version

Summary of OsREG504 (All List)

OrganismOryza sativa  
IDOsREG504  
SequenceCACGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2387  

Entry Sequences (2387 entries)

LocusGene modelSequenceDescription
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0164500AK068747CACGGCCCAATSimilar to ATP-dependent RNA helicase-like protein. 
AK103737CACGGCCCAATNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0212700AK108311CACGGCCCZinc finger, RING-type domain containing protein. 
Os01g0223400J013040P19GGGCCGTGNONE 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0343100J065039P06CCACGGCCCProtein of unknown function DUF594 family protein. 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
J023114F06CACGGCCCACGCNONE 
Os01g0382450J065084M05CACGGCCCGHypothetical protein. 
J065155G18CACGGCCCGNONE 
Os01g0525000015-038-B04CACGGCCCAGCNONE 
AK064104CACGGCCCAGCConserved hypothetical protein. 
Os01g0623900J090025M21CCACGGCCCGNONE 
J090082F22CCACGGCCCGNONE 
J090084L02CCACGGCCCGSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0662600009-056-E10CCACGGCCCNONE 
AK062234CCACGGCCCNONE 
AK098887CCACGGCCCNONE 
AK099656CCACGGCCCNONE 
AK119723CCACGGCCCSimilar to NifU-like protein. 
J013001K01CCACGGCCCNONE 
J013090F20CCACGGCCCNONE 
J013119A14CCACGGCCCNONE 
J013121P12CCACGGCCCNONE 
J033132I15CCACGGCCCNONE 
J075023F22CCACGGCCCNONE 
J075023M13CCACGGCCCNONE 
J100024D10CCACGGCCCNONE 
J100024N01CCACGGCCCNONE 
J100026H09CCACGGCCCNONE 
J100027H07CCACGGCCCNONE 
J100045K07CCACGGCCCNONE 
J100057K18CCACGGCCCNONE 
J100085C22CCACGGCCCNONE 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08CCGTGGGCCGTGNONE 
J033064N24CCGTGGGCCGTGNONE 
J043022M20CCGTGGGCCGTGNONE 
J065075K20CCGTGGGCCGTGNONE 
J065081K04CCGTGGGCCGTGNONE 
J065128K13CCGTGGGCCGTGNONE 
J065131K12CCGTGGGCCGTGNONE 
J065137H20CCGTGGGCCGTGNONE 
J065205A09CCGTGGGCCGTGNONE 
J090030C13CCGTGGGCCGTGNONE 
J090053I08CCGTGGGCCGTGNONE 
J090054O22CCGTGGGCCGTGNONE 
J090082C15CCGTGGGCCGTGNONE 
J090097P12CCGTGGGCCGTGNONE 
Os01g0705300AK102719AAATGGGCCGTGConserved hypothetical protein. 
AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK102719CACGGCCCATCTConserved hypothetical protein. 
AK103903AAATGGGCCGTGNONE 
AK103903AGATGGGCCGTGGGCCGTGNONE 
AK103903CACGGCCCATCTNONE 
J013146O16AAATGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J013146O16CACGGCCCATCTNONE 
J023024O09AAATGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J023024O09CACGGCCCATCTNONE 
J033105F22AAATGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033105F22CACGGCCCATCTNONE 
J033150L19AAATGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J033150L19CACGGCCCATCTNONE 
J075008G14AAATGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J075008G14CACGGCCCATCTNONE 
J090089L03AAATGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J090089L03CACGGCCCATCTNONE 
J100040H18AAATGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
J100040H18CACGGCCCATCTNONE 
Os01g0705500AK063120AGATGGGCCGTGConserved hypothetical protein. 
AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
AK063120CACGGCCCATTTConserved hypothetical protein. 
J065063M12AGATGGGCCGTGNONE 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065063M12CACGGCCCATTTNONE 
J065165C11AGATGGGCCGTGNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCATTTNONE 
Os01g0714800AK108555GGGCCGTGWRKY transcription factor 26. 
AY870609GGGCCGTGNONE 
Os01g0754000014-081-F07CGGGCCGTGGNONE 
AK063730CGGGCCGTGGConserved hypothetical protein. 
J065219A11CGGGCCGTGGNONE 
J075136N13CGGGCCGTGGNONE 
J100051G01CGGGCCGTGGNONE 
J100053M22CGGGCCGTGGNONE 
Os01g0801000AK064082CACGGCCCGGCCNONE 
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0825800AK102220GGGCCGTGAmino acid/polyamine transporter II family protein. 
Os01g0826400AK107199CACGGCCCCACGWRKY transcription factor 24 (WRKY24). 
AY341849CACGGCCCCACGNONE 
AY676925CACGGCCCCACGNONE 
AY870608CACGGCCCCACGNONE 
Os01g0863166J065007F23AACGGGCCGTGNONE 
J065007F23AACGGGCCGTGNONE 
J065007F23CACGGCCCGGCCNONE 
J065007F23CACGGCCCGTTNONE 
J065007F23CCACGGCCCATTTNONE 
J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21CACGGCCCGGCCConserved hypothetical protein. 
J065124H21CACGGCCCGTTConserved hypothetical protein. 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0866500AK111757CGGGCCGTGGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
J023060L20CGGGCCGTGGNONE 
J023143G12CGGGCCGTGGNONE 
Os01g0876500J053026A07CGATGGGCCGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CGATGGGCCGTGNONE 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0944700006-058-E06CTTGGGCCGTGGNONE 
006-065-A04CTTGGGCCGTGGNONE 
006-076-E07CTTGGGCCGTGGNONE 
006-087-A09CTTGGGCCGTGGNONE 
006-091-B05CTTGGGCCGTGGNONE 
006-105-C12CTTGGGCCGTGGNONE 
006-108-G03CTTGGGCCGTGGNONE 
006-113-C02CTTGGGCCGTGGNONE 
006-115-G03CTTGGGCCGTGGNONE 
009-047-H03CTTGGGCCGTGGNONE 
009-120-E11CTTGGGCCGTGGNONE 
009-195-C06CTTGGGCCGTGGNONE 
009-199-D12CTTGGGCCGTGGNONE 
013-006-E01CTTGGGCCGTGGNONE 
013-025-C06CTTGGGCCGTGGNONE 
013-035-D10CTTGGGCCGTGGNONE 
AF443600CTTGGGCCGTGGNONE 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
J013106C20CTTGGGCCGTGGNONE 
J023023O17CTTGGGCCGTGGNONE 
J023038J21CTTGGGCCGTGGNONE 
J023041A20CTTGGGCCGTGGNONE 
J023066P09CTTGGGCCGTGGNONE 
J023072F21CTTGGGCCGTGGNONE 
J023090L19CTTGGGCCGTGGNONE 
J023093M17CTTGGGCCGTGGNONE 
J023120D21CTTGGGCCGTGGNONE 
J023134O19CTTGGGCCGTGGNONE 
J023141D14CTTGGGCCGTGGNONE 
J033026N18CTTGGGCCGTGGNONE 
J033048M05CTTGGGCCGTGGNONE 
J033070N13CTTGGGCCGTGGNONE 
J033143C11CTTGGGCCGTGGNONE 
J033143O12CTTGGGCCGTGGNONE 
J043015L22CTTGGGCCGTGGNONE 
J053048D16CTTGGGCCGTGGNONE 
J053053L14CTTGGGCCGTGGNONE 
J053059O17CTTGGGCCGTGGNONE 
J053060N14CTTGGGCCGTGGNONE 
J053077B10CTTGGGCCGTGGNONE 
J053090L06CTTGGGCCGTGGNONE 
J053090M04CTTGGGCCGTGGNONE 
J075032N21CTTGGGCCGTGGNONE 
J075074O15CTTGGGCCGTGGNONE 
J075078I24CTTGGGCCGTGGNONE 
J090081N23CTTGGGCCGTGGNONE 
Os01g0946200AK071060CACGGCCCAAGNo apical meristem (NAM) protein domain containing protein. 
J023080K20CACGGCCCAAGNONE 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0208100011-077-C09GCCACACGGCCCSimilar to Chloroplast ADP,ATP carrier protein 2, chloroplast precursor (ADP/ATP translocase 2) (Adenine nucleotide translocase 2). 
Os02g0209900Os02g0209900GGGCCGTGSyntaxin/epimorphin family protein. 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK072956CGATGGGCCGTGATP11 family protein. 
AK102909CACGGCCCAAAGTCCCACCNONE 
AK102909CGATGGGCCGTGNONE 
J065017G18CACGGCCCAAAGTCCCACCNONE 
J065017G18CGATGGGCCGTGNONE 
J075066A05CACGGCCCAAAGTCCCACCNONE 
J075066A05CGATGGGCCGTGNONE 
Os02g0445700011-046-C10AACGGGCCGTGNONE 
011-046-C10CACGGCCCGTTNONE 
011-046-C10CGGGCCGTGNONE 
011-046-C10GCCGGGCCGTGNONE 
Os02g0461200012-026-A12CACGGCCCAACTNONE 
AK063459CACGGCCCAACTConserved hypothetical protein. 
J065183F11CACGGCCCAACTNONE 
J075190G18CACGGCCCAACTNONE 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0602300AK065609AACGGGCCGTGNONE 
AK065609AACGGGCCGTGNONE 
AK065609CACGGCCCGNONE 
AK065609CCGTGGGCCGTGNONE 
AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929CACGGCCCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08AACGGGCCGTGNONE 
J013092L08AACGGGCCGTGNONE 
J013092L08CACGGCCCGNONE 
J013092L08CCGTGGGCCGTGNONE 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23AACGGGCCGTGNONE 
J090040I23AACGGGCCGTGNONE 
J090040I23CACGGCCCGNONE 
J090040I23CCGTGGGCCGTGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0618400AK099283CCTGGGCCGTGGNONE 
AK111807CCTGGGCCGTGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CCTGGGCCGTGGNONE 
J090067D02CCTGGGCCGTGGNONE 
Os02g0621600AK071074CACGGCCCACAANONE 
AK108575CACGGCCCACAAConserved hypothetical protein. 
J023078O20CACGGCCCACAANONE 
J075025M01CACGGCCCACAANONE 
J090047L11CACGGCCCACAANONE 
Os02g0631000AK068667ATCTGGGCCGTGConserved hypothetical protein. 
J013159L03ATCTGGGCCGTGNONE 
J023119O20ATCTGGGCCGTGNONE 
J090098N20ATCTGGGCCGTGNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0633400AK073723CACGGCCCGSimilar to 61 kDa protein homolog. 
J100031K17CACGGCCCGNONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0669500AK111117CCACGGCCCGProtein of unknown function DUF241, plant family protein. 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0672500AK109266CCACGGCCCACCTNONE 
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174GGCCGGGCCGTGNONE 
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like. 
Os02g0717100014-089-G06CACGGCCCATTANONE 
AK063741CACGGCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J065052A22CACGGCCCATTANONE 
Os02g0727500009-018-G06CACGGCCCAATTNONE 
AK121427CACGGCCCAATTConserved hypothetical protein. 
J023136B21CACGGCCCAATTNONE 
J033044C13CACGGCCCAATTNONE 
J043037O12CACGGCCCAATTNONE 
J053072C14CACGGCCCAATTNONE 
J065008B15CACGGCCCAATTNONE 
J065033I12CACGGCCCAATTNONE 
J065077I18CACGGCCCAATTNONE 
J065149G03CACGGCCCAATTNONE 
J065159H07CACGGCCCAATTNONE 
J065162I17CACGGCCCAATTNONE 
J065168H02CACGGCCCAATTNONE 
J065176N09CACGGCCCAATTNONE 
J065178K23CACGGCCCAATTNONE 
J065216N03CACGGCCCAATTNONE 
J080001G08CACGGCCCAATTNONE 
J080002C09CACGGCCCAATTNONE 
J080007N17CACGGCCCAATTNONE 
J080009B04CACGGCCCAATTNONE 
J080009B17CACGGCCCAATTNONE 
J080011O15CACGGCCCAATTNONE 
J080022B06CACGGCCCAATTNONE 
J080022C13CACGGCCCAATTNONE 
J080024L04CACGGCCCAATTNONE 
J080031G21CACGGCCCAATTNONE 
J080035N14CACGGCCCAATTNONE 
J080036O14CACGGCCCAATTNONE 
J080040P10CACGGCCCAATTNONE 
J080042D03CACGGCCCAATTNONE 
J080042H05CACGGCCCAATTNONE 
J080042I20CACGGCCCAATTNONE 
J080043A01CACGGCCCAATTNONE 
J080043F17CACGGCCCAATTNONE 
J080046I19CACGGCCCAATTNONE 
J080053L20CACGGCCCAATTNONE 
J080055A20CACGGCCCAATTNONE 
J080055F01CACGGCCCAATTNONE 
J080056L02CACGGCCCAATTNONE 
J080058H02CACGGCCCAATTNONE 
J080059F11CACGGCCCAATTNONE 
J080062C03CACGGCCCAATTNONE 
J080064A07CACGGCCCAATTNONE 
J080064K15CACGGCCCAATTNONE 
J080067M17CACGGCCCAATTNONE 
J080067N17CACGGCCCAATTNONE 
J080068G07CACGGCCCAATTNONE 
J080069H15CACGGCCCAATTNONE 
J080069L08CACGGCCCAATTNONE 
J080069L20CACGGCCCAATTNONE 
J080069L21CACGGCCCAATTNONE 
J080069N20CACGGCCCAATTNONE 
J080071N24CACGGCCCAATTNONE 
J080074K17CACGGCCCAATTNONE 
J080076H08CACGGCCCAATTNONE 
J080082F19CACGGCCCAATTNONE 
J080086O16CACGGCCCAATTNONE 
J090025A19CACGGCCCAATTNONE 
J090025M06CACGGCCCAATTNONE 
J090070D02CACGGCCCAATTNONE 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0759400014-042-G11CACGGCCCNONE 
AK067456CACGGCCCZinc finger, RING-type domain containing protein. 
AY579411CACGGCCCNONE 
J013107I10CACGGCCCNONE 
J065056A11CACGGCCCNONE 
J065190D13CACGGCCCNONE 
J065205P06CACGGCCCNONE 
J075074C24CACGGCCCNONE 
J075088J08CACGGCCCNONE 
J075143A08CACGGCCCNONE 
J100068F04CACGGCCCNONE 
J100073G24CACGGCCCNONE 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0801900006-113-E02AACGGGCCGTGNONE 
006-113-E02AACGGGCCGTGNONE 
006-113-E02CACGGCCCGGCCNONE 
006-113-E02CACGGCCCGTTNONE 
006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488AACGGGCCGTGNONE 
AK109488AACGGGCCGTGNONE 
AK109488CACGGCCCGGCCNONE 
AK109488CACGGCCCGTTNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498CACGGCCCGGCCConserved hypothetical protein. 
AK109498CACGGCCCGTTConserved hypothetical protein. 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19AACGGGCCGTGNONE 
J065007D19AACGGGCCGTGNONE 
J065007D19CACGGCCCGGCCNONE 
J065007D19CACGGCCCGTTNONE 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11CACGGCCCGGCCNONE 
J065035G11CACGGCCCGTTNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05CACGGCCCGGCCNONE 
J065044E05CACGGCCCGTTNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01CACGGCCCGGCCNONE 
J065112N01CACGGCCCGTTNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03CACGGCCCGGCCNONE 
J065143B03CACGGCCCGTTNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16CACGGCCCGGCCNONE 
J065159A16CACGGCCCGTTNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23CACGGCCCGGCCNONE 
J090007K23CACGGCCCGTTNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09CACGGCCCGGCCNONE 
J090045N09CACGGCCCGTTNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20CACGGCCCGGCCNONE 
J090049L20CACGGCCCGTTNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK104882ACATGGGCCGTGNONE 
J013075C10ACATGGGCCGTGNONE 
J090012B18ACATGGGCCGTGNONE 
J090087J08ACATGGGCCGTGNONE 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076CCACGGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0129100003-009-E09CACGGCCCGCACCGCNONE 
AF384030CACGGCCCGCACCGCNONE 
AK098993CACGGCCCGCACCGCSeven transmembrane protein MLO2. 
AK111990CACGGCCCGCACCGCNONE 
J013098A12CACGGCCCGCACCGCNONE 
J023020M16CACGGCCCGCACCGCNONE 
J043001L02CACGGCCCGCACCGCNONE 
Os03g0132900006-025-D05CACGGCCCAAGNONE 
006-080-C01CACGGCCCAAGNONE 
AF001501CACGGCCCAAGNONE 
AK059871CACGGCCCAAGNONE 
AK099355CACGGCCCAAGSimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03CACGGCCCAAGNONE 
J033044P19CACGGCCCAAGNONE 
J033119B12CACGGCCCAAGNONE 
J075009H20CACGGCCCAAGNONE 
J075122E04CACGGCCCAAGNONE 
J075161D07CACGGCCCAAGNONE 
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK111974GCCGGGCCGTGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554CACGGCCCGTTNONE 
AK120554GCCGGGCCGTGNONE 
J075060J10CACGGCCCGTTNONE 
J075060J10GCCGGGCCGTGNONE 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0160200AK064836CACGGCCCAGTConserved hypothetical protein. 
AK071081CACGGCCCAGTNONE 
AK100712CACGGCCCAGTNONE 
AK104859CACGGCCCAGTNONE 
J013000F21CACGGCCCAGTNONE 
J013024G05CACGGCCCAGTNONE 
J013035E12CACGGCCCAGTNONE 
J013041A17CACGGCCCAGTNONE 
J013045D10CACGGCCCAGTNONE 
J013045F04CACGGCCCAGTNONE 
J013046F04CACGGCCCAGTNONE 
J013047F10CACGGCCCAGTNONE 
J013051E10CACGGCCCAGTNONE 
J013059J07CACGGCCCAGTNONE 
J013059O17CACGGCCCAGTNONE 
J013060A20CACGGCCCAGTNONE 
J013063J23CACGGCCCAGTNONE 
J013066D19CACGGCCCAGTNONE 
J013069O08CACGGCCCAGTNONE 
J013088K24CACGGCCCAGTNONE 
J013098G04CACGGCCCAGTNONE 
J013100I15CACGGCCCAGTNONE 
J013102E18CACGGCCCAGTNONE 
J013102O09CACGGCCCAGTNONE 
J013119M18CACGGCCCAGTNONE 
J013123I19CACGGCCCAGTNONE 
J013146H15CACGGCCCAGTNONE 
J013149A14CACGGCCCAGTNONE 
J023003A05CACGGCCCAGTNONE 
J023013O19CACGGCCCAGTNONE 
J023044M05CACGGCCCAGTNONE 
J023048O03CACGGCCCAGTNONE 
J023049L17CACGGCCCAGTNONE 
J023060D22CACGGCCCAGTNONE 
J023060F20CACGGCCCAGTNONE 
J023069G09CACGGCCCAGTNONE 
J023086E11CACGGCCCAGTNONE 
J023091I09CACGGCCCAGTNONE 
J023091M19CACGGCCCAGTNONE 
J023101D06CACGGCCCAGTNONE 
J023109B03CACGGCCCAGTNONE 
J023113B14CACGGCCCAGTNONE 
J023114B19CACGGCCCAGTNONE 
J023115H16CACGGCCCAGTNONE 
J023134F22CACGGCCCAGTNONE 
J023139I06CACGGCCCAGTNONE 
J023150C02CACGGCCCAGTNONE 
J033033A14CACGGCCCAGTNONE 
J033058O11CACGGCCCAGTNONE 
J033060H13CACGGCCCAGTNONE 
J033075P14CACGGCCCAGTNONE 
J033084O05CACGGCCCAGTNONE 
J033087G04CACGGCCCAGTNONE 
J033092E18CACGGCCCAGTNONE 
J033101G23CACGGCCCAGTNONE 
J033112I05CACGGCCCAGTNONE 
J033118E14CACGGCCCAGTNONE 
J033118P04CACGGCCCAGTNONE 
J033123C07CACGGCCCAGTNONE 
J043003C01CACGGCCCAGTNONE 
J043024B21CACGGCCCAGTNONE 
J043030N04CACGGCCCAGTNONE 
J043039J02CACGGCCCAGTNONE 
J043039N08CACGGCCCAGTNONE 
J075006N21CACGGCCCAGTNONE 
J075008A16CACGGCCCAGTNONE 
J075018J16CACGGCCCAGTNONE 
J075023G04CACGGCCCAGTNONE 
J075134F18CACGGCCCAGTNONE 
J075181B05CACGGCCCAGTNONE 
J090014O14CACGGCCCAGTNONE 
J090020H22CACGGCCCAGTNONE 
J090022G17CACGGCCCAGTNONE 
J090023J24CACGGCCCAGTNONE 
J090033H01CACGGCCCAGTNONE 
J090038A03CACGGCCCAGTNONE 
J090041O22CACGGCCCAGTNONE 
J090049E10CACGGCCCAGTNONE 
J090063E24CACGGCCCAGTNONE 
J090080N12CACGGCCCAGTNONE 
J100021G23CACGGCCCAGTNONE 
J100028P06CACGGCCCAGTNONE 
J100060L21CACGGCCCAGTNONE 
J100077D16CACGGCCCAGTNONE 
J100088I09CACGGCCCAGTNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0168200AK099530TGATGGGCCGTGConserved hypothetical protein. 
Os03g0183300003-107-A07CACGGCCCGNONE 
003-113-H10CACGGCCCGNONE 
003-118-G01CACGGCCCGNONE 
006-028-A09CACGGCCCGNONE 
006-047-D01CACGGCCCGNONE 
006-052-D04CACGGCCCGNONE 
006-087-H06CACGGCCCGNONE 
006-089-B03CACGGCCCGNONE 
006-092-D08CACGGCCCGNONE 
006-093-E07CACGGCCCGNONE 
009-029-H07CACGGCCCGNONE 
009-067-B05CACGGCCCGNONE 
009-091-F04CACGGCCCGNONE 
009-101-C10CACGGCCCGNONE 
009-113-A06CACGGCCCGNONE 
009-140-E12CACGGCCCGNONE 
009-145-E10CACGGCCCGNONE 
009-196-F02CACGGCCCGNONE 
011-054-E07CACGGCCCGNONE 
012-074-E10CACGGCCCGNONE 
012-076-E11CACGGCCCGNONE 
014-006-C07CACGGCCCGNONE 
014-085-G11CACGGCCCGNONE 
015-049-C04CACGGCCCGNONE 
015-062-E10CACGGCCCGNONE 
016-063-E02CACGGCCCGNONE 
AK058349CACGGCCCGHypothetical protein. 
AK105922CACGGCCCGNONE 
AK106163CACGGCCCGNONE 
AK119553CACGGCCCGNONE 
AY831395CACGGCCCGNONE 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
AK100356CCACGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0199500J065099N05CCACGGCCCNONE 
J065152P14CCACGGCCCConserved hypothetical protein. 
J080009C14CCACGGCCCNONE 
J080011K01CCACGGCCCNONE 
J080015H12CCACGGCCCNONE 
J080022K05CCACGGCCCNONE 
J080034G01CCACGGCCCNONE 
J080038I04CCACGGCCCNONE 
J080039F20CCACGGCCCNONE 
J080042J22CCACGGCCCNONE 
J080042N23CCACGGCCCNONE 
J080043E07CCACGGCCCNONE 
J080050A12CCACGGCCCNONE 
J080050C11CCACGGCCCNONE 
J080052B01CCACGGCCCNONE 
J080052H22CCACGGCCCNONE 
J080060E02CCACGGCCCNONE 
J080063K24CCACGGCCCNONE 
J080067I07CCACGGCCCNONE 
J080081H22CCACGGCCCNONE 
J080085J10CCACGGCCCNONE 
J080089E20CCACGGCCCNONE 
J080092N04CCACGGCCCNONE 
J080093B01CCACGGCCCNONE 
J080093N04CCACGGCCCNONE 
J080097B03CCACGGCCCNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0265300011-009-B11CACGGCCCGNONE 
AK101498CACGGCCCGMitochondrial substrate carrier family protein. 
J043024D03CACGGCCCGNONE 
J065096I09CACGGCCCGNONE 
J100071C08CACGGCCCGNONE 
Os03g0277500014-019-A09GTGTGGGCCGTGNONE 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GTGTGGGCCGTGNONE 
J065092A08GTGTGGGCCGTGNONE 
J065122E17GTGTGGGCCGTGNONE 
J065182K12GTGTGGGCCGTGNONE 
J065197H15GTGTGGGCCGTGNONE 
J075115A05GTGTGGGCCGTGNONE 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCACGGCCCAAGNONE 
J023079P21CCACGGCCCAAGNONE 
J023120G14CCACGGCCCAAGNONE 
J090042F16CCACGGCCCAAGNONE 
Os03g0279600006-070-A07CTGGGCCGTGNONE 
AK061080CTGGGCCGTGConserved hypothetical protein. 
AK071043CTGGGCCGTGNONE 
AK103191CTGGGCCGTGNONE 
J065077E22CTGGGCCGTGNONE 
J065208F22CTGGGCCGTGNONE 
J075156K12CTGGGCCGTGNONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein. 
Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0294600AK110762TGTGGGGCCGTGSimilar to Importin-beta1. 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0343500009-042-G06CCACGGCCCAACNONE 
009-063-D01CCACGGCCCAACNONE 
009-156-H09CCACGGCCCAACNONE 
AB117995CCACGGCCCAACNONE 
AK058737CCACGGCCCAACNONE 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK121502CCACGGCCCAACNONE 
J023082D10CCACGGCCCAACNONE 
J033022G11CCACGGCCCAACNONE 
J075048M16CCACGGCCCAACNONE 
J075049O20CCACGGCCCAACNONE 
J075082I02CCACGGCCCAACNONE 
J075105G01CCACGGCCCAACNONE 
J075131K05CCACGGCCCAACNONE 
J080002H01CCACGGCCCAACNONE 
J080003H01CCACGGCCCAACNONE 
J080005G08CCACGGCCCAACNONE 
J080011M13CCACGGCCCAACNONE 
J080020M02CCACGGCCCAACNONE 
J080026N24CCACGGCCCAACNONE 
J080028L09CCACGGCCCAACNONE 
J080032O14CCACGGCCCAACNONE 
J080033J12CCACGGCCCAACNONE 
J080035D05CCACGGCCCAACNONE 
J080039H01CCACGGCCCAACNONE 
J080044B07CCACGGCCCAACNONE 
J080044E23CCACGGCCCAACNONE 
J080049N11CCACGGCCCAACNONE 
J080050A21CCACGGCCCAACNONE 
J080055L24CCACGGCCCAACNONE 
J080059N20CCACGGCCCAACNONE 
J080061F04CCACGGCCCAACNONE 
J080078I16CCACGGCCCAACNONE 
J080079G24CCACGGCCCAACNONE 
J080080K13CCACGGCCCAACNONE 
J080083G20CCACGGCCCAACNONE 
J080087B08CCACGGCCCAACNONE 
J080091L19CCACGGCCCAACNONE 
J080094D06CCACGGCCCAACNONE 
J090038L06CCACGGCCCAACNONE 
J090075H06CCACGGCCCAACNONE 
J090081D12CCACGGCCCAACNONE 
Os03g0344100009-166-F10CTTGGGCCGTGNONE 
AK061903CTTGGGCCGTGNONE 
AK065547CTTGGGCCGTGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24CTTGGGCCGTGNONE 
J033087C06CTTGGGCCGTGNONE 
J053073I09CTTGGGCCGTGNONE 
J065189D11CTTGGGCCGTGNONE 
J090032B15CTTGGGCCGTGNONE 
Os03g0410700J065102A22AACTGGGCCGTGNONE 
Os03g0410900J065067F10CACGGCCCAGTTNONE 
J065073D08CACGGCCCAGTTNONE 
J065176C06CACGGCCCAGTTNONE 
J065189O13CACGGCCCAGTTNONE 
J065214E05CACGGCCCAGTTNONE 
J080007H09CACGGCCCAGTTNONE 
J080012B19CACGGCCCAGTTNONE 
J080020J16CACGGCCCAGTTNONE 
J080038J22CACGGCCCAGTTNONE 
J080045I09CACGGCCCAGTTNONE 
J080059M16CACGGCCCAGTTNONE 
J080060C19CACGGCCCAGTTNONE 
J080080P22CACGGCCCAGTTNONE 
J080083C03CACGGCCCAGTTNONE 
J080093M17CACGGCCCAGTTNONE 
J100029F12CACGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0639600AK111569CCACGGCCCSimilar to Zinc-finger protein Lsd1. 
J013071E13CCACGGCCCNONE 
J053039O11CCACGGCCCNONE 
J053048C05CCACGGCCCNONE 
J065171F11CCACGGCCCNONE 
J065188I07CCACGGCCCNONE 
J075172K20CCACGGCCCNONE 
J075199C18CCACGGCCCNONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069199CACGGCCCAAGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAATNONE 
AK069658CACGGCCCAAGNONE 
J023008E04CACGGCCCAAATNONE 
J023008E04CACGGCCCAAGNONE 
J023030D22CACGGCCCAAATNONE 
J023030D22CACGGCCCAAGNONE 
J033027E16CACGGCCCAAATNONE 
J033027E16CACGGCCCAAGNONE 
J033046D09CACGGCCCAAATNONE 
J033046D09CACGGCCCAAGNONE 
J033068I10CACGGCCCAAATNONE 
J033068I10CACGGCCCAAGNONE 
J033135A12CACGGCCCAAATNONE 
J033135A12CACGGCCCAAGNONE 
J065027E22CACGGCCCAAATNONE 
J065027E22CACGGCCCAAGNONE 
J065191K23CACGGCCCAAATNONE 
J065191K23CACGGCCCAAGNONE 
J090054D15CACGGCCCAAATNONE 
J090054D15CACGGCCCAAGNONE 
J090058J15CACGGCCCAAATNONE 
J090058J15CACGGCCCAAGNONE 
Os03g0736700AK060219CCACGGCCCGNONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
AK071361CACGGCCCAATTNONE 
AK103989CACGGCCCAATTNONE 
J023090K09CACGGCCCAATTNONE 
J043022H11CACGGCCCAATTNONE 
J053078F12CACGGCCCAATTNONE 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AY098743CACGGCCCACACNONE 
Os03g0807200011-031-F07CGGGCCGTGNONE 
AK063932CGGGCCGTGNONE 
AK103496CGGGCCGTGProtein of unknown function DUF1639 family protein. 
J033131A04CGGGCCGTGNONE 
J065109O03CGGGCCGTGNONE 
J080001M11CGGGCCGTGNONE 
J080002H18CGGGCCGTGNONE 
J080005I08CGGGCCGTGNONE 
J080006B05CGGGCCGTGNONE 
J080006D17CGGGCCGTGNONE 
J080007M19CGGGCCGTGNONE 
J080011E07CGGGCCGTGNONE 
J080012H06CGGGCCGTGNONE 
J080014D08CGGGCCGTGNONE 
J080017D06CGGGCCGTGNONE 
J080017K17CGGGCCGTGNONE 
J080020B17CGGGCCGTGNONE 
J080021O05CGGGCCGTGNONE 
J080021O15CGGGCCGTGNONE 
J080023I18CGGGCCGTGNONE 
J080025A21CGGGCCGTGNONE 
J080027P22CGGGCCGTGNONE 
J080028M22CGGGCCGTGNONE 
J080029B09CGGGCCGTGNONE 
J080029M07CGGGCCGTGNONE 
J080029M17CGGGCCGTGNONE 
J080030H23CGGGCCGTGNONE 
J080030K16CGGGCCGTGNONE 
J080030L19CGGGCCGTGNONE 
J080031A12CGGGCCGTGNONE 
J080031N21CGGGCCGTGNONE 
J080032G05CGGGCCGTGNONE 
J080032P20CGGGCCGTGNONE 
J080033H20CGGGCCGTGNONE 
J080034H22CGGGCCGTGNONE 
J080034J03CGGGCCGTGNONE 
J080034J16CGGGCCGTGNONE 
J080034N01CGGGCCGTGNONE 
J080035K20CGGGCCGTGNONE 
J080036I04CGGGCCGTGNONE 
J080036I19CGGGCCGTGNONE 
J080036O21CGGGCCGTGNONE 
J080038D06CGGGCCGTGNONE 
J080039J15CGGGCCGTGNONE 
J080039P18CGGGCCGTGNONE 
J080041H20CGGGCCGTGNONE 
J080041M11CGGGCCGTGNONE 
J080042F14CGGGCCGTGNONE 
J080043G10CGGGCCGTGNONE 
J080043J02CGGGCCGTGNONE 
J080044C19CGGGCCGTGNONE 
J080044G11CGGGCCGTGNONE 
J080045M03CGGGCCGTGNONE 
J080045N07CGGGCCGTGNONE 
J080047K14CGGGCCGTGNONE 
J080049I21CGGGCCGTGNONE 
J080050A06CGGGCCGTGNONE 
J080050I16CGGGCCGTGNONE 
J080050N16CGGGCCGTGNONE 
J080052C23CGGGCCGTGNONE 
J080052D18CGGGCCGTGNONE 
J080052F20CGGGCCGTGNONE 
J080052F23CGGGCCGTGNONE 
J080053M03CGGGCCGTGNONE 
J080054G13CGGGCCGTGNONE 
J080054H12CGGGCCGTGNONE 
J080055N03CGGGCCGTGNONE 
J080056E07CGGGCCGTGNONE 
J080057L04CGGGCCGTGNONE 
J080063O19CGGGCCGTGNONE 
J080064E21CGGGCCGTGNONE 
J080065D18CGGGCCGTGNONE 
J080065F18CGGGCCGTGNONE 
J080065H14CGGGCCGTGNONE 
J080065K15CGGGCCGTGNONE 
J080065M24CGGGCCGTGNONE 
J080066B18CGGGCCGTGNONE 
J080066B19CGGGCCGTGNONE 
J080071H19CGGGCCGTGNONE 
J080072E18CGGGCCGTGNONE 
J080074K21CGGGCCGTGNONE 
J080075B06CGGGCCGTGNONE 
J080076H07CGGGCCGTGNONE 
J080079D16CGGGCCGTGNONE 
J080082B20CGGGCCGTGNONE 
J080084N16CGGGCCGTGNONE 
J080085L07CGGGCCGTGNONE 
J080086L04CGGGCCGTGNONE 
J080086M07CGGGCCGTGNONE 
J080087D02CGGGCCGTGNONE 
J080087D15CGGGCCGTGNONE 
J080087J19CGGGCCGTGNONE 
J080088G20CGGGCCGTGNONE 
J080092M15CGGGCCGTGNONE 
J080093O10CGGGCCGTGNONE 
J080095L09CGGGCCGTGNONE 
J080096A18CGGGCCGTGNONE 
J080097C03CGGGCCGTGNONE 
J090019J07CGGGCCGTGNONE 
J090024N12CGGGCCGTGNONE 
J090049I09CGGGCCGTGNONE 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
J013042C24CACGGCCCACAANONE 
J013096O21CACGGCCCACAANONE 
J023109I23CACGGCCCACAANONE 
J033106N09CACGGCCCACAANONE 
J033107H03CACGGCCCACAANONE 
J033118G03CACGGCCCACAANONE 
J033145I24CACGGCCCACAANONE 
J065138D15CACGGCCCACAANONE 
J065140L13CACGGCCCACAANONE 
J065179M13CACGGCCCACAANONE 
J065200F05CACGGCCCACAANONE 
J075104F20CACGGCCCACAANONE 
J075143A15CACGGCCCACAANONE 
J075197J11CACGGCCCACAANONE 
Os03g0824400AK070153CACGGCCCATGGNONE 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0846400AK067706CGGGCCGTGCCCGGCCCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549CGGGCCGTGCCCGGCCCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0854800J090007D13CCACGGCCCNONE 
J090085N22CCACGGCCCNONE 
Os04g0208400AK069629AACGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629AGTGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629CACGGCCCGCyclin-like F-box domain containing protein. 
AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
Os04g0419100AK107777CACGGCCCAGTConserved hypothetical protein. 
J065037F08CACGGCCCAGTNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0462500006-073-E08GTGGTGGGGCCGTGNONE 
AK062065GTGGTGGGGCCGTGNONE 
AK071311GTGGTGGGGCCGTGSimilar to 14-3-3-like protein GF14-6. 
AK071822GTGGTGGGGCCGTGNONE 
AK099243GTGGTGGGGCCGTGNONE 
AK101938GTGGTGGGGCCGTGNONE 
J013056F02GTGGTGGGGCCGTGNONE 
J023020E08GTGGTGGGGCCGTGNONE 
J023085B16GTGGTGGGGCCGTGNONE 
J023117D08GTGGTGGGGCCGTGNONE 
J023133K12GTGGTGGGGCCGTGNONE 
J033025G04GTGGTGGGGCCGTGNONE 
J033052A15GTGGTGGGGCCGTGNONE 
J033074G16GTGGTGGGGCCGTGNONE 
J033090A16GTGGTGGGGCCGTGNONE 
J033122A07GTGGTGGGGCCGTGNONE 
J033133G09GTGGTGGGGCCGTGNONE 
J065002F16GTGGTGGGGCCGTGNONE 
J065030M09GTGGTGGGGCCGTGNONE 
J065056B11GTGGTGGGGCCGTGNONE 
J065115I10GTGGTGGGGCCGTGNONE 
J065120O09GTGGTGGGGCCGTGNONE 
J065124G21GTGGTGGGGCCGTGNONE 
J075031C14GTGGTGGGGCCGTGNONE 
J075040H07GTGGTGGGGCCGTGNONE 
J075047F04GTGGTGGGGCCGTGNONE 
J075065F14GTGGTGGGGCCGTGNONE 
J075066G20GTGGTGGGGCCGTGNONE 
J075105D01GTGGTGGGGCCGTGNONE 
J075147B04GTGGTGGGGCCGTGNONE 
J075149A12GTGGTGGGGCCGTGNONE 
J075172D07GTGGTGGGGCCGTGNONE 
J075190J11GTGGTGGGGCCGTGNONE 
J090038H18GTGGTGGGGCCGTGNONE 
J090087G05GTGGTGGGGCCGTGNONE 
J100025A10GTGGTGGGGCCGTGNONE 
J100025O10GTGGTGGGGCCGTGNONE 
J100027D02GTGGTGGGGCCGTGNONE 
J100027P06GTGGTGGGGCCGTGNONE 
J100032K04GTGGTGGGGCCGTGNONE 
J100056D21GTGGTGGGGCCGTGNONE 
J100060J08GTGGTGGGGCCGTGNONE 
J100063N19GTGGTGGGGCCGTGNONE 
J100064C14GTGGTGGGGCCGTGNONE 
J100064K18GTGGTGGGGCCGTGNONE 
J100070L21GTGGTGGGGCCGTGNONE 
J100072M17GTGGTGGGGCCGTGNONE 
J100074F21GTGGTGGGGCCGTGNONE 
J100087E05GTGGTGGGGCCGTGNONE 
U65956GTGGTGGGGCCGTGNONE 
Os04g0462900006-094-A02CACGGCCCGTTNONE 
006-097-F05CACGGCCCGTTNONE 
009-129-A10CACGGCCCGTTNONE 
015-042-F07CACGGCCCGTTNONE 
AK058481CACGGCCCGTTNONE 
AK059483CACGGCCCGTTNONE 
AK061324CACGGCCCGTTNONE 
AK099100CACGGCCCGTTNONE 
AK102579CACGGCCCGTTNONE 
AK106322CACGGCCCGTTSimilar to Prohibitin. 
J065059J20CACGGCCCGTTNONE 
J065085I02CACGGCCCGTTNONE 
J065118N23CACGGCCCGTTNONE 
J065208K24CACGGCCCGTTNONE 
J075053B14CACGGCCCGTTNONE 
J075097M22CACGGCCCGTTNONE 
J075184B07CACGGCCCGTTNONE 
J075194A15CACGGCCCGTTNONE 
J080315G03CACGGCCCGTTNONE 
J090088H19CACGGCCCGTTNONE 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0530000009-106-E11CACGGCCCAAAANONE 
011-012-E12CACGGCCCAAAANONE 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
J013052P20CACGGCCCAAAANONE 
J090060G12CACGGCCCAAAANONE 
J100073H10CACGGCCCAAAANONE 
Os04g0531100013-046-D02CACGGCCCACGGNONE 
013-046-D02CCACGGCCCACNONE 
AF090698CACGGCCCACGGNONE 
AF090698CCACGGCCCACNONE 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK063584CCACGGCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGGCCCACGGNONE 
J065025M20CCACGGCCCACNONE 
J065028L15CACGGCCCACGGNONE 
J065028L15CCACGGCCCACNONE 
J065048O03CACGGCCCACGGNONE 
J065048O03CCACGGCCCACNONE 
J065053K10CACGGCCCACGGNONE 
J065053K10CCACGGCCCACNONE 
J065072H10CACGGCCCACGGNONE 
J065072H10CCACGGCCCACNONE 
J065081H10CACGGCCCACGGNONE 
J065081H10CCACGGCCCACNONE 
J065082N17CACGGCCCACGGNONE 
J065082N17CCACGGCCCACNONE 
J065104K08CACGGCCCACGGNONE 
J065104K08CCACGGCCCACNONE 
J065106M03CACGGCCCACGGNONE 
J065106M03CCACGGCCCACNONE 
J065119I05CACGGCCCACGGNONE 
J065119I05CCACGGCCCACNONE 
J065122F04CACGGCCCACGGNONE 
J065122F04CCACGGCCCACNONE 
J065140N24CACGGCCCACGGNONE 
J065140N24CCACGGCCCACNONE 
J065153G09CACGGCCCACGGNONE 
J065153G09CCACGGCCCACNONE 
J065171H07CACGGCCCACGGNONE 
J065171H07CCACGGCCCACNONE 
J065172M23CACGGCCCACGGNONE 
J065172M23CCACGGCCCACNONE 
J065173K13CACGGCCCACGGNONE 
J065173K13CCACGGCCCACNONE 
J065177D22CACGGCCCACGGNONE 
J065177D22CCACGGCCCACNONE 
J065189H10CACGGCCCACGGNONE 
J065189H10CCACGGCCCACNONE 
J065198H24CACGGCCCACGGNONE 
J065198H24CCACGGCCCACNONE 
J065204D19CACGGCCCACGGNONE 
J065204D19CCACGGCCCACNONE 
J075006C08CACGGCCCACGGNONE 
J075006C08CCACGGCCCACNONE 
J075029I08CACGGCCCACGGNONE 
J075029I08CCACGGCCCACNONE 
J075039A16CACGGCCCACGGNONE 
J075039A16CCACGGCCCACNONE 
J075107I24CACGGCCCACGGNONE 
J075107I24CCACGGCCCACNONE 
J075135M22CACGGCCCACGGNONE 
J075135M22CCACGGCCCACNONE 
J075181P06CACGGCCCACGGNONE 
J075181P06CCACGGCCCACNONE 
J075190O11CACGGCCCACGGNONE 
J075190O11CCACGGCCCACNONE 
J075193F04CACGGCCCACGGNONE 
J075193F04CCACGGCCCACNONE 
Os04g0584100012-063-E01CACGGCCCATAANONE 
AK105292CACGGCCCATAAConserved hypothetical protein. 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0614500AK100259CACGGCCCGAminotransferase class-III family protein. 
Os04g0629500009-120-G06CACGGCCCNONE 
AK072821CACGGCCCSimilar to Thioredoxin h. 
AK103985CACGGCCCNONE 
AK121437CACGGCCCNONE 
J013111B13CACGGCCCNONE 
J013128N16CACGGCCCNONE 
J023098G05CACGGCCCNONE 
J023139A03CACGGCCCNONE 
J023140C07CACGGCCCNONE 
J065045N21CACGGCCCNONE 
J065054G17CACGGCCCNONE 
J065054L01CACGGCCCNONE 
J100044H07CACGGCCCNONE 
J100064L04CACGGCCCNONE 
Os04g0635800006-033-E07CACGGCCCGTTNONE 
011-067-A08CACGGCCCGTTNONE 
AK060110CACGGCCCGTTNONE 
AK099507CACGGCCCGTTGCN5-related N-acetyltransferase domain containing protein. 
AK104741CACGGCCCGTTNONE 
AK120021CACGGCCCGTTNONE 
J013029B17CACGGCCCGTTNONE 
J013134M07CACGGCCCGTTNONE 
J013149N18CACGGCCCGTTNONE 
J013153L10CACGGCCCGTTNONE 
J033131F08CACGGCCCGTTNONE 
J043010E02CACGGCCCGTTNONE 
J065031J05CACGGCCCGTTNONE 
J065031J06CACGGCCCGTTNONE 
J075030K04CACGGCCCGTTNONE 
J075178K05CACGGCCCGTTNONE 
J080001B10CACGGCCCGTTNONE 
J080003N19CACGGCCCGTTNONE 
J080005F20CACGGCCCGTTNONE 
J080005G16CACGGCCCGTTNONE 
J080007N02CACGGCCCGTTNONE 
J080009J04CACGGCCCGTTNONE 
J080017D04CACGGCCCGTTNONE 
J080020M22CACGGCCCGTTNONE 
J080021A15CACGGCCCGTTNONE 
J080021F21CACGGCCCGTTNONE 
J080023P05CACGGCCCGTTNONE 
J080024P22CACGGCCCGTTNONE 
J080027C20CACGGCCCGTTNONE 
J080029K03CACGGCCCGTTNONE 
J080035M18CACGGCCCGTTNONE 
J080039F22CACGGCCCGTTNONE 
J080039J03CACGGCCCGTTNONE 
J080039L03CACGGCCCGTTNONE 
J080039P14CACGGCCCGTTNONE 
J080042E12CACGGCCCGTTNONE 
J080047D19CACGGCCCGTTNONE 
J080047M21CACGGCCCGTTNONE 
J080049N03CACGGCCCGTTNONE 
J080056J12CACGGCCCGTTNONE 
J080060B10CACGGCCCGTTNONE 
J080062K08CACGGCCCGTTNONE 
J080064L07CACGGCCCGTTNONE 
J080069C15CACGGCCCGTTNONE 
J080074H06CACGGCCCGTTNONE 
J080086O14CACGGCCCGTTNONE 
J080090C20CACGGCCCGTTNONE 
J080090L14CACGGCCCGTTNONE 
J080095G08CACGGCCCGTTNONE 
J080097C07CACGGCCCGTTNONE 
J090011F03CACGGCCCGTTNONE 
J090082O17CACGGCCCGTTNONE 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-097-D05AAATGGGCCGTGGNONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
J013035J20AAATGGGCCGTGGNONE 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075157N21CCACGGCCCACGGNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0665000009-149-A12CACGGCCCAACNONE 
AK062995CACGGCCCAACCHCH domain containing protein. 
J065017G19CACGGCCCAACNONE 
J080301G12CACGGCCCAACNONE 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
J013029J20CCGTGGGCCGTGNONE 
J013072I16CCGTGGGCCGTGNONE 
J013134H18CCGTGGGCCGTGNONE 
J013159H06CCGTGGGCCGTGNONE 
Os05g0116600AK109828CACGGCCCF-box associated type 1 domain containing protein. 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0123400AK069521CACGGCCCATCAConserved hypothetical protein. 
J023022O05CACGGCCCATCANONE 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0223200015-037-E09CACGGCCCAAANONE 
AK106308CACGGCCCAAASimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CACGGCCCAAANONE 
J065056N06CACGGCCCAAANONE 
J065080I11CACGGCCCAAANONE 
J065104F11CACGGCCCAAANONE 
J065183L10CACGGCCCAAANONE 
J065185H12CACGGCCCAAANONE 
J065186N17CACGGCCCAAANONE 
Os05g0255600AK073067CACGGCCCATTThioredoxin domain 2 containing protein. 
J033022A04CACGGCCCATTNONE 
J033022B03CACGGCCCATTNONE 
J033116F22CACGGCCCATTNONE 
J065017H13CACGGCCCATTNONE 
J065038G20CACGGCCCATTNONE 
J065076J16CACGGCCCATTNONE 
J065135D06CACGGCCCATTNONE 
J065168P22CACGGCCCATTNONE 
J065188G21CACGGCCCATTNONE 
J065207C14CACGGCCCATTNONE 
J080014C23CACGGCCCATTNONE 
J080018G12CACGGCCCATTNONE 
J080021F03CACGGCCCATTNONE 
J100068C14CACGGCCCATTNONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0405400J090016P17CACGGCCCGGTNONE 
Os05g0413000AK058277TCTGGGCCGTGMitochodrial transcription termination factor-related family protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0455600AK060152CACGGCCCAGTAPrenylated rab acceptor PRA1 family protein. 
AK103269CACGGCCCAGTANONE 
AK105995CACGGCCCAGTANONE 
J023109E13CACGGCCCAGTANONE 
J023120K13CACGGCCCAGTANONE 
J033124H03CACGGCCCAGTANONE 
Os05g0458100006-084-A05AGATGGGCCGTGNONE 
006-084-A05AGTGGGCCGTGNONE 
009-091-H05AGATGGGCCGTGNONE 
009-091-H05AGTGGGCCGTGNONE 
AJ557547AGATGGGCCGTGNONE 
AJ557547AGTGGGCCGTGNONE 
AK059467AGATGGGCCGTGNONE 
AK059467AGTGGGCCGTGNONE 
AK061127AGATGGGCCGTGNONE 
AK061127AGTGGGCCGTGNONE 
AK101652AGATGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
AK101652AGTGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGATGGGCCGTGNONE 
J033044K06AGTGGGCCGTGNONE 
J033057B20AGATGGGCCGTGNONE 
J033057B20AGTGGGCCGTGNONE 
J033087A05AGATGGGCCGTGNONE 
J033087A05AGTGGGCCGTGNONE 
J043009C05AGATGGGCCGTGNONE 
J043009C05AGTGGGCCGTGNONE 
J090009E10AGATGGGCCGTGNONE 
J090009E10AGTGGGCCGTGNONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0495100AK108028CCTGGGCCGTGGConserved hypothetical protein. 
Os05g0524400AK063963CACGGCCCGCANONE 
AK072857CACGGCCCGCAPhosphofructokinase family protein. 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0548100AK060333CACGGCCCGGTConserved hypothetical protein. 
AK060333CGGGCCGTGCCGGCCCConserved hypothetical protein. 
AK060333CGTGTGGGGCCGTGConserved hypothetical protein. 
AK100682CACGGCCCGGTNONE 
AK100682CGGGCCGTGCCGGCCCNONE 
AK100682CGTGTGGGGCCGTGNONE 
J013151E01CACGGCCCGGTNONE 
J013151E01CGGGCCGTGCCGGCCCNONE 
J013151E01CGTGTGGGGCCGTGNONE 
J023113L22CACGGCCCGGTNONE 
J023113L22CGGGCCGTGCCGGCCCNONE 
J023113L22CGTGTGGGGCCGTGNONE 
J043027A19CACGGCCCGGTNONE 
J043027A19CGGGCCGTGCCGGCCCNONE 
J043027A19CGTGTGGGGCCGTGNONE 
J075093E06CACGGCCCGGTNONE 
J075093E06CGGGCCGTGCCGGCCCNONE 
J075093E06CGTGTGGGGCCGTGNONE 
J090060D15CACGGCCCGGTNONE 
J090060D15CGGGCCGTGCCGGCCCNONE 
J090060D15CGTGTGGGGCCGTGNONE 
J090082J03CACGGCCCGGTNONE 
J090082J03CGGGCCGTGCCGGCCCNONE 
J090082J03CGTGTGGGGCCGTGNONE 
J100050E01CACGGCCCGGTNONE 
J100050E01CGGGCCGTGCCGGCCCNONE 
J100050E01CGTGTGGGGCCGTGNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AY181210GGTGGGCCGTGNONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0577200AK069756TGATGGGCCGTGGCarboxylesterase, type B family protein. 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
AK120746CACGGCCCAATANONE 
Os06g0136000AK060303AACGGGCCGTGSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AACGGGCCGTGNONE 
J075185K19AACGGGCCGTGNONE 
J090028C16AACGGGCCGTGNONE 
J090099N12AACGGGCCGTGNONE 
J100070O10AACGGGCCGTGNONE 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0246500AK105105CCCGGGCCGTGSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0274500AK066417CACGGCCCCATCCCCCCGGCCCSimilar to SERK1 (Fragment). 
Os06g0308300AK059211CACGGCCCGNONE 
AK101549CACGGCCCGNONE 
AK102553CACGGCCCGSimilar to 65kD microtubule associated protein. 
J090014G18CACGGCCCGNONE 
J090082B01CACGGCCCGNONE 
Os06g0338900016-067-B02ACCGGGCCGTGNONE 
AK100837ACCGGGCCGTGNucleotidyl transferase domain containing protein. 
J013058L01ACCGGGCCGTGNONE 
J013135N01ACCGGGCCGTGNONE 
J023123E15ACCGGGCCGTGNONE 
J033051J01ACCGGGCCGTGNONE 
J090002O21ACCGGGCCGTGNONE 
J090013F06ACCGGGCCGTGNONE 
J090056F16ACCGGGCCGTGNONE 
J090081G13ACCGGGCCGTGNONE 
J090090P21ACCGGGCCGTGNONE 
J100039F05ACCGGGCCGTGNONE 
J100059J03ACCGGGCCGTGNONE 
Os06g0560400AK103575CACGGCCCNONE 
AK108074CACGGCCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0585200016-065-C02AACGGGCCGTGNONE 
016-065-C02AACGGGCCGTGNONE 
016-065-C02CACGGCCCGGCCNONE 
016-065-C02CACGGCCCGTTNONE 
016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592AACGGGCCGTGNONE 
AK068592AACGGGCCGTGNONE 
AK068592CACGGCCCGGCCNONE 
AK068592CACGGCCCGTTNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844AACGGGCCGTGNONE 
AK073844AACGGGCCGTGNONE 
AK073844CACGGCCCGGCCNONE 
AK073844CACGGCCCGTTNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549CACGGCCCGGCCConserved hypothetical protein. 
AK106549CACGGCCCGTTConserved hypothetical protein. 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14AACGGGCCGTGNONE 
J013154A14AACGGGCCGTGNONE 
J013154A14CACGGCCCGGCCNONE 
J013154A14CACGGCCCGTTNONE 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24AACGGGCCGTGNONE 
J100049K24AACGGGCCGTGNONE 
J100049K24CACGGCCCGGCCNONE 
J100049K24CACGGCCCGTTNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18AACGGGCCGTGNONE 
J100059C18AACGGGCCGTGNONE 
J100059C18CACGGCCCGGCCNONE 
J100059C18CACGGCCCGTTNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13AACGGGCCGTGNONE 
J100082N13AACGGGCCGTGNONE 
J100082N13CACGGCCCGGCCNONE 
J100082N13CACGGCCCGTTNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0590301J033139K16CACGGCCCGGTNONE 
J065011M13CACGGCCCGGTNONE 
J065027D20CACGGCCCGGTNONE 
J065039O05CACGGCCCGGTGlucose/ribitol dehydrogenase family protein. 
J065051O10CACGGCCCGGTNONE 
J065128I21CACGGCCCGGTNONE 
J065163P10CACGGCCCGGTNONE 
J065169H02CACGGCCCGGTNONE 
Os06g0647100009-005-F12CACGGCCCACCTNONE 
009-113-D11CACGGCCCACCTNONE 
009-132-D09CACGGCCCACCTNONE 
009-147-G06CACGGCCCACCTNONE 
AK066837CACGGCCCACCTSimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03CACGGCCCACCTNONE 
Os06g0656300006-034-G12CACGGCCCGGTNONE 
006-056-B10CACGGCCCGGTNONE 
006-089-A09CACGGCCCGGTNONE 
006-104-H10CACGGCCCGGTNONE 
006-108-G10CACGGCCCGGTNONE 
006-111-C10CACGGCCCGGTNONE 
006-113-G11CACGGCCCGGTNONE 
006-119-H10CACGGCCCGGTNONE 
009-033-E11CACGGCCCGGTNONE 
009-106-C06CACGGCCCGGTNONE 
009-160-F06CACGGCCCGGTNONE 
AK060123CACGGCCCGGTNONE 
AK060127CACGGCCCGGTProtein of unknown function DUF588 family protein. 
AK104184CACGGCCCGGTNONE 
J065042D07CACGGCCCGGTNONE 
J075029H23CACGGCCCGGTNONE 
J075151L06CACGGCCCGGTNONE 
J090027A16CACGGCCCGGTNONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os07g0105300AK107419CACGGCCCATAConserved hypothetical protein. 
AK107419CACGGCCCATTTConserved hypothetical protein. 
AK109521CACGGCCCATANONE 
AK109521CACGGCCCATTTNONE 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
J075120F11CACGGCCCAACANONE 
J075170L13CACGGCCCAACANONE 
J080302A21CACGGCCCAACANONE 
J080304J04CACGGCCCAACANONE 
J080308I12CACGGCCCAACANONE 
J080312F11CACGGCCCAACANONE 
J080315M22CACGGCCCAACANONE 
Os07g0158900AK064980CACGGCCCGTTCyclin-like F-box domain containing protein. 
AK064980GCCGGGCCGTGCyclin-like F-box domain containing protein. 
Os07g0160300AK065685TCTGGGCCGTGConserved hypothetical protein. 
J013020G13TCTGGGCCGTGNONE 
J013024B14TCTGGGCCGTGNONE 
J013040D10TCTGGGCCGTGNONE 
J043024N02TCTGGGCCGTGNONE 
J065063E19TCTGGGCCGTGNONE 
J065200G01TCTGGGCCGTGNONE 
J090098A05TCTGGGCCGTGNONE 
J100089M23TCTGGGCCGTGNONE 
Os07g0164500J013094M18GGCTGGGCCGTGNONE 
J013153L05GGCTGGGCCGTGNONE 
J023011J18GGCTGGGCCGTGNONE 
J023106H21GGCTGGGCCGTGNONE 
J033105F10GGCTGGGCCGTGNONE 
J065210M20GGCTGGGCCGTGSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05GGCTGGGCCGTGNONE 
J090061C13GGCTGGGCCGTGNONE 
J090074K15GGCTGGGCCGTGNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0213600AK107696CACGGCCCATTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CACGGCCCATTANONE 
J100082J05CACGGCCCATTANONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0301200AB110202AACGGGCCGTGNONE 
AB110202AGTGGGCCGTGNONE 
AB110202CACGGCCCGNONE 
AB110202CTTGGGCCGTGCTTGGGCCGTGGNONE 
AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AK073463AACGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463AGTGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463CACGGCCCGSimilar to RNA helicase (Fragment). 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
Os07g0408100AK108466GCCGGGCCGTGNONE 
AK111780GCCGGGCCGTGWD40-like domain containing protein. 
Os07g0496200AK064866CACGGCCCGGCCNONE 
AK065801CACGGCCCGGCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0531500J065122B10CACGGCCCHarpin-induced 1 domain containing protein. 
Os07g0555400AK070977CACGGCCCGConserved hypothetical protein. 
AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGGCCCACGCGNONE 
AK104756CACGGCCCACGCGNONE 
Os07g0598100AK068136CACGGCCCGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800CGCGTGCGCACGGCCCATGNONE 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0647800AK102332GGGCCGTGGConserved hypothetical protein. 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0694000006-033-G12GGGCCGTGNONE 
AK061472GGGCCGTGNONE 
Os07g0695400015-036-B08GGGCCGTGGNONE 
AK100615GGGCCGTGGNONE 
AK106304GGGCCGTGGKIP1-like domain containing protein. 
J023108B01GGGCCGTGGNONE 
Os08g0116500009-007-E05CACGGCCCACCNONE 
009-074-C07CACGGCCCACCNONE 
009-098-A07CACGGCCCACCNONE 
009-100-C03CACGGCCCACCNONE 
009-136-E04CACGGCCCACCNONE 
009-138-B08CACGGCCCACCNONE 
009-144-B06CACGGCCCACCNONE 
009-184-E04CACGGCCCACCNONE 
009-189-F01CACGGCCCACCNONE 
013-006-E05CACGGCCCACCNONE 
013-015-C10CACGGCCCACCNONE 
013-019-F09CACGGCCCACCNONE 
013-020-C01CACGGCCCACCNONE 
013-021-F05CACGGCCCACCNONE 
013-035-D08CACGGCCCACCNONE 
013-038-C09CACGGCCCACCNONE 
013-054-B07CACGGCCCACCNONE 
013-061-G10CACGGCCCACCNONE 
013-074-B01CACGGCCCACCNONE 
013-079-B06CACGGCCCACCNONE 
013-099-B09CACGGCCCACCNONE 
013-099-G11CACGGCCCACCNONE 
014-023-F04CACGGCCCACCNONE 
014-032-C07CACGGCCCACCNONE 
014-045-E02CACGGCCCACCNONE 
014-085-C02CACGGCCCACCNONE 
014-087-F04CACGGCCCACCNONE 
014-089-C04CACGGCCCACCNONE 
014-090-E01CACGGCCCACCNONE 
014-094-G11CACGGCCCACCNONE 
014-097-B07CACGGCCCACCNONE 
015-024-A12CACGGCCCACCNONE 
015-032-C06CACGGCCCACCNONE 
016-053-E09CACGGCCCACCNONE 
016-081-F10CACGGCCCACCNONE 
AK058240CACGGCCCACCSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09CACGGCCCACCNONE 
J023107O19CACGGCCCACCNONE 
J053029K21CACGGCCCACCNONE 
J053073P11CACGGCCCACCNONE 
J053074B04CACGGCCCACCNONE 
J053078M14CACGGCCCACCNONE 
J065001E12CACGGCCCACCNONE 
J065006J12CACGGCCCACCNONE 
J065015C06CACGGCCCACCNONE 
J065025D13CACGGCCCACCNONE 
J065029A04CACGGCCCACCNONE 
J065031D23CACGGCCCACCNONE 
J065032E24CACGGCCCACCNONE 
J065034P16CACGGCCCACCNONE 
J065043B04CACGGCCCACCNONE 
J065044A15CACGGCCCACCNONE 
J065062D18CACGGCCCACCNONE 
J065079G13CACGGCCCACCNONE 
J065080A19CACGGCCCACCNONE 
J065080A20CACGGCCCACCNONE 
J065089N19CACGGCCCACCNONE 
J065111O07CACGGCCCACCNONE 
J065115N15CACGGCCCACCNONE 
J065131A04CACGGCCCACCNONE 
J065138H02CACGGCCCACCNONE 
J065139K10CACGGCCCACCNONE 
J065144A02CACGGCCCACCNONE 
J065155J17CACGGCCCACCNONE 
J065159D18CACGGCCCACCNONE 
J065159I18CACGGCCCACCNONE 
J065167H12CACGGCCCACCNONE 
J065174C22CACGGCCCACCNONE 
J065184A05CACGGCCCACCNONE 
J065188M15CACGGCCCACCNONE 
J065191D23CACGGCCCACCNONE 
J065203C07CACGGCCCACCNONE 
J065207C23CACGGCCCACCNONE 
J065207L16CACGGCCCACCNONE 
J065212F01CACGGCCCACCNONE 
J065212F05CACGGCCCACCNONE 
J075037B07CACGGCCCACCNONE 
J075042F15CACGGCCCACCNONE 
J075059J03CACGGCCCACCNONE 
J075068M18CACGGCCCACCNONE 
J075079E13CACGGCCCACCNONE 
J075081F12CACGGCCCACCNONE 
J075083I05CACGGCCCACCNONE 
J075123K23CACGGCCCACCNONE 
J075142F16CACGGCCCACCNONE 
J075156N03CACGGCCCACCNONE 
J075162K05CACGGCCCACCNONE 
J075171E08CACGGCCCACCNONE 
J075177N03CACGGCCCACCNONE 
J075182K17CACGGCCCACCNONE 
J075186K02CACGGCCCACCNONE 
J075191K05CACGGCCCACCNONE 
J080011E10CACGGCCCACCNONE 
J080016M21CACGGCCCACCNONE 
J080017A17CACGGCCCACCNONE 
J080031O09CACGGCCCACCNONE 
J080039G21CACGGCCCACCNONE 
J080041B01CACGGCCCACCNONE 
J080050G20CACGGCCCACCNONE 
J080054A12CACGGCCCACCNONE 
J080058O08CACGGCCCACCNONE 
J080061N04CACGGCCCACCNONE 
J080064L23CACGGCCCACCNONE 
J080064P05CACGGCCCACCNONE 
J080069I17CACGGCCCACCNONE 
J080070E07CACGGCCCACCNONE 
J080071B20CACGGCCCACCNONE 
J080074L08CACGGCCCACCNONE 
J080076N08CACGGCCCACCNONE 
J080081A14CACGGCCCACCNONE 
J080081J17CACGGCCCACCNONE 
J080085N14CACGGCCCACCNONE 
J080090B09CACGGCCCACCNONE 
J080097L11CACGGCCCACCNONE 
J080306H13CACGGCCCACCNONE 
J080307H13CACGGCCCACCNONE 
J080311F12CACGGCCCACCNONE 
J080316L23CACGGCCCACCNONE 
J080318H02CACGGCCCACCNONE 
J090016L15CACGGCCCACCNONE 
J090019I02CACGGCCCACCNONE 
J090031G21CACGGCCCACCNONE 
J090066C15CACGGCCCACCNONE 
J100032I02CACGGCCCACCNONE 
J100032N07CACGGCCCACCNONE 
J100032N16CACGGCCCACCNONE 
J100041P21CACGGCCCACCNONE 
J100048M04CACGGCCCACCNONE 
J100048M14CACGGCCCACCNONE 
J100063B08CACGGCCCACCNONE 
J100088E20CACGGCCCACCNONE 
J100090I08CACGGCCCACCNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0191900AK067587CTTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK099016CTTGGGCCGTGNONE 
J013032I08CTTGGGCCGTGNONE 
J013050I24CTTGGGCCGTGNONE 
J013128E05CTTGGGCCGTGNONE 
Os08g0195400006-057-E04CACGGCCCGGTNONE 
006-057-E04CCTGGGCCGTGNONE 
006-057-E04CGGGCCGTGNONE 
006-057-E04GGGCCGGCCCGGCACGGCCCGNONE 
006-060-B10CACGGCCCGGTNONE 
006-060-B10CCTGGGCCGTGNONE 
006-060-B10CGGGCCGTGNONE 
006-060-B10GGGCCGGCCCGGCACGGCCCGNONE 
AK070464CACGGCCCGGTConserved hypothetical protein. 
AK070464CCTGGGCCGTGConserved hypothetical protein. 
AK070464CGGGCCGTGConserved hypothetical protein. 
AK070464GGGCCGGCCCGGCACGGCCCGConserved hypothetical protein. 
AK104389CACGGCCCGGTNONE 
AK104389CCTGGGCCGTGNONE 
AK104389CGGGCCGTGNONE 
AK104389GGGCCGGCCCGGCACGGCCCGNONE 
AK106140CACGGCCCGGTNONE 
AK106140CCTGGGCCGTGNONE 
AK106140CGGGCCGTGNONE 
AK106140GGGCCGGCCCGGCACGGCCCGNONE 
J023013G08CACGGCCCGGTNONE 
J023013G08CCTGGGCCGTGNONE 
J023013G08CGGGCCGTGNONE 
J023013G08GGGCCGGCCCGGCACGGCCCGNONE 
J023054K19CACGGCCCGGTNONE 
J023054K19CCTGGGCCGTGNONE 
J023054K19CGGGCCGTGNONE 
J023054K19GGGCCGGCCCGGCACGGCCCGNONE 
J023089D18CACGGCCCGGTNONE 
J023089D18CCTGGGCCGTGNONE 
J023089D18CGGGCCGTGNONE 
J023089D18GGGCCGGCCCGGCACGGCCCGNONE 
J023092K05CACGGCCCGGTNONE 
J023092K05CCTGGGCCGTGNONE 
J023092K05CGGGCCGTGNONE 
J023092K05GGGCCGGCCCGGCACGGCCCGNONE 
J033025A08CACGGCCCGGTNONE 
J033025A08CCTGGGCCGTGNONE 
J033025A08CGGGCCGTGNONE 
J033025A08GGGCCGGCCCGGCACGGCCCGNONE 
J033067P12CACGGCCCGGTNONE 
J033067P12CCTGGGCCGTGNONE 
J033067P12CGGGCCGTGNONE 
J033067P12GGGCCGGCCCGGCACGGCCCGNONE 
J033098A10CACGGCCCGGTNONE 
J033098A10CCTGGGCCGTGNONE 
J033098A10CGGGCCGTGNONE 
J033098A10GGGCCGGCCCGGCACGGCCCGNONE 
J065219L04CACGGCCCGGTNONE 
J065219L04CCTGGGCCGTGNONE 
J065219L04CGGGCCGTGNONE 
J065219L04GGGCCGGCCCGGCACGGCCCGNONE 
J090021P06CACGGCCCGGTNONE 
J090021P06CCTGGGCCGTGNONE 
J090021P06CGGGCCGTGNONE 
J090021P06GGGCCGGCCCGGCACGGCCCGNONE 
J090062M05CACGGCCCGGTNONE 
J090062M05CCTGGGCCGTGNONE 
J090062M05CGGGCCGTGNONE 
J090062M05GGGCCGGCCCGGCACGGCCCGNONE 
J090079F15CACGGCCCGGTNONE 
J090079F15CCTGGGCCGTGNONE 
J090079F15CGGGCCGTGNONE 
J090079F15GGGCCGGCCCGGCACGGCCCGNONE 
J100041H19CACGGCCCGGTNONE 
J100041H19CCTGGGCCGTGNONE 
J100041H19CGGGCCGTGNONE 
J100041H19GGGCCGGCCCGGCACGGCCCGNONE 
Os08g0224200AK101331CGGGCCGTGCCGGCCCSimilar to Ythdf2-prov protein. 
AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0243600AB110183CACGGCCCAAAANONE 
AK101443CACGGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0243900011-052-H03GTTTGGGCCGTGNONE 
AK102707GTTTGGGCCGTGNONE 
AK121452GTTTGGGCCGTGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20GTTTGGGCCGTGNONE 
J065168E04GTTTGGGCCGTGNONE 
Os08g0328300AK102227CACGGCCCGTTNONE 
AK102227CGGGCCGTGNONE 
AK102227GCCGGGCCGTGNONE 
AK105392CACGGCCCGTTENT domain containing protein. 
AK105392CGGGCCGTGENT domain containing protein. 
AK105392GCCGGGCCGTGENT domain containing protein. 
Os08g0414600AK101578GGTTGGGCCGTGSoluble quinoprotein glucose dehydrogenase domain containing protein. 
AK101579GGTTGGGCCGTGNONE 
Os08g0440500AK058761CCACGGCCCATTAMIR domain containing protein. 
Os08g0465300AK108076CACGGCCCACAConserved hypothetical protein. 
Os08g0465800AY428025CACGGCCCAGCCNONE 
J013029M24CACGGCCCAGCCNONE 
J013030K15CACGGCCCAGCCNONE 
J013048G12CACGGCCCAGCCNONE 
J023041H10CACGGCCCAGCCNONE 
J023065G12CACGGCCCAGCCNONE 
J023074A02CACGGCCCAGCCNONE 
J023092B20CACGGCCCAGCCNONE 
J023147A01CACGGCCCAGCCNONE 
J023150L07CACGGCCCAGCCNONE 
J043007P21CACGGCCCAGCCNONE 
J090004P19CACGGCCCAGCCNONE 
J100030K13CACGGCCCAGCCNONE 
J100060N03CACGGCCCAGCCNONE 
Os08g0486200012-094-G01CACGGCCCAACCNONE 
015-022-G01CACGGCCCAACCNONE 
AK064030CACGGCCCAACCSimilar to Splicing factor SC35. 
AK103676CACGGCCCAACCNONE 
J023034B03CACGGCCCAACCNONE 
J033126D21CACGGCCCAACCNONE 
J033136B19CACGGCCCAACCNONE 
J043004H03CACGGCCCAACCNONE 
J080009E16CACGGCCCAACCNONE 
J080020G22CACGGCCCAACCNONE 
J080029L21CACGGCCCAACCNONE 
J080033M18CACGGCCCAACCNONE 
J080043H20CACGGCCCAACCNONE 
J080046N23CACGGCCCAACCNONE 
J080055K10CACGGCCCAACCNONE 
J080059P19CACGGCCCAACCNONE 
J080060G22CACGGCCCAACCNONE 
J080064L15CACGGCCCAACCNONE 
J080065D19CACGGCCCAACCNONE 
J080065J06CACGGCCCAACCNONE 
J080074L14CACGGCCCAACCNONE 
J080076H14CACGGCCCAACCNONE 
J080079A08CACGGCCCAACCNONE 
J080092D09CACGGCCCAACCNONE 
J080093D19CACGGCCCAACCNONE 
J080093F01CACGGCCCAACCNONE 
J080095L16CACGGCCCAACCNONE 
J090073P10CACGGCCCAACCNONE 
Os08g0527400AK119389CACGGCCCAACTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0547000AK120698CCACGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0550100AB070258CACGGCCCNONE 
AK061287CACGGCCCSimilar to 26S proteasome subunit RPN3a. 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0557400006-024-C02CCACGGCCCATATNONE 
AK060067CCACGGCCCATATProtein tyrosine phosphatase-like protein. 
AY224424CCACGGCCCATATNONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0115400AK067816GGACACGTGCACGGCCCATGTNONE 
AK101706GGACACGTGCACGGCCCATGTSimilar to Poly(A)-binding protein. 
Os09g0332700AK067899CACGGCCCACGTSimilar to PDR-type ABC transporter 2 (Fragment). 
Os09g0338400AK059171CCACGGCCCAACANONE 
AK068798CCACGGCCCAACANONE 
AK072043CCACGGCCCAACANONE 
AK098947CCACGGCCCAACASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0424600AK073882TCCGGGCCGTGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0472900009-179-B12CACGGCCCGNONE 
AK063132CACGGCCCGSimilar to Blight-associated protein p12 precursor. 
J065022E01CACGGCCCGNONE 
J065034L01CACGGCCCGNONE 
J065073P13CACGGCCCGNONE 
J065079I12CACGGCCCGNONE 
J065144L22CACGGCCCGNONE 
J065180K05CACGGCCCGNONE 
J100063O18CACGGCCCGNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0516600AK070780AGGTGGGCCCCACGGCCCGNONE 
AK103563AGGTGGGCCCCACGGCCCGNONE 
AY054407AGGTGGGCCCCACGGCCCGGlyoxalase II. 
J013058P06AGGTGGGCCCCACGGCCCGNONE 
J013093G04AGGTGGGCCCCACGGCCCGNONE 
J023007G05AGGTGGGCCCCACGGCCCGNONE 
J023091A08AGGTGGGCCCCACGGCCCGNONE 
J023136K23AGGTGGGCCCCACGGCCCGNONE 
J023138D20AGGTGGGCCCCACGGCCCGNONE 
J033022N20AGGTGGGCCCCACGGCCCGNONE 
J033065N15AGGTGGGCCCCACGGCCCGNONE 
J033109L23AGGTGGGCCCCACGGCCCGNONE 
J053073C08AGGTGGGCCCCACGGCCCGNONE 
J075094J24AGGTGGGCCCCACGGCCCGNONE 
J075106P21AGGTGGGCCCCACGGCCCGNONE 
Os09g0535000AK058712CCACGGCCCSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CCACGGCCCNONE 
AK069832CCACGGCCCNONE 
J100065D20CCACGGCCCNONE 
Os09g0549700J053039F06CCACGGCCCAAATNONE 
J065089F23CCACGGCCCAAATRibosomal protein L18P/L5E family protein. 
J065090G14CCACGGCCCAAATNONE 
J065093M17CCACGGCCCAAATNONE 
J065096L23CCACGGCCCAAATNONE 
J065152A18CCACGGCCCAAATNONE 
J065155H12CCACGGCCCAAATNONE 
Os09g0559900AK111842CACGGCCCCACGCGProtein kinase-like domain containing protein. 
AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os09g0573200J013027J02AGTGGGCCGTGGNONE 
J013034M08AGTGGGCCGTGGNONE 
J013037L03AGTGGGCCGTGGNONE 
J013041D10AGTGGGCCGTGGNONE 
J013042D15AGTGGGCCGTGGNONE 
J013109H17AGTGGGCCGTGGNONE 
J013132A18AGTGGGCCGTGGNONE 
J013160N13AGTGGGCCGTGGNONE 
J013169I09AGTGGGCCGTGGNONE 
J023029F18AGTGGGCCGTGGNONE 
J023041A02AGTGGGCCGTGGNONE 
J023097B14AGTGGGCCGTGGNONE 
J023142I04AGTGGGCCGTGGNONE 
J023142N06AGTGGGCCGTGGNONE 
J033023I21AGTGGGCCGTGGNONE 
J033032G15AGTGGGCCGTGGNONE 
J033042M17AGTGGGCCGTGGNONE 
J033070F09AGTGGGCCGTGGNONE 
J053063L09AGTGGGCCGTGGNONE 
J053064A09AGTGGGCCGTGGNONE 
J065073M19AGTGGGCCGTGGNONE 
J075005H11AGTGGGCCGTGGNONE 
J075026D12AGTGGGCCGTGGNONE 
J075043G07AGTGGGCCGTGGNONE 
J075084N05AGTGGGCCGTGGNONE 
J075092D05AGTGGGCCGTGGNONE 
J075110E24AGTGGGCCGTGGNONE 
J075176I05AGTGGGCCGTGGNONE 
J090009H19AGTGGGCCGTGGNONE 
J090025K11AGTGGGCCGTGGNONE 
J090049E20AGTGGGCCGTGGNONE 
J090070G02AGTGGGCCGTGGNONE 
Os11g0114700AK065865AGTGGGCCGTGGNONE 
AK066583AGTGGGCCGTGGNONE 
AK070834AGTGGGCCGTGGPAP/25A core domain containing protein. 
AK072543AGTGGGCCGTGGNONE 
Os11g0146700AK065900GTATGGGCCGTGNONE 
AK072412GTATGGGCCGTGRED-like, C-terminal family protein. 
Os11g0209700012-068-H08CCACGGCCCCCACCACNONE 
015-016-B07CCACGGCCCCCACCACNONE 
AK068331CCACGGCCCCCACCACNONE 
Os11g0219400AK069850CACGGCCCGGTAnkyrin repeat containing protein. 
AK069850GGCCGGGCTTGGGCCGTGAnkyrin repeat containing protein. 
AK069850TATTGGGCCGTGCCTGGGCCGTGAnkyrin repeat containing protein. 
AK099123CACGGCCCGGTNONE 
AK099123GGCCGGGCTTGGGCCGTGNONE 
AK099123TATTGGGCCGTGCCTGGGCCGTGNONE 
J023143G18CACGGCCCGGTNONE 
J023143G18GGCCGGGCTTGGGCCGTGNONE 
J023143G18TATTGGGCCGTGCCTGGGCCGTGNONE 
Os11g0247300AK105080GGGCCGTGNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0479300AK099761CCACGGCCCCACCRabGAP/TBC domain containing protein. 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0593100AK070035TATGGGCCGTGProtein of unknown function DUF295 family protein. 
J023038E14TATGGGCCGTGNONE 
J100062C21TATGGGCCGTGNONE 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0657200AK059959CACGGCCCAGC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GCTGGGCCGTGNONE 
AK062752GCTGGGCCGTGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0660000AK066709CACGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
AK066709CGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
AK066709CGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
AK066709GCCGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CACGGCCCGTTNONE 
J013074O18CGGGCCGTGNONE 
J013074O18CGGGCCGTGNONE 
J013074O18GCCGGGCCGTGNONE 
J023081H12CACGGCCCGTTNONE 
J023081H12CGGGCCGTGNONE 
J023081H12CGGGCCGTGNONE 
J023081H12GCCGGGCCGTGNONE 
J065072E24CACGGCCCGTTNONE 
J065072E24CGGGCCGTGNONE 
J065072E24CGGGCCGTGNONE 
J065072E24GCCGGGCCGTGNONE 
J065186K08CACGGCCCGTTNONE 
J065186K08CGGGCCGTGNONE 
J065186K08CGGGCCGTGNONE 
J065186K08GCCGGGCCGTGNONE 
J075079E19CACGGCCCGTTNONE 
J075079E19CGGGCCGTGNONE 
J075079E19CGGGCCGTGNONE 
J075079E19GCCGGGCCGTGNONE 
J075093J05CACGGCCCGTTNONE 
J075093J05CGGGCCGTGNONE 
J075093J05CGGGCCGTGNONE 
J075093J05GCCGGGCCGTGNONE 
J075124I21CACGGCCCGTTNONE 
J075124I21CGGGCCGTGNONE 
J075124I21CGGGCCGTGNONE 
J075124I21GCCGGGCCGTGNONE 
J075187F09CACGGCCCGTTNONE 
J075187F09CGGGCCGTGNONE 
J075187F09CGGGCCGTGNONE 
J075187F09GCCGGGCCGTGNONE 
J090037O16CACGGCCCGTTNONE 
J090037O16CGGGCCGTGNONE 
J090037O16CGGGCCGTGNONE 
J090037O16GCCGGGCCGTGNONE 
Os12g0124400AK071024CACGGCCCATGAExostosin-like family protein. 
Os12g0145700AK071391CACGGCCCGPyruvate kinase family protein. 
J023013N02CACGGCCCGNONE 
J033085D15CACGGCCCGNONE 
J043021I09CACGGCCCGNONE 
J100055L05CACGGCCCGNONE 
Os12g0156400012-065-D02GCTGGGCCGTGNONE 
AK072086GCTGGGCCGTGNONE 
AK099278GCTGGGCCGTGDcp1-like decapping family protein. 
J013063H09GCTGGGCCGTGNONE 
J023125D09GCTGGGCCGTGNONE 
J023149G21GCTGGGCCGTGNONE 
J033064E07GCTGGGCCGTGNONE 
J033093C07GCTGGGCCGTGNONE 
J033107E06GCTGGGCCGTGNONE 
J075172A11GCTGGGCCGTGNONE 
J090009E07GCTGGGCCGTGNONE 
J090023F13GCTGGGCCGTGNONE 
J090071N18GCTGGGCCGTGNONE 
Os12g0244500AK102026ACTGGGCCGTGGConserved hypothetical protein. 
J023014D06ACTGGGCCGTGGNONE 
J023060C12ACTGGGCCGTGGNONE 
J033080M18ACTGGGCCGTGGNONE 
J090017I22ACTGGGCCGTGGNONE 
J090023D21ACTGGGCCGTGGNONE 
J090036J05ACTGGGCCGTGGNONE 
J090053M19ACTGGGCCGTGGNONE 
Os12g0278900AK106816CACGGCCCACAPeptidase C1A, papain family protein. 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0498800AK067767CACGGCCCAACCConserved hypothetical protein. 
J065073G03CACGGCCCAACCNONE 
J065102I05CACGGCCCAACCNONE 
Os12g0557800AK121691AAATGGGCCGGTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK121691AACGGGCCGTGProtein prenyltransferase domain containing protein. 
AK121691CACGGCCCAProtein prenyltransferase domain containing protein. 
AK121691CACGGCCCACAProtein prenyltransferase domain containing protein. 
AK121691CCTGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AAATGGGCCGGTGGGCCGTGNONE 
J013095M03AACGGGCCGTGNONE 
J013095M03CACGGCCCANONE 
J013095M03CACGGCCCACANONE 
J013095M03CCTGGGCCGTGNONE 
J033071H11AAATGGGCCGGTGGGCCGTGNONE 
J033071H11AACGGGCCGTGNONE 
J033071H11CACGGCCCANONE 
J033071H11CACGGCCCACANONE 
J033071H11CCTGGGCCGTGNONE 
J065101B02AAATGGGCCGGTGGGCCGTGNONE 
J065101B02AACGGGCCGTGNONE 
J065101B02CACGGCCCANONE 
J065101B02CACGGCCCACANONE 
J065101B02CCTGGGCCGTGNONE 
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein. 
AK069292AACGGCCCACGGCCCACGTNONE 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.