONE 
J075011L24GGCCGTGGCGTGNONE 
J075022O12GGCCGTGGCGTGNONE 
Os01g0238200009-027-B03CACGCCACNONE 
009-031-A07CACGCCACNONE 
009-119-A04CACGCCACNONE 
009-175-C11CACGCCACNONE 
AK062403CACGCCACConserved hypothetical protein. 
AK063106CACGCCACNONE 
J065058A15CACGCCACNONE 
J065116N10CACGCCACNONE 
J065141K18CACGCCACNONE 
Os01g0254000006-037-A11CACGCCACNONE 
006-059-H09CACGCCACNONE 
006-088-D11CACGCCACNONE 
006-112-B06CACGCCACNONE 
006-120-E12CACGCCACNONE 
AK111904CACGCCACNONE 
AK111979CACGCCACNONE 
AK119548CACGCCACNONE 
AY620417CACGCCACSimilar to NTGB2 (Fragment). 
J023112F13CACGCCACNONE 
J053066C19CACGCCACNONE 
J065006L12CACGCCACNONE 
J065019L17CACGCCACNONE 
J065081J05CACGCCACNONE 
J065085D02CACGCCACNONE 
J065203D03CACGCCACNONE 
J065210O20CACGCCACNONE 
J090062P06CACGCCACNONE 
J090063N07CACGCCACNONE 
J100061H24CACGCCACNONE 
Os01g0272600015-046-G06CACGCCACNONE 
AK067786CACGCCACConserved hypothetical protein. 
Os01g0273800AK109645TCCACGCCACFAD dependent oxidoreductase family protein. 
Os01g0279700AK067683CACGCCACGCCTCNONE 
AK100107CACGCCACGCCTCMajor facilitator superfamily protein. 
J023004N09CACGCCACGCCTCNONE 
J075019L14CACGCCACGCCTCNONE 
J075187F21CACGCCACGCCTCNONE 
Os01g0281100AK109672GTGACGTGTGGCGTGConserved hypothetical protein. 
J065013K07GTGACGTGTGGCGTGNONE 
J065040E15GTGACGTGTGGCGTGNONE 
J065127F12GTGACGTGTGGCGTGNONE 
J075155K23GTGACGTGTGGCGTGNONE 
Os01g0313300AJ575219GCCCCCACGCCACNONE 
AK111775GCCCCCACGCCACSimilar to EREBP-3 protein (Fragment). 
J023075G11GCCCCCACGCCACNONE 
J065086L01GCCCCCACGCCACNONE 
J065161K09GCCCCCACGCCACNONE 
J075019P13GCCCCCACGCCACNONE 
Os01g0347000AK069585CACGCCACSimilar to PROPYZAMIDE-HTPERSENSITIVE 1. 
Os01g0390400AK067433TCCACGCCACNONE 
AK106834TCCACGCCACNONE 
J033069B09TCCACGCCACNONE 
Os01g0623900J090025M21CACGCCACGCCACGCGACGCGACNONE 
J090082F22CACGCCACGCCACGCGACGCGACNONE 
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0665200012-014-E12CACGCCACNONE 
AK072082CACGCCACSimilar to Blast and wounding induced mitogen-activated protein kinase. 
J013000P12CACGCCACNONE 
J013074J01CACGCCACNONE 
J013147E15CACGCCACNONE 
J023003P12CACGCCACNONE 
J023126F21CACGCCACNONE 
J033028H14CACGCCACNONE 
J033034L22CACGCCACNONE 
Os01g0672400AK060901GTGGCGTGNONE 
AK061329GTGGCGTGDrought induced 19 family protein. 
AK101922GTGGCGTGNONE 
Os01g0675500AK062112CACGCCACNONE 
Os01g0705500AK063120GTGGCGTGConserved hypothetical protein. 
J065063M12GTGGCGTGNONE 
J065165C11GTGGCGTGNONE 
Os01g0730300AK101207CACGCCACHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CACGCCACNONE 
Os01g0736600009-105-F04CACGCCACNONE 
014-035-D08CACGCCACNONE 
AK099546CACGCCACZinc finger, RING-type domain containing protein. 
AK105189CACGCCACNONE 
J065155B14CACGCCACNONE 
J075007F01CACGCCACNONE 
Os01g0752600AK100905GTGGCGTGGlycosyl transferase, family 19 protein. 
Os01g0756200AK108553GTGGCGTGSimilar to VirE2-interacting protein VIP1. 
Os01g0760600011-038-B09CCCCCACGCCACNONE 
AB110193CCCCCACGCCACNONE 
AK103133CCCCCACGCCACNONE 
AK104829CCCCCACGCCACNONE 
D14673CCCCCACGCCACNONE 
J023110C16CCCCCACGCCACNONE 
J033028M22CCCCCACGCCACNONE 
J033038A21CCCCCACGCCACNONE 
J033044D24CCCCCACGCCACNONE 
J033095C16CCCCCACGCCACNONE 
J090003F07CCCCCACGCCACNONE 
J090009P10CCCCCACGCCACNONE 
J090023K01CCCCCACGCCACNONE 
J090033G02CCCCCACGCCACNONE 
J090037I22CCCCCACGCCACNONE 
J090038A17CCCCCACGCCACNONE 
J090048K09CCCCCACGCCACNONE 
J090069N01CCCCCACGCCACNONE 
J090078C19CCCCCACGCCACNONE 
J090089P15CCCCCACGCCACNONE 
J090093D07CCCCCACGCCACNONE 
J090095H01CCCCCACGCCACNONE 
J100057J03CCCCCACGCCACNONE 
Os01g0776700J065046N20CACGCCACConserved hypothetical protein. 
J100086L02CACGCCACNONE 
Os01g0794400AK122041GTGGCGTGACTCGACThioredoxin domain 2 containing protein. 
Os01g0800300006-097-C12CACGCCACGCGGGGGNONE 
014-070-C12CACGCCACGCGGGGGNONE 
AK072549CACGCCACGCGGGGGNONE 
AK100942CACGCCACGCGGGGGNONE 
AK100951CACGCCACGCGGGGGConserved hypothetical protein. 
AK106023CACGCCACGCGGGGGNONE 
J023138D05CACGCCACGCGGGGGNONE 
J075097P16CACGCCACGCGGGGGNONE 
J075099F23CACGCCACGCGGGGGNONE 
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment). 
Os01g0830700AK101671GTGGCGTGProtein of unknown function DUF231, plant domain containing protein. 
AK105654GTGGCGTGNONE 
Os01g0836400AK073540CACGCCACSAC3/GANP family protein. 
J023019D11CACGCCACNONE 
J023139O22CACGCCACNONE 
J033042J20CACGCCACNONE 
J033046M18CACGCCACNONE 
J033124J09CACGCCACNONE 
J090015E05CACGCCACNONE 
J090076J09CACGCCACNONE 
Os01g0841000009-005-A12CACGCCACGCGTNONE 
AK059601CACGCCACGCGTENTH/VHS domain containing protein. 
AK103342CACGCCACGCGTNONE 
J023022C02CACGCCACGCGTNONE 
J023030C09CACGCCACGCGTNONE 
J033075D24CACGCCACGCGTNONE 
J033123O16CACGCCACGCGTNONE 
J033126C16CACGCCACGCGTNONE 
J065120M23CACGCCACGCGTNONE 
J065190I23CACGCCACGCGTNONE 
J090090G01CACGCCACGCGTNONE 
Os01g0851300AK101770GACGTGGCGTGReticulon family protein. 
J033064I03GACGTGGCGTGNONE 
J100058A05GACGTGGCGTGNONE 
Os01g0862800AK071274GTCCCACCACGCCACNo apical meristem (NAM) protein domain containing protein. 
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein. 
Os01g0869800006-029-F03CACGCCACGCGGCCCATGNONE 
006-067-H02CACGCCACGCGGCCCATGNONE 
006-084-A06CACGCCACGCGGCCCATGNONE 
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS. 
AK071827CACGCCACGCGGCCCATGNONE 
AK104275CACGCCACGCGGCCCATGNONE 
J013049J07CACGCCACGCGGCCCATGNONE 
J033089F12CACGCCACGCGGCCCATGNONE 
J090094I11CACGCCACGCGGCCCATGNONE 
Os01g0885600AK059523CACGCCACEsterase/lipase/thioesterase domain containing protein. 
J065013G01CACGCCACNONE 
J065063D03CACGCCACNONE 
J065143H01CACGCCACNONE 
J065146F08CACGCCACNONE 
J065153D14CACGCCACNONE 
J065170E02CACGCCACNONE 
J065175M22CACGCCACNONE 
J065186E13CACGCCACNONE 
J075023J16CACGCCACNONE 
J075176J06CACGCCACNONE 
Os01g0913600AK071735CACGCCACSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
J023003J11CACGCCACNONE 
J023037O11CACGCCACNONE 
J023109K10CACGCCACNONE 
Os01g0962100AK109813CACGCCACConserved hypothetical protein. 
Os02g0105500AK063929GTGGCGTGNONE 
AK102953GTGGCGTGIQ calmodulin-binding region domain containing protein. 
Os02g0115900AF006825CACGCCACNONE 
AK065743CACGCCACEndosperm lumenal binding protein. 
AK119653CACGCCACNONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
Os02g0202400AK107368CACGCCACSimilar to Plastidial ADP-glucose transporter. 
J075147G14CACGCCACNONE 
J090009K03CACGCCACNONE 
Os02g0209400AK108109GTCGCGCGCCACGCCACGCCACConserved hypothetical protein. 
Os02g0496300014-031-F08CCCACACGCCACNONE 
AK069861CCCACACGCCACNONE 
AK105361CCCACACGCCACConserved hypothetical protein. 
J023038A06CCCACACGCCACNONE 
Os02g0600200009-154-A06CACGCCACGTNONE 
AK058978CACGCCACGTNONE 
AK066974CACGCCACGTIQ calmodulin-binding region domain containing protein. 
Os02g0613200AK064869GTGGCGTGNONE 
AK065051GTGGCGTGNONE 
AK098853GTGGCGTGConserved hypothetical protein. 
AK098974GTGGCGTGNONE 
J013000H15GTGGCGTGNONE 
J013001I18GTGGCGTGNONE 
J013022I18GTGGCGTGNONE 
J013025D06GTGGCGTGNONE 
J013037H17GTGGCGTGNONE 
J013043F22GTGGCGTGNONE 
J013075E01GTGGCGTGNONE 
J013088D09GTGGCGTGNONE 
J013088E19GTGGCGTGNONE 
J013102O18GTGGCGTGNONE 
J013110C08GTGGCGTGNONE 
J013118C06GTGGCGTGNONE 
J013119F22GTGGCGTGNONE 
J013128K14GTGGCGTGNONE 
J013158C17GTGGCGTGNONE 
J023013P15GTGGCGTGNONE 
J023044L21GTGGCGTGNONE 
J033023I04GTGGCGTGNONE 
J033038I22GTGGCGTGNONE 
J033095M02GTGGCGTGNONE 
J043022F05GTGGCGTGNONE 
J080307N20GTGGCGTGNONE 
J080315C02GTGGCGTGNONE 
J080316A15GTGGCGTGNONE 
J080316G03GTGGCGTGNONE 
J090029E24GTGGCGTGNONE 
J090031H15GTGGCGTGNONE 
J090034F13GTGGCGTGNONE 
J090047G02GTGGCGTGNONE 
J090069M24GTGGCGTGNONE 
J100052E15GTGGCGTGNONE 
Os02g0614200AK061591GTGGCGTGConserved hypothetical protein. 
J065191B08GTGGCGTGNONE 
Os02g0616600AK106681CACGCCACConserved hypothetical protein. 
J065062G16CACGCCACNONE 
Os02g0625000AB103094GTGGCGTGNONE 
AJ298877GTGGCGTGNONE 
AK065669GTGGCGTGNONE 
AK099334GTGGCGTGNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0741500AK068867CACGCCACRibbon-helix-helix domain containing protein. 
Os02g0755200AK070699GTGGCGTGGASimilar to FLOWERING LOCUS D (Fragment). 
J023056I20GTGGCGTGGANONE 
J065048B13GTGGCGTGGANONE 
J065128H21GTGGCGTGGANONE 
J065201E09GTGGCGTGGANONE 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os03g0101600006-047-B09GTGGCGTGGGCNONE 
006-082-H11GTGGCGTGGGCNONE 
AK061143GTGGCGTGGGCNONE 
AK069374GTGGCGTGGGCSimilar to Quinone oxidoreductase. 
J023012O14GTGGCGTGGGCNONE 
Os03g0119500AK060258GTGGCGTGGANONE 
Os03g0119700011-050-F05GTGGCGTGGANONE 
AK105249GTGGCGTGGANONE 
AK119410GTGGCGTGGATetratricopeptide-like helical domain containing protein. 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
J065085G16GTGGCGTGGGCCAANONE 
J100086C03GTGGCGTGGGCCAANONE 
Os03g0129300AK067755TCCACGCCACSimilar to Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) (Fragment). 
J013118G18TCCACGCCACNONE 
J065024E09TCCACGCCACNONE 
J065024I09TCCACGCCACNONE 
J065038L15TCCACGCCACNONE 
J065040E10TCCACGCCACNONE 
J065042C14TCCACGCCACNONE 
J065053F19TCCACGCCACNONE 
J065061D05TCCACGCCACNONE 
J065063H01TCCACGCCACNONE 
J065064D11TCCACGCCACNONE 
J065085I03TCCACGCCACNONE 
J065091A13TCCACGCCACNONE 
J065091O11TCCACGCCACNONE 
J065099G22TCCACGCCACNONE 
J065100E18TCCACGCCACNONE 
J065107B13TCCACGCCACNONE 
J065120A19TCCACGCCACNONE 
J065158E01TCCACGCCACNONE 
J065165D07TCCACGCCACNONE 
J065166K03TCCACGCCACNONE 
J065166P18TCCACGCCACNONE 
J065171K03TCCACGCCACNONE 
J065184H11TCCACGCCACNONE 
J065187H22TCCACGCCACNONE 
J065196N06TCCACGCCACNONE 
J065196P13TCCACGCCACNONE 
J065196P19TCCACGCCACNONE 
J065202P20TCCACGCCACNONE 
J065205L15TCCACGCCACNONE 
J075015H23TCCACGCCACNONE 
J075039I11TCCACGCCACNONE 
J075043L15TCCACGCCACNONE 
J075045C15TCCACGCCACNONE 
J075052F12TCCACGCCACNONE 
J075053J17TCCACGCCACNONE 
J075060L14TCCACGCCACNONE 
J075073G04TCCACGCCACNONE 
J075084H08TCCACGCCACNONE 
J075085O17TCCACGCCACNONE 
J075092E21TCCACGCCACNONE 
J075095M06TCCACGCCACNONE 
J075097H17TCCACGCCACNONE 
J075101I16TCCACGCCACNONE 
J075104B08TCCACGCCACNONE 
J075111K02TCCACGCCACNONE 
J075114M07TCCACGCCACNONE 
J075119G16TCCACGCCACNONE 
J075119M06TCCACGCCACNONE 
J075120B16TCCACGCCACNONE 
J075134K15TCCACGCCACNONE 
J075136M07TCCACGCCACNONE 
J075138L21TCCACGCCACNONE 
J075139H24TCCACGCCACNONE 
J075157C11TCCACGCCACNONE 
J075159H15TCCACGCCACNONE 
J075159N11TCCACGCCACNONE 
J075177F01TCCACGCCACNONE 
J075198H03TCCACGCCACNONE 
J090071B14TCCACGCCACNONE 
Os03g0137400AK072057CACGCCACGCCACNONE 
AK101118CACGCCACGCCACProtein of unknown function DUF221 domain containing protein. 
J013129L02CACGCCACGCCACNONE 
J033025H22CACGCCACGCCACNONE 
J033034L15CACGCCACGCCACNONE 
J033044F21CACGCCACGCCACNONE 
J033046F15CACGCCACGCCACNONE 
J033101I17CACGCCACGCCACNONE 
J033150K16CACGCCACGCCACNONE 
J065042G12CACGCCACGCCACNONE 
J065083F17CACGCCACGCCACNONE 
J100044G19CACGCCACGCCACNONE 
Os03g0144800AK103041GCCCACGCCACSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
J013043M12GCCCACGCCACNONE 
J013043N11GCCCACGCCACNONE 
J013093E21GCCCACGCCACNONE 
J033030E13GCCCACGCCACNONE 
J033044H20GCCCACGCCACNONE 
J033084H08GCCCACGCCACNONE 
J033117F03GCCCACGCCACNONE 
J043005E24GCCCACGCCACNONE 
J065218M08GCCCACGCCACNONE 
Os03g0146300011-078-E08CCAGCCCACGCCACNONE 
014-009-B07CCAGCCCACGCCACNONE 
AK121395CCAGCCCACGCCACSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319CCAGCCCACGCCACNONE 
J013104I06CCAGCCCACGCCACNONE 
J023130M16CCAGCCCACGCCACNONE 
J053037E13CCAGCCCACGCCACNONE 
J075104M08CCAGCCCACGCCACNONE 
J075144I22CCAGCCCACGCCACNONE 
J100057B09CCAGCCCACGCCACNONE 
Os03g0149800006-115-C08CACGCCACNONE 
AK109394CACGCCACSimilar to RING-H2 finger protein ATL1D. 
Os03g0197300AK102651CACGCCACGCCACCCCCACGTCGCGCGCCupin, RmlC-type domain containing protein. 
Os03g0269900AK101153CACGCCACProtein of unknown function DUF604 family protein. 
J065001B15CACGCCACNONE 
Os03g0275500003-016-A07CACGCCACNONE 
AK060774CACGCCACNONE 
J080001J24CACGCCACNONE 
J080010J16CACGCCACNONE 
J080010N08CACGCCACNONE 
J080013E06CACGCCACNONE 
J080018G18CACGCCACNONE 
J080023A08CACGCCACNONE 
J080034N18CACGCCACNONE 
J080038D24CACGCCACNONE 
J080045E23CACGCCACNONE 
J080045P19CACGCCACNONE 
J080051O05CACGCCACNONE 
J080060E01CACGCCACNONE 
J080060M06CACGCCACNONE 
J080091F05CACGCCACNONE 
J080096L24CACGCCACNONE 
Os03g0284700AK069841GTGGCGTGHypothetical protein. 
Os03g0285800AF216315GTGGCGTGNONE 
AF332873GTGGCGTGNONE 
AF479883GTGGCGTGNONE 
AF479884GTGGCGTGNONE 
AJ250311GTGGCGTGNONE 
AJ486975GTGGCGTGNONE 
AK067339GTGGCGTGMAP Kinase. 
AK104834GTGGCGTGNONE 
J013102O17GTGGCGTGNONE 
J023055N19GTGGCGTGNONE 
J023099F06GTGGCGTGNONE 
J065144H06GTGGCGTGNONE 
J065153A14GTGGCGTGNONE 
J065212K01GTGGCGTGNONE 
Os03g0298600009-095-C02TCCACGCCACCAACNONE 
AK066846TCCACGCCACCAACTetratricopeptide-like helical domain containing protein. 
Os03g0300900014-046-H03CACGCCACGTGNONE 
AK064068CACGCCACGTGNONE 
Os03g0302900011-005-H01TCCACGCCACNONE 
AK069222TCCACGCCACConserved hypothetical protein. 
J023014L15TCCACGCCACNONE 
J033023G12TCCACGCCACNONE 
J090008H16TCCACGCCACNONE 
Os03g0343900009-077-C03TCCACGCCACGTGGCNONE 
AK105813TCCACGCCACGTGGCPhotosystem II protein PsbX family protein. 
J100059N03TCCACGCCACGTGGCNONE 
J100079C20TCCACGCCACGTGGCNONE 
Os03g0364400AK066529GTGGCGTGGASimilar to Phytosulfokine receptor-like protein. 
AK071963GTGGCGTGGANONE 
J013073L01GTGGCGTGGANONE 
J100037H12GTGGCGTGGANONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0669300006-050-A06CACGCCACNONE 
AK061572CACGCCACGlycoside hydrolase, family 17 protein. 
AK120399CACGCCACNONE 
AK120903CACGCCACNONE 
J075023N09CACGCCACNONE 
J075083N02CACGCCACNONE 
J075097I22CACGCCACNONE 
J100070D08CACGCCACNONE 
J100086L13CACGCCACNONE 
Os03g0700600AK107009GTGGCGTGConserved hypothetical protein. 
Os03g0703300016-074-H01CACGCCACNONE 
016-074-H01CACGCCACGCCACNONE 
AK073831CACGCCACCalponin-like actin-binding domain containing protein. 
AK073831CACGCCACGCCACCalponin-like actin-binding domain containing protein. 
Os03g0722600J075145A04CACGCCACCAP protein family protein. 
Os03g0755100AK066049CACGCCACSimilar to Transporter associated with antigen processing-like protein. 
Os03g0773600AK103310GTGGCGTGKinesin, motor region domain containing protein. 
Os03g0786500016-056-D08CGCGTCGCACGCCACNONE 
AK106487CGCGTCGCACGCCACSimilar to Glycine-rich protein 2. 
J080001C23CGCGTCGCACGCCACNONE 
J080005A02CGCGTCGCACGCCACNONE 
J080009A14CGCGTCGCACGCCACNONE 
J080009B11CGCGTCGCACGCCACNONE 
J080011L03CGCGTCGCACGCCACNONE 
J080017E21CGCGTCGCACGCCACNONE 
J080018H08CGCGTCGCACGCCACNONE 
J080021E11CGCGTCGCACGCCACNONE 
J080025O20CGCGTCGCACGCCACNONE 
J080026H21CGCGTCGCACGCCACNONE 
J080029I10CGCGTCGCACGCCACNONE 
J080036L01CGCGTCGCACGCCACNONE 
J080038M15CGCGTCGCACGCCACNONE 
J080051H09CGCGTCGCACGCCACNONE 
J080053E18CGCGTCGCACGCCACNONE 
J080054I12CGCGTCGCACGCCACNONE 
J080055B14CGCGTCGCACGCCACNONE 
J080060L16CGCGTCGCACGCCACNONE 
J080067G06CGCGTCGCACGCCACNONE 
J080069K14CGCGTCGCACGCCACNONE 
J080070N14CGCGTCGCACGCCACNONE 
J080071G10CGCGTCGCACGCCACNONE 
J080076D08CGCGTCGCACGCCACNONE 
J080076O11CGCGTCGCACGCCACNONE 
J080078E10CGCGTCGCACGCCACNONE 
J080079B15CGCGTCGCACGCCACNONE 
J080079K03CGCGTCGCACGCCACNONE 
J080079O15CGCGTCGCACGCCACNONE 
J080087B18CGCGTCGCACGCCACNONE 
Os03g0786700AK067936TCCACGCCACN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0793800003-107-B05CACGCCACNONE 
006-043-E11CACGCCACNONE 
009-092-B10CACGCCACNONE 
009-173-G09CACGCCACNONE 
AK058812CACGCCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J065063N11CACGCCACNONE 
J075065L02CACGCCACNONE 
J075068K22CACGCCACNONE 
J075124I23CACGCCACNONE 
J075127F10CACGCCACNONE 
J075198A21CACGCCACNONE 
Os03g0820400009-042-F06GTGGCGTGNONE 
009-046-E08GTGGCGTGNONE 
009-079-B08GTGGCGTGNONE 
009-111-H09GTGGCGTGNONE 
009-150-D10GTGGCGTGNONE 
015-073-H11GTGGCGTGNONE 
AK119690GTGGCGTGSimilar to ZPT2-13. 
AY286473GTGGCGTGNONE 
AY305864GTGGCGTGNONE 
J100051O21GTGGCGTGNONE 
Os03g0825300AK072216ACCCCCCACCCCACACACGCCACNONE 
AK102693ACCCCCCACCCCACACACGCCACNONE 
AK105593ACCCCCCACCCCACACACGCCACProtein kinase-like domain containing protein. 
BT014687ACCCCCCACCCCACACACGCCACNONE 
Os03g0830500J065024D01GTGGCGTGNONE 
J065078H14GTGGCGTGNONE 
J065099B04GTGGCGTGNONE 
J065129J08GTGGCGTGNONE 
J100037P21GTGGCGTGNONE 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
Os03g0838900AK066994GTGGCGTGConserved hypothetical protein. 
J013088J21GTGGCGTGNONE 
J065094N18GTGGCGTGNONE 
J075037E08GTGGCGTGNONE 
J075123C06GTGGCGTGNONE 
J075123G02GTGGCGTGNONE 
J090045G20GTGGCGTGNONE 
Os03g0844900AK100284GTGGCGTGRNA binding S1 domain containing protein. 
J023075D13GTGGCGTGNONE 
Os03g0851800006-071-B07GTGGCGTGNONE 
006-102-A08GTGGCGTGNONE 
AK066656GTGGCGTGNONE 
AK104812GTGGCGTGNONE 
J013072H13GTGGCGTGNONE 
J013095E21GTGGCGTGNONE 
J043005I06GTGGCGTGNONE 
J065212H04GTGGCGTGNONE 
J075007C18GTGGCGTGNONE 
J075063A13GTGGCGTGNONE 
J075151I15GTGGCGTGNONE 
Y10253GTGGCGTGSimilar to Pantoate--beta-alanine ligase (EC 6.3.2.1) (Pantothenate synthetase) (Pantoate activating enzyme). 
Os04g0117800Os04g0117800CACGCCACCTGTAmidase family protein. 
Os04g0293600AK063003GTGGCGTGHypothetical protein. 
Os04g0337300AK060427CACGCCACHypothetical protein. 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0387600009-148-E01CACGCCACNONE 
009-155-A11CACGCCACNONE 
009-175-F04CACGCCACNONE 
AK063862CACGCCACConserved hypothetical protein. 
J065035F12CACGCCACNONE 
J065162C13CACGCCACNONE 
J065169L19CACGCCACNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0464200AK103582CACGCCACGCCACBetaine-aldehyde dehydrogenase (EC 1.2.1.8) (BADH). 
J033133A13CACGCCACGCCACNONE 
J090026I06CACGCCACGCCACNONE 
J090096B12CACGCCACGCCACNONE 
Os04g0476800AK070908CACGCCACSimilar to TA5 protein (Fragment). 
Os04g0483500009-132-G09GTGGCGTGNONE 
AK060512GTGGCGTGSimilar to B-keto acyl reductase. 
J065021G03GTGGCGTGNONE 
J080304E09GTGGCGTGNONE 
J080311F01GTGGCGTGNONE 
J080317H02GTGGCGTGNONE 
J080317L09GTGGCGTGNONE 
J100047G13GTGGCGTGNONE 
J100066L09GTGGCGTGNONE 
Os04g0502300009-116-F02CACGCCACNONE 
009-130-H06CACGCCACNONE 
AK120520CACGCCACSimilar to 40S ribosomal protein S11. 
J013124K01CACGCCACNONE 
J023102F03CACGCCACNONE 
J033094F17CACGCCACNONE 
J053054C22CACGCCACNONE 
J065024N13CACGCCACNONE 
J065083J18CACGCCACNONE 
J065132O14CACGCCACNONE 
J065156M09CACGCCACNONE 
J065176N15CACGCCACNONE 
J065208H08CACGCCACNONE 
J075054B03CACGCCACNONE 
J090053E20CACGCCACNONE 
J100075B09CACGCCACNONE 
J100089H12CACGCCACNONE 
Os04g0511400AK070476CACGCCACGCGCGGGTNONE 
AK072430CACGCCACGCGCGGGTSugar transporter family protein. 
J023054A07CACGCCACGCGCGGGTNONE 
Os04g0531100013-046-D02CACGCCACNONE 
AF090698CACGCCACNONE 
AK063584CACGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGCCACNONE 
J065028L15CACGCCACNONE 
J065048O03CACGCCACNONE 
J065053K10CACGCCACNONE 
J065072H10CACGCCACNONE 
J065081H10CACGCCACNONE 
J065082N17CACGCCACNONE 
J065104K08CACGCCACNONE 
J065106M03CACGCCACNONE 
J065119I05CACGCCACNONE 
J065122F04CACGCCACNONE 
J065140N24CACGCCACNONE 
J065153G09CACGCCACNONE 
J065171H07CACGCCACNONE 
J065172M23CACGCCACNONE 
J065173K13CACGCCACNONE 
J065177D22CACGCCACNONE 
J065189H10CACGCCACNONE 
J065198H24CACGCCACNONE 
J065204D19CACGCCACNONE 
J075006C08CACGCCACNONE 
J075029I08CACGCCACNONE 
J075039A16CACGCCACNONE 
J075107I24CACGCCACNONE 
J075135M22CACGCCACNONE 
J075181P06CACGCCACNONE 
J075190O11CACGCCACNONE 
J075193F04CACGCCACNONE 
Os04g0549300AK063296CACGCCACSimilar to GA protein (Fragment). 
J065073I11CACGCCACNONE 
J065172C13CACGCCACNONE 
J090004B10CACGCCACNONE 
J090039N18CACGCCACNONE 
J090088F09CACGCCACNONE 
Os04g0566300009-017-D06ACGCGTCCACGCCACNONE 
AK062357ACGCGTCCACGCCACHypothetical protein. 
Os04g0574100006-087-B01GTGGCGTGNONE 
AK061150GTGGCGTGNONE 
AK069178GTGGCGTGExostosin-like family protein. 
AK121041GTGGCGTGNONE 
J023008D04GTGGCGTGNONE 
J023052A13GTGGCGTGNONE 
J065046P18GTGGCGTGNONE 
J065105D10GTGGCGTGNONE 
Os04g0577800009-022-G09CACGCCACProtein of unknown function UPF0136, Transmembrane family protein. 
009-029-D09CACGCCACNONE 
J065089O06CACGCCACNONE 
J100080N01CACGCCACNONE 
Os04g0579200AK100603CACGCCACZinc finger, RING-type domain containing protein. 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0591300009-006-D05GTGGCGTGNONE 
AK105120GTGGCGTGConserved hypothetical protein. 
Os04g0609200AK103652GTGGCGTGMajor facilitator superfamily protein. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0635000009-031-A05GCCCACGCCACGCCACGCCACNONE 
009-074-F05GCCCACGCCACGCCACGCCACNONE 
009-163-H03GCCCACGCCACGCCACGCCACNONE 
AK062619GCCCACGCCACGCCACGCCACConserved hypothetical protein. 
Os04g0636400006-064-G07CACGCCACNONE 
006-097-D05CACGCCACNONE 
AK061848CACGCCACSimilar to Senescence-associated protein 6. 
AK099573CACGCCACNONE 
J013035J20CACGCCACNONE 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACCACCCACACGCCACACGCCCAAAANONE 
Os04g0660500AK099839CACGCCACProtein kinase-like domain containing protein. 
J013095D08CACGCCACNONE 
J013107K18CACGCCACNONE 
Os04g0690866014-091-B08CACGCCACConserved hypothetical protein. 
J065085H18CACGCCACNONE 
J065099J05CACGCCACNONE 
J065194D12CACGCCACNONE 
J065197H01CACGCCACNONE 
Os05g0110100009-015-D08GTGGCGTGNONE 
009-023-C09GTGGCGTGNONE 
009-031-B11GTGGCGTGNONE 
009-034-C02GTGGCGTGNONE 
009-050-B08GTGGCGTGNONE 
009-065-D12GTGGCGTGNONE 
009-090-G08GTGGCGTGNONE 
009-111-H07GTGGCGTGNONE 
009-136-F12GTGGCGTGNONE 
009-138-E06GTGGCGTGNONE 
009-138-G12GTGGCGTGNONE 
009-141-D08GTGGCGTGNONE 
009-143-D01GTGGCGTGNONE 
009-179-D09GTGGCGTGNONE 
009-179-E03GTGGCGTGNONE 
009-196-A09GTGGCGTGNONE 
009-199-F04GTGGCGTGNONE 
013-021-E05GTGGCGTGNONE 
013-076-C04GTGGCGTGNONE 
013-096-F06GTGGCGTGNONE 
014-071-A05GTGGCGTGNONE 
014-077-F09GTGGCGTGNONE 
AK099779GTGGCGTGNONE 
AK121142GTGGCGTGConserved hypothetical protein. 
J013095A16GTGGCGTGNONE 
J013111A17GTGGCGTGNONE 
J013132G04GTGGCGTGNONE 
J023077M04GTGGCGTGNONE 
J065001B11GTGGCGTGNONE 
J065001E11GTGGCGTGNONE 
J065057G10GTGGCGTGNONE 
J065057L08GTGGCGTGNONE 
J065080E07GTGGCGTGNONE 
J065087K10GTGGCGTGNONE 
J065091M15GTGGCGTGNONE 
J065167A15GTGGCGTGNONE 
J075018F02GTGGCGTGNONE 
J075063F20GTGGCGTGNONE 
J075064F18GTGGCGTGNONE 
J075066N19GTGGCGTGNONE 
J075073I02GTGGCGTGNONE 
J075080P17GTGGCGTGNONE 
J075081F11GTGGCGTGNONE 
J075085E03GTGGCGTGNONE 
J075101G18GTGGCGTGNONE 
J075149N08GTGGCGTGNONE 
J075158I21GTGGCGTGNONE 
J075161M20GTGGCGTGNONE 
J075190F12GTGGCGTGNONE 
J075194K16GTGGCGTGNONE 
J080001E08GTGGCGTGNONE 
J080001F21GTGGCGTGNONE 
J080001H19GTGGCGTGNONE 
J080001O15GTGGCGTGNONE 
J080005I22GTGGCGTGNONE 
J080006K23GTGGCGTGNONE 
J080014D20GTGGCGTGNONE 
J080014I05GTGGCGTGNONE 
J080014K21GTGGCGTGNONE 
J080017I24GTGGCGTGNONE 
J080017K11GTGGCGTGNONE 
J080018F11GTGGCGTGNONE 
J080022L18GTGGCGTGNONE 
J080024N23GTGGCGTGNONE 
J080027J23GTGGCGTGNONE 
J080029B14GTGGCGTGNONE 
J080032F14GTGGCGTGNONE 
J080032K19GTGGCGTGNONE 
J080032O21GTGGCGTGNONE 
J080033P17GTGGCGTGNONE 
J080034I06GTGGCGTGNONE 
J080039F24GTGGCGTGNONE 
J080040O13GTGGCGTGNONE 
J080042B02GTGGCGTGNONE 
J080043E12GTGGCGTGNONE 
J080043J15GTGGCGTGNONE 
J080043N09GTGGCGTGNONE 
J080052J08GTGGCGTGNONE 
J080053K01GTGGCGTGNONE 
J080053K19GTGGCGTGNONE 
J080055J09GTGGCGTGNONE 
J080058D07GTGGCGTGNONE 
J080062F11GTGGCGTGNONE 
J080063J24GTGGCGTGNONE 
J080066H04GTGGCGTGNONE 
J080066I09GTGGCGTGNONE 
J080067B02GTGGCGTGNONE 
J080067N09GTGGCGTGNONE 
J080068D22GTGGCGTGNONE 
J080068K13GTGGCGTGNONE 
J080069N19GTGGCGTGNONE 
J080070D07GTGGCGTGNONE 
J080070E05GTGGCGTGNONE 
J080071G04GTGGCGTGNONE 
J080077G05GTGGCGTGNONE 
J080077O06GTGGCGTGNONE 
J080085F05GTGGCGTGNONE 
J080086E07GTGGCGTGNONE 
J080089G16GTGGCGTGNONE 
J080092K15GTGGCGTGNONE 
J080094A08GTGGCGTGNONE 
J080097A09GTGGCGTGNONE 
J080097J07GTGGCGTGNONE 
J090027N01GTGGCGTGNONE 
J090081J05GTGGCGTGNONE 
Os05g0255600AK073067CACGCCACThioredoxin domain 2 containing protein. 
J033022A04CACGCCACNONE 
J033022B03CACGCCACNONE 
J033116F22CACGCCACNONE 
J065017H13CACGCCACNONE 
J065038G20CACGCCACNONE 
J065076J16CACGCCACNONE 
J065135D06CACGCCACNONE 
J065168P22CACGCCACNONE 
J065188G21CACGCCACNONE 
J065207C14CACGCCACNONE 
J080014C23CACGCCACNONE 
J080018G12CACGCCACNONE 
J080021F03CACGCCACNONE 
J100068C14CACGCCACNONE 
Os05g0306000AK071384TCCACGCCACemp24/gp25L/p24 family protein. 
Os05g0358500AK060575CGCACCGCGACGCACGCCACNONE 
AK100777CGCACCGCGACGCACGCCACProtein phosphatase 2C-like domain containing protein. 
Os05g0372300AK120018CACGCCACCytochrome P450 family protein. 
Os05g0381400014-036-H12GTGGCGTGNONE 
014-085-H12GTGGCGTGNONE 
AK102039GTGGCGTGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17GTGGCGTGNONE 
J075057P04GTGGCGTGNONE 
J075066K19GTGGCGTGNONE 
J075068L13GTGGCGTGNONE 
J075074J21GTGGCGTGNONE 
J075076N10GTGGCGTGNONE 
J075078L14GTGGCGTGNONE 
J075099O16GTGGCGTGNONE 
J075120C05GTGGCGTGNONE 
J075140I24GTGGCGTGNONE 
J075148F21GTGGCGTGNONE 
J075151F01GTGGCGTGNONE 
J075151I10GTGGCGTGNONE 
J075156M15GTGGCGTGNONE 
J075191F07GTGGCGTGNONE 
J075192K20GTGGCGTGNONE 
J075195M22GTGGCGTGNONE 
Os05g0423500015-048-C11CACGCCACNONE 
AK066000CACGCCACProtein kinase-like domain containing protein. 
J013049L02CACGCCACNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0466600009-088-F09CACGCCACGTCNONE 
009-105-C11CACGCCACGTCNONE 
009-156-C06CACGCCACGTCNONE 
AK119240CACGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0468700AB051864CACGCCACAmmonium transporter. 
AK065288CACGCCACNONE 
J013002M22CACGCCACNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0503300011-013-H12CACGCCACNONE 
012-072-B03CACGCCACNONE 
AK073969CACGCCACSimilar to Sulfite reductase (Fragment). 
AK100773CACGCCACNONE 
AK103289CACGCCACNONE 
J013045K07CACGCCACNONE 
J033075F01CACGCCACNONE 
J033125N07CACGCCACNONE 
J033130G12CACGCCACNONE 
Os05g0508900009-060-D06CACGCCACNONE 
009-070-B04CACGCCACNONE 
009-078-B07CACGCCACNONE 
009-091-F11CACGCCACNONE 
009-138-F06CACGCCACNONE 
AK066345CACGCCACConserved hypothetical protein. 
J013064H24CACGCCACNONE 
Os05g0510700AK070308CACGCCACBSD domain containing protein. 
Os05g0534800Os05g0534800CACGCCACArf GTPase activating protein family protein. 
Os05g0541200AK068633GTGGCGTGGCGTGGCGTGConserved hypothetical protein 730 family protein. 
J013157L23GTGGCGTGGCGTGGCGTGNONE 
Os05g0557200AK062090CACGCCACNONE 
AK102111CACGCCACArmadillo-like helical domain containing protein. 
J013047E13CACGCCACNONE 
J013089P04CACGCCACNONE 
J013130H17CACGCCACNONE 
J013132C20CACGCCACNONE 
J023001E06CACGCCACNONE 
J023108C09CACGCCACNONE 
J023125C12CACGCCACNONE 
J033023O10CACGCCACNONE 
J033033K16CACGCCACNONE 
J033064C11CACGCCACNONE 
J033071P07CACGCCACNONE 
J033072H14CACGCCACNONE 
J033084F06CACGCCACNONE 
J033084H11CACGCCACNONE 
J033097C05CACGCCACNONE 
J043009E20CACGCCACNONE 
J053035M10CACGCCACNONE 
J053043J22CACGCCACNONE 
J053082K10CACGCCACNONE 
J053094N13CACGCCACNONE 
Os05g0576600AK107732CACGCCACConserved hypothetical protein. 
Os05g0595300011-076-H02GGGGCCCACACGCCACNONE 
012-009-E07GGGGCCCACACGCCACNONE 
012-096-B01GGGGCCCACACGCCACNONE 
AK059614GGGGCCCACACGCCACNONE 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
J033040P21GGGGCCCACACGCCACNONE 
Os06g0107100AK066804CACGCCACProtein of unknown function DUF819 family protein. 
AK068804CACGCCACNONE 
AK098965CACGCCACNONE 
Os06g0114700AK061552ACGTGGCGTGProtein of unknown function DUF1218 family protein. 
AK098848ACGTGGCGTGNONE 
AK122142ACGTGGCGTGNONE 
J013000D16ACGTGGCGTGNONE 
Os06g0153600AK099903CACGCCACNONE 
AK109685CACGCCACConserved hypothetical protein. 
Os06g0160700012-100-G07CACGCCACNONE 
AF165890CACGCCACNONE 
AK109458CACGCCACSimilar to Starch synthase I, chloroplast precursor (EC 2.4.1.21) (Soluble starch synthase 1) (SSS 1). 
AY299404CACGCCACNONE 
D16202CACGCCACNONE 
J033126L01CACGCCACNONE 
J065192J01CACGCCACNONE 
J090009J02CACGCCACNONE 
Os06g0166900012-095-F08CACGCCACNONE 
AK058497CACGCCACProtein kinase-like domain containing protein. 
J023122G08CACGCCACNONE 
J033039B21CACGCCACNONE 
J090077C01CACGCCACNONE 
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GTGACGTGGCGTGNONE 
Os06g0182400AK068745CACGCCACMetallophosphoesterase domain containing protein. 
Os06g0195800AK111076CACGCCACConserved hypothetical protein. 
Os06g0211300009-024-G02GTGGCGTGNONE 
AK060015GTGGCGTGSterol-binding domain containing protein. 
J013070F17GTGGCGTGNONE 
J043021H14GTGGCGTGNONE 
J053055N13GTGGCGTGNONE 
J065027B03GTGGCGTGNONE 
J065089K23GTGGCGTGNONE 
J065211P10GTGGCGTGNONE 
J075018F05GTGGCGTGNONE 
J075050P05GTGGCGTGNONE 
J075054G10GTGGCGTGNONE 
J075090D23GTGGCGTGNONE 
J075122C12GTGGCGTGNONE 
J075122I05GTGGCGTGNONE 
J075149M07GTGGCGTGNONE 
J075155H05GTGGCGTGNONE 
J075169P07GTGGCGTGNONE 
J075188L21GTGGCGTGNONE 
Os06g0229800AB115915CACGCCACNONE 
AB115916CACGCCACNONE 
AB115917CACGCCACNONE 
AB115918CACGCCACNONE 
AF419099CACGCCACSimilar to Starch synthase IIA. 
AK101978CACGCCACNONE 
Os06g0234700011-053-C05GTGGCGTGNONE 
015-022-A04GTGGCGTGNONE 
AK103533GTGGCGTGConserved hypothetical protein. 
J033132A10GTGGCGTGNONE 
J090017G15GTGGCGTGNONE 
Os06g0248200Os06g0248200CACGCCACNONE 
Os06g0252800AK070507CACGCCACSimilar to STF-1 (Fragment). 
J023054C04CACGCCACNONE 
Os06g0332400AK058294CGTGTGGCGTGNONE 
AK101738CGTGTGGCGTGVHS domain containing protein. 
J013119B12CGTGTGGCGTGNONE 
J013132G17CGTGTGGCGTGNONE 
J023034E06CGTGTGGCGTGNONE 
J023039I05CGTGTGGCGTGNONE 
J033024E14CGTGTGGCGTGNONE 
J033039N04CGTGTGGCGTGNONE 
J033048P16CGTGTGGCGTGNONE 
J033069F24CGTGTGGCGTGNONE 
J033071D15CGTGTGGCGTGNONE 
J033106D01CGTGTGGCGTGNONE 
J033106D09CGTGTGGCGTGNONE 
J033106F09CGTGTGGCGTGNONE 
J033107K03CGTGTGGCGTGNONE 
J033129G10CGTGTGGCGTGNONE 
J065016B15CGTGTGGCGTGNONE 
J065022H07CGTGTGGCGTGNONE 
J065048E07CGTGTGGCGTGNONE 
J065068B11CGTGTGGCGTGNONE 
J065157C13CGTGTGGCGTGNONE 
J100042J02CGTGTGGCGTGNONE 
Os06g0551400009-003-D11CACGCCACNONE 
011-025-C09CACGCCACNONE 
AK066548CACGCCACRas-related protein RIC2. 
D13758CACGCCACNONE 
J013069H14CACGCCACNONE 
J053037J07CACGCCACNONE 
J065011J03CACGCCACNONE 
J065078L15CACGCCACNONE 
J065103H24CACGCCACNONE 
J065157A07CACGCCACNONE 
J065213P12CACGCCACNONE 
J090007P04CACGCCACNONE 
J090052N23CACGCCACNONE 
Os06g0589500AK073322CACGCCACConserved hypothetical protein. 
J033030G15CACGCCACNONE 
J033148N18CACGCCACNONE 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175CACGCCACGTCACCNONE 
Os06g0595900AK066655CACGCCACGCGTGCGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02CACGCCACGCGTGCGNONE 
J075055H13CACGCCACGCGTGCGNONE 
J075188H14CACGCCACGCGTGCGNONE 
Os06g0648500AK106895TCCACGCCACConserved hypothetical protein. 
Os06g0650900AK071882CACGCCACGCCACGCCACNONE 
AK107961CACGCCACGCCACGCCACHeat shock protein DnaJ family protein. 
Os06g0663600AK100787CACGCCACEndonuclease V family protein. 
Os06g0679400AK111697CACGCCACSimilar to Myb-related protein Pp2. 
J023003K05CACGCCACNONE 
J023004F23CACGCCACNONE 
J023010K17CACGCCACNONE 
J023077C13CACGCCACNONE 
Os06g0704100AK103758CACGCCACProtein of unknown function DUF547 domain containing protein. 
J033143F04CACGCCACNONE 
J033144M16CACGCCACNONE 
J033145M16CACGCCACNONE 
Os07g0107900011-004-F03GTGGCGTGGGTCCNONE 
011-089-F01GTGGCGTGGGTCCNONE 
AK073520GTGGCGTGGGTCCNONE 
AK073651GTGGCGTGGGTCCConserved hypothetical protein. 
J013118M08GTGGCGTGGGTCCNONE 
J033042E18GTGGCGTGGGTCCNONE 
J033066E10GTGGCGTGGGTCCNONE 
J080303I24GTGGCGTGGGTCCNONE 
J080316O19GTGGCGTGGGTCCNONE 
J090019H13GTGGCGTGGGTCCNONE 
Os07g0133500015-010-H05CACGCCACNONE 
AB110179CACGCCACNONE 
AK106244CACGCCACProtein of unknown function DUF1005 family protein. 
J090075I21CACGCCACNONE 
Os07g0217600AK065971CACGCCACCytochrome P450 family protein. 
Os07g0258400AK121534GCCCACGCCACNONE 
L41217GCCCACGCCACNONE 
S81897GCCCACGCCACOsNramp1 (Integral membrane protein). 
Os07g0295000AK071844CACGCCACMitochondrial substrate carrier family protein. 
AK071844CACGCCACGTMitochondrial substrate carrier family protein. 
AK099295CACGCCACNONE 
AK099295CACGCCACGTNONE 
Os07g0407350J065005B03ACACGTGGCGTGNONE 
J065058G23ACACGTGGCGTGNONE 
J065144A11ACACGTGGCGTGNONE 
J065175J02ACACGTGGCGTGConserved hypothetical protein. 
Os07g0419200006-089-B01CACGCCACNONE 
AK061170CACGCCACConserved hypothetical protein. 
Os07g0533800016-078-C05CACGCCACNONE 
AK064277CACGCCACPeptidase A1, pepsin family protein. 
J100040M23CACGCCACNONE 
J100058K11CACGCCACNONE 
Os07g0560300012-087-F10CACGCCACNONE 
012-098-C12CACGCCACNONE 
015-050-D03CACGCCACNONE 
AK101241CACGCCACArmadillo-like helical domain containing protein. 
Os07g0570300AK100076CACGCCACPeptidase M16, C-terminal domain containing protein. 
J100033J04CACGCCACNONE 
J100065L10CACGCCACNONE 
Os07g0572800AK060818GTGGCGTGGANONE 
Os07g0592100AK107947GTGGCGTGSimilar to Alcohol dehydrogenase-like protein. 
J065083J04GTGGCGTGNONE 
J100052L21GTGGCGTGNONE 
Os07g0597000009-013-A01CACGCCACNONE 
009-077-A02CACGCCACNONE 
009-195-H04CACGCCACNONE 
AF094773CACGCCACNONE 
AK062134CACGCCACNONE 
AK103429CACGCCACSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19CACGCCACNONE 
J013152D01CACGCCACNONE 
J023024K09CACGCCACNONE 
J023058J15CACGCCACNONE 
J023097I07CACGCCACNONE 
J023132B05CACGCCACNONE 
J033065L11CACGCCACNONE 
J033086B12CACGCCACNONE 
J033128M07CACGCCACNONE 
J043010M23CACGCCACNONE 
J043024A05CACGCCACNONE 
J053057P08CACGCCACNONE 
J065022G24CACGCCACNONE 
J065028I10CACGCCACNONE 
J065065D08CACGCCACNONE 
J065103D22CACGCCACNONE 
J065153K16CACGCCACNONE 
J065210B16CACGCCACNONE 
J075015H18CACGCCACNONE 
J075102C14CACGCCACNONE 
J080302G09CACGCCACNONE 
J080302L20CACGCCACNONE 
J080303K11CACGCCACNONE 
J080312C18CACGCCACNONE 
J080316F08CACGCCACNONE 
J090023I05CACGCCACNONE 
J090023I07CACGCCACNONE 
J090053C21CACGCCACNONE 
J090067J22CACGCCACNONE 
J090070E24CACGCCACNONE 
J090078H04CACGCCACNONE 
J090089P06CACGCCACNONE 
J090092E21CACGCCACNONE 
J100014G01CACGCCACNONE 
J100022L20CACGCCACNONE 
J100024I05CACGCCACNONE 
J100025L08CACGCCACNONE 
J100030J03CACGCCACNONE 
J100031K12CACGCCACNONE 
J100036N01CACGCCACNONE 
J100050C23CACGCCACNONE 
J100062G12CACGCCACNONE 
J100067L17CACGCCACNONE 
J100074O09CACGCCACNONE 
Os07g0602000AK071832GGGCCGTTTCCACGCCACSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11GGGCCGTTTCCACGCCACNONE 
J023138E01GGGCCGTTTCCACGCCACNONE 
J023149O13GGGCCGTTTCCACGCCACNONE 
J090074M19GGGCCGTTTCCACGCCACNONE 
Os07g0618700AK066033CACGCCACConserved hypothetical protein. 
J013043D16CACGCCACNONE 
J065124E20CACGCCACNONE 
Os07g0620200AK099859TCCACGCCACHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TCCACGCCACNONE 
Os07g0622200AB122058CACGCCACNONE 
AK069968CACGCCACNONE 
AK105687CACGCCACSimilar to M-160-u1_1 (Fragment). 
J075095A10CACGCCACNONE 
Os07g0633200AK061338CACGCCACGCGTCCSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451CACGCCACGCGTCCNONE 
J033096E22CACGCCACGCGTCCNONE 
J033125D06CACGCCACGCGTCCNONE 
J075048C23CACGCCACGCGTCCNONE 
J075050G02CACGCCACGCGTCCNONE 
J075104J04CACGCCACGCGTCCNONE 
J075144N04CACGCCACGCGTCCNONE 
Os07g0669000AK099431CACGCCACSimilar to Catalytic subunit of polymerase zeta. 
J065073M09CACGCCACNONE 
Os07g0679500AK102562CACGCCACGCCACSimilar to Transcription factor RF2b. 
Os07g0687200013-008-A10CACGCCACNONE 
AF441191CACGCCACCalmodulin (CaM). 
AJ271913CACGCCACNONE 
AK063566CACGCCACNONE 
AK071852CACGCCACNONE 
J023117O08CACGCCACNONE 
J065142O13CACGCCACNONE 
J065150O18CACGCCACNONE 
J100047M24CACGCCACNONE 
J100060P22CACGCCACNONE 
J100066M20CACGCCACNONE 
J100069O16CACGCCACNONE 
Os08g0113500Os08g0113500GTGGCGTGSimilar to NAC transcription factor. 
Os08g0120200AK103562CACGCCACDNA polymerase III, delta family protein. 
Os08g0124000011-023-G08CACGCCACNONE 
AK063293CACGCCACSimilar to Resistance protein candidate (Fragment). 
AK067378CACGCCACNONE 
J090067O21CACGCCACNONE 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0140300AK069031CACGCCACSimilar to Tryptophan decarboxylase. 
J023003D15CACGCCACNONE 
J053039H11CACGCCACNONE 
Os08g0192800AK059490CACGCCACNONE 
AK101678CACGCCACNONE 
AK120613CACGCCACBromodomain containing protein. 
J080039B22CACGCCACNONE 
J080039I23CACGCCACNONE 
J080074D19CACGCCACNONE 
J080086N13CACGCCACNONE 
Os08g0197000AK109710GTGGCGTGCyclin-like F-box domain containing protein. 
Os08g0207500AB126089CACGCCACGTNONE 
AK105258CACGCCACGTSimilar to Zinc transporter ZIP1 (Fragment). 
Os08g0260600AK108529TCCACGCCCACACGCCACACGCD9/CD37/CD63 antigen family protein. 
Os08g0430700AK101681CACGCCACSimilar to UVB-resistance protein-like. 
AK102785CACGCCACNONE 
Os08g0565200AK108143CACGCCACGTCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0382500009-117-E11CACGCCACNONE 
AK105199CACGCCACConserved hypothetical protein. 
Os09g0393200AK059445GTGGCGTGTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os09g0446200011-092-H04CACGCCACSpc97/Spc98 family protein. 
Os09g0453800AK119212CACGCCACGCGTGCGNONE 
J023081A04CACGCCACGCGTGCGNONE 
J065180G14CACGCCACGCGTGCGNONE 
J100024A17CACGCCACGCGTGCGNONE 
J100030A05CACGCCACGCGTGCGNONE 
J100042I11CACGCCACGCGTGCGNONE 
J100054N05CACGCCACGCGTGCGNONE 
J100075G23CACGCCACGCGTGCGNONE 
Os09g0480400AK100641CACGCCACSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15CACGCCACNONE 
J090053K21CACGCCACNONE 
Os09g0528200006-021-E01CACGCCACNONE 
AK059755CACGCCACNONE 
Os09g0558100009-028-D03CGCGACGCCACGCCACNONE 
014-011-A04CGCGACGCCACGCCACNONE 
AB030211CGCGACGCCACGCCACSimilar to Low-temperature induced protein lt101.2. 
AK062410CGCGACGCCACGCCACNONE 
J065006B17CGCGACGCCACGCCACNONE 
J065067M15CGCGACGCCACGCCACNONE 
J065075E19CGCGACGCCACGCCACNONE 
J075011G16CGCGACGCCACGCCACNONE 
J075015L22CGCGACGCCACGCCACNONE 
J075035O11CGCGACGCCACGCCACNONE 
J075072E15CGCGACGCCACGCCACNONE 
J075100O22CGCGACGCCACGCCACNONE 
Os09g0565700AK066427GTGGCGTGPrephenate dehydratase domain containing protein. 
J075033I12GTGGCGTGNONE 
J075181I05GTGGCGTGNONE 
Os09g0567400AK072521GTGGCGTGSimilar to Histidine-containing phosphotransfer protein. 
AK104879GTGGCGTGNONE 
AY345241GTGGCGTGNONE 
J013055N16GTGGCGTGNONE 
J023131B06GTGGCGTGNONE 
J023149P12GTGGCGTGNONE 
J033074B19GTGGCGTGNONE 
J053024J01GTGGCGTGNONE 
J053054M07GTGGCGTGNONE 
J053059A11GTGGCGTGNONE 
J053060K04GTGGCGTGNONE 
J053063F20GTGGCGTGNONE 
J053089G08GTGGCGTGNONE 
J053094D10GTGGCGTGNONE 
J065012B16GTGGCGTGNONE 
J065014F12GTGGCGTGNONE 
J065032O04GTGGCGTGNONE 
J065045J12GTGGCGTGNONE 
J065065J10GTGGCGTGNONE 
J065106C19GTGGCGTGNONE 
J065135I07GTGGCGTGNONE 
J065144G01GTGGCGTGNONE 
J065178E14GTGGCGTGNONE 
J065190M08GTGGCGTGNONE 
J065201L17GTGGCGTGNONE 
J075010O13GTGGCGTGNONE 
J075031L11GTGGCGTGNONE 
J075041A15GTGGCGTGNONE 
J075080E07GTGGCGTGNONE 
J075108A09GTGGCGTGNONE 
J075125M20GTGGCGTGNONE 
J075131L03GTGGCGTGNONE 
J075163J08GTGGCGTGNONE 
J090033B10GTGGCGTGNONE 
J090045C22GTGGCGTGNONE 
J100043J24GTGGCGTGNONE 
J100052K01GTGGCGTGNONE 
J100062C17GTGGCGTGNONE 
Os09g0571400AK103109CACGCCACCyclophilin 1. 
J023011A12CACGCCACNONE 
J033119A20CACGCCACNONE 
J053034N16CACGCCACNONE 
J053045N23CACGCCACNONE 
J053052J12CACGCCACNONE 
J053052K04CACGCCACNONE 
J053099M15CACGCCACNONE 
J065071H23CACGCCACNONE 
J065131B16CACGCCACNONE 
J075003F19CACGCCACNONE 
J075116F02CACGCCACNONE 
J075126G05CACGCCACNONE 
J075145E09CACGCCACNONE 
J075149O22CACGCCACNONE 
J075163A09CACGCCACNONE 
J075194A09CACGCCACNONE 
L29471CACGCCACNONE 
Os11g0126900012-037-D04CACGCCACNONE 
015-046-E12CACGCCACNONE 
015-069-A05CACGCCACNONE 
AK069257CACGCCACSimilar to NAC domain transcription factor. 
J023011O06CACGCCACNONE 
J065091E09CACGCCACNONE 
J075021C14CACGCCACNONE 
J075035D07CACGCCACNONE 
J075084B04CACGCCACNONE 
J075171O09CACGCCACNONE 
J075199M23CACGCCACNONE 
Os11g0237700J100060P16GTGGCGTGConserved hypothetical protein. 
J100065I12GTGGCGTGNONE 
Os11g0291500AK108558ACACGTGGCGTGSimilar to Beta-D-xylosidase. 
Os11g0303800AK068654TCCACGCCACConserved hypothetical protein. 
J075084L14TCCACGCCACNONE 
Os11g0528500AK058434TCCACGCCACGCCACGCCACGCCACGCGCGCGASimilar to Rubredoxin 1 (Rd-1). 
J065110G13TCCACGCCACGCCACGCCACGCCACGCGCGCGANONE 
Os11g0610700012-090-B04GTGGCGTGNONE 
AK099760GTGGCGTGWD40-like domain containing protein. 
J065026G23GTGGCGTGNONE 
J065062A01GTGGCGTGNONE 
J065065J18GTGGCGTGNONE 
J100026C05GTGGCGTGNONE 
Os11g0637000AK119762GTGGCGTGSimilar to Sorbitol transporter. 
Os12g0114100AK067447CACGCCACSimilar to MAP kinase-like protein. 
AK067447GTGGCGTGSimilar to MAP kinase-like protein. 
AK072172CACGCCACNONE 
AK072172GTGGCGTGNONE 
J013075O15CACGCCACNONE 
J013075O15GTGGCGTGNONE 
J013129I24CACGCCACNONE 
J013129I24GTGGCGTGNONE 
J090058A14CACGCCACNONE 
J090058A14GTGGCGTGNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0460800J023003J21GCCCACACGCCACNONE 
Os12g0477400J100045P07CACGCCACNo apical meristem (NAM) protein domain containing protein. 
J100046N20CACGCCACNONE 
Os12g0617900AK065064GTGGCGTGSimilar to Serine/threonine protein phosphatase BSL2 (EC 3.1.3.16) (BSU1-like protein 2). 
AK066418GTGGCGTGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.