version

Summary of OsREG506 (All List)

OrganismOryza sativa  
IDOsREG506  
SequenceCACGTCTC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE Motif 
Total Entry Count919  

Entry Sequences (919 entries)

LocusGene modelSequenceDescription
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0186900013-032-B12GAGACGTGNONE 
013-069-C11GAGACGTGNONE 
AK105323GAGACGTGNONE 
AK105331GAGACGTGConserved hypothetical protein. 
AK106168GAGACGTGNONE 
J065023I10GAGACGTGNONE 
J065182I03GAGACGTGNONE 
J075116O22GAGACGTGNONE 
J090082G13GAGACGTGNONE 
J100060H12GAGACGTGNONE 
Os01g0222700012-011-E01GAGACGTGACGTGNONE 
AK068883GAGACGTGACGTGNONE 
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGACGTGACGTGNONE 
J043013D08GAGACGTGACGTGNONE 
J065089G19GAGACGTGACGTGNONE 
J065197K19GAGACGTGACGTGNONE 
J075161L21GAGACGTGACGTGNONE 
Os01g0328300AK064025GAGACGTGNONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0558600006-120-G12GAGACGTGNONE 
J013100N20GAGACGTGNONE 
J033043P09GAGACGTGNONE 
J033125M18GAGACGTGNONE 
J053043N11GAGACGTGNONE 
J065008E07GAGACGTGNONE 
J065080O16GAGACGTGNONE 
J075002G24GAGACGTGNONE 
J075123C09GAGACGTGNONE 
S66160GAGACGTGRas-related protein RIC1. 
Os01g0559000006-032-B11GAGACGTGGCGNONE 
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein. 
Os01g0584900AK108522GAGACGTGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846GAGACGTGNONE 
J065161G19GAGACGTGNONE 
J065193D14GAGACGTGNONE 
J065193L05GAGACGTGNONE 
J065196K16GAGACGTGNONE 
Os01g0597600J075191I06CACGTCTCAmino acid/polyamine transporter II family protein. 
Os01g0639600005-018-A02CACGTCTCNONE 
AK067056CACGTCTCProtein of unknown function DUF1645 family protein. 
J013066M03CACGTCTCNONE 
J013066O05CACGTCTCNONE 
J013088M21CACGTCTCNONE 
J065045F04CACGTCTCNONE 
J080018F22CACGTCTCNONE 
J080037B10CACGTCTCNONE 
J080042G23CACGTCTCNONE 
J080052B21CACGTCTCNONE 
J080060H13CACGTCTCNONE 
J100024A05CACGTCTCNONE 
J100071A09CACGTCTCNONE 
J100080K14CACGTCTCNONE 
Os01g0772500AK109736CACGTCTCGCGCGGlycosyl transferase, family 14 protein. 
Os01g0793900009-109-G11CACGTCTCNONE 
009-125-A10CACGTCTCNONE 
AK062811CACGTCTCConserved hypothetical protein. 
Os01g0806400Os01g0806400GAGACGTGTCCProtein of unknown function DUF617, plant family protein. 
Os01g0819300AK107799GAGACGTGConserved hypothetical protein. 
Os01g0869800006-029-F03GAGACGTGGCNONE 
006-067-H02GAGACGTGGCNONE 
006-084-A06GAGACGTGGCNONE 
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS. 
AK071827GAGACGTGGCNONE 
AK104275GAGACGTGGCNONE 
J013049J07GAGACGTGGCNONE 
J033089F12GAGACGTGGCNONE 
J090094I11GAGACGTGGCNONE 
Os01g0954900AK110957CACGTCTCSimilar to Nucleoid DNA-binding-like protein. 
Os01g0962400AK059165GAGACGTGProtein of unknown function UPF0185 family protein. 
J013157N02GAGACGTGNONE 
J065169F13GAGACGTGNONE 
J065192L21GAGACGTGNONE 
J075016P11GAGACGTGNONE 
J075023M14GAGACGTGNONE 
J075051K17GAGACGTGNONE 
J075053O05GAGACGTGNONE 
J075080D08GAGACGTGNONE 
J075080P04GAGACGTGNONE 
J075088B19GAGACGTGNONE 
J075137L06GAGACGTGNONE 
J100029C08GAGACGTGNONE 
J100067J09GAGACGTGNONE 
Os02g0109200AK108815GCGCGCGAGACGTGNONE 
J100030O18GCGCGCGAGACGTGNONE 
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein. 
Os02g0143200AK070600CCCCACGTCTCArmadillo-like helical domain containing protein. 
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein. 
J065117F22CGTCGGATGAGACGTGNONE 
Os02g0184000AK072584CACGTCTCZinc finger, DHHC-type domain containing protein. 
J090079L17CACGTCTCNONE 
Os02g0226200Os02g0226200CACGTCTCHAD-superfamily subfamily IB hydrolase, hypothetical 1 protein. 
Os02g0327500AK069802GCCCACGTCTCProtein of unknown function DUF266, plant family protein. 
J065186I04GCCCACGTCTCNONE 
Os02g0528500J053035P18GAGACGTGNONE 
J053046L13GAGACGTGNONE 
J053099F11GAGACGTGNONE 
Os02g0530600AK102681CCCCCACGTCTCGCGTCTCBRCT domain containing protein. 
Os02g0534600Os02g0534600CACGTCTCConserved hypothetical protein. 
Os02g0555300AK108454CACGTCTCNo apical meristem (NAM) protein domain containing protein. 
Os02g0576400AK107966CACGTCTCConserved hypothetical protein. 
J075083G06CACGTCTCNONE 
J075164K09CACGTCTCNONE 
Os02g0579000AB028180GCCACGTCTCNONE 
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein. 
J065045C05GCCACGTCTCNONE 
J065191M18GCCACGTCTCNONE 
J065207F02GCCACGTCTCNONE 
J065213H24GCCACGTCTCNONE 
J075003H02GCCACGTCTCNONE 
J075143B14GCCACGTCTCNONE 
J100051O03GCCACGTCTCNONE 
J100075K22GCCACGTCTCNONE 
Os02g0643500AK068423CACGTCTCPentapeptide repeat containing protein. 
Os02g0663800AK069605GAGACGTGSimilar to Actin-depolymerizing factor (ADF). 
J023022O15GAGACGTGNONE 
J023138H18GAGACGTGNONE 
Os02g0672200AK112025CACGTCTCNONE 
Os02g0710300AK109662GAGACGTGSimilar to INDEHISCENT protein. 
Os02g0782100AK065421CACGTCTCChorismate synthase family protein. 
J065038A03CACGTCTCNONE 
Os02g0782300AK109297GGCTGGGCGAGACGTGNONE 
Os03g0131200AB020502CACGTCTCNONE 
AK062174CACGTCTCNONE 
AK066378CACGTCTCSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372CACGTCTCNONE 
J013060B21CACGTCTCNONE 
J013149P20CACGTCTCNONE 
J023060E16CACGTCTCNONE 
J043004A19CACGTCTCNONE 
J053029N09CACGTCTCNONE 
J053072I10CACGTCTCNONE 
J065016G02CACGTCTCNONE 
J065022E22CACGTCTCNONE 
J065024K17CACGTCTCNONE 
J065035E10CACGTCTCNONE 
J065036D13CACGTCTCNONE 
J065041E06CACGTCTCNONE 
J065064H14CACGTCTCNONE 
J065067I06CACGTCTCNONE 
J065080C01CACGTCTCNONE 
J065086K23CACGTCTCNONE 
J065087L12CACGTCTCNONE 
J065090I05CACGTCTCNONE 
J065117E23CACGTCTCNONE 
J065120A10CACGTCTCNONE 
J065120L22CACGTCTCNONE 
J065123F02CACGTCTCNONE 
J065128G02CACGTCTCNONE 
J065142B04CACGTCTCNONE 
J065143K12CACGTCTCNONE 
J065148B18CACGTCTCNONE 
J065153C16CACGTCTCNONE 
J065163J11CACGTCTCNONE 
J065168L24CACGTCTCNONE 
J065181J11CACGTCTCNONE 
J065190F19CACGTCTCNONE 
J065209E24CACGTCTCNONE 
J065210G04CACGTCTCNONE 
J065217H17CACGTCTCNONE 
J065219I20CACGTCTCNONE 
J075001M13CACGTCTCNONE 
J075007B08CACGTCTCNONE 
J075009I01CACGTCTCNONE 
J075014C11CACGTCTCNONE 
J075014L02CACGTCTCNONE 
J075016E07CACGTCTCNONE 
J075017J02CACGTCTCNONE 
J075018F07CACGTCTCNONE 
J075018N07CACGTCTCNONE 
J075019B06CACGTCTCNONE 
J075024F21CACGTCTCNONE 
J075026B18CACGTCTCNONE 
J075026M12CACGTCTCNONE 
J075032B13CACGTCTCNONE 
J075033O09CACGTCTCNONE 
J075041A09CACGTCTCNONE 
J075045L13CACGTCTCNONE 
J075048N11CACGTCTCNONE 
J075052A14CACGTCTCNONE 
J075061B17CACGTCTCNONE 
J075061I05CACGTCTCNONE 
J075066I11CACGTCTCNONE 
J075066P09CACGTCTCNONE 
J075068F03CACGTCTCNONE 
J075068P22CACGTCTCNONE 
J075080I15CACGTCTCNONE 
J075081I07CACGTCTCNONE 
J075082K01CACGTCTCNONE 
J075083A18CACGTCTCNONE 
J075086O11CACGTCTCNONE 
J075087E02CACGTCTCNONE 
J075087M19CACGTCTCNONE 
J075088G23CACGTCTCNONE 
J075092K18CACGTCTCNONE 
J075095H15CACGTCTCNONE 
J075095K12CACGTCTCNONE 
J075096L06CACGTCTCNONE 
J075100H23CACGTCTCNONE 
J075100K01CACGTCTCNONE 
J075102K21CACGTCTCNONE 
J075104F24CACGTCTCNONE 
J075106C17CACGTCTCNONE 
J075106E06CACGTCTCNONE 
J075106M19CACGTCTCNONE 
J075106O12CACGTCTCNONE 
J075108I09CACGTCTCNONE 
J075111M06CACGTCTCNONE 
J075112E12CACGTCTCNONE 
J075114C04CACGTCTCNONE 
J075120A06CACGTCTCNONE 
J075120D14CACGTCTCNONE 
J075122P15CACGTCTCNONE 
J075123A11CACGTCTCNONE 
J075123L12CACGTCTCNONE 
J075127G14CACGTCTCNONE 
J075127H09CACGTCTCNONE 
J075128M04CACGTCTCNONE 
J075129J04CACGTCTCNONE 
J075130J01CACGTCTCNONE 
J075137N02CACGTCTCNONE 
J075137O14CACGTCTCNONE 
J075138H22CACGTCTCNONE 
J075139P16CACGTCTCNONE 
J075141G08CACGTCTCNONE 
J075142C17CACGTCTCNONE 
J075143B09CACGTCTCNONE 
J075156I11CACGTCTCNONE 
J075158M03CACGTCTCNONE 
J075166I21CACGTCTCNONE 
J075167C08CACGTCTCNONE 
J075170C12CACGTCTCNONE 
J075170F08CACGTCTCNONE 
J075170G04CACGTCTCNONE 
J075172N16CACGTCTCNONE 
J075172P13CACGTCTCNONE 
J075173G24CACGTCTCNONE 
J075175D01CACGTCTCNONE 
J075175K01CACGTCTCNONE 
J075181O04CACGTCTCNONE 
J075186A04CACGTCTCNONE 
J075190B08CACGTCTCNONE 
J075190M24CACGTCTCNONE 
J075193D18CACGTCTCNONE 
J075193H03CACGTCTCNONE 
J075195N18CACGTCTCNONE 
J080001N20CACGTCTCNONE 
J080006K17CACGTCTCNONE 
J080012I16CACGTCTCNONE 
J080013K20CACGTCTCNONE 
J080018N01CACGTCTCNONE 
J080041G15CACGTCTCNONE 
J080048L15CACGTCTCNONE 
J080049A21CACGTCTCNONE 
J080075G12CACGTCTCNONE 
J080076O09CACGTCTCNONE 
J080078P10CACGTCTCNONE 
J080084D10CACGTCTCNONE 
J090005N07CACGTCTCNONE 
Os03g0136400015-024-C11CACGTCTCNONE 
015-036-H11CACGTCTCNONE 
016-006-B01CACGTCTCNONE 
AK107027CACGTCTCSimilar to Inorganic phosphate transporter 1. 
AK121484CACGTCTCNONE 
AY569611CACGTCTCNONE 
J023119F21CACGTCTCNONE 
J023138A04CACGTCTCNONE 
J023141L20CACGTCTCNONE 
J023149P03CACGTCTCNONE 
J033088J04CACGTCTCNONE 
J065019D17CACGTCTCNONE 
J065075M14CACGTCTCNONE 
J065124F08CACGTCTCNONE 
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE 
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein. 
J013129L02CGCACCGCGACACGTCACGTCTCNONE 
J033025H22CGCACCGCGACACGTCACGTCTCNONE 
J033034L15CGCACCGCGACACGTCACGTCTCNONE 
J033044F21CGCACCGCGACACGTCACGTCTCNONE 
J033046F15CGCACCGCGACACGTCACGTCTCNONE 
J033101I17CGCACCGCGACACGTCACGTCTCNONE 
J033150K16CGCACCGCGACACGTCACGTCTCNONE 
J065042G12CGCACCGCGACACGTCACGTCTCNONE 
J065083F17CGCACCGCGACACGTCACGTCTCNONE 
J100044G19CGCACCGCGACACGTCACGTCTCNONE 
Os03g0152700AK067387CACGTCTCRNA-binding S4 domain containing protein. 
J013099O15CACGTCTCNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0180900AK073589GAGACGTGZIM domain containing protein. 
J023044O09GAGACGTGNONE 
J033051K03GAGACGTGNONE 
J043020I11GAGACGTGNONE 
J065005J15GAGACGTGNONE 
J065009L10GAGACGTGNONE 
J065121F02GAGACGTGNONE 
J065124M17GAGACGTGNONE 
J065140F24GAGACGTGNONE 
J065178M13GAGACGTGNONE 
J065178M14GAGACGTGNONE 
J065186G13GAGACGTGNONE 
J100053L08GAGACGTGNONE 
Os03g0228900J065037A17CACGTCTCNONE 
J065053L23CACGTCTCNONE 
J065061G13CACGTCTCNONE 
J065100L21CACGTCTCNONE 
J065101C08CACGTCTCNONE 
J065112B13CACGTCTCHypothetical protein. 
J065114G11CACGTCTCNONE 
J065122L03CACGTCTCNONE 
J065127B04CACGTCTCNONE 
Os03g0242300AK065146CACGTCTCConserved hypothetical protein. 
J013002A22CACGTCTCNONE 
J023088H11CACGTCTCNONE 
J065083M12CACGTCTCNONE 
J065169P06CACGTCTCNONE 
J100037B08CACGTCTCNONE 
Os03g0248000AK070612CACGTCTCNONE 
AK071419CACGTCTCNONE 
AK100304CACGTCTCAutophagy protein Apg9 family protein. 
Os03g0268300AK102684CACGTCTCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22CACGTCTCNONE 
J013057J23CACGTCTCNONE 
J013149I10CACGTCTCNONE 
J013149M20CACGTCTCNONE 
J013151D14CACGTCTCNONE 
J013162O11CACGTCTCNONE 
J023001F12CACGTCTCNONE 
J023031B21CACGTCTCNONE 
J023080A07CACGTCTCNONE 
J023081N04CACGTCTCNONE 
J023090C08CACGTCTCNONE 
J023134G05CACGTCTCNONE 
J023139G17CACGTCTCNONE 
J023143I10CACGTCTCNONE 
J023147D04CACGTCTCNONE 
J023147O15CACGTCTCNONE 
J033102K23CACGTCTCNONE 
J033106C17CACGTCTCNONE 
J075033G19CACGTCTCNONE 
J075039J18CACGTCTCNONE 
J075050K20CACGTCTCNONE 
J075075J03CACGTCTCNONE 
J075080E16CACGTCTCNONE 
J075086L08CACGTCTCNONE 
J075091K19CACGTCTCNONE 
J075099O20CACGTCTCNONE 
J075104I06CACGTCTCNONE 
J075137C16CACGTCTCNONE 
J075152G03CACGTCTCNONE 
J075176N12CACGTCTCNONE 
J100086K11CACGTCTCNONE 
Os03g0296300AK100042CACGTCTCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os03g0296400AK073460GAGACGTGSimilar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment). 
AK104149GAGACGTGNONE 
AK105818GAGACGTGNONE 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0565600J090030D24CACGTCTCNONE 
Os03g0663800011-023-B06GAGACGTGGCGNONE 
011-033-C06GAGACGTGGCGNONE 
012-011-E03GAGACGTGGCGNONE 
012-014-F04GAGACGTGGCGNONE 
012-027-C01GAGACGTGGCGNONE 
012-027-H07GAGACGTGGCGNONE 
012-031-A02GAGACGTGGCGNONE 
012-044-E05GAGACGTGGCGNONE 
012-045-G10GAGACGTGGCGNONE 
012-049-H02GAGACGTGGCGNONE 
012-053-G08GAGACGTGGCGNONE 
012-058-D07GAGACGTGGCGNONE 
012-061-H02GAGACGTGGCGNONE 
012-066-A02GAGACGTGGCGNONE 
012-074-F12GAGACGTGGCGNONE 
012-079-D08GAGACGTGGCGNONE 
012-081-E05GAGACGTGGCGNONE 
012-083-F04GAGACGTGGCGNONE 
012-084-F08GAGACGTGGCGNONE 
012-086-E08GAGACGTGGCGNONE 
012-086-F01GAGACGTGGCGNONE 
012-087-F03GAGACGTGGCGNONE 
012-087-H02GAGACGTGGCGNONE 
012-088-E05GAGACGTGGCGNONE 
012-089-B02GAGACGTGGCGNONE 
014-016-A04GAGACGTGGCGNONE 
AK105347GAGACGTGGCGNONE 
J075032I06GAGACGTGGCGNONE 
J075041O22GAGACGTGGCGNONE 
J075093E24GAGACGTGGCGNONE 
J075094E06GAGACGTGGCGNONE 
U45322GAGACGTGGCGCupin region domain containing protein. 
Os03g0703000011-082-B01CCCCACGTCTCNONE 
014-041-E03CCCCACGTCTCNONE 
AK100165CCCCACGTCTCNONE 
AK103027CCCCACGTCTCNONE 
AK105026CCCCACGTCTCNONE 
J013146C10CCCCACGTCTCNONE 
J023050B03CCCCACGTCTCNONE 
J033117C01CCCCACGTCTCNONE 
J080039D22CCCCACGTCTCNONE 
J090013G10CCCCACGTCTCNONE 
J090025K21CCCCACGTCTCNONE 
J090052K21CCCCACGTCTCNONE 
J090074F22CCCCACGTCTCNONE 
J100063C18CCCCACGTCTCNONE 
J100083C15CCCCACGTCTCNONE 
U28047CCCCACGTCTCSimilar to Beta-glucosidase. 
Os03g0760500AK100633GAGACGTGCytochrome P450 family protein. 
Os03g0780400011-100-D09CCCCACGTCTCNONE 
AK061347CCCCACGTCTCNONE 
AK073162CCCCACGTCTCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCCACGTCTCNONE 
J065045I07CCCCACGTCTCNONE 
J090036F17CCCCACGTCTCNONE 
J090077M14CCCCACGTCTCNONE 
J100055G20CCCCACGTCTCNONE 
Os03g0786100006-022-C03CACGTCTCNONE 
006-080-F11CACGTCTCNONE 
015-008-D04CACGTCTCNONE 
016-058-E09CACGTCTCNONE 
AF022740CACGTCTCNONE 
AK061719CACGTCTCSimilar to Glycolate oxidase (EC 1.1.3.15) (Fragment). 
AK098878CACGTCTCNONE 
AK120304CACGTCTCNONE 
J013000O05CACGTCTCNONE 
J013001E15CACGTCTCNONE 
J013092D22CACGTCTCNONE 
J013153E14CACGTCTCNONE 
J023025M01CACGTCTCNONE 
J023074D02CACGTCTCNONE 
J023105H23CACGTCTCNONE 
J023139M03CACGTCTCNONE 
J023145L05CACGTCTCNONE 
J023148L22CACGTCTCNONE 
J033123C09CACGTCTCNONE 
J065005A15CACGTCTCNONE 
J065013I07CACGTCTCNONE 
J065037C19CACGTCTCNONE 
J065057K02CACGTCTCNONE 
J065077P12CACGTCTCNONE 
J065081F14CACGTCTCNONE 
J065218J06CACGTCTCNONE 
J080013H06CACGTCTCNONE 
J080304A21CACGTCTCNONE 
J090075B05CACGTCTCNONE 
J090094I08CACGTCTCNONE 
J100022K05CACGTCTCNONE 
J100063M22CACGTCTCNONE 
J100065M16CACGTCTCNONE 
J100077A07CACGTCTCNONE 
Os03g0788800AK071670CACGTCTCZinc finger, RING-type domain containing protein. 
J013090J22CACGTCTCNONE 
J023050M06CACGTCTCNONE 
J023073A12CACGTCTCNONE 
J023075P21CACGTCTCNONE 
J023106F04CACGTCTCNONE 
J075181H19CACGTCTCNONE 
J090009C24CACGTCTCNONE 
J100027L24CACGTCTCNONE 
J100055F06CACGTCTCNONE 
J100081C22CACGTCTCNONE 
J100084I21CACGTCTCNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0849900006-063-F01CACGTCTCNONE 
006-082-G05CACGTCTCNONE 
009-157-E10CACGTCTCNONE 
016-061-A06CACGTCTCNONE 
AK071606CACGTCTCNONE 
AK104518CACGTCTCNONE 
AK105978CACGTCTCConserved hypothetical protein. 
J023099J20CACGTCTCNONE 
J043026K14CACGTCTCNONE 
J043036C20CACGTCTCNONE 
Os04g0295500AK107143CACGTCTCConserved hypothetical protein. 
Os04g0437000J065046G11CACGTCTCNONE 
J065141A18CACGTCTCNo apical meristem (NAM) protein domain containing protein. 
J100029L01CACGTCTCNONE 
J100032L13CACGTCTCNONE 
J100082O14CACGTCTCNONE 
Os04g0447300AK111006GAGACGTGConserved hypothetical protein. 
Os04g0460600006-040-E02CACGTCTCNONE 
AB028181CACGTCTCNONE 
AK061745CACGTCTCSimilar to NAM / CUC2-like protein. 
AK071020CACGTCTCNONE 
AK104626CACGTCTCNONE 
J013052N07CACGTCTCNONE 
J023080H09CACGTCTCNONE 
J023093B17CACGTCTCNONE 
J043034H10CACGTCTCNONE 
J100022I17CACGTCTCNONE 
J100055I15CACGTCTCNONE 
Os04g0479300AK106088CACGTCTCConserved hypothetical protein. 
Os04g0493000J013052L03GAGACGTGTCGNONE 
J080308E10GAGACGTGTCGNONE 
Os04g0525000AK067753GCCACACGTCTCConserved hypothetical protein. 
J013118G14GCCACACGTCTCNONE 
J065026J15GCCACACGTCTCNONE 
J065184H21GCCACACGTCTCNONE 
J065186H22GCCACACGTCTCNONE 
J065193D20GCCACACGTCTCNONE 
J075060D12GCCACACGTCTCNONE 
J075179L24GCCACACGTCTCNONE 
Os04g0540600AF464932GAGACGTGGGGCNONE 
AK071169GAGACGTGGGGCAldehyde dehydrogenase NAD(P)-dependent family protein. 
J023022A08GAGACGTGGGGCNONE 
J023127F17GAGACGTGGGGCNONE 
J033127K14GAGACGTGGGGCNONE 
J075060H15GAGACGTGGGGCNONE 
J080063F04GAGACGTGGGGCNONE 
J090030C21GAGACGTGGGGCNONE 
J090049I06GAGACGTGGGGCNONE 
Os04g0586700012-045-A04GAGACGTGNONE 
AK063488GAGACGTGZinc finger, RING-type domain containing protein. 
J065073M14GAGACGTGNONE 
J065132G04GAGACGTGNONE 
J065205J21GAGACGTGNONE 
J100043M22GAGACGTGNONE 
Os04g0643100014-026-F09GAGACGTGTCCNONE 
AK067501GAGACGTGTCCSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK106989GAGACGTGTCCNONE 
J013110H12GAGACGTGTCCNONE 
J090089E23GAGACGTGTCCNONE 
J100033G14GAGACGTGTCCNONE 
J100033L15GAGACGTGTCCNONE 
J100041J24GAGACGTGTCCNONE 
J100041M14GAGACGTGTCCNONE 
J100057A03GAGACGTGTCCNONE 
J100059C11GAGACGTGTCCNONE 
J100072B15GAGACGTGTCCNONE 
J100073N24GAGACGTGTCCNONE 
Os04g0647800AK065350GAGACGTGSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876GAGACGTGNONE 
AK104069GAGACGTGNONE 
Os04g0656800011-008-B09CACGTCTCNONE 
Os04g0661200AK102842CACGTCTCProtein of unknown function DUF941 family protein. 
J033075E19CACGTCTCNONE 
J033109O19CACGTCTCNONE 
J065002J12CACGTCTCNONE 
J065026E22CACGTCTCNONE 
J065061F05CACGTCTCNONE 
J065068D22CACGTCTCNONE 
J065072N14CACGTCTCNONE 
J065085F02CACGTCTCNONE 
J075055G19CACGTCTCNONE 
J075105B14CACGTCTCNONE 
J075118M17CACGTCTCNONE 
J075193H02CACGTCTCNONE 
J100040O05CACGTCTCNONE 
J100064I04CACGTCTCNONE 
Os04g0690600011-007-D04GAGACGTGNONE 
AK109449GAGACGTGConserved hypothetical protein. 
J065019H13GAGACGTGNONE 
J065021N08GAGACGTGNONE 
J065085C08GAGACGTGNONE 
J065214O07GAGACGTGNONE 
Os05g0218100AK108327CACGTCTCConserved hypothetical protein. 
Os05g0397300009-051-E02CACGTCTCNONE 
009-060-E03CACGTCTCNONE 
009-075-B01CACGTCTCNONE 
009-082-B11CACGTCTCNONE 
009-136-D05CACGTCTCNONE 
AK062621CACGTCTCNONE 
AK066003CACGTCTCNONE 
AK070832CACGTCTCConserved hypothetical protein. 
J023066C05CACGTCTCNONE 
Os05g0428600AK106696CACGTCTCSimilar to HSP70 precursor. 
Os05g0552300AK062179CACGTCTCSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK065272CACGTCTCNONE 
AK121567CACGTCTCNONE 
J013002L07CACGTCTCNONE 
J013096F06CACGTCTCNONE 
J013111B06CACGTCTCNONE 
J023024K23CACGTCTCNONE 
J023036P19CACGTCTCNONE 
J033034A18CACGTCTCNONE 
J033034P13CACGTCTCNONE 
J033051E12CACGTCTCNONE 
J033087M05CACGTCTCNONE 
J033092G03CACGTCTCNONE 
J033098N21CACGTCTCNONE 
J033103B15CACGTCTCNONE 
J043038F23CACGTCTCNONE 
J065096K22CACGTCTCNONE 
J065167D17CACGTCTCNONE 
J100040H06CACGTCTCNONE 
J100048M06CACGTCTCNONE 
J100087G01CACGTCTCNONE 
Os05g0560600011-097-B07CACGTCTCCGATCCGNONE 
AK067862CACGTCTCCGATCCGNONE 
AK122091CACGTCTCCGATCCGHomeodomain-like containing protein. 
J013124K11CACGTCTCCGATCCGNONE 
J033124C04CACGTCTCCGATCCGNONE 
J065013L06CACGTCTCCGATCCGNONE 
J065117J23CACGTCTCCGATCCGNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0136900AK107405GAGACGTGGGCProtein of unknown function DUF296 domain containing protein. 
Os06g0143000AB014056CACGTCTCNONE 
AK062073CACGTCTCNONE 
AK071301CACGTCTCIron-superoxide dismutase (EC 1.15.1.1). 
J013043A16CACGTCTCNONE 
J023001M11CACGTCTCNONE 
J023087L08CACGTCTCNONE 
J023145K23CACGTCTCNONE 
J033123L01CACGTCTCNONE 
J065127O08CACGTCTCNONE 
Os06g0151900AK058759GAGACGTGPhosphofructokinase family protein. 
Os06g0153200AK072625CACGTCTCNONE 
AK106752CACGTCTCProtein of unknown function DUF250 domain containing protein. 
Os06g0506600009-119-E12GAGACGTGNONE 
J023086A18GAGACGTGNONE 
J033036I02GAGACGTGNONE 
J033125C16GAGACGTGNONE 
J065013I11GAGACGTGNONE 
J065026O21GAGACGTGNONE 
J065060H10GAGACGTGNONE 
J065067A15GAGACGTGNONE 
J065068F07GAGACGTGNONE 
J065085N06GAGACGTGNONE 
J065108N10GAGACGTGNONE 
J065161O11GAGACGTGNONE 
J065185J15GAGACGTGNONE 
J065191H18GAGACGTGNONE 
J065199J09GAGACGTGNONE 
J075005G03GAGACGTGNONE 
J075018C16GAGACGTGNONE 
J075061K20GAGACGTGNONE 
J075069J06GAGACGTGNONE 
J075075H19GAGACGTGNONE 
J075076D20GAGACGTGNONE 
J075078D16GAGACGTGNONE 
J075100J19GAGACGTGNONE 
J075110M11GAGACGTGNONE 
J075157N05GAGACGTGNONE 
J075171F20GAGACGTGNONE 
J075177G08GAGACGTGNONE 
J075179G08GAGACGTGNONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0698711AK070810CGACACGTCTCGGCCConserved hypothetical protein. 
J065019B03CGACACGTCTCGGCCNONE 
J065047C24CGACACGTCTCGGCCNONE 
Os06g0698748004-013-F09CGACACGTCTCNONE 
006-099-E12CGACACGTCTCNONE 
009-074-D06CGACACGTCTCNONE 
009-081-C02CGACACGTCTCNONE 
013-065-B10CGACACGTCTCNONE 
AK100361CGACACGTCTCConserved hypothetical protein. 
AK105781CGACACGTCTCNONE 
J013088K23CGACACGTCTCNONE 
J013158L05CGACACGTCTCNONE 
J023083M02CGACACGTCTCNONE 
J075034E21CGACACGTCTCNONE 
J075049F24CGACACGTCTCNONE 
J075055A21CGACACGTCTCNONE 
J100044A04CGACACGTCTCNONE 
J100058I01CGACACGTCTCNONE 
Os07g0162400006-026-C05CACGTCTCNONE 
AK060082CACGTCTCEsterase/lipase/thioesterase domain containing protein. 
Os07g0162600015-024-F04CACGTCTCNONE 
AK105789CACGTCTCNONE 
AK106274CACGTCTCEsterase/lipase/thioesterase domain containing protein. 
J100026E18CACGTCTCNONE 
J100037B07CACGTCTCNONE 
J100090H11CACGTCTCNONE 
Os07g0554600AK072955CACGTCTCConserved hypothetical protein. 
Os07g0620800AK063671CGCCACGTCTCCyclin-like domain containing protein. 
Os08g0100400AK102424GAGACGTGNONE 
J033093E21GAGACGTGNONE 
Os08g0100500006-093-G03CACGTCTCNONE 
AK109496CACGTCTCNONE 
J013097K15CACGTCTCNONE 
J023027K12CACGTCTCNONE 
J033046J03CACGTCTCNONE 
J075012A04CACGTCTCNONE 
J075056N17CACGTCTCNONE 
J075104O11CACGTCTCNONE 
J075177A17CACGTCTCNONE 
J090012E07CACGTCTCNONE 
J090054H18CACGTCTCNONE 
J090061K07CACGTCTCNONE 
Os08g0157900012-025-H08CCCACCACGTCTCNONE 
012-069-E02CCCACCACGTCTCNONE 
012-074-H11CCCACCACGTCTCNONE 
AK065294CCCACCACGTCTCSimilar to NAM protein. 
J013002N10CCCACCACGTCTCNONE 
J013042J10CCCACCACGTCTCNONE 
J023060K03CCCACCACGTCTCNONE 
J023145N12CCCACCACGTCTCNONE 
J033040L20CCCACCACGTCTCNONE 
J033044L13CCCACCACGTCTCNONE 
J033057C19CCCACCACGTCTCNONE 
J033107E01CCCACCACGTCTCNONE 
J033123M07CCCACCACGTCTCNONE 
J033136I18CCCACCACGTCTCNONE 
J065051P18CCCACCACGTCTCNONE 
J065055L08CCCACCACGTCTCNONE 
J065196D15CCCACCACGTCTCNONE 
Os08g0244100012-067-B02CCCACTCTCACGTCTCNONE 
AK064015CCCACTCTCACGTCTCNONE 
AK101898CCCACTCTCACGTCTCNONE 
AK102977CCCACTCTCACGTCTCt-snare domain containing protein. 
J033071B08CCCACTCTCACGTCTCNONE 
J033115N03CCCACTCTCACGTCTCNONE 
J065031I08CCCACTCTCACGTCTCNONE 
J065091O05CCCACTCTCACGTCTCNONE 
J065116E21CCCACTCTCACGTCTCNONE 
J065131F08CCCACTCTCACGTCTCNONE 
J065196N04CCCACTCTCACGTCTCNONE 
J075064N17CCCACTCTCACGTCTCNONE 
J075078P10CCCACTCTCACGTCTCNONE 
J075108N23CCCACTCTCACGTCTCNONE 
J075142C18CCCACTCTCACGTCTCNONE 
J075163I12CCCACTCTCACGTCTCNONE 
J075177B18CCCACTCTCACGTCTCNONE 
J075178A18CCCACTCTCACGTCTCNONE 
J075191N04CCCACTCTCACGTCTCNONE 
Os08g0270900AK108117CACGTCTCConserved hypothetical protein. 
Os08g0326600AK065219GAGACGTGTCGSimilar to GMP synthetase. 
Os08g0440100AK068551CACGTCTCSimilar to Temperature stress-induced lipocalin. 
J013155M04CACGTCTCNONE 
J033041C20CACGTCTCNONE 
J043031L02CACGTCTCNONE 
J043038J23CACGTCTCNONE 
J065006F20CACGTCTCNONE 
J065030H05CACGTCTCNONE 
J065069H05CACGTCTCNONE 
J065078M19CACGTCTCNONE 
J065146E24CACGTCTCNONE 
J065154J17CACGTCTCNONE 
J065158L04CACGTCTCNONE 
J065182J20CACGTCTCNONE 
J065211P16CACGTCTCNONE 
J075020M18CACGTCTCNONE 
J075035J01CACGTCTCNONE 
J075037K13CACGTCTCNONE 
J075052E12CACGTCTCNONE 
J075056I12CACGTCTCNONE 
J075064H18CACGTCTCNONE 
J075121E06CACGTCTCNONE 
J075123H03CACGTCTCNONE 
J075146P20CACGTCTCNONE 
J075156O06CACGTCTCNONE 
J075158A14CACGTCTCNONE 
J075169L03CACGTCTCNONE 
J090013K02CACGTCTCNONE 
Os08g0497900AK071174GAGACGTGGCConserved hypothetical protein. 
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE 
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein. 
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE 
Os08g0564300AK111817CACGTCTCNONE 
Os09g0133600006-034-E08CGACACGTCTCNONE 
AK061477CGACACGTCTCPAP fibrillin family protein. 
AK099394CGACACGTCTCNONE 
AK104742CGACACGTCTCNONE 
AY224474CGACACGTCTCNONE 
Os09g0299000AK069336CACGTCTCSimilar to CDPK substrate protein 1. 
J013067B11CACGTCTCNONE 
J013132D15CACGTCTCNONE 
J023010K22CACGTCTCNONE 
J023045F12CACGTCTCNONE 
J023128A22CACGTCTCNONE 
J033092P14CACGTCTCNONE 
J065083M23CACGTCTCNONE 
J065107F02CACGTCTCNONE 
J075082K07CACGTCTCNONE 
Os09g0466800AK101607CACGTCTCConserved hypothetical protein. 
J033052A16CACGTCTCNONE 
Os09g0505700006-050-D06CACGTCTCNONE 
AF189365CACGTCTCNONE 
AK061034CACGTCTCNONE 
AK069451CACGTCTCRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CACGTCTCNONE 
J065115A18CACGTCTCNONE 
J065143E16CACGTCTCNONE 
J065146F17CACGTCTCNONE 
J065201H17CACGTCTCNONE 
J075029C13CACGTCTCNONE 
J075049I05CACGTCTCNONE 
J075122G19CACGTCTCNONE 
J075132N08CACGTCTCNONE 
Os09g0538450J080302B10CACGTCTCHypothetical protein. 
Os09g0570400AK065287GAGACGTGMajor facilitator superfamily protein. 
J013002M15GAGACGTGNONE 
J013030F15GAGACGTGNONE 
J013055E11GAGACGTGNONE 
J013071P13GAGACGTGNONE 
J013072E15GAGACGTGNONE 
J013072G14GAGACGTGNONE 
J013075F17GAGACGTGNONE 
J013089I20GAGACGTGNONE 
J013092E05GAGACGTGNONE 
J013121F02GAGACGTGNONE 
J013122D22GAGACGTGNONE 
J013156E24GAGACGTGNONE 
J023042O15GAGACGTGNONE 
J023104D22GAGACGTGNONE 
J033065I08GAGACGTGNONE 
J033131C03GAGACGTGNONE 
J090064E11GAGACGTGNONE 
J100063G18GAGACGTGNONE 
Os11g0169600J075003I07GCCACGTCTCNONE 
J100025P12GCCACGTCTCNONE 
J100056P17GCCACGTCTCNONE 
J100073F05GCCACGTCTCNONE 
J100084H07GCCACGTCTCNONE 
J100085M11GCCACGTCTCConserved hypothetical protein. 
Os11g0202000AK063427CACGTCTCCyclin-like F-box domain containing protein. 
AK063427GAGACGTGGACACGTGTCCyclin-like F-box domain containing protein. 
AK122020CACGTCTCNONE 
AK122020GAGACGTGGACACGTGTCNONE 
J033111N03CACGTCTCNONE 
J033111N03GAGACGTGGACACGTGTCNONE 
Os11g0216100AK059179CACGTCTCSimilar to Chaperone protein dnaJ. 
Os11g0299300AK119915CACGTCTCLipase, class 3 family protein. 
Os11g0454300009-010-F05CACGTCTCNONE 
011-073-B07CACGTCTCNONE 
011-089-D03CACGTCTCNONE 
012-041-B07CACGTCTCNONE 
012-042-D12CACGTCTCNONE 
012-046-G11CACGTCTCNONE 
012-072-D10CACGTCTCNONE 
012-090-F06CACGTCTCNONE 
013-009-A10CACGTCTCNONE 
013-096-B03CACGTCTCNONE 
014-002-F10CACGTCTCNONE 
014-006-A10CACGTCTCNONE 
014-006-C05CACGTCTCNONE 
014-006-E01CACGTCTCNONE 
014-006-H04CACGTCTCNONE 
014-009-D05CACGTCTCNONE 
014-010-D07CACGTCTCNONE 
014-012-A10CACGTCTCNONE 
014-013-F08CACGTCTCNONE 
014-014-D01CACGTCTCNONE 
014-016-D07CACGTCTCNONE 
014-020-F09CACGTCTCNONE 
014-023-C07CACGTCTCNONE 
014-024-A03CACGTCTCNONE 
014-025-D11CACGTCTCNONE 
014-027-D02CACGTCTCNONE 
014-030-F11CACGTCTCNONE 
014-032-H06CACGTCTCNONE 
014-034-D06CACGTCTCNONE 
014-037-E04CACGTCTCNONE 
014-038-C02CACGTCTCNONE 
014-041-B08CACGTCTCNONE 
014-044-A10CACGTCTCNONE 
014-045-C11CACGTCTCNONE 
014-046-B04CACGTCTCNONE 
014-047-D01CACGTCTCNONE 
014-053-C03CACGTCTCNONE 
014-053-C09CACGTCTCNONE 
014-072-D09CACGTCTCNONE 
014-073-D09CACGTCTCNONE 
014-073-F01CACGTCTCNONE 
014-081-B04CACGTCTCNONE 
014-081-G07CACGTCTCNONE 
014-084-C10CACGTCTCNONE 
014-084-F03CACGTCTCNONE 
014-085-D08CACGTCTCNONE 
014-087-H10CACGTCTCNONE 
014-095-E02CACGTCTCNONE 
014-095-G07CACGTCTCNONE 
AK121952CACGTCTCSimilar to Water-stress inducible protein RAB21. 
J033107K14CACGTCTCNONE 
J065021B08CACGTCTCNONE 
J065059D24CACGTCTCNONE 
J065066D13CACGTCTCNONE 
J065070K11CACGTCTCNONE 
J065081I18CACGTCTCNONE 
J065120F19CACGTCTCNONE 
J065186M13CACGTCTCNONE 
J075031E22CACGTCTCNONE 
J075046F04CACGTCTCNONE 
J075069L13CACGTCTCNONE 
J075097G09CACGTCTCNONE 
J075099C23CACGTCTCNONE 
J075149N21CACGTCTCNONE 
J075150G23CACGTCTCNONE 
J075170K09CACGTCTCNONE 
J075173A09CACGTCTCNONE 
J075177C21CACGTCTCNONE 
Os11g0525800AK059719TGGGGGAGACGTGSimilar to ADL308Cp. 
J065171D14TGGGGGAGACGTGNONE 
J075048H22TGGGGGAGACGTGNONE 
J075121D14TGGGGGAGACGTGNONE 
J075136P16TGGGGGAGACGTGNONE 
Os11g0547000AK100677CACGTCTCSimilar to FKF1. 
Os12g0266200AK066290GAGACGTGSimilar to Fibrillin-2 precursor. 
Os12g0464400AK121922CACGTCTCGlucose/ribitol dehydrogenase family protein. 
J033106F11CACGTCTCNONE 
J065037O17CACGTCTCNONE 
J065090K04CACGTCTCNONE 
J075007O03CACGTCTCNONE 
J075030J20CACGTCTCNONE 
J075071F12CACGTCTCNONE 
J075090G11CACGTCTCNONE 
J075091A09CACGTCTCNONE 
J075092N10CACGTCTCNONE 
J075116A20CACGTCTCNONE 
J075126P10CACGTCTCNONE 
J075133E24CACGTCTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.