version

Summary of OsREG505 (All List)

OrganismOryza sativa  
IDOsREG505  
SequenceCACGTCAC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count1644  

Entry Sequences (1644 entries)

LocusGene modelSequenceDescription
Os01g0140100AK068990GTGACGTGPeptidase A1, pepsin family protein. 
J065163I12GTGACGTGNONE 
J075003M22GTGACGTGNONE 
Os01g0164700013-037-D07CACGTCACNONE 
AK066699CACGTCACProtein of unknown function DUF410 family protein. 
J013073F20CACGTCACNONE 
J033091F23CACGTCACNONE 
J065056C14CACGTCACNONE 
Os01g0186900013-032-B12CACGTCACCNONE 
013-069-C11CACGTCACCNONE 
AK105323CACGTCACCNONE 
AK105331CACGTCACCConserved hypothetical protein. 
AK106168CACGTCACCNONE 
J065023I10CACGTCACCNONE 
J065182I03CACGTCACCNONE 
J075116O22CACGTCACCNONE 
J090082G13CACGTCACCNONE 
J100060H12CACGTCACCNONE 
Os01g0188400AK072842CACGTCACNONE 
AK121770CACGTCACNONE 
D16499CACGTCACNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23CACGTCACNONE 
J100060J17CACGTCACNONE 
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein. 
Os01g0222700012-011-E01GAGACGTGACGTGNONE 
AK068883GAGACGTGACGTGNONE 
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGACGTGACGTGNONE 
J043013D08GAGACGTGACGTGNONE 
J065089G19GAGACGTGACGTGNONE 
J065197K19GAGACGTGACGTGNONE 
J075161L21GAGACGTGACGTGNONE 
Os01g0257100J100030B03CGCCACGTCACCNONE 
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein. 
Os01g0281100AK109672GTGACGTGTGGCGTGConserved hypothetical protein. 
J065013K07GTGACGTGTGGCGTGNONE 
J065040E15GTGACGTGTGGCGTGNONE 
J065127F12GTGACGTGTGGCGTGNONE 
J075155K23GTGACGTGTGGCGTGNONE 
Os01g0564400J013160K14GCCACGTCACNONE 
J065063D15GCCACGTCACNONE 
J065162D09GCCACGTCACNONE 
J075006C23GCCACGTCACNONE 
J075112F15GCCACGTCACNONE 
Os01g0607000009-020-G09CACGTCACNONE 
AK105136CACGTCACGlutelin family protein. 
Os01g0612600004-008-D07CACGTCACNONE 
004-008-D07CACGTCACNONE 
009-057-C09CACGTCACNONE 
009-057-C09CACGTCACNONE 
009-130-C01CACGTCACNONE 
009-130-C01CACGTCACNONE 
AK062906CACGTCACNONE 
AK062906CACGTCACNONE 
AK066561CACGTCACProtein of unknown function DUF1644 family protein. 
AK066561CACGTCACProtein of unknown function DUF1644 family protein. 
J013065E14CACGTCACNONE 
J013065E14CACGTCACNONE 
J013073D14CACGTCACNONE 
J013073D14CACGTCACNONE 
J023014A21CACGTCACNONE 
J023014A21CACGTCACNONE 
J023073M13CACGTCACNONE 
J023073M13CACGTCACNONE 
J023079F02CACGTCACNONE 
J023079F02CACGTCACNONE 
J023083B16CACGTCACNONE 
J023083B16CACGTCACNONE 
J023090G19CACGTCACNONE 
J023090G19CACGTCACNONE 
J023095F15CACGTCACNONE 
J023095F15CACGTCACNONE 
J023119H11CACGTCACNONE 
J023119H11CACGTCACNONE 
J033040B01CACGTCACNONE 
J033040B01CACGTCACNONE 
J033044F13CACGTCACNONE 
J033044F13CACGTCACNONE 
J033081E23CACGTCACNONE 
J033081E23CACGTCACNONE 
J033121K07CACGTCACNONE 
J033121K07CACGTCACNONE 
J033124D11CACGTCACNONE 
J033124D11CACGTCACNONE 
J033131N22CACGTCACNONE 
J033131N22CACGTCACNONE 
J065179E10CACGTCACNONE 
J065179E10CACGTCACNONE 
J090020A13CACGTCACNONE 
J090020A13CACGTCACNONE 
J090045K17CACGTCACNONE 
J090045K17CACGTCACNONE 
J090047M24CACGTCACNONE 
J090047M24CACGTCACNONE 
J090064G23CACGTCACNONE 
J090064G23CACGTCACNONE 
J090084G08CACGTCACNONE 
J090084G08CACGTCACNONE 
J090086F18CACGTCACNONE 
J090086F18CACGTCACNONE 
J100032D09CACGTCACNONE 
J100032D09CACGTCACNONE 
J100037O18CACGTCACNONE 
J100037O18CACGTCACNONE 
J100042B03CACGTCACNONE 
J100042B03CACGTCACNONE 
J100061D06CACGTCACNONE 
J100061D06CACGTCACNONE 
J100061I03CACGTCACNONE 
J100061I03CACGTCACNONE 
J100063B17CACGTCACNONE 
J100063B17CACGTCACNONE 
Os01g0639600005-018-A02GTGACGTGNONE 
AK067056GTGACGTGProtein of unknown function DUF1645 family protein. 
J013066M03GTGACGTGNONE 
J013066O05GTGACGTGNONE 
J013088M21GTGACGTGNONE 
J065045F04GTGACGTGNONE 
J080018F22GTGACGTGNONE 
J080037B10GTGACGTGNONE 
J080042G23GTGACGTGNONE 
J080052B21GTGACGTGNONE 
J080060H13GTGACGTGNONE 
J100024A05GTGACGTGNONE 
J100071A09GTGACGTGNONE 
J100080K14GTGACGTGNONE 
Os01g0733200AK066316CACGTCACSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493CACGTCACNONE 
J013066G03CACGTCACNONE 
J090034J08CACGTCACNONE 
Os01g0803200006-057-A07GTGACGTGNONE 
009-028-E02GTGACGTGNONE 
AF435976GTGACGTGNONE 
AK061770GTGACGTGCysteine proteinase inhibitor-I (Oryzacystatin-I). 
AK072206GTGACGTGNONE 
AK121632GTGACGTGNONE 
D29717GTGACGTGNONE 
J013088C04GTGACGTGNONE 
J023110F17GTGACGTGNONE 
J033029J21GTGACGTGNONE 
J033050G08GTGACGTGNONE 
J033121L08GTGACGTGNONE 
J03469GTGACGTGNONE 
J043040J18GTGACGTGNONE 
J065009B11GTGACGTGNONE 
J065037D05GTGACGTGNONE 
J065046C08GTGACGTGNONE 
J065051M08GTGACGTGNONE 
J065059H24GTGACGTGNONE 
J065060A10GTGACGTGNONE 
J065066O10GTGACGTGNONE 
J065075N07GTGACGTGNONE 
J065088G17GTGACGTGNONE 
J065101N07GTGACGTGNONE 
J065111I03GTGACGTGNONE 
J065122A02GTGACGTGNONE 
J065128L10GTGACGTGNONE 
J065134A09GTGACGTGNONE 
J065162H09GTGACGTGNONE 
J065178F05GTGACGTGNONE 
J065209J08GTGACGTGNONE 
J065217F08GTGACGTGNONE 
J075023A10GTGACGTGNONE 
J075023H20GTGACGTGNONE 
J075048H09GTGACGTGNONE 
J075062K16GTGACGTGNONE 
J075074F03GTGACGTGNONE 
J075080G02GTGACGTGNONE 
J075125J09GTGACGTGNONE 
J075125L15GTGACGTGNONE 
J075152L15GTGACGTGNONE 
J075173B03GTGACGTGNONE 
J075177M22GTGACGTGNONE 
J080001B16GTGACGTGNONE 
J080005K01GTGACGTGNONE 
J080005L08GTGACGTGNONE 
J080005N22GTGACGTGNONE 
J080007B02GTGACGTGNONE 
J080008E24GTGACGTGNONE 
J080008L18GTGACGTGNONE 
J080009H13GTGACGTGNONE 
J080010E21GTGACGTGNONE 
J080011D21GTGACGTGNONE 
J080011P22GTGACGTGNONE 
J080013A16GTGACGTGNONE 
J080016M01GTGACGTGNONE 
J080017A09GTGACGTGNONE 
J080020A09GTGACGTGNONE 
J080023B21GTGACGTGNONE 
J080023L04GTGACGTGNONE 
J080023M10GTGACGTGNONE 
J080028B02GTGACGTGNONE 
J080031E01GTGACGTGNONE 
J080036N13GTGACGTGNONE 
J080036N17GTGACGTGNONE 
J080037M05GTGACGTGNONE 
J080043K21GTGACGTGNONE 
J080043M11GTGACGTGNONE 
J080044I08GTGACGTGNONE 
J080044N16GTGACGTGNONE 
J080049L02GTGACGTGNONE 
J080050H04GTGACGTGNONE 
J080054G17GTGACGTGNONE 
J080054G21GTGACGTGNONE 
J080057A13GTGACGTGNONE 
J080057G02GTGACGTGNONE 
J080057G23GTGACGTGNONE 
J080061A19GTGACGTGNONE 
J080062A13GTGACGTGNONE 
J080062J22GTGACGTGNONE 
J080063G15GTGACGTGNONE 
J080066A18GTGACGTGNONE 
J080066E03GTGACGTGNONE 
J080067E10GTGACGTGNONE 
J080069L14GTGACGTGNONE 
J080071I09GTGACGTGNONE 
J080076E22GTGACGTGNONE 
J080078L03GTGACGTGNONE 
J080078L15GTGACGTGNONE 
J080081G17GTGACGTGNONE 
J080083C20GTGACGTGNONE 
J080083J03GTGACGTGNONE 
J080086C02GTGACGTGNONE 
J080088E16GTGACGTGNONE 
J080090A03GTGACGTGNONE 
J080090C14GTGACGTGNONE 
J080090F11GTGACGTGNONE 
J080093N06GTGACGTGNONE 
J080094B22GTGACGTGNONE 
J080094C11GTGACGTGNONE 
J080096E22GTGACGTGNONE 
J080096F18GTGACGTGNONE 
J080301K11GTGACGTGNONE 
J080302C22GTGACGTGNONE 
J080304K12GTGACGTGNONE 
J080317G06GTGACGTGNONE 
J080318L23GTGACGTGNONE 
J090047A06GTGACGTGNONE 
J100025M24GTGACGTGNONE 
J100026O09GTGACGTGNONE 
J100027D03GTGACGTGNONE 
J100028C19GTGACGTGNONE 
J100028D07GTGACGTGNONE 
J100031H13GTGACGTGNONE 
J100053M24GTGACGTGNONE 
J100054J03GTGACGTGNONE 
J100055D24GTGACGTGNONE 
J100059L24GTGACGTGNONE 
J100062D23GTGACGTGNONE 
J100062F02GTGACGTGNONE 
J100063G22GTGACGTGNONE 
J100064A04GTGACGTGNONE 
J100064P17GTGACGTGNONE 
J100065F17GTGACGTGNONE 
J100072F05GTGACGTGNONE 
J100077D21GTGACGTGNONE 
J100081B17GTGACGTGNONE 
J100087G09GTGACGTGNONE 
J100089C12GTGACGTGNONE 
J100090G01GTGACGTGNONE 
U54702GTGACGTGNONE 
Os01g0818300AK063274GTGACGTGKH domain containing protein. 
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment). 
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein. 
J065207M23CACGTCACCNONE 
Os01g0846300AK065949CACGTCACSimilar to Protein phosphatase 2C. 
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein. 
Os01g0865100016-066-A05GGACACGTCACNONE 
AK065779GGACACGTCACNONE 
AK071410GGACACGTCACSimilar to Uricase (Fragment). 
J013039E23GGACACGTCACNONE 
J023024I07GGACACGTCACNONE 
J065160J15GGACACGTCACNONE 
J090052J17GGACACGTCACNONE 
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment). 
AF378183CACGTCACCNONE 
AK070516CACGTCACCNONE 
AK119536CACGTCACCNONE 
J023057C24CACGTCACCNONE 
J023078G07CACGTCACCNONE 
J065015D23CACGTCACCNONE 
J065050J17CACGTCACCNONE 
J065058B03CACGTCACCNONE 
J065119C16CACGTCACCNONE 
J065134N01CACGTCACCNONE 
J065174B10CACGTCACCNONE 
J075046D04CACGTCACCNONE 
J075172N05CACGTCACCNONE 
Os01g0900800009-086-C08CACGTCACCNONE 
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713CACGTCACCNONE 
J053025O10CACGTCACCNONE 
J065063K24CACGTCACCNONE 
J065167N21CACGTCACCNONE 
J100060A20CACGTCACCNONE 
J100079J03CACGTCACCNONE 
J100087D11CACGTCACCNONE 
J100089K10CACGTCACCNONE 
Os01g0913300AK100698GTGACGTGTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07GTGACGTGNONE 
J023102B09GTGACGTGNONE 
J023102N03GTGACGTGNONE 
J023114K11GTGACGTGNONE 
J023140A21GTGACGTGNONE 
J043017F23GTGACGTGNONE 
J075058O15GTGACGTGNONE 
Os01g0914300009-174-C06CACGTCACNONE 
014-073-B09CACGTCACNONE 
AK103489CACGTCACNONE 
AK105463CACGTCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J033076A02CACGTCACNONE 
J033130M24CACGTCACNONE 
Os01g0922100AK110737GTGACGTGConserved hypothetical protein. 
Os01g0954100009-087-G12GTGACGTGNONE 
AK062680GTGACGTGConserved hypothetical protein. 
Os02g0127900AK102783GGTGACGTGGCHypothetical protein. 
J065042F15GGTGACGTGGCNONE 
J075005J10GGTGACGTGGCNONE 
J075038F02GGTGACGTGGCNONE 
J075048K10GGTGACGTGGCNONE 
J075064D21GGTGACGTGGCNONE 
J075074M07GGTGACGTGGCNONE 
J075078D20GGTGACGTGGCNONE 
J075109P15GGTGACGTGGCNONE 
J075115K24GGTGACGTGGCNONE 
J075135G01GGTGACGTGGCNONE 
J075156B07GGTGACGTGGCNONE 
Os02g0148100AF216317CACGTCACNONE 
AF241166CACGTCACNONE 
AK119650CACGTCACMAP kinase MAPK2 (MAP kinase 3). 
Os02g0160000AK062904CACGTCACSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140 of Kluyveromyces lactis. 
Os02g0227200009-123-E01GTGACGTGNONE 
AB018377GTGACGTGNONE 
AK072428GTGACGTGNONE 
AK120885GTGACGTGEarly nodulin. 
J013022O14GTGACGTGNONE 
J043034L12GTGACGTGNONE 
J065030L16GTGACGTGNONE 
J065056C10GTGACGTGNONE 
J065066P11GTGACGTGNONE 
J065101I24GTGACGTGNONE 
J065102E21GTGACGTGNONE 
J065113P17GTGACGTGNONE 
J065120I17GTGACGTGNONE 
J065122P08GTGACGTGNONE 
J065124D04GTGACGTGNONE 
J065140K10GTGACGTGNONE 
J065140P20GTGACGTGNONE 
J065147O15GTGACGTGNONE 
J065148L22GTGACGTGNONE 
J065159N03GTGACGTGNONE 
J065180B09GTGACGTGNONE 
J075027C19GTGACGTGNONE 
J075120L04GTGACGTGNONE 
J075134I10GTGACGTGNONE 
J075161B08GTGACGTGNONE 
J075172F11GTGACGTGNONE 
J090073H01GTGACGTGNONE 
J100017B11GTGACGTGNONE 
J100030L05GTGACGTGNONE 
J100064A03GTGACGTGNONE 
Os02g0307800006-080-C10GGTGACGTGNONE 
006-116-A02GGTGACGTGNONE 
AK061868GGTGACGTGNONE 
AK065304GGTGACGTGConserved hypothetical protein. 
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein. 
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE 
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein. 
J065197J05CACGTCACAAAAGCCCATTNONE 
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein. 
J033071N12CACGTCACCNONE 
J033143I02CACGTCACCNONE 
J100019J22CACGTCACCNONE 
J100075O13CACGTCACCNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0522700012-086-C03GCCACGTCACCNONE 
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein. 
Os02g0551600009-174-H09GCCACGTCACCNONE 
AK063102GCCACGTCACCConserved hypothetical protein. 
Os02g0576400AK107966CACGTCACConserved hypothetical protein. 
J075083G06CACGTCACNONE 
J075164K09CACGTCACNONE 
Os02g0582400006-091-G09GGTGACGTGNONE 
AK070989GGTGACGTGConserved hypothetical protein. 
J023075I23GGTGACGTGNONE 
J080021H07GGTGACGTGNONE 
J080068A03GGTGACGTGNONE 
J080089B13GGTGACGTGNONE 
J080093G22GGTGACGTGNONE 
Os02g0601800AB060276CACGTCACNONE 
AK099539CACGTCACNONE 
AK101873CACGTCACBromodomain containing protein. 
AK106801CACGTCACNONE 
AK121758CACGTCACNONE 
AK121891CACGTCACNONE 
J013059H01CACGTCACNONE 
J013092F08CACGTCACNONE 
J013146J04CACGTCACNONE 
J023001K12CACGTCACNONE 
J023002H16CACGTCACNONE 
J023013B10CACGTCACNONE 
J023081I22CACGTCACNONE 
J023084K19CACGTCACNONE 
J023150E24CACGTCACNONE 
J033023B18CACGTCACNONE 
J033025F18CACGTCACNONE 
J033048P08CACGTCACNONE 
J033060M24CACGTCACNONE 
J033070G06CACGTCACNONE 
J033088P12CACGTCACNONE 
J033105C13CACGTCACNONE 
J043009N18CACGTCACNONE 
J065103G21CACGTCACNONE 
J075039H15CACGTCACNONE 
J090014K10CACGTCACNONE 
J090022N02CACGTCACNONE 
J090033F18CACGTCACNONE 
J090033I04CACGTCACNONE 
J090041F11CACGTCACNONE 
J090045P20CACGTCACNONE 
J090054B01CACGTCACNONE 
J090055M12CACGTCACNONE 
J090071K09CACGTCACNONE 
J090098O16CACGTCACNONE 
J090099P15CACGTCACNONE 
J100050I16CACGTCACNONE 
Os02g0658033J090015D03CACGTCACPleckstrin-like domain containing protein. 
Os02g0690600AK110831CACGTCACU box domain containing protein. 
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment). 
AK098873GTGACGTGGCNONE 
J013001C18GTGACGTGGCNONE 
J080003D07GTGACGTGGCNONE 
J080003H24GTGACGTGGCNONE 
J080010C23GTGACGTGGCNONE 
J080011I04GTGACGTGGCNONE 
J080011O03GTGACGTGGCNONE 
J080012F13GTGACGTGGCNONE 
J080020E06GTGACGTGGCNONE 
J080025H22GTGACGTGGCNONE 
J080026D15GTGACGTGGCNONE 
J080028D20GTGACGTGGCNONE 
J080029P20GTGACGTGGCNONE 
J080031K22GTGACGTGGCNONE 
J080034I05GTGACGTGGCNONE 
J080036E11GTGACGTGGCNONE 
J080036H13GTGACGTGGCNONE 
J080037E17GTGACGTGGCNONE 
J080043N05GTGACGTGGCNONE 
J080044L23GTGACGTGGCNONE 
J080047N11GTGACGTGGCNONE 
J080048O04GTGACGTGGCNONE 
J080049M01GTGACGTGGCNONE 
J080050F21GTGACGTGGCNONE 
J080054F09GTGACGTGGCNONE 
J080055N20GTGACGTGGCNONE 
J080058C02GTGACGTGGCNONE 
J080058K15GTGACGTGGCNONE 
J080062G02GTGACGTGGCNONE 
J080066H16GTGACGTGGCNONE 
J080066O05GTGACGTGGCNONE 
J080067O16GTGACGTGGCNONE 
J080068E13GTGACGTGGCNONE 
J080069P16GTGACGTGGCNONE 
J080072M11GTGACGTGGCNONE 
J080076H09GTGACGTGGCNONE 
J080081G24GTGACGTGGCNONE 
J080082J05GTGACGTGGCNONE 
J080084I10GTGACGTGGCNONE 
J080087L24GTGACGTGGCNONE 
J080089H07GTGACGTGGCNONE 
J080089M05GTGACGTGGCNONE 
J080092G18GTGACGTGGCNONE 
J080095N08GTGACGTGGCNONE 
Os02g0762600AK103657CACGTCACNONE 
AK110321CACGTCACConserved hypothetical protein. 
J033135G19CACGTCACNONE 
J090004E21CACGTCACNONE 
J100067M04CACGTCACNONE 
Os02g0766600006-039-E02CACGTCACNONE 
009-087-E05CACGTCACNONE 
013-049-E02CACGTCACNONE 
AK059779CACGTCACProtein of unknown function DUF1685 family protein. 
AK099386CACGTCACNONE 
J033072H02CACGTCACNONE 
J065045F21CACGTCACNONE 
J065079P05CACGTCACNONE 
J065121M12CACGTCACNONE 
J065134C23CACGTCACNONE 
J065140G23CACGTCACNONE 
J065180P12CACGTCACNONE 
J065212O07CACGTCACNONE 
J100028B03CACGTCACNONE 
J100030E05CACGTCACNONE 
J100037O12CACGTCACNONE 
J100050P11CACGTCACNONE 
J100058I07CACGTCACNONE 
J100059G05CACGTCACNONE 
J100062H11CACGTCACNONE 
J100064L18CACGTCACNONE 
J100068G08CACGTCACNONE 
Os02g0824400AK121390CACGTCACConserved hypothetical protein. 
J023128P21CACGTCACNONE 
J053097O16CACGTCACNONE 
J065012I02CACGTCACNONE 
J065049C06CACGTCACNONE 
J065051H02CACGTCACNONE 
J065069A13CACGTCACNONE 
J065082E04CACGTCACNONE 
J065102N09CACGTCACNONE 
J065157O10CACGTCACNONE 
J065188N23CACGTCACNONE 
J065190J11CACGTCACNONE 
J065202M09CACGTCACNONE 
Os02g0824500AK111296GTGACGTGSimilar to Remorin. 
J065048M11GTGACGTGNONE 
J065081F01GTGACGTGNONE 
Os02g0830000011-075-D11GTGACGTGACGTGNONE 
AK101841GTGACGTGACGTGProtein prenyltransferase domain containing protein. 
J033069G13GTGACGTGACGTGNONE 
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein. 
Os03g0119900AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CGCCACGTCACCGATCCGNONE 
J065165C24CGCCACGTCACCGATCCGNONE 
J075039M05CGCCACGTCACCGATCCGNONE 
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE 
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein. 
J013129L02CGCACCGCGACACGTCACGTCTCNONE 
J033025H22CGCACCGCGACACGTCACGTCTCNONE 
J033034L15CGCACCGCGACACGTCACGTCTCNONE 
J033044F21CGCACCGCGACACGTCACGTCTCNONE 
J033046F15CGCACCGCGACACGTCACGTCTCNONE 
J033101I17CGCACCGCGACACGTCACGTCTCNONE 
J033150K16CGCACCGCGACACGTCACGTCTCNONE 
J065042G12CGCACCGCGACACGTCACGTCTCNONE 
J065083F17CGCACCGCGACACGTCACGTCTCNONE 
J100044G19CGCACCGCGACACGTCACGTCTCNONE 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCCACGTCACCCGCACGCGNONE 
J023003L18CGCCACGTCACCCGCACGCGNONE 
J023022K18CGCCACGTCACCCGCACGCGNONE 
J023107H13CGCCACGTCACCCGCACGCGNONE 
J023107K02CGCCACGTCACCCGCACGCGNONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0160200AK064836GTGACGTGGACCGGACGCGTCCConserved hypothetical protein. 
AK071081GTGACGTGGACCGGACGCGTCCNONE 
AK100712GTGACGTGGACCGGACGCGTCCNONE 
AK104859GTGACGTGGACCGGACGCGTCCNONE 
J013000F21GTGACGTGGACCGGACGCGTCCNONE 
J013024G05GTGACGTGGACCGGACGCGTCCNONE 
J013035E12GTGACGTGGACCGGACGCGTCCNONE 
J013041A17GTGACGTGGACCGGACGCGTCCNONE 
J013045D10GTGACGTGGACCGGACGCGTCCNONE 
J013045F04GTGACGTGGACCGGACGCGTCCNONE 
J013046F04GTGACGTGGACCGGACGCGTCCNONE 
J013047F10GTGACGTGGACCGGACGCGTCCNONE 
J013051E10GTGACGTGGACCGGACGCGTCCNONE 
J013059J07GTGACGTGGACCGGACGCGTCCNONE 
J013059O17GTGACGTGGACCGGACGCGTCCNONE 
J013060A20GTGACGTGGACCGGACGCGTCCNONE 
J013063J23GTGACGTGGACCGGACGCGTCCNONE 
J013066D19GTGACGTGGACCGGACGCGTCCNONE 
J013069O08GTGACGTGGACCGGACGCGTCCNONE 
J013088K24GTGACGTGGACCGGACGCGTCCNONE 
J013098G04GTGACGTGGACCGGACGCGTCCNONE 
J013100I15GTGACGTGGACCGGACGCGTCCNONE 
J013102E18GTGACGTGGACCGGACGCGTCCNONE 
J013102O09GTGACGTGGACCGGACGCGTCCNONE 
J013119M18GTGACGTGGACCGGACGCGTCCNONE 
J013123I19GTGACGTGGACCGGACGCGTCCNONE 
J013146H15GTGACGTGGACCGGACGCGTCCNONE 
J013149A14GTGACGTGGACCGGACGCGTCCNONE 
J023003A05GTGACGTGGACCGGACGCGTCCNONE 
J023013O19GTGACGTGGACCGGACGCGTCCNONE 
J023044M05GTGACGTGGACCGGACGCGTCCNONE 
J023048O03GTGACGTGGACCGGACGCGTCCNONE 
J023049L17GTGACGTGGACCGGACGCGTCCNONE 
J023060D22GTGACGTGGACCGGACGCGTCCNONE 
J023060F20GTGACGTGGACCGGACGCGTCCNONE 
J023069G09GTGACGTGGACCGGACGCGTCCNONE 
J023086E11GTGACGTGGACCGGACGCGTCCNONE 
J023091I09GTGACGTGGACCGGACGCGTCCNONE 
J023091M19GTGACGTGGACCGGACGCGTCCNONE 
J023101D06GTGACGTGGACCGGACGCGTCCNONE 
J023109B03GTGACGTGGACCGGACGCGTCCNONE 
J023113B14GTGACGTGGACCGGACGCGTCCNONE 
J023114B19GTGACGTGGACCGGACGCGTCCNONE 
J023115H16GTGACGTGGACCGGACGCGTCCNONE 
J023134F22GTGACGTGGACCGGACGCGTCCNONE 
J023139I06GTGACGTGGACCGGACGCGTCCNONE 
J023150C02GTGACGTGGACCGGACGCGTCCNONE 
J033033A14GTGACGTGGACCGGACGCGTCCNONE 
J033058O11GTGACGTGGACCGGACGCGTCCNONE 
J033060H13GTGACGTGGACCGGACGCGTCCNONE 
J033075P14GTGACGTGGACCGGACGCGTCCNONE 
J033084O05GTGACGTGGACCGGACGCGTCCNONE 
J033087G04GTGACGTGGACCGGACGCGTCCNONE 
J033092E18GTGACGTGGACCGGACGCGTCCNONE 
J033101G23GTGACGTGGACCGGACGCGTCCNONE 
J033112I05GTGACGTGGACCGGACGCGTCCNONE 
J033118E14GTGACGTGGACCGGACGCGTCCNONE 
J033118P04GTGACGTGGACCGGACGCGTCCNONE 
J033123C07GTGACGTGGACCGGACGCGTCCNONE 
J043003C01GTGACGTGGACCGGACGCGTCCNONE 
J043024B21GTGACGTGGACCGGACGCGTCCNONE 
J043030N04GTGACGTGGACCGGACGCGTCCNONE 
J043039J02GTGACGTGGACCGGACGCGTCCNONE 
J043039N08GTGACGTGGACCGGACGCGTCCNONE 
J075006N21GTGACGTGGACCGGACGCGTCCNONE 
J075008A16GTGACGTGGACCGGACGCGTCCNONE 
J075018J16GTGACGTGGACCGGACGCGTCCNONE 
J075023G04GTGACGTGGACCGGACGCGTCCNONE 
J075134F18GTGACGTGGACCGGACGCGTCCNONE 
J075181B05GTGACGTGGACCGGACGCGTCCNONE 
J090014O14GTGACGTGGACCGGACGCGTCCNONE 
J090020H22GTGACGTGGACCGGACGCGTCCNONE 
J090022G17GTGACGTGGACCGGACGCGTCCNONE 
J090023J24GTGACGTGGACCGGACGCGTCCNONE 
J090033H01GTGACGTGGACCGGACGCGTCCNONE 
J090038A03GTGACGTGGACCGGACGCGTCCNONE 
J090041O22GTGACGTGGACCGGACGCGTCCNONE 
J090049E10GTGACGTGGACCGGACGCGTCCNONE 
J090063E24GTGACGTGGACCGGACGCGTCCNONE 
J090080N12GTGACGTGGACCGGACGCGTCCNONE 
J100021G23GTGACGTGGACCGGACGCGTCCNONE 
J100028P06GTGACGTGGACCGGACGCGTCCNONE 
J100060L21GTGACGTGGACCGGACGCGTCCNONE 
J100077D16GTGACGTGGACCGGACGCGTCCNONE 
J100088I09GTGACGTGGACCGGACGCGTCCNONE 
Os03g0161200AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0187350J065013L15GTGACGTGHypothetical protein. 
J065049N06GTGACGTGNONE 
J065090E15GTGACGTGNONE 
J065112I11GTGACGTGNONE 
J065114I10GTGACGTGNONE 
Os03g0196800006-059-H10GTGACGTGNONE 
009-016-G04GTGACGTGNONE 
AK058535GTGACGTGSimilar to Cyanelle 30S ribosomal protein S10. 
AK104108GTGACGTGNONE 
J013147G20GTGACGTGNONE 
J100026M18GTGACGTGNONE 
J100043F14GTGACGTGNONE 
J100062D03GTGACGTGNONE 
Os03g0215800AK071308CACGTCACCPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor. 
AK073337CGCCACGTCACNONE 
Os03g0271500AK068546CACGTCACNONE 
AK109239CACGTCACConserved hypothetical protein. 
J013157P04CACGTCACNONE 
J075041K23CACGTCACNONE 
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0310400009-143-E11CACGTCACNONE 
AK068241CACGTCACEnoyl-CoA hydratase/isomerase domain containing protein. 
J065176F24CACGTCACNONE 
Os03g0328100AK107122CACGTCACSimilar to Axi 1 (Auxin-independent growth promoter)-like protein. 
Os03g0333000AK109811CACGTCACConserved hypothetical protein. 
J065152D04CACGTCACNONE 
J090011B05CACGTCACNONE 
Os03g0333100AK101050GTGACGTGProtein of unknown function DUF663 domain containing protein. 
Os03g0338000AK121399GTGACGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0442400Os03g0442400CACGTCACNONE 
Os03g0567600AK065135GTGACGTGNONE 
AK098896GTGACGTGNONE 
AK100305GTGACGTGProtein of unknown function DUF563 family protein. 
Os03g0634000014-034-A03CACGTCACCNONE 
AK063673CACGTCACCSimilar to THA4. 
Os03g0667100012-045-B01GTGACGTGNONE 
AK065363GTGACGTGBTB domain containing protein. 
AK065952GTGACGTGNONE 
J013045I05GTGACGTGNONE 
J013129F20GTGACGTGNONE 
Os03g0701000J075172J23GTGACGTGNONE 
Os03g0744800AK059983GCCACGTCACemp24/gp25L/p24 family protein. 
J065067D01GCCACGTCACNONE 
J065122L19GCCACGTCACNONE 
J090041I03GCCACGTCACNONE 
J100039H03GCCACGTCACNONE 
Os03g0745000AK109590CGCCACGTCACCGCACNONE 
AY332465CGCCACGTCACCGCACNONE 
AY344486CGCCACGTCACCGCACNONE 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0757200AK071136CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023078E19CACGTCACNONE 
Os03g0810800006-060-G12GGTGACGTGGCNONE 
006-063-F08GGTGACGTGGCNONE 
006-102-H09GGTGACGTGGCNONE 
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase. 
AK070201GGTGACGTGGCNONE 
AK105938GGTGACGTGGCNONE 
J023042C15GGTGACGTGGCNONE 
J053075K10GGTGACGTGGCNONE 
J065061E08GGTGACGTGGCNONE 
J065079B21GGTGACGTGGCNONE 
J065082F07GGTGACGTGGCNONE 
J065128H02GGTGACGTGGCNONE 
J065195C03GGTGACGTGGCNONE 
J090038F07GGTGACGTGGCNONE 
J090048P14GGTGACGTGGCNONE 
J090052C07GGTGACGTGGCNONE 
J090089M12GGTGACGTGGCNONE 
J090097F20GGTGACGTGGCNONE 
J100037H03GGTGACGTGGCNONE 
J100038K01GGTGACGTGGCNONE 
Os03g0818100015-098-A09GGTGACGTGTCACTNONE 
AK064366GGTGACGTGTCACTNONE 
AK121701GGTGACGTGTCACTHistidine acid phosphatase family protein. 
Os03g0821900AK070847CACGTCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20GCCACGTCACNONE 
Os03g0825700AK067902CACGTCACCSimilar to Defective in exine formation. 
Os03g0825900AK109694CACGTCACConserved hypothetical protein. 
Os03g0835600AK101677CACGTCACAcyl-coA-binding protein, ACBP family protein. 
Os03g0854800J090007D13CGCCACGTCACNONE 
J090085N22CGCCACGTCACNONE 
Os04g0177400012-039-C04GTGACGTGNONE 
Os04g0271700AK059031CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110CACGTCACNONE 
AK099145CACGTCACNONE 
J065045A03CACGTCACNONE 
Os04g0286400009-144-C10GCCACGTCACCNONE 
AK062974GCCACGTCACCHypothetical protein. 
Os04g0390700AK107261GTGACGTGTCGGlucose/ribitol dehydrogenase family protein. 
Os04g0436800015-053-A06CACGTCACNONE 
AK101115CACGTCACProtein prenyltransferase domain containing protein. 
J033025G14CACGTCACNONE 
J033073N23CACGTCACNONE 
J033097L19CACGTCACNONE 
Os04g0447400AK070858CACGTCACCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CACGTCACCNONE 
J023003G16CACGTCACCNONE 
J023006F16CACGTCACCNONE 
J023008D10CACGTCACCNONE 
J023010A01CACGTCACCNONE 
J023012M16CACGTCACCNONE 
J023023H17CACGTCACCNONE 
J023029B12CACGTCACCNONE 
J023030F09CACGTCACCNONE 
J023034K03CACGTCACCNONE 
J023045A16CACGTCACCNONE 
J023048I04CACGTCACCNONE 
J023056C09CACGTCACCNONE 
J023056F05CACGTCACCNONE 
J023058B21CACGTCACCNONE 
J023058N06CACGTCACCNONE 
J023059F03CACGTCACCNONE 
J023059M19CACGTCACCNONE 
J023060P05CACGTCACCNONE 
J023062D07CACGTCACCNONE 
J023063F16CACGTCACCNONE 
J023068K15CACGTCACCNONE 
J023069L04CACGTCACCNONE 
J023075I24CACGTCACCNONE 
J023086H01CACGTCACCNONE 
J023086I24CACGTCACCNONE 
J023091M08CACGTCACCNONE 
J023095A07CACGTCACCNONE 
J023110K06CACGTCACCNONE 
J023113D07CACGTCACCNONE 
J023126J05CACGTCACCNONE 
J023140F04CACGTCACCNONE 
J023141N19CACGTCACCNONE 
Os04g0447500AK064090GGTGACGTGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0541700AK109177GGACACGTCACNONE 
AY554030GGACACGTCACNONE 
J065055P13GGACACGTCACNONE 
J065057N20GGACACGTCACNONE 
J065136D07GGACACGTCACNONE 
Os04g0564700AK111806CACGTCACCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0577700AK108703CACGTCACProtein of unknown function DUF623, plant domain containing protein. 
Os04g0595800016-024-H02CACGTCACNONE 
AK058642CACGTCACSimilar to Secretory carrier membrane protein. 
AK120076CACGTCACNONE 
J075124H24CACGTCACNONE 
Os04g0623100006-042-D10GCCACGTCACNONE 
AK067276GCCACGTCACBromodomain containing protein. 
J013097L22GCCACGTCACNONE 
J013099L18GCCACGTCACNONE 
J023009D13GCCACGTCACNONE 
J023041M21GCCACGTCACNONE 
J090088H12GCCACGTCACNONE 
Os04g0679400004-018-E07CACCGCACGTCACNONE 
006-039-G08CACCGCACGTCACNONE 
006-045-D06CACCGCACGTCACNONE 
006-048-B12CACCGCACGTCACNONE 
006-061-C05CACCGCACGTCACNONE 
006-062-A03CACCGCACGTCACNONE 
006-063-A06CACCGCACGTCACNONE 
006-066-B04CACCGCACGTCACNONE 
006-068-H12CACCGCACGTCACNONE 
006-075-C08CACCGCACGTCACNONE 
006-076-A02CACCGCACGTCACNONE 
006-083-B04CACCGCACGTCACNONE 
006-090-F04CACCGCACGTCACNONE 
006-099-H12CACCGCACGTCACNONE 
006-105-F10CACCGCACGTCACNONE 
006-106-G03CACCGCACGTCACNONE 
006-107-B05CACCGCACGTCACNONE 
006-108-F06CACCGCACGTCACNONE 
006-109-E09CACCGCACGTCACNONE 
006-111-B02CACCGCACGTCACNONE 
006-113-C10CACCGCACGTCACNONE 
009-128-G11CACCGCACGTCACNONE 
009-150-B02CACCGCACGTCACNONE 
009-156-E08CACCGCACGTCACNONE 
012-015-E07CACCGCACGTCACNONE 
012-027-B04CACCGCACGTCACNONE 
012-030-A03CACCGCACGTCACNONE 
012-066-E06CACCGCACGTCACNONE 
012-083-A09CACCGCACGTCACNONE 
012-088-E07CACCGCACGTCACNONE 
012-097-F08CACCGCACGTCACNONE 
013-010-D04CACCGCACGTCACNONE 
013-012-A01CACCGCACGTCACNONE 
013-016-D04CACCGCACGTCACNONE 
013-041-B01CACCGCACGTCACNONE 
013-043-F10CACCGCACGTCACNONE 
013-047-C12CACCGCACGTCACNONE 
013-058-E10CACCGCACGTCACNONE 
013-063-B07CACCGCACGTCACNONE 
013-076-A01CACCGCACGTCACNONE 
013-081-D04CACCGCACGTCACNONE 
013-090-D05CACCGCACGTCACNONE 
013-091-B07CACCGCACGTCACNONE 
014-030-A04CACCGCACGTCACNONE 
014-055-A04CACCGCACGTCACNONE 
014-070-A04CACCGCACGTCACNONE 
015-033-C10CACCGCACGTCACNONE 
015-040-H10CACCGCACGTCACNONE 
016-006-F03CACCGCACGTCACNONE 
016-090-B03CACCGCACGTCACNONE 
AK065314CACCGCACGTCACNONE 
AK068608CACCGCACGTCACNONE 
AK099009CACCGCACGTCACNONE 
AK099087CACCGCACGTCACNONE 
AK099368CACCGCACGTCACNONE 
AK099653CACCGCACGTCACNONE 
AK099975CACCGCACGTCACNONE 
AK104249CACCGCACGTCACNONE 
AK104376CACCGCACGTCACNONE 
AK106133CACCGCACGTCACNONE 
AK119666CACCGCACGTCACNONE 
AK120508CACCGCACGTCACNONE 
AK121152CACCGCACGTCACSimilar to Ripening-associated protein (Fragment). 
J013002O24CACCGCACGTCACNONE 
J013023H15CACCGCACGTCACNONE 
J013036E15CACCGCACGTCACNONE 
J013042D22CACCGCACGTCACNONE 
J013045A07CACCGCACGTCACNONE 
J013056D24CACCGCACGTCACNONE 
J013057D10CACCGCACGTCACNONE 
J013059B08CACCGCACGTCACNONE 
J013059D01CACCGCACGTCACNONE 
J013060C02CACCGCACGTCACNONE 
J013070N22CACCGCACGTCACNONE 
J013071K02CACCGCACGTCACNONE 
J013073G04CACCGCACGTCACNONE 
J013096J17CACCGCACGTCACNONE 
J013098G08CACCGCACGTCACNONE 
J013123H02CACCGCACGTCACNONE 
J013135I23CACCGCACGTCACNONE 
J013149G08CACCGCACGTCACNONE 
J013155N04CACCGCACGTCACNONE 
J013156C23CACCGCACGTCACNONE 
J013157C07CACCGCACGTCACNONE 
J013157D23CACCGCACGTCACNONE 
J023001K19CACCGCACGTCACNONE 
J023002H21CACCGCACGTCACNONE 
J023003H14CACCGCACGTCACNONE 
J023006D09CACCGCACGTCACNONE 
J023010E07CACCGCACGTCACNONE 
J023014E18CACCGCACGTCACNONE 
J023024G16CACCGCACGTCACNONE 
J023034F13CACCGCACGTCACNONE 
J023034F17CACCGCACGTCACNONE 
J023045C18CACCGCACGTCACNONE 
J023058P17CACCGCACGTCACNONE 
J023061H18CACCGCACGTCACNONE 
J023064H05CACCGCACGTCACNONE 
J023078J16CACCGCACGTCACNONE 
J023079L03CACCGCACGTCACNONE 
J023085N10CACCGCACGTCACNONE 
J023087G10CACCGCACGTCACNONE 
J023088I02CACCGCACGTCACNONE 
J023093K24CACCGCACGTCACNONE 
J023095H05CACCGCACGTCACNONE 
J023097C02CACCGCACGTCACNONE 
J023101P15CACCGCACGTCACNONE 
J023106C22CACCGCACGTCACNONE 
J023121B08CACCGCACGTCACNONE 
J023121N13CACCGCACGTCACNONE 
J023123F01CACCGCACGTCACNONE 
J023128E14CACCGCACGTCACNONE 
J023128M11CACCGCACGTCACNONE 
J023135L14CACCGCACGTCACNONE 
J023141H20CACCGCACGTCACNONE 
J023150A12CACCGCACGTCACNONE 
J033035G16CACCGCACGTCACNONE 
J033037N04CACCGCACGTCACNONE 
J033041D20CACCGCACGTCACNONE 
J033052O07CACCGCACGTCACNONE 
J033061D19CACCGCACGTCACNONE 
J033068M01CACCGCACGTCACNONE 
J033090I15CACCGCACGTCACNONE 
J033103G06CACCGCACGTCACNONE 
J033117F16CACCGCACGTCACNONE 
J033120H02CACCGCACGTCACNONE 
J033126N05CACCGCACGTCACNONE 
J033136C13CACCGCACGTCACNONE 
J033139H08CACCGCACGTCACNONE 
J043024N03CACCGCACGTCACNONE 
J043027G07CACCGCACGTCACNONE 
J065103L02CACCGCACGTCACNONE 
J065108G02CACCGCACGTCACNONE 
J065175N11CACCGCACGTCACNONE 
J080003B03CACCGCACGTCACNONE 
J080007J02CACCGCACGTCACNONE 
J080008D02CACCGCACGTCACNONE 
J080008E04CACCGCACGTCACNONE 
J080015H20CACCGCACGTCACNONE 
J080017J09CACCGCACGTCACNONE 
J080020O09CACCGCACGTCACNONE 
J080021F06CACCGCACGTCACNONE 
J080027L11CACCGCACGTCACNONE 
J080028J11CACCGCACGTCACNONE 
J080030G17CACCGCACGTCACNONE 
J080035E09CACCGCACGTCACNONE 
J080035F20CACCGCACGTCACNONE 
J080036H18CACCGCACGTCACNONE 
J080039M19CACCGCACGTCACNONE 
J080042A21CACCGCACGTCACNONE 
J080043A07CACCGCACGTCACNONE 
J080052A16CACCGCACGTCACNONE 
J080055G22CACCGCACGTCACNONE 
J080061O12CACCGCACGTCACNONE 
J080062I05CACCGCACGTCACNONE 
J080068K18CACCGCACGTCACNONE 
J080070G01CACCGCACGTCACNONE 
J080077F11CACCGCACGTCACNONE 
J080079N14CACCGCACGTCACNONE 
J080084G11CACCGCACGTCACNONE 
J080093C04CACCGCACGTCACNONE 
J090056G10CACCGCACGTCACNONE 
J090091H01CACCGCACGTCACNONE 
J100025J03CACCGCACGTCACNONE 
J100027L16CACCGCACGTCACNONE 
J100030B22CACCGCACGTCACNONE 
J100048H23CACCGCACGTCACNONE 
J100050C24CACCGCACGTCACNONE 
J100055F22CACCGCACGTCACNONE 
J100057L08CACCGCACGTCACNONE 
J100065E17CACCGCACGTCACNONE 
J100072C03CACCGCACGTCACNONE 
Os04g0682500015-003-H03CACGTCACNONE 
AK064978CACGTCACNONE 
AK121739CACGTCACPeptidase T2, asparaginase 2 family protein. 
J013001C03CACGTCACNONE 
J023028M11CACGTCACNONE 
J033085H01CACGTCACNONE 
Os05g0119200AK067943CACGTCACConserved hypothetical protein. 
J013122C02CACGTCACNONE 
J065077M14CACGTCACNONE 
J065108P21CACGTCACNONE 
J065138G20CACGTCACNONE 
J065148H07CACGTCACNONE 
J065205P09CACGTCACNONE 
J075061H16CACGTCACNONE 
J075140H13CACGTCACNONE 
J075153H02CACGTCACNONE 
J075170B14CACGTCACNONE 
Os05g0145100AK107957CACGTCACCConserved hypothetical protein. 
Os05g0171900012-005-F08GGTGACGTGNONE 
012-048-G09GGTGACGTGNONE 
013-046-A07GGTGACGTGNONE 
013-050-D10GGTGACGTGNONE 
014-003-G04GGTGACGTGNONE 
014-008-G10GGTGACGTGNONE 
014-011-E07GGTGACGTGNONE 
014-011-F11GGTGACGTGNONE 
014-019-C02GGTGACGTGNONE 
014-037-G03GGTGACGTGNONE 
014-043-G06GGTGACGTGNONE 
014-045-A05GGTGACGTGNONE 
014-047-C07GGTGACGTGNONE 
014-052-F03GGTGACGTGNONE 
014-088-G07GGTGACGTGNONE 
014-090-B11GGTGACGTGNONE 
015-010-A06GGTGACGTGNONE 
015-013-B11GGTGACGTGNONE 
015-026-A04GGTGACGTGNONE 
015-041-G01GGTGACGTGNONE 
015-046-D06GGTGACGTGNONE 
015-050-B07GGTGACGTGNONE 
015-053-C03GGTGACGTGNONE 
015-056-C04GGTGACGTGNONE 
015-057-B04GGTGACGTGNONE 
015-075-C12GGTGACGTGNONE 
015-079-F04GGTGACGTGNONE 
016-025-F02GGTGACGTGNONE 
016-030-B10GGTGACGTGNONE 
016-034-B03GGTGACGTGNONE 
016-034-E04GGTGACGTGNONE 
016-035-B07GGTGACGTGNONE 
016-035-D10GGTGACGTGNONE 
016-039-C06GGTGACGTGNONE 
016-042-D01GGTGACGTGNONE 
016-043-C02GGTGACGTGNONE 
016-044-B01GGTGACGTGNONE 
016-045-G06GGTGACGTGNONE 
016-049-G07GGTGACGTGNONE 
016-052-C10GGTGACGTGNONE 
016-070-D03GGTGACGTGNONE 
016-077-H10GGTGACGTGNONE 
016-082-F02GGTGACGTGNONE 
016-087-D04GGTGACGTGNONE 
016-093-B05GGTGACGTGNONE 
016-093-F06GGTGACGTGNONE 
AK069814GGTGACGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
AK106348GGTGACGTGNONE 
AK119584GGTGACGTGNONE 
AK119669GGTGACGTGNONE 
J013074J12GGTGACGTGNONE 
J023031G07GGTGACGTGNONE 
J023072P16GGTGACGTGNONE 
J023105N07GGTGACGTGNONE 
J053023E11GGTGACGTGNONE 
J053025H06GGTGACGTGNONE 
J053029G08GGTGACGTGNONE 
J053051L10GGTGACGTGNONE 
J065011P09GGTGACGTGNONE 
J065022O05GGTGACGTGNONE 
J065071D04GGTGACGTGNONE 
J065100B07GGTGACGTGNONE 
J065104O10GGTGACGTGNONE 
J065154H19GGTGACGTGNONE 
J065183D19GGTGACGTGNONE 
J065185I07GGTGACGTGNONE 
J065205O17GGTGACGTGNONE 
J075022N11GGTGACGTGNONE 
J100033M17GGTGACGTGNONE 
Os05g0297900AK071238TAAGCCCAGTGACGTGSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03TAAGCCCAGTGACGTGNONE 
J023041J06TAAGCCCAGTGACGTGNONE 
J023085B09TAAGCCCAGTGACGTGNONE 
J033031J11TAAGCCCAGTGACGTGNONE 
J065010C22TAAGCCCAGTGACGTGNONE 
J065032E10TAAGCCCAGTGACGTGNONE 
J065141O18TAAGCCCAGTGACGTGNONE 
J065155K04TAAGCCCAGTGACGTGNONE 
Os05g0344200006-022-E04CACGTCACCNONE 
006-080-D01CACGTCACCNONE 
009-021-D03CACGTCACCNONE 
009-026-A10CACGTCACCNONE 
009-054-B12CACGTCACCNONE 
009-059-H03CACGTCACCNONE 
009-077-C02CACGTCACCNONE 
009-095-H12CACGTCACCNONE 
009-106-B08CACGTCACCNONE 
009-138-D10CACGTCACCNONE 
009-140-G06CACGTCACCNONE 
009-146-E09CACGTCACCNONE 
009-161-F04CACGTCACCNONE 
009-176-F05CACGTCACCNONE 
013-047-C03CACGTCACCNONE 
013-052-E07CACGTCACCNONE 
013-054-G04CACGTCACCNONE 
013-095-D10CACGTCACCNONE 
014-003-D06CACGTCACCNONE 
014-020-C09CACGTCACCNONE 
014-043-E01CACGTCACCNONE 
014-080-G09CACGTCACCNONE 
014-081-H05CACGTCACCNONE 
AK060058CACGTCACCConserved hypothetical protein. 
AK098850CACGTCACCNONE 
AK104716CACGTCACCNONE 
AK119727CACGTCACCNONE 
J013000G04CACGTCACCNONE 
J013155L11CACGTCACCNONE 
J033138J22CACGTCACCNONE 
J065112E22CACGTCACCNONE 
J065124M06CACGTCACCNONE 
J065130M01CACGTCACCNONE 
J065137I03CACGTCACCNONE 
J065157O12CACGTCACCNONE 
J065171B12CACGTCACCNONE 
J075003O16CACGTCACCNONE 
J075026G12CACGTCACCNONE 
J075032K07CACGTCACCNONE 
J075070I11CACGTCACCNONE 
J075093K06CACGTCACCNONE 
J075148C12CACGTCACCNONE 
J075148L08CACGTCACCNONE 
J075152G13CACGTCACCNONE 
J075177G07CACGTCACCNONE 
J100026I09CACGTCACCNONE 
J100083L11CACGTCACCNONE 
J100086F04CACGTCACCNONE 
Os05g0346300009-033-C06GTGACGTGGCNONE 
009-033-C06GTGACGTGGCNONE 
AF529175GTGACGTGGCNONE 
AF529175GTGACGTGGCNONE 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK103081GTGACGTGGCNONE 
AK103081GTGACGTGGCNONE 
AK104191GTGACGTGGCNONE 
AK104191GTGACGTGGCNONE 
J013049B09GTGACGTGGCNONE 
J013049B09GTGACGTGGCNONE 
J023142E24GTGACGTGGCNONE 
J023142E24GTGACGTGGCNONE 
J033052M14GTGACGTGGCNONE 
J033052M14GTGACGTGGCNONE 
J033089N04GTGACGTGGCNONE 
J033089N04GTGACGTGGCNONE 
J033118F01GTGACGTGGCNONE 
J033118F01GTGACGTGGCNONE 
J065054E07GTGACGTGGCNONE 
J065054E07GTGACGTGGCNONE 
J065066L18GTGACGTGGCNONE 
J065066L18GTGACGTGGCNONE 
J065078C21GTGACGTGGCNONE 
J065078C21GTGACGTGGCNONE 
J065127G23GTGACGTGGCNONE 
J065127G23GTGACGTGGCNONE 
J065128N24GTGACGTGGCNONE 
J065128N24GTGACGTGGCNONE 
J065144P17GTGACGTGGCNONE 
J065144P17GTGACGTGGCNONE 
J065147P14GTGACGTGGCNONE 
J065147P14GTGACGTGGCNONE 
J065170E16GTGACGTGGCNONE 
J065170E16GTGACGTGGCNONE 
J065175D17GTGACGTGGCNONE 
J065175D17GTGACGTGGCNONE 
J065176M05GTGACGTGGCNONE 
J065176M05GTGACGTGGCNONE 
J065218G20GTGACGTGGCNONE 
J065218G20GTGACGTGGCNONE 
J090074J12GTGACGTGGCNONE 
J090074J12GTGACGTGGCNONE 
J100019H16GTGACGTGGCNONE 
J100019H16GTGACGTGGCNONE 
J100031N24GTGACGTGGCNONE 
J100031N24GTGACGTGGCNONE 
J100072G08GTGACGTGGCNONE 
J100072G08GTGACGTGGCNONE 
J100086I23GTGACGTGGCNONE 
J100086I23GTGACGTGGCNONE 
Os05g0346400AK058872GCCACGTCACNONE 
AK058872GCCACGTCACNONE 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
J033105N07GCCACGTCACNONE 
J033105N07GCCACGTCACNONE 
J100077I17GCCACGTCACNONE 
J100077I17GCCACGTCACNONE 
Os05g0367900Os05g0367900CACGTCACHarpin-induced 1 domain containing protein. 
Os05g0404700Os05g0404700GTGACGTGZinc finger, CW-type domain containing protein. 
Os05g0494700Os05g0494700GTGACGTGNONE 
Os05g0506000AF031609CACGTCACCNONE 
AK062012CACGTCACCNONE 
AK098900CACGTCACCNONE 
AK122090CACGTCACCSimilar to MS5-like protein (Fragment). 
J013002B13CACGTCACCNONE 
J023149G13CACGTCACCNONE 
J033123O20CACGTCACCNONE 
J080315O17CACGTCACCNONE 
Os05g0508500009-110-H08CACGTCACCNONE 
009-135-B09CACGTCACCNONE 
009-165-D10CACGTCACCNONE 
AB053294CACGTCACCNONE 
AK059385CACGTCACCNONE 
AK106758CACGTCACCSimilar to Thioredoxin H. 
J013121L08CACGTCACCNONE 
J023069L24CACGTCACCNONE 
J023146O17CACGTCACCNONE 
J043030D01CACGTCACCNONE 
J065084D15CACGTCACCNONE 
J090046E10CACGTCACCNONE 
J090078J10CACGTCACCNONE 
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06GGTGACGTGGCGNONE 
AK063846GGTGACGTGGCGConserved hypothetical protein. 
AK122038GGTGACGTGGCGNONE 
J033113C01GGTGACGTGGCGNONE 
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE 
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein. 
J013047J05CAAGGCCCCACACGTCACNONE 
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein. 
J013063P08CGCCACGTCACTCCACGCCNONE 
J013110N24CGCCACGTCACTCCACGCCNONE 
J013156K22CGCCACGTCACTCCACGCCNONE 
J043038A08CGCCACGTCACTCCACGCCNONE 
J090004K18CGCCACGTCACTCCACGCCNONE 
J090085F03CGCCACGTCACTCCACGCCNONE 
Os05g0540100AB021666CACGTCACCNONE 
AK060623CACGTCACCNONE 
AK103819CACGTCACCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0566400AK061645GCCACGTCACCNONE 
AK099472GCCACGTCACCNONE 
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase. 
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein. 
Os06g0140900AK058823CACGTCACSigma factor, regions 3 and 4 domain containing protein. 
J065159C22CACGTCACNONE 
J090061D18CACGTCACNONE 
J100066L20CACGTCACNONE 
J100085F19CACGTCACNONE 
J100088E11CACGTCACNONE 
Os06g0145600015-013-D11GTGACGTGNONE 
AK106249GTGACGTGTransferase family protein. 
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GTGACGTGGCGTGNONE 
Os06g0340600006-114-G04CACGTCACGTCACNONE 
AK061872CACGTCACGTCACPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
AK065176CACGTCACGTCACNONE 
AK100224CACGTCACGTCACNONE 
J013002D10CACGTCACGTCACNONE 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175CACGCCACGTCACCNONE 
Os06g0598800011-079-A05GGTGACGTGNONE 
014-040-G10GGTGACGTGNONE 
AK101377GGTGACGTGSimilar to Fatty acid elongase 1-like protein. 
J013022A17GGTGACGTGNONE 
J023011B05GGTGACGTGNONE 
J023104L12GGTGACGTGNONE 
J033033O20GGTGACGTGNONE 
J033036C04GGTGACGTGNONE 
J065060C17GGTGACGTGNONE 
J075009D16GGTGACGTGNONE 
J075123K20GGTGACGTGNONE 
J075191A14GGTGACGTGNONE 
J090038I01GGTGACGTGNONE 
Os06g0625500006-034-A05GCCACGTCACNONE 
AK058459GCCACGTCACSimilar to Thioredoxin peroxidase. 
AK068955GCCACGTCACNONE 
AK104130GCCACGTCACNONE 
J023003C09GCCACGTCACNONE 
J033043I02GCCACGTCACNONE 
J065063E05GCCACGTCACNONE 
J065190D24GCCACGTCACNONE 
J065198I01GCCACGTCACNONE 
J075107A02GCCACGTCACNONE 
Os06g0636700AK058562CACGTCACLipolytic enzyme, G-D-S-L family protein. 
AK058562CACGTCACCLipolytic enzyme, G-D-S-L family protein. 
Os06g0650100009-016-C02CACGTCACNONE 
AK062354CACGTCACSimilar to Polyubiquitin gene (Fragment). 
Os06g0683800AK110639CACGTCACGTCACCConserved hypothetical protein. 
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein. 
Os06g0725900AK061771CACGTCACCNONE 
AK065019CACGTCACCSimilar to Cell division protein ftsH homolog, chloroplast precursor (EC 3.4.24.-) (DS9). 
Os06g0728700AK111637GTGACGTGHomeodomain-like containing protein. 
AK119632GTGACGTGNONE 
J075015J02GTGACGTGNONE 
J075016L14GTGACGTGNONE 
J075078O03GTGACGTGNONE 
J075098O14GTGACGTGNONE 
J075171L20GTGACGTGNONE 
Os07g0115300006-039-C05CACGTCACCNONE 
AK061511CACGTCACCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0121100AK102706CACGTCACProtein of unknown function DUF1719, Oryza sativa family protein. 
Os07g0141400003-129-D08GTGACGTGNONE 
006-021-E02GTGACGTGNONE 
006-025-C06GTGACGTGNONE 
006-027-H11GTGACGTGNONE 
006-036-C05GTGACGTGNONE 
006-046-D07GTGACGTGNONE 
006-047-A02GTGACGTGNONE 
006-050-F02GTGACGTGNONE 
006-053-D07GTGACGTGNONE 
006-054-E06GTGACGTGNONE 
006-055-E01GTGACGTGNONE 
006-055-F01GTGACGTGNONE 
006-056-H12GTGACGTGNONE 
006-057-D07GTGACGTGNONE 
006-074-G10GTGACGTGNONE 
006-077-C02GTGACGTGNONE 
006-081-E01GTGACGTGNONE 
006-089-B08GTGACGTGNONE 
006-089-C10GTGACGTGNONE 
006-092-E07GTGACGTGNONE 
006-096-C11GTGACGTGNONE 
006-096-H06GTGACGTGNONE 
006-097-E07GTGACGTGNONE 
006-098-D03GTGACGTGNONE 
006-102-C05GTGACGTGNONE 
006-107-E09GTGACGTGNONE 
006-110-C09GTGACGTGNONE 
006-113-C01GTGACGTGNONE 
006-114-D09GTGACGTGNONE 
006-115-H06GTGACGTGNONE 
009-016-G06GTGACGTGNONE 
009-031-C05GTGACGTGNONE 
009-060-B05GTGACGTGNONE 
009-123-H12GTGACGTGNONE 
009-154-B09GTGACGTGNONE 
009-172-F07GTGACGTGNONE 
009-193-A04GTGACGTGNONE 
AF022732GTGACGTGNONE 
AF052203GTGACGTGNONE 
AK065248GTGACGTGSimilar to 23 kDa polypeptide of photosystem II. 
AK104722GTGACGTGNONE 
D49713GTGACGTGNONE 
J013002J02GTGACGTGNONE 
J065051O13GTGACGTGNONE 
J065066J18GTGACGTGNONE 
J065077G23GTGACGTGNONE 
J065162C22GTGACGTGNONE 
J065162G22GTGACGTGNONE 
J075091B13GTGACGTGNONE 
J075099J22GTGACGTGNONE 
J100056O22GTGACGTGNONE 
J100059E01GTGACGTGNONE 
J100079F20GTGACGTGNONE 
Os07g0168600AK068262CACGTCACCSimilar to 3-glucanase. 
AK105668CACGTCACCNONE 
Os07g0170100AK102495CACGTCACNONE 
AK105761CACGTCACSimilar to Branched chain alpha-keto acid dehydrogenase E1 beta subunit. 
J100075K07CACGTCACNONE 
Os07g0181000AK066918GCCACGTCACCNONE 
AK070512GCCACGTCACCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0181500AK072431CGCCACGTCACCProtein of unknown function DUF506, plant family protein. 
Os07g0209100AK120944GGACACGTCACCSimilar to Seed imbibition protein (Fragment). 
Os07g0240300AK072205CACGTCACConserved hypothetical protein. 
AK098977CACGTCACNONE 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0258400AK121534CACGTCACCNONE 
L41217CACGTCACCNONE 
S81897CACGTCACCOsNramp1 (Integral membrane protein). 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0545400009-136-E03CGCCACGTCACCGATCCGNONE 
013-015-G08CGCCACGTCACCGATCCGNONE 
AK059228CGCCACGTCACCGATCCGNONE 
J065040D09CGCCACGTCACCGATCCGNONE 
J065051C19CGCCACGTCACCGATCCGNONE 
J065139B05CGCCACGTCACCGATCCGNONE 
J065160E20CGCCACGTCACCGATCCGNONE 
J065207I17CGCCACGTCACCGATCCGNONE 
J080319M24CGCCACGTCACCGATCCGNONE 
Os07g0557500AK101830CACGTCACCZinc finger, RING-type domain containing protein. 
J013075M04CACGTCACCNONE 
J033068I24CACGTCACCNONE 
Os07g0661100Os07g0661100GCCACGTCACGlycosyl transferase, family 4 protein. 
Os07g0681700AK103213CCCCACGTCACGCCCACACGlycosyl transferase, family 8 protein. 
Os07g0682700003-131-G11GTGACGTGNONE 
016-086-E10GTGACGTGNONE 
AK065098GTGACGTGSimilar to Chitin-binding lectin 1 precursor (PL-I). 
AK103680GTGACGTGNONE 
J013001M18GTGACGTGNONE 
J033136D22GTGACGTGNONE 
Os07g0683200013-007-C05CGCCACGTCACNONE 
013-065-B12CGCCACGTCACNONE 
AK068606CGCCACGTCACSimilar to OsNAC6 protein. 
J013157G23CGCCACGTCACNONE 
J065027I23CGCCACGTCACNONE 
J065030M02CGCCACGTCACNONE 
J065056J02CGCCACGTCACNONE 
J065124H04CGCCACGTCACNONE 
J065142K03CGCCACGTCACNONE 
J065142M16CGCCACGTCACNONE 
J065201J05CGCCACGTCACNONE 
J065215H19CGCCACGTCACNONE 
J075195N15CGCCACGTCACNONE 
J090073O17CGCCACGTCACNONE 
J100069P10CGCCACGTCACNONE 
Os08g0119900AK119899CACGTCACConserved hypothetical protein. 
Os08g0128200AK120428GCCACGTCACCConserved hypothetical protein. 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
AK104886CGCCACGTCACGCCTCGCCCNONE 
J013089M01CGCCACGTCACGCCTCGCCCNONE 
J023037M15CGCCACGTCACGCCTCGCCCNONE 
J033068E03CGCCACGTCACGCCTCGCCCNONE 
J090021P19CGCCACGTCACGCCTCGCCCNONE 
Os08g0299200009-120-G12GCCACGTCACCNONE 
J075096F13GCCACGTCACCAdenylate cyclase domain containing protein. 
Os08g0411800AK119368GTGACGTGConserved hypothetical protein. 
Os08g0414300AK072217CACGTCACConserved hypothetical protein. 
J065039C07CACGTCACNONE 
J065098N11CACGTCACNONE 
J065120J15CACGTCACNONE 
J075076H12CACGTCACNONE 
J075101N16CACGTCACNONE 
J080010A07CACGTCACNONE 
J080023C16CACGTCACNONE 
J080027G22CACGTCACNONE 
J080053D02CACGTCACNONE 
J080065E17CACGTCACNONE 
J080068C15CACGTCACNONE 
J090061J10CACGTCACNONE 
Os08g0458600AK107384CACGTCACCheY-like domain containing protein. 
Os08g0474000009-121-F01CACGTCACNONE 
009-124-B06CACGTCACNONE 
AK062882CACGTCACSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0484700J065041E01GGTGACGTGHomeodomain-like containing protein. 
Os08g0510300AK072472CACGTCACCK+ potassium transporter family protein. 
J023020L12CACGTCACCNONE 
J023112D01CACGTCACCNONE 
J023113B06CACGTCACCNONE 
J023119J10CACGTCACCNONE 
Os08g0523600009-189-E05GGTGACGTGNONE 
AK063901GGTGACGTGSimilar to CTV.22. 
Os08g0535400004-001-H10CACGTCACCNONE 
AK071527CACGTCACCZinc finger, DHHC-type domain containing protein. 
J023107B02CACGTCACCNONE 
Os08g0536300AF358777CACGTCACCNONE 
AK099722CACGTCACCSimilar to Hd1. 
J100054G13CACGTCACCNONE 
Os08g0553800006-058-A04GGTGACGTGNONE 
006-061-F09GGTGACGTGNONE 
AK065711GGTGACGTGNONE 
AK066697GGTGACGTGNmrA-like family protein. 
AK073638GGTGACGTGNONE 
AK104428GGTGACGTGNONE 
AK105897GGTGACGTGNONE 
J075001A06GGTGACGTGNONE 
J075041H20GGTGACGTGNONE 
J075123J24GGTGACGTGNONE 
Os09g0115400AK067816CACGTCACNONE 
AK101706CACGTCACSimilar to Poly(A)-binding protein. 
Os09g0322000AK067346GCCACGTCACSimilar to PaMst-1. 
J075056E09GCCACGTCACNONE 
J100031I18GCCACGTCACNONE 
J100032J07GCCACGTCACNONE 
Os09g0394300AK105580GGTGACGTGGCGGlycoside hydrolase, family 9 protein. 
J100046E13GGTGACGTGGCGNONE 
J100049L10GGTGACGTGGCGNONE 
J100074H21GGTGACGTGGCGNONE 
J100090G03GGTGACGTGGCGNONE 
Os09g0417600006-110-A01GTGACGTGNONE 
AF467736GTGACGTGNONE 
AK059966GTGACGTGNONE 
AK068337GTGACGTGWRKY transcription factor 76. 
AY323479GTGACGTGNONE 
J013151N12GTGACGTGNONE 
J065064C11GTGACGTGNONE 
J065152D10GTGACGTGNONE 
J065162J10GTGACGTGNONE 
J075033B01GTGACGTGNONE 
Os09g0457900AK067195CACGTCACCTCGGCCCCACGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J013098P10CACGTCACCTCGGCCCCACGNONE 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0471000AK103634CACGTCACProtein of unknown function DUF1637 family protein. 
AK107828CACGTCACNONE 
Os09g0480600AK107853CACGTCACCGAGCCGHypothetical protein. 
Os09g0481200005-016-B10CGCCACGTCACCNONE 
009-011-E05CGCCACGTCACCNONE 
009-045-E02CGCCACGTCACCNONE 
009-049-A02CGCCACGTCACCNONE 
009-055-H07CGCCACGTCACCNONE 
009-067-E08CGCCACGTCACCNONE 
009-068-G08CGCCACGTCACCNONE 
009-076-E11CGCCACGTCACCNONE 
009-077-E02CGCCACGTCACCNONE 
009-085-H03CGCCACGTCACCNONE 
009-088-C06CGCCACGTCACCNONE 
009-088-D07CGCCACGTCACCNONE 
009-098-A03CGCCACGTCACCNONE 
009-100-B03CGCCACGTCACCNONE 
009-105-H04CGCCACGTCACCNONE 
009-108-D08CGCCACGTCACCNONE 
009-110-E02CGCCACGTCACCNONE 
009-114-F08CGCCACGTCACCNONE 
009-118-A09CGCCACGTCACCNONE 
009-118-C10CGCCACGTCACCNONE 
009-120-F08CGCCACGTCACCNONE 
009-123-B07CGCCACGTCACCNONE 
009-126-F11CGCCACGTCACCNONE 
009-131-D02CGCCACGTCACCNONE 
009-132-F11CGCCACGTCACCNONE 
009-133-H07CGCCACGTCACCNONE 
009-134-B03CGCCACGTCACCNONE 
009-135-D08CGCCACGTCACCNONE 
009-138-E07CGCCACGTCACCNONE 
009-138-G03CGCCACGTCACCNONE 
009-140-E05CGCCACGTCACCNONE 
009-143-B06CGCCACGTCACCNONE 
009-144-D01CGCCACGTCACCNONE 
009-147-D09CGCCACGTCACCNONE 
009-149-C09CGCCACGTCACCNONE 
009-150-F10CGCCACGTCACCNONE 
009-151-E10CGCCACGTCACCNONE 
009-151-H10CGCCACGTCACCNONE 
009-154-A08CGCCACGTCACCNONE 
009-154-D03CGCCACGTCACCNONE 
009-155-B09CGCCACGTCACCNONE 
009-163-E08CGCCACGTCACCNONE 
009-163-G11CGCCACGTCACCNONE 
009-165-B06CGCCACGTCACCNONE 
009-165-C12CGCCACGTCACCNONE 
009-165-H07CGCCACGTCACCNONE 
009-167-D02CGCCACGTCACCNONE 
009-175-F08CGCCACGTCACCNONE 
009-177-H04CGCCACGTCACCNONE 
009-177-H08CGCCACGTCACCNONE 
009-178-B09CGCCACGTCACCNONE 
009-184-E07CGCCACGTCACCNONE 
009-186-F09CGCCACGTCACCNONE 
009-188-H01CGCCACGTCACCNONE 
009-191-G10CGCCACGTCACCNONE 
009-192-C08CGCCACGTCACCNONE 
009-192-D06CGCCACGTCACCNONE 
009-195-H11CGCCACGTCACCNONE 
009-197-C06CGCCACGTCACCNONE 
AK061695CGCCACGTCACCNONE 
AK098847CGCCACGTCACCSimilar to Photosystem I reaction center subunit V (PSI-G) (Photosystem I 9 kDa protein) (Fragment). 
J013000C21CGCCACGTCACCNONE 
J065026J24CGCCACGTCACCNONE 
J065038L06CGCCACGTCACCNONE 
J065059E08CGCCACGTCACCNONE 
J065059N21CGCCACGTCACCNONE 
J065066H14CGCCACGTCACCNONE 
J065112H14CGCCACGTCACCNONE 
J065152I16CGCCACGTCACCNONE 
J065152L16CGCCACGTCACCNONE 
J065179N13CGCCACGTCACCNONE 
J065198E01CGCCACGTCACCNONE 
J075002I24CGCCACGTCACCNONE 
J075021G08CGCCACGTCACCNONE 
J075023N02CGCCACGTCACCNONE 
J075031C09CGCCACGTCACCNONE 
J075032G16CGCCACGTCACCNONE 
J075083F07CGCCACGTCACCNONE 
J075086P19CGCCACGTCACCNONE 
J075094D01CGCCACGTCACCNONE 
J075127I02CGCCACGTCACCNONE 
J075176I18CGCCACGTCACCNONE 
J100029F21CGCCACGTCACCNONE 
J100031P15CGCCACGTCACCNONE 
J100049C10CGCCACGTCACCNONE 
J100089B21CGCCACGTCACCNONE 
Os09g0551600005-020-H08CGGATCGGTGACGTGGCGNONE 
006-043-E02CGGATCGGTGACGTGGCGNONE 
013-043-F03CGGATCGGTGACGTGGCGNONE 
AK066658CGGATCGGTGACGTGGCGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGGATCGGTGACGTGGCGNONE 
J065177J20CGGATCGGTGACGTGGCGNONE 
J075041D06CGGATCGGTGACGTGGCGNONE 
J075199H24CGGATCGGTGACGTGGCGNONE 
J080001G07CGGATCGGTGACGTGGCGNONE 
J080024A12CGGATCGGTGACGTGGCGNONE 
J080025B15CGGATCGGTGACGTGGCGNONE 
J090017G07CGGATCGGTGACGTGGCGNONE 
J090050G23CGGATCGGTGACGTGGCGNONE 
J090083G11CGGATCGGTGACGTGGCGNONE 
Os11g0130200AK059458CACGTCACProtein of unknown function DUF309 family protein. 
J075195F21CACGTCACNONE 
Os11g0139400AK107562CACGTCACCProtein of unknown function DUF250 domain containing protein. 
Os11g0216300AK067129GTGACGTGGCABC-1 domain containing protein. 
Os11g0484000012-001-D04CACGTCACTGACANONE 
AK065321CACGTCACTGACAClass II aldolase/adducin, N-terminal family protein. 
J013002P15CACGTCACTGACANONE 
Os11g0512000AK107369CACGTCACNo apical meristem (NAM) protein domain containing protein. 
J075006M23CACGTCACNONE 
J075069E01CACGTCACNONE 
J075073J15CACGTCACNONE 
J075081H21CACGTCACNONE 
J075081I24CACGTCACNONE 
J075098E10CACGTCACNONE 
J075109B07CACGTCACNONE 
J075109B09CACGTCACNONE 
J075109K23CACGTCACNONE 
J075120F18CACGTCACNONE 
J075121H03CACGTCACNONE 
J075174O18CACGTCACNONE 
J075177G19CACGTCACNONE 
J075179P19CACGTCACNONE 
J075195P18CACGTCACNONE 
J075196B20CACGTCACNONE 
J090068H20CACGTCACNONE 
Os11g0513900AK101049GTGACGTGConserved hypothetical protein. 
Os11g0536900J100027G18GCCACGTCACCConserved hypothetical protein. 
J100073G12GCCACGTCACCNONE 
Os12g0168000AK072953GTGACGTGNONE 
Os12g0511300015-003-D12CACGTCACNONE 
AK064077CACGTCACNONE 
AK109892CACGTCACNONE 
AK121419CACGTCACConserved hypothetical protein. 
J065020L21CACGTCACNONE 
J065033D11CACGTCACNONE 
J065038K03CACGTCACNONE 
J065043A18CACGTCACNONE 
J065056F02CACGTCACNONE 
J065071M10CACGTCACNONE 
J065158M05CACGTCACNONE 
J065161E23CACGTCACNONE 
J065202O07CACGTCACNONE 
J065208N21CACGTCACNONE 
J100069C18CACGTCACNONE 
J100088H18CACGTCACNONE 
J100090B10CACGTCACNONE 
Os12g0626400AK063967CACGTCACCSimilar to Phytoene synthase 1, chloroplast precursor (EC 2.5.1.-) (Fruit ripening specific protein pTOM5). 
AK073290CACGTCACCNONE 
AY452768CACGTCACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.