version

Summary of OsREG503 (All List)

OrganismOryza sativa  
IDOsREG503  
SequenceCACGCCTC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1483  

Entry Sequences (1483 entries)

LocusGene modelSequenceDescription
Os01g0188400AK072842GAGGCGTGNONE 
AK121770GAGGCGTGNONE 
D16499GAGGCGTGNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23GAGGCGTGNONE 
J100060J17GAGGCGTGNONE 
Os01g0200700003-117-A10GAGGCGTGNONE 
009-011-D05GAGGCGTGNONE 
009-016-D05GAGGCGTGNONE 
009-043-F05GAGGCGTGNONE 
009-088-B02GAGGCGTGNONE 
009-105-E05GAGGCGTGNONE 
009-118-D05GAGGCGTGNONE 
009-118-D11GAGGCGTGNONE 
009-121-E05GAGGCGTGNONE 
009-121-G02GAGGCGTGNONE 
009-124-B08GAGGCGTGNONE 
009-126-E04GAGGCGTGNONE 
009-127-F01GAGGCGTGNONE 
009-129-H11GAGGCGTGNONE 
009-150-C11GAGGCGTGNONE 
009-151-G09GAGGCGTGNONE 
009-156-H01GAGGCGTGNONE 
009-163-D12GAGGCGTGNONE 
009-166-E01GAGGCGTGNONE 
009-185-D03GAGGCGTGNONE 
009-190-E08GAGGCGTGNONE 
009-191-H01GAGGCGTGNONE 
009-192-A09GAGGCGTGNONE 
009-194-G03GAGGCGTGNONE 
009-196-G07GAGGCGTGNONE 
013-005-G02GAGGCGTGNONE 
016-091-B04GAGGCGTGNONE 
AF001396GAGGCGTGNONE 
AF147786GAGGCGTGNONE 
AK058313GAGGCGTGSimilar to Metallothionein-like protein type 3 (MT-3) (MWMT3). 
AK120350GAGGCGTGNONE 
J013038E17GAGGCGTGNONE 
J013040L18GAGGCGTGNONE 
J013051P11GAGGCGTGNONE 
J013065G09GAGGCGTGNONE 
J013129O19GAGGCGTGNONE 
J033046N24GAGGCGTGNONE 
J043010D24GAGGCGTGNONE 
J065045L19GAGGCGTGNONE 
J065055A05GAGGCGTGNONE 
J065055A06GAGGCGTGNONE 
J065068J11GAGGCGTGNONE 
J065073P09GAGGCGTGNONE 
J065077G01GAGGCGTGNONE 
J065093O19GAGGCGTGNONE 
J065094I04GAGGCGTGNONE 
J065109M22GAGGCGTGNONE 
J065114M11GAGGCGTGNONE 
J065116H03GAGGCGTGNONE 
J065128A19GAGGCGTGNONE 
J065130C24GAGGCGTGNONE 
J065142E10GAGGCGTGNONE 
J065148K01GAGGCGTGNONE 
J065159C20GAGGCGTGNONE 
J065167L04GAGGCGTGNONE 
J065183G24GAGGCGTGNONE 
J075007A16GAGGCGTGNONE 
J075007B16GAGGCGTGNONE 
J075013N19GAGGCGTGNONE 
J075015H14GAGGCGTGNONE 
J075022I03GAGGCGTGNONE 
J075030K16GAGGCGTGNONE 
J075032L15GAGGCGTGNONE 
J075038I11GAGGCGTGNONE 
J075043D06GAGGCGTGNONE 
J075043J09GAGGCGTGNONE 
J075048M09GAGGCGTGNONE 
J075049D16GAGGCGTGNONE 
J075050F09GAGGCGTGNONE 
J075052G16GAGGCGTGNONE 
J075060E12GAGGCGTGNONE 
J075064P13GAGGCGTGNONE 
J075082N08GAGGCGTGNONE 
J075082N18GAGGCGTGNONE 
J075085D09GAGGCGTGNONE 
J075085F18GAGGCGTGNONE 
J075090L09GAGGCGTGNONE 
J075097I03GAGGCGTGNONE 
J075098N03GAGGCGTGNONE 
J075100L09GAGGCGTGNONE 
J075115B10GAGGCGTGNONE 
J075127N20GAGGCGTGNONE 
J075131J17GAGGCGTGNONE 
J075137K04GAGGCGTGNONE 
J075143E17GAGGCGTGNONE 
J075146O06GAGGCGTGNONE 
J075151D18GAGGCGTGNONE 
J075154H23GAGGCGTGNONE 
J075156B14GAGGCGTGNONE 
J075156H24GAGGCGTGNONE 
J075161A06GAGGCGTGNONE 
J075162N01GAGGCGTGNONE 
J075166K17GAGGCGTGNONE 
J075172C05GAGGCGTGNONE 
J075176I03GAGGCGTGNONE 
J075180J22GAGGCGTGNONE 
J075181F09GAGGCGTGNONE 
J075183D18GAGGCGTGNONE 
J075188I23GAGGCGTGNONE 
J075188L16GAGGCGTGNONE 
J075194G19GAGGCGTGNONE 
J080001A16GAGGCGTGNONE 
J080001A18GAGGCGTGNONE 
J080002G19GAGGCGTGNONE 
J080002M08GAGGCGTGNONE 
J080003I02GAGGCGTGNONE 
J080003K02GAGGCGTGNONE 
J080005I12GAGGCGTGNONE 
J080007H03GAGGCGTGNONE 
J080008B16GAGGCGTGNONE 
J080008N06GAGGCGTGNONE 
J080010B17GAGGCGTGNONE 
J080010F06GAGGCGTGNONE 
J080010J04GAGGCGTGNONE 
J080012G03GAGGCGTGNONE 
J080016E16GAGGCGTGNONE 
J080018H07GAGGCGTGNONE 
J080018H11GAGGCGTGNONE 
J080018M11GAGGCGTGNONE 
J080020L10GAGGCGTGNONE 
J080021F13GAGGCGTGNONE 
J080021J04GAGGCGTGNONE 
J080021J08GAGGCGTGNONE 
J080022H19GAGGCGTGNONE 
J080023C04GAGGCGTGNONE 
J080023E15GAGGCGTGNONE 
J080030L17GAGGCGTGNONE 
J080032A12GAGGCGTGNONE 
J080033A01GAGGCGTGNONE 
J080033A05GAGGCGTGNONE 
J080034D11GAGGCGTGNONE 
J080035A09GAGGCGTGNONE 
J080035O06GAGGCGTGNONE 
J080040G01GAGGCGTGNONE 
J080041C01GAGGCGTGNONE 
J080045F24GAGGCGTGNONE 
J080045J19GAGGCGTGNONE 
J080045P12GAGGCGTGNONE 
J080046B01GAGGCGTGNONE 
J080046F01GAGGCGTGNONE 
J080046F11GAGGCGTGNONE 
J080047D04GAGGCGTGNONE 
J080047J20GAGGCGTGNONE 
J080047M23GAGGCGTGNONE 
J080048D03GAGGCGTGNONE 
J080050H21GAGGCGTGNONE 
J080051B10GAGGCGTGNONE 
J080053I23GAGGCGTGNONE 
J080061A01GAGGCGTGNONE 
J080064C12GAGGCGTGNONE 
J080065D08GAGGCGTGNONE 
J080066K10GAGGCGTGNONE 
J080067C07GAGGCGTGNONE 
J080068A05GAGGCGTGNONE 
J080068H19GAGGCGTGNONE 
J080068I09GAGGCGTGNONE 
J080071H22GAGGCGTGNONE 
J080072H09GAGGCGTGNONE 
J080074K10GAGGCGTGNONE 
J080075C10GAGGCGTGNONE 
J080075H03GAGGCGTGNONE 
J080079B17GAGGCGTGNONE 
J080079C09GAGGCGTGNONE 
J080079H01GAGGCGTGNONE 
J080080A04GAGGCGTGNONE 
J080080G12GAGGCGTGNONE 
J080082K17GAGGCGTGNONE 
J080085G21GAGGCGTGNONE 
J080085J03GAGGCGTGNONE 
J080086A13GAGGCGTGNONE 
J080087A17GAGGCGTGNONE 
J080088B04GAGGCGTGNONE 
J080091F11GAGGCGTGNONE 
J080092N10GAGGCGTGNONE 
J080092P03GAGGCGTGNONE 
J080094K23GAGGCGTGNONE 
J080095C08GAGGCGTGNONE 
J080096P06GAGGCGTGNONE 
J080301I12GAGGCGTGNONE 
J080301N10GAGGCGTGNONE 
J080302L04GAGGCGTGNONE 
J080303L16GAGGCGTGNONE 
J080304C12GAGGCGTGNONE 
J080304J22GAGGCGTGNONE 
J080304K14GAGGCGTGNONE 
J080305N24GAGGCGTGNONE 
J080307F05GAGGCGTGNONE 
J080308J07GAGGCGTGNONE 
J080308O10GAGGCGTGNONE 
J080312I15GAGGCGTGNONE 
J080312O05GAGGCGTGNONE 
J080313N01GAGGCGTGNONE 
J080313N10GAGGCGTGNONE 
J080315B12GAGGCGTGNONE 
J080317D12GAGGCGTGNONE 
J080318M08GAGGCGTGNONE 
J090012C09GAGGCGTGNONE 
J090023G22GAGGCGTGNONE 
J100035A22GAGGCGTGNONE 
J100037K23GAGGCGTGNONE 
J100079J19GAGGCGTGNONE 
Os01g0242600AK067756CACGCCTCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK098860CACGCCTCNONE 
J013000N23CACGCCTCNONE 
J013026B16CACGCCTCNONE 
J013030A09CACGCCTCNONE 
J013066I04CACGCCTCNONE 
J013066P03CACGCCTCNONE 
J013090L14CACGCCTCNONE 
J013102C20CACGCCTCNONE 
J013124H07CACGCCTCNONE 
J023061K20CACGCCTCNONE 
J043026K09CACGCCTCNONE 
J090015G19CACGCCTCNONE 
J100070B02CACGCCTCNONE 
Os01g0279700AK067683CACGCCACGCCTCNONE 
AK100107CACGCCACGCCTCMajor facilitator superfamily protein. 
J023004N09CACGCCACGCCTCNONE 
J075019L14CACGCCACGCCTCNONE 
J075187F21CACGCCACGCCTCNONE 
Os01g0371500009-137-G05CACGCCTCNONE 
AK062937CACGCCTCSimilar to Glutathione-S-transferase 19E50. 
Os01g0382400006-074-E08CACGCCTCNONE 
006-095-F07CACGCCTCNONE 
009-002-H04CACGCCTCNONE 
009-064-C10CACGCCTCNONE 
009-118-D06CACGCCTCNONE 
009-141-H03CACGCCTCNONE 
AK121108CACGCCTCSimilar to Pathogenesis-related protein PRB1-2 precursor. 
J013073F05CACGCCTCNONE 
J023072K01CACGCCTCNONE 
J065024B08CACGCCTCNONE 
J065214G18CACGCCTCNONE 
J075029B19CACGCCTCNONE 
J075074K08CACGCCTCNONE 
Os01g0512200J013067C10CACGCCTCNONE 
Os01g0561600AK069494TCCACGCCTCCytochrome P450 family protein. 
J023025F12TCCACGCCTCNONE 
J023036E02TCCACGCCTCNONE 
Os01g0652000AK058938CGGACGGAGGCGTGConserved hypothetical protein. 
Os01g0658500AK058491CACGCCTCProtein of unknown function DUF852, eukaryotic family protein. 
AK069050CACGCCTCNONE 
J043036P22CACGCCTCNONE 
Os01g0680400AK067914GAGGCGTGTAFII28-like protein family protein. 
J065039K13GAGGCGTGNONE 
J065042K22GAGGCGTGNONE 
J080016E23GAGGCGTGNONE 
J080064E22GAGGCGTGNONE 
Os01g0754200AK099782CACGCCTCGlycosyl transferase, family 48 protein. 
AK120195CACGCCTCNONE 
AK120402CACGCCTCNONE 
J013036H01CACGCCTCNONE 
J013088I17CACGCCTCNONE 
Os01g0760600011-038-B09GAGGCGTGGANONE 
AB110193GAGGCGTGGANONE 
AK067557GAGGCGTGGANONE 
AK099338GAGGCGTGGANONE 
AK103133GAGGCGTGGANONE 
AK103586GAGGCGTGGAAspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A). 
AK104829GAGGCGTGGANONE 
D14673GAGGCGTGGANONE 
J023030P20GAGGCGTGGANONE 
J023110C16GAGGCGTGGANONE 
J033025N16GAGGCGTGGANONE 
J033026K01GAGGCGTGGANONE 
J033026M02GAGGCGTGGANONE 
J033028M22GAGGCGTGGANONE 
J033036D08GAGGCGTGGANONE 
J033038A21GAGGCGTGGANONE 
J033044D24GAGGCGTGGANONE 
J033051F18GAGGCGTGGANONE 
J033095C16GAGGCGTGGANONE 
J090003F07GAGGCGTGGANONE 
J090009P10GAGGCGTGGANONE 
J090012D16GAGGCGTGGANONE 
J090023K01GAGGCGTGGANONE 
J090030J17GAGGCGTGGANONE 
J090033G02GAGGCGTGGANONE 
J090037I22GAGGCGTGGANONE 
J090038A17GAGGCGTGGANONE 
J090048K09GAGGCGTGGANONE 
J090069N01GAGGCGTGGANONE 
J090078C19GAGGCGTGGANONE 
J090089P15GAGGCGTGGANONE 
J090093D07GAGGCGTGGANONE 
J090095H01GAGGCGTGGANONE 
J100057J03GAGGCGTGGANONE 
Os01g0778700AK064933GAGGCGTGGGTCCCConserved hypothetical protein. 
Os01g0780900J033069J11GAGGCGTGNONE 
J065054P18GAGGCGTGNONE 
J065163O05GAGGCGTGNONE 
J065165B05GAGGCGTGNONE 
J075097O22GAGGCGTGNONE 
J080029E07GAGGCGTGNONE 
J080093M08GAGGCGTGNONE 
J100025J07GAGGCGTGNONE 
J100029N22GAGGCGTGNONE 
J100041C23GAGGCGTGConserved hypothetical protein. 
J100041M22GAGGCGTGNONE 
J100058D11GAGGCGTGNONE 
J100064E15GAGGCGTGNONE 
J100066M09GAGGCGTGNONE 
J100067H14GAGGCGTGNONE 
Os01g0815400AK121388GAGGCGTGConserved hypothetical protein. 
J023013D09GAGGCGTGNONE 
J023044L20GAGGCGTGNONE 
J023128J12GAGGCGTGNONE 
J075010E04GAGGCGTGNONE 
J090090E03GAGGCGTGNONE 
Os01g0830000012-056-G03CACGCCTCTCGGCCGCCACACGNONE 
015-092-H05CACGCCTCTCGGCCGCCACACGNONE 
AK121100CACGCCTCTCGGCCGCCACACGSimilar to Plastid sufB (Fragment). 
J023069G03CACGCCTCTCGGCCGCCACACGNONE 
J090047G13CACGCCTCTCGGCCGCCACACGNONE 
J090059K22CACGCCTCTCGGCCGCCACACGNONE 
Os01g0830100AK069755CGTGTGGCGGCCGAGAGGCGTGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0851100AK071217CACGCCTCNONE 
Os01g0870100AK103428CTCGGCCCGCACGCCTCNONE 
Os01g0878900006-023-D10CACGCCTCNONE 
006-039-B03CACGCCTCNONE 
006-044-D12CACGCCTCNONE 
006-046-C09CACGCCTCNONE 
006-055-A06CACGCCTCNONE 
006-068-B07CACGCCTCNONE 
006-078-D10CACGCCTCNONE 
006-081-C03CACGCCTCNONE 
006-083-A11CACGCCTCNONE 
006-083-E07CACGCCTCNONE 
006-099-F07CACGCCTCNONE 
006-108-H03CACGCCTCNONE 
006-112-C01CACGCCTCNONE 
009-170-G06CACGCCTCNONE 
AK060927CACGCCTCSimilar to 4,5-DOPA dioxygenase extradiol-like protein. 
AK104432CACGCCTCNONE 
AK104462CACGCCTCNONE 
AK104545CACGCCTCNONE 
AK104601CACGCCTCNONE 
AK104652CACGCCTCNONE 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J043003L24ACCGGCCCACGCCTCNONE 
Os01g0908700AK120427CACGCCTCSimilar to Hnrpa2b1-prov protein. 
Os01g0971700006-081-D12CACGCCTCNONE 
AK059198CACGCCTCNONE 
AK105975CACGCCTCStreptomyces cyclase/dehydrase family protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0580900AK120486CACGCCTCTGF-beta receptor, type I/II extracellular region family protein. 
J100082N03CACGCCTCNONE 
Os02g0595700006-057-E01CACGCCTCNONE 
006-082-F10CACGCCTCNONE 
006-087-C10CACGCCTCNONE 
006-091-H03CACGCCTCNONE 
006-094-A11CACGCCTCNONE 
AF145053CACGCCTCNONE 
AK064937CACGCCTCNONE 
AK066858CACGCCTCNONE 
AK104785CACGCCTCNONE 
AK119587CACGCCTCChloroplast translational elongation factor Tu. 
J013000P03CACGCCTCNONE 
Os02g0621300011-035-A02CACGCCTCNONE 
011-035-A02GAGGCGTGNONE 
012-074-D02CACGCCTCNONE 
012-074-D02GAGGCGTGNONE 
AK066386CACGCCTCSterol desaturase family protein. 
AK066386GAGGCGTGSterol desaturase family protein. 
J023048N02CACGCCTCNONE 
J023048N02GAGGCGTGNONE 
J023077I04CACGCCTCNONE 
J023077I04GAGGCGTGNONE 
J023099F03CACGCCTCNONE 
J023099F03GAGGCGTGNONE 
J023114N13CACGCCTCNONE 
J023114N13GAGGCGTGNONE 
J043024L07CACGCCTCNONE 
J043024L07GAGGCGTGNONE 
J043036I06CACGCCTCNONE 
J043036I06GAGGCGTGNONE 
J043037F15CACGCCTCNONE 
J043037F15GAGGCGTGNONE 
J065030O22CACGCCTCNONE 
J065030O22GAGGCGTGNONE 
J065110J05CACGCCTCNONE 
J065110J05GAGGCGTGNONE 
J065121B17CACGCCTCNONE 
J065121B17GAGGCGTGNONE 
J065198E04CACGCCTCNONE 
J065198E04GAGGCGTGNONE 
J090025I24CACGCCTCNONE 
J090025I24GAGGCGTGNONE 
J090033I21CACGCCTCNONE 
J090033I21GAGGCGTGNONE 
J090090I01CACGCCTCNONE 
J090090I01GAGGCGTGNONE 
J100083P08CACGCCTCNONE 
J100083P08GAGGCGTGNONE 
Os02g0648300015-041-D07GAGGCGTGHomeodomain-like containing protein. 
AK111742GAGGCGTGNONE 
Os02g0653000AK062922CACGCCTCConserved hypothetical protein. 
Os02g0744200AF247162CACGCCTCNONE 
AK073572CACGCCTCAlpha-expansin OsEXPA5. 
AK107334CACGCCTCNONE 
J065006L24CACGCCTCNONE 
J065184I10CACGCCTCNONE 
J065205G12CACGCCTCNONE 
J090051J23CACGCCTCNONE 
Os02g0777800AK066978ACCCCCCACACGCCTCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0788600Os02g0788600CACGCCTCClp, N terminal domain containing protein. 
Os03g0127900009-144-F12GAGGCGTGNONE 
AK062977GAGGCGTGSodium/hydrogen exchanger family protein. 
Os03g0130400AK070255GGTCCACGCCTCAdenylate kinase, subfamily protein. 
Os03g0136200004-011-E10CACGCCTCNONE 
006-067-A08CACGCCTCNONE 
011-007-E02CACGCCTCNONE 
011-099-H10CACGCCTCNONE 
012-044-D08CACGCCTCNONE 
013-045-G12CACGCCTCNONE 
013-062-C09CACGCCTCNONE 
013-072-F09CACGCCTCNONE 
013-085-B12CACGCCTCNONE 
013-097-E09CACGCCTCNONE 
013-097-F09CACGCCTCNONE 
014-013-C09CACGCCTCNONE 
014-082-D08CACGCCTCNONE 
015-071-A09CACGCCTCNONE 
AF042333CACGCCTCNONE 
AK060887CACGCCTCNONE 
AK121681CACGCCTC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14CACGCCTCNONE 
J013123F01CACGCCTCNONE 
J023050A02CACGCCTCNONE 
J033046H22CACGCCTCNONE 
J033070A11CACGCCTCNONE 
J065059G11CACGCCTCNONE 
J065068F10CACGCCTCNONE 
J065164A10CACGCCTCNONE 
J075031F07CACGCCTCNONE 
J075054J01CACGCCTCNONE 
J075086M04CACGCCTCNONE 
J075118K23CACGCCTCNONE 
J075122A09CACGCCTCNONE 
J075123D06CACGCCTCNONE 
J075129A22CACGCCTCNONE 
J075161E07CACGCCTCNONE 
J075179H04CACGCCTCNONE 
J075181C06CACGCCTCNONE 
J075186A12CACGCCTCNONE 
J090014H16CACGCCTCNONE 
J090045G17CACGCCTCNONE 
J090048B09CACGCCTCNONE 
J090052J23CACGCCTCNONE 
J090052K22CACGCCTCNONE 
J090059F10CACGCCTCNONE 
J090080F19CACGCCTCNONE 
J100039J08CACGCCTCNONE 
J100044K02CACGCCTCNONE 
J100051E16CACGCCTCNONE 
J100053F08CACGCCTCNONE 
J100056F07CACGCCTCNONE 
J100058A10CACGCCTCNONE 
Os03g0137400AK072057GAGGCGTGNONE 
AK101118GAGGCGTGProtein of unknown function DUF221 domain containing protein. 
J013129L02GAGGCGTGNONE 
J033025H22GAGGCGTGNONE 
J033034L15GAGGCGTGNONE 
J033044F21GAGGCGTGNONE 
J033046F15GAGGCGTGNONE 
J033101I17GAGGCGTGNONE 
J033150K16GAGGCGTGNONE 
J065042G12GAGGCGTGNONE 
J065083F17GAGGCGTGNONE 
J100044G19GAGGCGTGNONE 
Os03g0225200AK065907TCCACGCCTCNONE 
AK074008TCCACGCCTCCyclin-like domain containing protein. 
J013044F04TCCACGCCTCNONE 
J090071F03TCCACGCCTCNONE 
Os03g0227700AB206579CACGCCTCCytochrome P450 family protein. 
Os03g0255000AK101625GAGGCGTGTGGCFAR1 domain containing protein. 
J033052M07GAGGCGTGTGGCNONE 
Os03g0271100AB095095CACGCCTCNONE 
AK060821CACGCCTCSimilar to Sigma factor SIG2B. 
AK067693CACGCCTCNONE 
AK099036CACGCCTCNONE 
Os03g0283400AK064670CACGCCTCConserved hypothetical protein. 
J065005D03CACGCCTCNONE 
J065023G14CACGCCTCNONE 
J065087B12CACGCCTCNONE 
J065113B15CACGCCTCNONE 
Os03g0284000Os03g0284000GAGGCGTGConserved hypothetical protein. 
Os03g0319300006-021-E05GAGGCGTGGANONE 
006-022-H12GAGGCGTGGANONE 
009-187-E02GAGGCGTGGANONE 
AF042840GAGGCGTGGANONE 
AK059756GAGGCGTGGACalmodulin (CaM). 
AK070090GAGGCGTGGANONE 
J065017J02GAGGCGTGGANONE 
J065028G17GAGGCGTGGANONE 
J065045N09GAGGCGTGGANONE 
J065078F21GAGGCGTGGANONE 
J065091H01GAGGCGTGGANONE 
J065112B19GAGGCGTGGANONE 
J065186E08GAGGCGTGGANONE 
J065199G12GAGGCGTGGANONE 
J075030K07GAGGCGTGGANONE 
J075050B02GAGGCGTGGANONE 
J075057G07GAGGCGTGGANONE 
J075070F01GAGGCGTGGANONE 
J075093N12GAGGCGTGGANONE 
J075095K13GAGGCGTGGANONE 
J075102D14GAGGCGTGGANONE 
J075103B17GAGGCGTGGANONE 
J075114K05GAGGCGTGGANONE 
J075142F18GAGGCGTGGANONE 
J075154L11GAGGCGTGGANONE 
J075185F08GAGGCGTGGANONE 
J090012A14GAGGCGTGGANONE 
J090044L10GAGGCGTGGANONE 
J100044C12GAGGCGTGGANONE 
J100088J19GAGGCGTGGANONE 
Os03g0321900AK073317TCCACGCCTCCMP/dCMP deaminase, zinc-binding domain containing protein. 
Os03g0323200AK062262CACGCCTCNONE 
AK065420CACGCCTCNONE 
J013022D10CACGCCTCNONE 
Os03g0327600014-081-C01GAGGCGTGNONE 
AK069815GAGGCGTGRicin B-related lectin domain containing protein. 
X95402GAGGCGTGNONE 
Os03g0579900AK108792CACGCCTCConserved hypothetical protein. 
Os03g0619100AK119803CACGCCTCZinc finger, Dof-type family protein. 
Os03g0696300AK069854GAGGCGTGCCAAT-binding transcription factor, subunit B family protein. 
Os03g0701200006-042-B09TCCACGCCTCNONE 
006-097-E12TCCACGCCTCNONE 
AK061528TCCACGCCTCNONE 
AK061982TCCACGCCTCNONE 
AK099563TCCACGCCTCSimilar to Sugar-starvation induced protein (Fragment). 
J065034C24TCCACGCCTCNONE 
J075007L05TCCACGCCTCNONE 
J075104M20TCCACGCCTCNONE 
J075127H03TCCACGCCTCNONE 
Os03g0713100J013039M09CCCCCACGCCTCNONE 
J023007K01CCCCCACGCCTCNONE 
J023073H01CCCCCACGCCTCNONE 
J023087M20CCCCCACGCCTCNONE 
J023142E01CCCCCACGCCTCNONE 
J033048E03CCCCCACGCCTCNONE 
J033048F03CCCCCACGCCTCSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCCCACGCCTCNONE 
J033074M20CCCCCACGCCTCNONE 
J033084M11CCCCCACGCCTCNONE 
J033091I23CCCCCACGCCTCNONE 
J033100C08CCCCCACGCCTCNONE 
J033123K19CCCCCACGCCTCNONE 
J090006P21CCCCCACGCCTCNONE 
J090045O16CCCCCACGCCTCNONE 
J100087M13CCCCCACGCCTCNONE 
Os03g0729600009-092-C12CGACACGTCCACGCCTCNONE 
009-156-H03CGACACGTCCACGCCTCNONE 
AK062697CGACACGTCCACGCCTCNONE 
AK063169CGACACGTCCACGCCTCConserved hypothetical protein. 
Os03g0776400015-009-D03CACGCCTCNONE 
AK106237CACGCCTCConserved hypothetical protein. 
J100024C12CACGCCTCNONE 
J100083J23CACGCCTCNONE 
Os03g0780400011-100-D09CACGCCTCNONE 
AK061347CACGCCTCNONE 
AK073162CACGCCTCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CACGCCTCNONE 
J065045I07CACGCCTCNONE 
J090036F17CACGCCTCNONE 
J090077M14CACGCCTCNONE 
J100055G20CACGCCTCNONE 
Os03g0820600013-030-F01CACGCCTCNONE 
013-030-F01GAGGCGTGNONE 
AK058941CACGCCTCSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3). 
AK058941GAGGCGTGSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3). 
J065038I10CACGCCTCNONE 
J065038I10GAGGCGTGNONE 
J065043C23CACGCCTCNONE 
J065043C23GAGGCGTGNONE 
J065060H20CACGCCTCNONE 
J065060H20GAGGCGTGNONE 
J065065E06CACGCCTCNONE 
J065065E06GAGGCGTGNONE 
J065078K18CACGCCTCNONE 
J065078K18GAGGCGTGNONE 
J065116J24CACGCCTCNONE 
J065116J24GAGGCGTGNONE 
J065118G22CACGCCTCNONE 
J065118G22GAGGCGTGNONE 
J065129D16CACGCCTCNONE 
J065129D16GAGGCGTGNONE 
J065153G20CACGCCTCNONE 
J065153G20GAGGCGTGNONE 
J065159I03CACGCCTCNONE 
J065159I03GAGGCGTGNONE 
J065176E14CACGCCTCNONE 
J065176E14GAGGCGTGNONE 
J065187B11CACGCCTCNONE 
J065187B11GAGGCGTGNONE 
J065203D14CACGCCTCNONE 
J065203D14GAGGCGTGNONE 
J065217P15CACGCCTCNONE 
J065217P15GAGGCGTGNONE 
J075105D14CACGCCTCNONE 
J075105D14GAGGCGTGNONE 
J100036F11CACGCCTCNONE 
J100036F11GAGGCGTGNONE 
J100044M07CACGCCTCNONE 
J100044M07GAGGCGTGNONE 
Os03g0830600AK107563CACGCCTCPectinesterase inhibitor domain containing protein. 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
Os04g0405600015-003-G04GAGGCGTGGANONE 
AK068579GAGGCGTGGAProtein of unknown function DUF1350 family protein. 
AK101565GAGGCGTGGANONE 
J013023M11GAGGCGTGGANONE 
J013055A13GAGGCGTGGANONE 
J013157C11GAGGCGTGGANONE 
J033128I12GAGGCGTGGANONE 
J065193N19GAGGCGTGGANONE 
J090055C15GAGGCGTGGANONE 
J090058C22GAGGCGTGGANONE 
J090077L18GAGGCGTGGANONE 
J090086C04GAGGCGTGGANONE 
J090095D03GAGGCGTGGANONE 
J100040K04GAGGCGTGGANONE 
J100040M11GAGGCGTGGANONE 
Os04g0490000AK108365TCCACGCCTCCCACTCCSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0510900012-083-A10GAGGCGTGNONE 
014-002-F04GAGGCGTGNONE 
AK063625GAGGCGTGSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20GAGGCGTGNONE 
J065144F23GAGGCGTGNONE 
J065153D08GAGGCGTGNONE 
J065178A02GAGGCGTGNONE 
J065178B01GAGGCGTGNONE 
J065195M21GAGGCGTGNONE 
Os04g0530300009-053-E04GAGGCGTGNONE 
009-074-E03GAGGCGTGNONE 
AK066705GAGGCGTGConserved hypothetical protein. 
Os04g0636900009-009-D04TCCACGCCTCNONE 
009-010-G07TCCACGCCTCNONE 
009-048-H10TCCACGCCTCNONE 
013-066-B10TCCACGCCTCNONE 
014-093-G08TCCACGCCTCNONE 
015-025-C07TCCACGCCTCNONE 
J013058C15TCCACGCCTCNONE 
J013058E15TCCACGCCTCNONE 
J013072N16TCCACGCCTCNONE 
J013102O16TCCACGCCTCNONE 
J090069E22TCCACGCCTCNONE 
J100030G19TCCACGCCTCNONE 
J100050F15TCCACGCCTCNONE 
J100050L20TCCACGCCTCNONE 
J100054F18TCCACGCCTCNONE 
J100083P05TCCACGCCTCNONE 
Os04g0650700006-037-H03CACGCCTCNONE 
AK061502CACGCCTCNONE 
AK068693CACGCCTCNONE 
AK121820CACGCCTCSimilar to L-asparaginase (L-asparagine amidohydrolase). 
J043030P10CACGCCTCNONE 
J065084D09CACGCCTCNONE 
Os04g0674000006-093-C01GAGGCGTGGANONE 
009-040-F06GAGGCGTGGANONE 
AK071276GAGGCGTGGANONE 
AK109377GAGGCGTGGAConserved hypothetical protein. 
AK119671GAGGCGTGGANONE 
J023084J11GAGGCGTGGANONE 
J023088F18GAGGCGTGGANONE 
J065099M12GAGGCGTGGANONE 
J065136J08GAGGCGTGGANONE 
J065167H22GAGGCGTGGANONE 
J075046L21GAGGCGTGGANONE 
J080029F17GAGGCGTGGANONE 
J080053C16GAGGCGTGGANONE 
J080053E24GAGGCGTGGANONE 
J080074D14GAGGCGTGGANONE 
J100029C12GAGGCGTGGANONE 
J100030D01GAGGCGTGGANONE 
J100044E16GAGGCGTGGANONE 
J100065N18GAGGCGTGGANONE 
J100077D18GAGGCGTGGANONE 
J100090P13GAGGCGTGGANONE 
Os05g0125500011-009-G05CACGCCTCNONE 
012-050-D12CACGCCTCNONE 
AK066314CACGCCTCSimilar to Isovaleryl-CoA dehydrogenase, mitochondrial precursor (EC 1.3.99.10) (IVD). 
J013064C04CACGCCTCNONE 
J100033M24CACGCCTCNONE 
J100041O08CACGCCTCNONE 
J100073K02CACGCCTCNONE 
Os05g0344200006-022-E04GAGGCGTGNONE 
006-080-D01GAGGCGTGNONE 
009-021-D03GAGGCGTGNONE 
009-026-A10GAGGCGTGNONE 
009-054-B12GAGGCGTGNONE 
009-059-H03GAGGCGTGNONE 
009-077-C02GAGGCGTGNONE 
009-095-H12GAGGCGTGNONE 
009-106-B08GAGGCGTGNONE 
009-138-D10GAGGCGTGNONE 
009-140-G06GAGGCGTGNONE 
009-146-E09GAGGCGTGNONE 
009-161-F04GAGGCGTGNONE 
009-176-F05GAGGCGTGNONE 
013-047-C03GAGGCGTGNONE 
013-052-E07GAGGCGTGNONE 
013-054-G04GAGGCGTGNONE 
013-095-D10GAGGCGTGNONE 
014-003-D06GAGGCGTGNONE 
014-020-C09GAGGCGTGNONE 
014-043-E01GAGGCGTGNONE 
014-080-G09GAGGCGTGNONE 
014-081-H05GAGGCGTGNONE 
AK060058GAGGCGTGConserved hypothetical protein. 
AK098850GAGGCGTGNONE 
AK104716GAGGCGTGNONE 
AK119727GAGGCGTGNONE 
J013000G04GAGGCGTGNONE 
J013155L11GAGGCGTGNONE 
J033138J22GAGGCGTGNONE 
J065112E22GAGGCGTGNONE 
J065124M06GAGGCGTGNONE 
J065130M01GAGGCGTGNONE 
J065137I03GAGGCGTGNONE 
J065157O12GAGGCGTGNONE 
J065171B12GAGGCGTGNONE 
J075003O16GAGGCGTGNONE 
J075026G12GAGGCGTGNONE 
J075032K07GAGGCGTGNONE 
J075070I11GAGGCGTGNONE 
J075093K06GAGGCGTGNONE 
J075148C12GAGGCGTGNONE 
J075148L08GAGGCGTGNONE 
J075152G13GAGGCGTGNONE 
J075177G07GAGGCGTGNONE 
J100026I09GAGGCGTGNONE 
J100083L11GAGGCGTGNONE 
J100086F04GAGGCGTGNONE 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
Os05g0358500AK060575CCCCCACGCCTCNONE 
AK100777CCCCCACGCCTCProtein phosphatase 2C-like domain containing protein. 
Os05g0376600AK073218CACGCCTCGCN5-related N-acetyltransferase domain containing protein. 
Os05g0395300AK066212CACGCCTCProtein of unknown function DUF21 domain containing protein. 
Os05g0429600AK058688GAGGCGTGNONE 
AK066891GAGGCGTGConserved hypothetical protein. 
Os05g0453700009-171-G06CACGCCTCNONE 
015-019-F02CACGCCTCNONE 
AB110169CACGCCTCNONE 
AK063881CACGCCTCSimilar to ENOD18 protein (Fragment). 
AK073600CACGCCTCNONE 
J033048I03CACGCCTCNONE 
J065026A09CACGCCTCNONE 
J065028M08CACGCCTCNONE 
J075140N01CACGCCTCNONE 
Os05g0455600AK060152TCCACGCCTCPrenylated rab acceptor PRA1 family protein. 
AK103269TCCACGCCTCNONE 
AK105995TCCACGCCTCNONE 
J023109E13TCCACGCCTCNONE 
J023120K13TCCACGCCTCNONE 
J033124H03TCCACGCCTCNONE 
Os05g0473300AK102559TGTGGGCCCCACGCCTCNONE 
AK103822TGTGGGCCCCACGCCTCNONE 
AK109855TGTGGGCCCCACGCCTCSimilar to Ethylene response factor 1. 
Os05g0530400AB050096CACGCCTCHeat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10). 
AB050098CACGCCTCNONE 
AK100412CACGCCTCNONE 
AY344492CACGCCTCNONE 
Os05g0534400AK101368GAGGCGTGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13GAGGCGTGNONE 
J065045H07GAGGCGTGNONE 
Os05g0550600014-080-F08CACGCCTCNONE 
AK063729CACGCCTCNONE 
AK119689CACGCCTCSimilar to Nonspecific lipid-transfer protein 2 (nsLTP2) (7 kDa lipid transfer protein). 
J065102I02CACGCCTCNONE 
Os05g0562800AK072829CACGCCTCNONE 
J023138F22CACGCCTCNONE 
Os05g0567100015-030-G11CACGCCTCNONE 
AK066453CACGCCTCNONE 
AK067742CACGCCTCNONE 
AK098906CACGCCTCNONE 
AK098911CACGCCTCNONE 
AK103421CACGCCTCNONE 
AK104838CACGCCTCNONE 
D32144CACGCCTCAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14CACGCCTCNONE 
J013002H22CACGCCTCNONE 
J013022G01CACGCCTCNONE 
J013039N15CACGCCTCNONE 
J023007F19CACGCCTCNONE 
J023107B10CACGCCTCNONE 
J033038D21CACGCCTCNONE 
J033043E23CACGCCTCNONE 
J033061A06CACGCCTCNONE 
Os05g0573700AK065295GGCCCCACACGCCTCSimilar to Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-acid reductoisomerase) (Alpha-keto-beta-hydroxylacil reductoisomerase). 
J065100L13GGCCCCACACGCCTCNONE 
J100062P20GGCCCCACACGCCTCNONE 
Os05g0595400006-103-B08GAGGCGTGNONE 
009-117-H06GAGGCGTGNONE 
AK061858GAGGCGTGNONE 
AK066391GAGGCGTGSimilar to Nucleoside diphosphate kinase III (EC 2.7.4.6) (NDK III) (NDP kinase III) (NDPK III). 
J013109B15GAGGCGTGNONE 
J023003J16GAGGCGTGNONE 
J023027P15GAGGCGTGNONE 
J023106M08GAGGCGTGNONE 
J023122O03GAGGCGTGNONE 
J033081D04GAGGCGTGNONE 
J033086G23GAGGCGTGNONE 
J033115F13GAGGCGTGNONE 
Os06g0101300013-080-G09CACGCCTCNONE 
015-006-A01CACGCCTCNONE 
015-044-F09CACGCCTCNONE 
AK109515CACGCCTCZinc finger, RING-type domain containing protein. 
AK121897CACGCCTCNONE 
J033084O06CACGCCTCNONE 
J033105E24CACGCCTCNONE 
J033126H24CACGCCTCNONE 
J065001F05CACGCCTCNONE 
J065002H03CACGCCTCNONE 
J065026B12CACGCCTCNONE 
J065093E11CACGCCTCNONE 
J065122E04CACGCCTCNONE 
J065164O07CACGCCTCNONE 
J065182M16CACGCCTCNONE 
J065217N11CACGCCTCNONE 
J090002P22CACGCCTCNONE 
Os06g0157000009-109-H03CACGCCTCNONE 
AK066113CACGCCTCLipolytic enzyme, G-D-S-L family protein. 
Os06g0168700011-054-F04GAGGCGTGGGCNONE 
012-001-G03GAGGCGTGGGCNONE 
AK101305GAGGCGTGGGCNONE 
AK103637GAGGCGTGGGCSimilar to Prolin rich protein. 
J075082N06GAGGCGTGGGCNONE 
J100086I19GAGGCGTGGGCNONE 
Os06g0264500AK120596GAGGCGTGTGF-beta receptor, type I/II extracellular region family protein. 
Os06g0285200AK109660GAGGCGTGNONE 
AY062183GAGGCGTGSimilar to Leafy cotyledon 1-like L1L protein. 
Os06g0286228AK069113TCCACGCCTCCupredoxin domain containing protein. 
Os06g0325700AK111131GAGGCGTGConserved hypothetical protein. 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0473200AK119330GAGGCGTGSimilar to NPK2. 
Os06g0475400AK102441GAGGCGTGProtein of unknown function DUF563 family protein. 
J013048F10GAGGCGTGNONE 
J013060O09GAGGCGTGNONE 
J013088E17GAGGCGTGNONE 
J013156B17GAGGCGTGNONE 
J013157J20GAGGCGTGNONE 
J033067E21GAGGCGTGNONE 
J033093L19GAGGCGTGNONE 
J033107F13GAGGCGTGNONE 
J033126A07GAGGCGTGNONE 
J100057N07GAGGCGTGNONE 
Os06g0589500AK073322CACGCCTCConserved hypothetical protein. 
AK073322CACGCCTCConserved hypothetical protein. 
J033030G15CACGCCTCNONE 
J033030G15CACGCCTCNONE 
J033148N18CACGCCTCNONE 
J033148N18CACGCCTCNONE 
Os06g0625800AK120023CACGCCTCTetratricopeptide-like helical domain containing protein. 
Os06g0642900AK073896CACGCCTCUbiquitin system component Cue domain containing protein. 
J033042P11CACGCCTCNONE 
J033072G12CACGCCTCNONE 
J090050C02CACGCCTCNONE 
Os06g0679500AK063283CACGCCTCSimilar to Avr9 elicitor response-like protein. 
AK108015CACGCCTCNONE 
Os06g0704700AK120907CGCCACGTCCACGCCTCNmrA-like family protein. 
AY224493CGCCACGTCCACGCCTCNONE 
Os06g0726100006-116-E04TCCACGCCTCNONE 
009-099-B08TCCACGCCTCNONE 
009-181-F01TCCACGCCTCNONE 
009-187-H08TCCACGCCTCNONE 
AK061280TCCACGCCTCSimilar to Seed chitinase-c. 
Z29962TCCACGCCTCNONE 
Os06g0728500AK073799CACGCCTCConserved hypothetical protein. 
AK099928CACGCCTCNONE 
J013160E03CACGCCTCNONE 
J033068A13CACGCCTCNONE 
J065102H08CACGCCTCNONE 
J065105L10CACGCCTCNONE 
J065211K03CACGCCTCNONE 
J090020J22CACGCCTCNONE 
J090025M15CACGCCTCNONE 
J100065L07CACGCCTCNONE 
J100065M19CACGCCTCNONE 
J100084O03CACGCCTCNONE 
Os07g0229200AK058412GAGGCGTGGTGTGGGGGCCyclin-like F-box domain containing protein. 
Os07g0419800J080309B06GAGGCGTGGGCCACNONE 
Os07g0584900AK058404CACGCCTCNONE 
AK059561CACGCCTCArmadillo-like helical domain containing protein. 
J023062J12CACGCCTCNONE 
J075199M03CACGCCTCNONE 
Os07g0607400AK106797CACGCCTCVirulence factor, pectin lyase fold family protein. 
Os07g0607800012-042-C02CACGCCTCNONE 
012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CACGCCTCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CACGCCTCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CACGCCTCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CACGCCTCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0616800AK100306ATGGCCCACGCCTCSucrose synthase 3 (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase 3). 
J023081P20ATGGCCCACGCCTCNONE 
J023083F19ATGGCCCACGCCTCNONE 
J023131O18ATGGCCCACGCCTCNONE 
J075005A08ATGGCCCACGCCTCNONE 
J075014A17ATGGCCCACGCCTCNONE 
J075034L22ATGGCCCACGCCTCNONE 
J075042E03ATGGCCCACGCCTCNONE 
J075058F21ATGGCCCACGCCTCNONE 
J075068P20ATGGCCCACGCCTCNONE 
J075069D01ATGGCCCACGCCTCNONE 
J075081D21ATGGCCCACGCCTCNONE 
J075094N20ATGGCCCACGCCTCNONE 
J075141C12ATGGCCCACGCCTCNONE 
J075175I11ATGGCCCACGCCTCNONE 
J075177O15ATGGCCCACGCCTCNONE 
J075181B08ATGGCCCACGCCTCNONE 
J075181E16ATGGCCCACGCCTCNONE 
J075182M01ATGGCCCACGCCTCNONE 
J090002E09ATGGCCCACGCCTCNONE 
J090012C07ATGGCCCACGCCTCNONE 
J090016H23ATGGCCCACGCCTCNONE 
J090018C17ATGGCCCACGCCTCNONE 
J090023D12ATGGCCCACGCCTCNONE 
J090025B11ATGGCCCACGCCTCNONE 
J090026B16ATGGCCCACGCCTCNONE 
J090026D01ATGGCCCACGCCTCNONE 
J090026N17ATGGCCCACGCCTCNONE 
J090027G04ATGGCCCACGCCTCNONE 
J090027J17ATGGCCCACGCCTCNONE 
J090030L01ATGGCCCACGCCTCNONE 
J090032F19ATGGCCCACGCCTCNONE 
J090033C02ATGGCCCACGCCTCNONE 
J090041D05ATGGCCCACGCCTCNONE 
J090042O17ATGGCCCACGCCTCNONE 
J090048I02ATGGCCCACGCCTCNONE 
J090048K18ATGGCCCACGCCTCNONE 
J090054J02ATGGCCCACGCCTCNONE 
J090056K21ATGGCCCACGCCTCNONE 
J090057D16ATGGCCCACGCCTCNONE 
J090058F22ATGGCCCACGCCTCNONE 
J090062L16ATGGCCCACGCCTCNONE 
J090062L17ATGGCCCACGCCTCNONE 
J090063H10ATGGCCCACGCCTCNONE 
J090063L17ATGGCCCACGCCTCNONE 
J090069A12ATGGCCCACGCCTCNONE 
J090069I20ATGGCCCACGCCTCNONE 
J090069L03ATGGCCCACGCCTCNONE 
J090072F07ATGGCCCACGCCTCNONE 
J090074K19ATGGCCCACGCCTCNONE 
J090077E02ATGGCCCACGCCTCNONE 
J090078L13ATGGCCCACGCCTCNONE 
J090081C14ATGGCCCACGCCTCNONE 
J090081J18ATGGCCCACGCCTCNONE 
J090083E11ATGGCCCACGCCTCNONE 
J090083I21ATGGCCCACGCCTCNONE 
J090083P21ATGGCCCACGCCTCNONE 
J090088H09ATGGCCCACGCCTCNONE 
J090090I19ATGGCCCACGCCTCNONE 
J090090K03ATGGCCCACGCCTCNONE 
J090092L21ATGGCCCACGCCTCNONE 
J090094M21ATGGCCCACGCCTCNONE 
J090095E24ATGGCCCACGCCTCNONE 
J090095H06ATGGCCCACGCCTCNONE 
J090095P19ATGGCCCACGCCTCNONE 
J090096E13ATGGCCCACGCCTCNONE 
J090096G02ATGGCCCACGCCTCNONE 
J090096N12ATGGCCCACGCCTCNONE 
J090097C07ATGGCCCACGCCTCNONE 
Os07g0620800AK063671CACGCCTCCyclin-like domain containing protein. 
Os07g0625500AK064628CACGCCTCSimilar to Fimbriata-associated protein (Fragment). 
Os08g0133100AK109905GAGGCGTGSimilar to Tpv2-1c protein (Fragment). 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
AK104886CGCCACGTCACGCCTCGCCCNONE 
J013089M01CGCCACGTCACGCCTCGCCCNONE 
J023037M15CGCCACGTCACGCCTCGCCCNONE 
J033068E03CGCCACGTCACGCCTCGCCCNONE 
J090021P19CGCCACGTCACGCCTCGCCCNONE 
Os08g0157500006-104-C12GAGGCGTGNONE 
AB122056GAGGCGTGNONE 
AK061859GAGGCGTGNONE 
Os08g0236900AK109597GAGGCGTGGACTGGGCCTGConserved hypothetical protein. 
Os08g0425800009-168-F06GAGGCGTGNONE 
AK061339GAGGCGTGConserved hypothetical protein. 
AK101198GAGGCGTGNONE 
J033030L06GAGGCGTGNONE 
J100036D08GAGGCGTGNONE 
J100052I22GAGGCGTGNONE 
Os08g0468400011-057-F06CACGCCTCNONE 
AK063363CACGCCTCHEC/Ndc80p family protein. 
J100048N11CACGCCTCNONE 
Os08g0535600AK121683GAGGCGTGGACCZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCGTGGACCNONE 
J075088M24GAGGCGTGGACCNONE 
J075140B03GAGGCGTGGACCNONE 
J090014B14GAGGCGTGGACCNONE 
Os08g0542100AK058490GAGGCGTGRibosomal protein L7, eukaryotic form family protein. 
AK101416GAGGCGTGNONE 
J033037N08GAGGCGTGNONE 
J033086B16GAGGCGTGNONE 
J043036J02GAGGCGTGNONE 
J065137E02GAGGCGTGNONE 
J090015L07GAGGCGTGNONE 
J100036D02GAGGCGTGNONE 
Os08g0566600AK061598GAGGCGTGNONE 
AK066210GAGGCGTGSimilar to PGR5. 
J065082J05GAGGCGTGNONE 
J065124K07GAGGCGTGNONE 
J065147J04GAGGCGTGNONE 
Os09g0346500004-015-F05CACGCCTCNONE 
005-018-A05CACGCCTCNONE 
006-021-B03CACGCCTCNONE 
006-021-D10CACGCCTCNONE 
006-021-E07CACGCCTCNONE 
006-021-F03CACGCCTCNONE 
006-022-A06CACGCCTCNONE 
006-022-B07CACGCCTCNONE 
006-022-C02CACGCCTCNONE 
006-023-E02CACGCCTCNONE 
006-023-G08CACGCCTCNONE 
006-023-H05CACGCCTCNONE 
006-024-B09CACGCCTCNONE 
006-024-E02CACGCCTCNONE 
006-025-F01CACGCCTCNONE 
006-025-G12CACGCCTCNONE 
006-026-D02CACGCCTCNONE 
006-026-D05CACGCCTCNONE 
006-028-C05CACGCCTCNONE 
006-028-E07CACGCCTCNONE 
006-028-F05CACGCCTCNONE 
006-028-F07CACGCCTCNONE 
006-028-F08CACGCCTCNONE 
006-028-G09CACGCCTCNONE 
006-029-B04CACGCCTCNONE 
006-029-C10CACGCCTCNONE 
006-030-H03CACGCCTCNONE 
006-031-F04CACGCCTCNONE 
006-031-G11CACGCCTCNONE 
006-032-D07CACGCCTCNONE 
006-032-G02CACGCCTCNONE 
006-032-H02CACGCCTCNONE 
006-032-H10CACGCCTCNONE 
006-033-A05CACGCCTCNONE 
006-033-C04CACGCCTCNONE 
006-033-D02CACGCCTCNONE 
006-034-C05CACGCCTCNONE 
006-034-D01CACGCCTCNONE 
006-034-H10CACGCCTCNONE 
006-035-A10CACGCCTCNONE 
006-035-B10CACGCCTCNONE 
006-035-D05CACGCCTCNONE 
006-036-B07CACGCCTCNONE 
006-036-F04CACGCCTCNONE 
006-036-H02CACGCCTCNONE 
006-036-H05CACGCCTCNONE 
006-036-H06CACGCCTCNONE 
006-037-C10CACGCCTCNONE 
006-037-F03CACGCCTCNONE 
006-038-B05CACGCCTCNONE 
006-038-E03CACGCCTCNONE 
006-038-E06CACGCCTCNONE 
006-039-B07CACGCCTCNONE 
006-039-D03CACGCCTCNONE 
006-039-F05CACGCCTCNONE 
006-041-A10CACGCCTCNONE 
006-041-B07CACGCCTCNONE 
006-042-B05CACGCCTCNONE 
006-042-C04CACGCCTCNONE 
006-042-D12CACGCCTCNONE 
006-043-C11CACGCCTCNONE 
006-043-E04CACGCCTCNONE 
006-044-E09CACGCCTCNONE 
006-045-B01CACGCCTCNONE 
006-045-G02CACGCCTCNONE 
006-046-A01CACGCCTCNONE 
006-046-C07CACGCCTCNONE 
006-046-G02CACGCCTCNONE 
006-047-B02CACGCCTCNONE 
006-047-C01CACGCCTCNONE 
006-047-D05CACGCCTCNONE 
006-047-F09CACGCCTCNONE 
006-049-E05CACGCCTCNONE 
006-049-E09CACGCCTCNONE 
006-050-A01CACGCCTCNONE 
006-050-A12CACGCCTCNONE 
006-050-C05CACGCCTCNONE 
006-050-C06CACGCCTCNONE 
006-050-G06CACGCCTCNONE 
006-050-G10CACGCCTCNONE 
006-050-H02CACGCCTCNONE 
006-051-A02CACGCCTCNONE 
006-051-B09CACGCCTCNONE 
006-051-C02CACGCCTCNONE 
006-051-H01CACGCCTCNONE 
006-052-B12CACGCCTCNONE 
006-052-D08CACGCCTCNONE 
006-052-E08CACGCCTCNONE 
006-052-F05CACGCCTCNONE 
006-052-F11CACGCCTCNONE 
006-052-G08CACGCCTCNONE 
006-052-G11CACGCCTCNONE 
006-052-H07CACGCCTCNONE 
006-053-A08CACGCCTCNONE 
006-053-B06CACGCCTCNONE 
006-054-H08CACGCCTCNONE 
006-055-B08CACGCCTCNONE 
006-055-E03CACGCCTCNONE 
006-055-H08CACGCCTCNONE 
006-056-A10CACGCCTCNONE 
006-056-C10CACGCCTCNONE 
006-056-E04CACGCCTCNONE 
006-057-A10CACGCCTCNONE 
006-058-A02CACGCCTCNONE 
006-058-D11CACGCCTCNONE 
006-058-F01CACGCCTCNONE 
006-058-H03CACGCCTCNONE 
006-058-H10CACGCCTCNONE 
006-059-B04CACGCCTCNONE 
006-059-F04CACGCCTCNONE 
006-060-A06CACGCCTCNONE 
006-060-B07CACGCCTCNONE 
006-060-D03CACGCCTCNONE 
006-062-B09CACGCCTCNONE 
006-062-C02CACGCCTCNONE 
006-062-D01CACGCCTCNONE 
006-062-E01CACGCCTCNONE 
006-062-F03CACGCCTCNONE 
006-062-H02CACGCCTCNONE 
006-063-C03CACGCCTCNONE 
006-063-G02CACGCCTCNONE 
006-063-H10CACGCCTCNONE 
006-064-H01CACGCCTCNONE 
006-067-F08CACGCCTCNONE 
006-068-G11CACGCCTCNONE 
006-071-B06CACGCCTCNONE 
006-071-G08CACGCCTCNONE 
006-071-H10CACGCCTCNONE 
006-072-H11CACGCCTCNONE 
006-073-C12CACGCCTCNONE 
006-073-E07CACGCCTCNONE 
006-073-H09CACGCCTCNONE 
006-074-C03CACGCCTCNONE 
006-074-F03CACGCCTCNONE 
006-074-G02CACGCCTCNONE 
006-074-H12CACGCCTCNONE 
006-075-C06CACGCCTCNONE 
006-075-G07CACGCCTCNONE 
006-075-G08CACGCCTCNONE 
006-075-G09CACGCCTCNONE 
006-075-H09CACGCCTCNONE 
006-076-C02CACGCCTCNONE 
006-076-E12CACGCCTCNONE 
006-076-G04CACGCCTCNONE 
006-076-G06CACGCCTCNONE 
006-076-G11CACGCCTCNONE 
006-077-D09CACGCCTCNONE 
006-077-E08CACGCCTCNONE 
006-079-B10CACGCCTCNONE 
006-079-F11CACGCCTCNONE 
006-079-H04CACGCCTCNONE 
006-079-H11CACGCCTCNONE 
006-080-D06CACGCCTCNONE 
006-080-E10CACGCCTCNONE 
006-080-F09CACGCCTCNONE 
006-080-G04CACGCCTCNONE 
006-081-C05CACGCCTCNONE 
006-081-D08CACGCCTCNONE 
006-081-E09CACGCCTCNONE 
006-081-F07CACGCCTCNONE 
006-081-H11CACGCCTCNONE 
006-082-E05CACGCCTCNONE 
006-083-E12CACGCCTCNONE 
006-083-F12CACGCCTCNONE 
006-084-A10CACGCCTCNONE 
006-084-B07CACGCCTCNONE 
006-084-E05CACGCCTCNONE 
006-084-F07CACGCCTCNONE 
006-085-C01CACGCCTCNONE 
006-085-D08CACGCCTCNONE 
006-085-G07CACGCCTCNONE 
006-085-G11CACGCCTCNONE 
006-086-A01CACGCCTCNONE 
006-086-B09CACGCCTCNONE 
006-086-E05CACGCCTCNONE 
006-086-F11CACGCCTCNONE 
006-086-F12CACGCCTCNONE 
006-086-G03CACGCCTCNONE 
006-087-C01CACGCCTCNONE 
006-087-D09CACGCCTCNONE 
006-087-E02CACGCCTCNONE 
006-087-F07CACGCCTCNONE 
006-088-A05CACGCCTCNONE 
006-088-F02CACGCCTCNONE 
006-089-F08CACGCCTCNONE 
006-090-G11CACGCCTCNONE 
006-091-H10CACGCCTCNONE 
006-092-B09CACGCCTCNONE 
006-092-E09CACGCCTCNONE 
006-093-B01CACGCCTCNONE 
006-093-C09CACGCCTCNONE 
006-093-G08CACGCCTCNONE 
006-094-G06CACGCCTCNONE 
006-095-A11CACGCCTCNONE 
006-095-D06CACGCCTCNONE 
006-095-F06CACGCCTCNONE 
006-096-E05CACGCCTCNONE 
006-096-H05CACGCCTCNONE 
006-097-A04CACGCCTCNONE 
006-097-H01CACGCCTCNONE 
006-098-B10CACGCCTCNONE 
006-098-F01CACGCCTCNONE 
006-098-G08CACGCCTCNONE 
006-098-H08CACGCCTCNONE 
006-099-E01CACGCCTCNONE 
006-100-C11CACGCCTCNONE 
006-100-F03CACGCCTCNONE 
006-101-B03CACGCCTCNONE 
006-101-B06CACGCCTCNONE 
006-101-B09CACGCCTCNONE 
006-101-G02CACGCCTCNONE 
006-101-H03CACGCCTCNONE 
006-102-A03CACGCCTCNONE 
006-102-E11CACGCCTCNONE 
006-102-H01CACGCCTCNONE 
006-102-H03CACGCCTCNONE 
006-103-C04CACGCCTCNONE 
006-103-H06CACGCCTCNONE 
006-104-A03CACGCCTCNONE 
006-104-F11CACGCCTCNONE 
006-105-H05CACGCCTCNONE 
006-105-H07CACGCCTCNONE 
006-106-B12CACGCCTCNONE 
006-106-D04CACGCCTCNONE 
006-107-A08CACGCCTCNONE 
006-107-C03CACGCCTCNONE 
006-107-G02CACGCCTCNONE 
006-108-B06CACGCCTCNONE 
006-109-B02CACGCCTCNONE 
006-109-D08CACGCCTCNONE 
006-109-F11CACGCCTCNONE 
006-109-G08CACGCCTCNONE 
006-110-G12CACGCCTCNONE 
006-110-H07CACGCCTCNONE 
006-111-A01CACGCCTCNONE 
006-111-A11CACGCCTCNONE 
006-111-D01CACGCCTCNONE 
006-111-H10CACGCCTCNONE 
006-111-H11CACGCCTCNONE 
006-112-A03CACGCCTCNONE 
006-112-B02CACGCCTCNONE 
006-112-B10CACGCCTCNONE 
006-112-E12CACGCCTCNONE 
006-112-F06CACGCCTCNONE 
006-112-H10CACGCCTCNONE 
006-113-A10CACGCCTCNONE 
006-113-C07CACGCCTCNONE 
006-114-A04CACGCCTCNONE 
006-114-B10CACGCCTCNONE 
006-114-C04CACGCCTCNONE 
006-114-D03CACGCCTCNONE 
006-114-D07CACGCCTCNONE 
006-114-G11CACGCCTCNONE 
006-115-C01CACGCCTCNONE 
006-116-A12CACGCCTCNONE 
006-116-F09CACGCCTCNONE 
006-116-H01CACGCCTCNONE 
006-117-B04CACGCCTCNONE 
006-117-B08CACGCCTCNONE 
006-117-E07CACGCCTCNONE 
006-117-E11CACGCCTCNONE 
006-117-H04CACGCCTCNONE 
006-117-H11CACGCCTCNONE 
006-118-A12CACGCCTCNONE 
006-118-C01CACGCCTCNONE 
006-119-A12CACGCCTCNONE 
006-119-C11CACGCCTCNONE 
006-119-F06CACGCCTCNONE 
009-038-E07CACGCCTCNONE 
009-053-G07CACGCCTCNONE 
009-088-D05CACGCCTCNONE 
009-109-G12CACGCCTCNONE 
009-124-H09CACGCCTCNONE 
009-134-F04CACGCCTCNONE 
009-149-G07CACGCCTCNONE 
009-181-D07CACGCCTCNONE 
009-191-D03CACGCCTCNONE 
AK058305CACGCCTCNONE 
AK060851CACGCCTCSimilar to Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP). 
AK104281CACGCCTCNONE 
AK104288CACGCCTCNONE 
AK104350CACGCCTCNONE 
D00641CACGCCTCNONE 
J013091G20CACGCCTCNONE 
J013129G18CACGCCTCNONE 
J013158J17CACGCCTCNONE 
J023013M23CACGCCTCNONE 
J023062B14CACGCCTCNONE 
J023105C20CACGCCTCNONE 
J023113G18CACGCCTCNONE 
J065060F20CACGCCTCNONE 
J065132G17CACGCCTCNONE 
J065163A19CACGCCTCNONE 
J075001K18CACGCCTCNONE 
J075047E10CACGCCTCNONE 
J075050E09CACGCCTCNONE 
J075058J15CACGCCTCNONE 
J075086B22CACGCCTCNONE 
J075086E16CACGCCTCNONE 
J075092C16CACGCCTCNONE 
J075130A10CACGCCTCNONE 
J075140F10CACGCCTCNONE 
J075161K06CACGCCTCNONE 
J075176J22CACGCCTCNONE 
J075177I20CACGCCTCNONE 
J075179H01CACGCCTCNONE 
J080003C15CACGCCTCNONE 
J080005N03CACGCCTCNONE 
J080011I16CACGCCTCNONE 
J080014C08CACGCCTCNONE 
J080017L17CACGCCTCNONE 
J080018K10CACGCCTCNONE 
J080022J03CACGCCTCNONE 
J080024I10CACGCCTCNONE 
J080026F17CACGCCTCNONE 
J080029G15CACGCCTCNONE 
J080032H11CACGCCTCNONE 
J080034C09CACGCCTCNONE 
J080035B22CACGCCTCNONE 
J080037H20CACGCCTCNONE 
J080039J16CACGCCTCNONE 
J080042J20CACGCCTCNONE 
J080044F03CACGCCTCNONE 
J080044F23CACGCCTCNONE 
J080045H08CACGCCTCNONE 
J080048H13CACGCCTCNONE 
J080062K23CACGCCTCNONE 
J080063G19CACGCCTCNONE 
J080068M05CACGCCTCNONE 
J080069L18CACGCCTCNONE 
J080071P09CACGCCTCNONE 
J080074E21CACGCCTCNONE 
J080075A14CACGCCTCNONE 
J080075C06CACGCCTCNONE 
J080085D10CACGCCTCNONE 
J080085E07CACGCCTCNONE 
J080086E17CACGCCTCNONE 
J080089F09CACGCCTCNONE 
J080089O19CACGCCTCNONE 
J080096A04CACGCCTCNONE 
J080301D10CACGCCTCNONE 
J080301E15CACGCCTCNONE 
J080306C23CACGCCTCNONE 
J080307L24CACGCCTCNONE 
J080308G21CACGCCTCNONE 
J080315H03CACGCCTCNONE 
J090014I10CACGCCTCNONE 
J090018H12CACGCCTCNONE 
J090031J20CACGCCTCNONE 
J090055A05CACGCCTCNONE 
J090062H23CACGCCTCNONE 
J090071K20CACGCCTCNONE 
J090099G11CACGCCTCNONE 
J100045E10CACGCCTCNONE 
J100046E18CACGCCTCNONE 
J100052B19CACGCCTCNONE 
J100053A01CACGCCTCNONE 
J100079P18CACGCCTCNONE 
Os09g0526800014-002-D10CTCTCCGCCCACGCCTCGCCCNONE 
AK060048CTCTCCGCCCACGCCTCGCCCNONE 
AK072174CTCTCCGCCCACGCCTCGCCCNONE 
AK105121CTCTCCGCCCACGCCTCGCCCNC domain containing protein. 
J013135P13CTCTCCGCCCACGCCTCGCCCNONE 
J033135C23CTCTCCGCCCACGCCTCGCCCNONE 
J043036C17CTCTCCGCCCACGCCTCGCCCNONE 
J065066N16CTCTCCGCCCACGCCTCGCCCNONE 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0558200016-083-C09GGGCGAGGCGTGGTCAGTGGNONE 
AK068834GGGCGAGGCGTGGTCAGTGGNONE 
AK103673GGGCGAGGCGTGGTCAGTGGHomeodomain-like containing protein. 
J013159M18GGGCGAGGCGTGGTCAGTGGNONE 
J065022I04GGGCGAGGCGTGGTCAGTGGNONE 
J065089B19GGGCGAGGCGTGGTCAGTGGNONE 
Os11g0114200015-058-D09CACGCCTCNONE 
AK106364CACGCCTCHypothetical protein. 
J065088F05CACGCCTCNONE 
J065160C13CACGCCTCNONE 
Os11g0116300AK059463CACGCCTCChalcone-flavanone isomerase family protein. 
J013123B20CACGCCTCNONE 
J023013C07CACGCCTCNONE 
J023043O08CACGCCTCNONE 
J023050O19CACGCCTCNONE 
J023074E18CACGCCTCNONE 
J023084C24CACGCCTCNONE 
J065076N12CACGCCTCNONE 
Os11g0171400AK107165CACGCCTCNONE 
AK107313CACGCCTCConserved hypothetical protein. 
J065083M09CACGCCTCNONE 
J065096I11CACGCCTCNONE 
J065199P18CACGCCTCNONE 
J075039I17CACGCCTCNONE 
J075054E05CACGCCTCNONE 
J075080H21CACGCCTCNONE 
J075120G04CACGCCTCNONE 
J075155C17CACGCCTCNONE 
Os11g0195600AK068003CACGCCTCSimilar to Amino acid carrier (Fragment). 
AK104370CACGCCTCNONE 
Os12g0122450Os12g0122450CACGCCTCTCCGCNONE 
Os12g0561200AK110847GAGGCGTGNONE 
Os12g0592900AK064058CACGCCTCNONE 
AK120039CACGCCTCHypothetical protein. 
J065081M07CACGCCTCNONE 
J065105G17CACGCCTCNONE 
J075017E06CACGCCTCNONE 
J075040M14CACGCCTCNONE 
J075052I18CACGCCTCNONE 
J075055J23CACGCCTCNONE 
J075057L03CACGCCTCNONE 
J075099C10CACGCCTCNONE 
J075104C21CACGCCTCNONE 
J075172L12CACGCCTCNONE 
J075179D22CACGCCTCNONE 
J075182G07CACGCCTCNONE 
J075194N11CACGCCTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.