version

Summary of OsREG507 (All List)

OrganismOryza sativa  
IDOsREG507  
SequenceCACGTGGC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count3279  

Entry Sequences (3279 entries)

LocusGene modelSequenceDescription
Os01g0149800009-003-D05GCCACGTGTNONE 
009-075-F04GCCACGTGTNONE 
009-164-H05GCCACGTGTNONE 
J013021G22GCCACGTGTNONE 
J013026A08GCCACGTGTNONE 
J013055B05GCCACGTGTNONE 
J013064G22GCCACGTGTNONE 
J013105C09GCCACGTGTNONE 
J013129K15GCCACGTGTNONE 
J023129B01GCCACGTGTNONE 
J033036H01GCCACGTGTNONE 
J033057B09GCCACGTGTNONE 
J043037E20GCCACGTGTNONE 
J043039C11GCCACGTGTNONE 
J043039D02GCCACGTGTNONE 
J043039G15GCCACGTGTNONE 
J043040L16GCCACGTGTNONE 
J053034B13GCCACGTGTNONE 
J053061F14GCCACGTGTNONE 
J053097D22GCCACGTGTNONE 
J065032N05GCCACGTGTNONE 
J065050F21GCCACGTGTNONE 
J065052D11GCCACGTGTNONE 
J065097I08GCCACGTGTNONE 
J065109M12GCCACGTGTNONE 
J065162C19GCCACGTGTNONE 
J065162C20GCCACGTGTNONE 
J065171G23GCCACGTGTNONE 
J065206I03GCCACGTGTNONE 
J065218O18GCCACGTGTNONE 
J080020M17GCCACGTGTNONE 
J080030J11GCCACGTGTNONE 
J080032A22GCCACGTGTNONE 
J080036E19GCCACGTGTNONE 
J080037I16GCCACGTGTNONE 
J080051D03GCCACGTGTNONE 
J080051D05GCCACGTGTNONE 
J080054K06GCCACGTGTNONE 
J080076G01GCCACGTGTNONE 
J080077P08GCCACGTGTNONE 
J080085E13GCCACGTGTNONE 
J080087A22GCCACGTGTNONE 
J080310A13GCCACGTGTNONE 
J090080A15GCCACGTGTNONE 
J090087N14GCCACGTGTNONE 
J100017E03GCCACGTGTNONE 
J100024B10GCCACGTGTNONE 
J100025A07GCCACGTGTNONE 
J100026G16GCCACGTGTNONE 
J100030A10GCCACGTGTNONE 
J100030M18GCCACGTGTNONE 
J100044D08GCCACGTGTNONE 
J100045F20GCCACGTGTNONE 
J100046L06GCCACGTGTNONE 
J100050J10GCCACGTGTNONE 
J100054E07GCCACGTGTNONE 
J100054G22GCCACGTGTNONE 
J100054L21GCCACGTGTNONE 
J100058A12GCCACGTGTNONE 
J100064O14GCCACGTGTNONE 
J100069M10GCCACGTGTNONE 
J100073C18GCCACGTGTNONE 
J100077H21GCCACGTGTNONE 
J100078A09GCCACGTGTNONE 
J100081F01GCCACGTGTNONE 
J100082H17GCCACGTGTNONE 
J100090C20GCCACGTGTNONE 
U43530GCCACGTGTMetallothionein-like protein type 2. 
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein. 
J065010E12GCCGGCCCGCCACGTGTNONE 
J065067D06GCCGGCCCGCCACGTGTNONE 
J090043F21GCCGGCCCGCCACGTGTNONE 
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCCACGTGTCCNONE 
J065122H15CGCCACGTGTCCNONE 
J065140B19CGCCACGTGTCCNONE 
J100031E12CGCCACGTGTCCNONE 
J100068J03CGCCACGTGTCCNONE 
J100083E12CGCCACGTGTCCNONE 
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein. 
J013071N06ACACGTGGCGNONE 
J023088F12ACACGTGGCGNONE 
J100027H24ACACGTGGCGNONE 
J100053K15ACACGTGGCGNONE 
J100082M15ACACGTGGCGNONE 
Os01g0187700AK101445GCCACGTGGCGConserved hypothetical protein. 
J033039I17GCCACGTGGCGNONE 
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein. 
Os01g0246400009-143-G05CACTGACACGTGGCNONE 
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0270100006-096-H09CGCCACGTGTNONE 
009-009-C10CGCCACGTGTNONE 
009-054-E06CGCCACGTGTNONE 
014-085-F09CGCCACGTGTNONE 
AK073275CGCCACGTGTNONE 
AK104155CGCCACGTGTNONE 
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor. 
J033025K21CGCCACGTGTNONE 
J075065H10CGCCACGTGTNONE 
J075143G10CGCCACGTGTNONE 
J100059J02CGCCACGTGTNONE 
Os01g0280200J065103B05GCCACGTGNONE 
J065103B05GCCACGTGTNONE 
J065183G15GCCACGTGConserved hypothetical protein. 
J065183G15GCCACGTGTConserved hypothetical protein. 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE 
009-084-B05ACAGCCCACGTGGCNONE 
009-100-E07ACAGCCCACGTGGCNONE 
009-133-B03ACAGCCCACGTGGCNONE 
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment). 
AK066266ACAGCCCACGTGGCNONE 
AK102013ACAGCCCACGTGGCNONE 
J065001I21ACAGCCCACGTGGCNONE 
J065025D22ACAGCCCACGTGGCNONE 
J065098M18ACAGCCCACGTGGCNONE 
J065105O22ACAGCCCACGTGGCNONE 
J065121F07ACAGCCCACGTGGCNONE 
J065181F03ACAGCCCACGTGGCNONE 
J075020M03ACAGCCCACGTGGCNONE 
J075028O06ACAGCCCACGTGGCNONE 
J075032F15ACAGCCCACGTGGCNONE 
J075033H07ACAGCCCACGTGGCNONE 
J075062F22ACAGCCCACGTGGCNONE 
J075083P19ACAGCCCACGTGGCNONE 
J075097J16ACAGCCCACGTGGCNONE 
J075099A15ACAGCCCACGTGGCNONE 
J075104P03ACAGCCCACGTGGCNONE 
J075118K12ACAGCCCACGTGGCNONE 
J075125H01ACAGCCCACGTGGCNONE 
J075127K12ACAGCCCACGTGGCNONE 
J075128F24ACAGCCCACGTGGCNONE 
J075151P06ACAGCCCACGTGGCNONE 
J075169K22ACAGCCCACGTGGCNONE 
J075170K24ACAGCCCACGTGGCNONE 
J075182A01ACAGCCCACGTGGCNONE 
J075199H16ACAGCCCACGTGGCNONE 
J080010O12ACAGCCCACGTGGCNONE 
J080013A02ACAGCCCACGTGGCNONE 
J080013F09ACAGCCCACGTGGCNONE 
J080017C19ACAGCCCACGTGGCNONE 
J080017G05ACAGCCCACGTGGCNONE 
J080022L04ACAGCCCACGTGGCNONE 
J080025B17ACAGCCCACGTGGCNONE 
J080029A08ACAGCCCACGTGGCNONE 
J080037C12ACAGCCCACGTGGCNONE 
J080037L14ACAGCCCACGTGGCNONE 
J080037M24ACAGCCCACGTGGCNONE 
J080038M21ACAGCCCACGTGGCNONE 
J080039E06ACAGCCCACGTGGCNONE 
J080039I10ACAGCCCACGTGGCNONE 
J080042H01ACAGCCCACGTGGCNONE 
J080042L18ACAGCCCACGTGGCNONE 
J080042N21ACAGCCCACGTGGCNONE 
J080043E01ACAGCCCACGTGGCNONE 
J080044H05ACAGCCCACGTGGCNONE 
J080047H10ACAGCCCACGTGGCNONE 
J080050H03ACAGCCCACGTGGCNONE 
J080060N21ACAGCCCACGTGGCNONE 
J080061M09ACAGCCCACGTGGCNONE 
J080062D15ACAGCCCACGTGGCNONE 
J080062I18ACAGCCCACGTGGCNONE 
J080063G05ACAGCCCACGTGGCNONE 
J080063H16ACAGCCCACGTGGCNONE 
J080067G16ACAGCCCACGTGGCNONE 
J080067M07ACAGCCCACGTGGCNONE 
J080068M13ACAGCCCACGTGGCNONE 
J080069A19ACAGCCCACGTGGCNONE 
J080069G14ACAGCCCACGTGGCNONE 
J080070F04ACAGCCCACGTGGCNONE 
J080070K15ACAGCCCACGTGGCNONE 
J080072O20ACAGCCCACGTGGCNONE 
J080075L02ACAGCCCACGTGGCNONE 
J080077I10ACAGCCCACGTGGCNONE 
J080077P03ACAGCCCACGTGGCNONE 
J080078F14ACAGCCCACGTGGCNONE 
J080092H15ACAGCCCACGTGGCNONE 
J080097J15ACAGCCCACGTGGCNONE 
J080305C10ACAGCCCACGTGGCNONE 
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE 
J075042F02GCCCCCACACACGTGGCNONE 
J075068E10GCCCCCACACACGTGGCNONE 
J075116E19GCCCCCACACACGTGGCNONE 
J075131C10GCCCCCACACACGTGGCNONE 
J075145J11GCCCCCACACACGTGGCNONE 
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12GCCCCCACACACGTGGCNONE 
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein. 
J043003O18ACACGTGGCGNONE 
J065105K07ACACGTGGCGNONE 
J065123H16ACACGTGGCGNONE 
J065198K17ACACGTGGCGNONE 
J100027C20ACACGTGGCGNONE 
Os01g0324400AK102854GCCACGTGGGNONE 
AK111299GCCACGTGGGNONE 
J033032A11GCCACGTGGGNONE 
J033110L02GCCACGTGGGNONE 
Os01g0382450J065084M05GCCACGTGGCHypothetical protein. 
J065084M05GCCACGTGTCCHypothetical protein. 
J065155G18GCCACGTGGCNONE 
J065155G18GCCACGTGTCCNONE 
Os01g0511100013-100-E04GCCACGTGGCNONE 
AK070914GCCACGTGGCUniversal stress protein (Usp) family protein. 
J065068H19GCCACGTGGCNONE 
J065186L22GCCACGTGGCNONE 
J075039N04GCCACGTGGCNONE 
J075040L20GCCACGTGGCNONE 
J075040P08GCCACGTGGCNONE 
J075094I09GCCACGTGGCNONE 
J075097P08GCCACGTGGCNONE 
J075115O17GCCACGTGGCNONE 
J075132J24GCCACGTGGCNONE 
J075148P21GCCACGTGGCNONE 
J075166G18GCCACGTGGCNONE 
J075172M15GCCACGTGGCNONE 
J075187L14GCCACGTGGCNONE 
Os01g0541600Os01g0541600GCCACGTGConserved hypothetical protein. 
Os01g0549250J065045M13CACGTGGCConserved hypothetical protein. 
Os01g0571700AK120410ACACGTGGCNucleic acid-binding, OB-fold domain containing protein. 
Os01g0581300AK066182CGCCACGTGSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015CGCCACGTGNONE 
Os01g0613900014-018-D04GCCACGTGNONE 
AK119181GCCACGTGProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GCCACGTGNONE 
J065019A15GCCACGTGNONE 
J075090J10GCCACGTGNONE 
J075195H12GCCACGTGNONE 
Os01g0653700011-003-E09CGCCACGTGNONE 
AK073990CGCCACGTGCyclin-like F-box domain containing protein. 
AK120129CGCCACGTGNONE 
J033036F18CGCCACGTGNONE 
J033072D10CGCCACGTGNONE 
J033089B18CGCCACGTGNONE 
J033089J09CGCCACGTGNONE 
J033136J11CGCCACGTGNONE 
J065065E24CGCCACGTGNONE 
J090065L03CGCCACGTGNONE 
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0718500AK111346ACACGTGGCConserved hypothetical protein. 
Os01g0733200AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCCACACGTGGCNONE 
J013066G03GCCACACGTGGCNONE 
J090034J08GCCACACGTGGCNONE 
Os01g0734600012-079-G06CCCACGTGGCNONE 
AK065450CCCACGTGGCNONE 
AK103129CCCACGTGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK119562CCCACGTGGCNONE 
J075086F18CCCACGTGGCNONE 
J075147G07CCCACGTGGCNONE 
Os01g0745400AK107872CCCACGTGGCSec34-like protein family protein. 
Os01g0750500006-028-G02CACGTGGCGNONE 
006-105-B02CACGTGGCGNONE 
006-117-D04CACGTGGCGNONE 
013-066-D08CACGTGGCGNONE 
015-058-C06CACGTGGCGNONE 
AK067516CACGTGGCGProtein of unknown function DUF814 domain containing protein. 
AK104228CACGTGGCGNONE 
AK104728CACGTGGCGNONE 
J013056K07CACGTGGCGNONE 
J013073A21CACGTGGCGNONE 
J013112J21CACGTGGCGNONE 
J065034L03CACGTGGCGNONE 
J100026F22CACGTGGCGNONE 
J100073H05CACGTGGCGNONE 
J100084P09CACGTGGCGNONE 
Os01g0767600AK070672CCCACGTGGCConserved hypothetical protein. 
J013131M12CCCACGTGGCNONE 
J023027B15CCCACGTGGCNONE 
J023059I06CCCACGTGGCNONE 
J023095L05CCCACGTGGCNONE 
J033033E20CCCACGTGGCNONE 
J033105F24CCCACGTGGCNONE 
J033148N05CCCACGTGGCNONE 
J065060H14CCCACGTGGCNONE 
J090093E17CCCACGTGGCNONE 
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0787400006-097-H03CGCCACGTGTNONE 
AK061223CGCCACGTGTConserved hypothetical protein. 
J065011G11CGCCACGTGTNONE 
J065161F18CGCCACGTGTNONE 
Os01g0788400AK109763CACGTGGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
AK120977CACGTGGCNONE 
Os01g0793900009-109-G11GGCCGTCCACGTGGCNONE 
009-125-A10GGCCGTCCACGTGGCNONE 
AK062811GGCCGTCCACGTGGCConserved hypothetical protein. 
Os01g0817700003-108-A10CACGTGGCGNONE 
AK060836CACGTGGCGNONE 
AK065059CACGTGGCGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10CACGTGGCGNONE 
J013047D19CACGTGGCGNONE 
J013056K09CACGTGGCGNONE 
J013068P20CACGTGGCGNONE 
J013108G18CACGTGGCGNONE 
J023007N01CACGTGGCGNONE 
J023008A22CACGTGGCGNONE 
J023010B02CACGTGGCGNONE 
J023029O13CACGTGGCGNONE 
J023064F21CACGTGGCGNONE 
J023073E22CACGTGGCGNONE 
J023143E14CACGTGGCGNONE 
J033027N20CACGTGGCGNONE 
J033032G14CACGTGGCGNONE 
J033037E03CACGTGGCGNONE 
J033057N19CACGTGGCGNONE 
J033065E16CACGTGGCGNONE 
J033066B19CACGTGGCGNONE 
J033069G01CACGTGGCGNONE 
J033071B03CACGTGGCGNONE 
J033080C12CACGTGGCGNONE 
J033081K19CACGTGGCGNONE 
J033096B19CACGTGGCGNONE 
J033101E20CACGTGGCGNONE 
J033135L21CACGTGGCGNONE 
J033139I07CACGTGGCGNONE 
J033150A21CACGTGGCGNONE 
J043036J05CACGTGGCGNONE 
J043039D03CACGTGGCGNONE 
J043039F19CACGTGGCGNONE 
J090006K04CACGTGGCGNONE 
J090017G14CACGTGGCGNONE 
J090034E23CACGTGGCGNONE 
J090039D07CACGTGGCGNONE 
J090039I09CACGTGGCGNONE 
J090044F21CACGTGGCGNONE 
J090049J12CACGTGGCGNONE 
J090053A19CACGTGGCGNONE 
J090061E23CACGTGGCGNONE 
J090079K09CACGTGGCGNONE 
J090092F21CACGTGGCGNONE 
J100022E04CACGTGGCGNONE 
J100038I01CACGTGGCGNONE 
J100066C22CACGTGGCGNONE 
J100067C11CACGTGGCGNONE 
J100073F07CACGTGGCGNONE 
J100084I24CACGTGGCGNONE 
Os01g0841600006-045-E03GCCACGTGTNONE 
AK059805GCCACGTGTSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase). 
AK099310GCCACGTGTNONE 
AK100708GCCACGTGTNONE 
AK104017GCCACGTGTNONE 
AK104461GCCACGTGTNONE 
J065211F22GCCACGTGTNONE 
J090054P20GCCACGTGTNONE 
Os01g0858900AK107493CACGTGGCGlycosyl transferase, family 29 protein. 
J065097H23CACGTGGCNONE 
J100070A02CACGTGGCNONE 
J100072M10CACGTGGCNONE 
Os01g0867900AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein. 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0923300AK067520GCCACGTGGCCBS domain containing protein. 
Os01g0933600006-074-G12GCCACGTGNONE 
012-065-H08GCCACGTGNONE 
013-017-D11GCCACGTGNONE 
013-046-C03GCCACGTGNONE 
013-068-E06GCCACGTGNONE 
015-084-F04GCCACGTGNONE 
016-073-A05GCCACGTGNONE 
AK067040GCCACGTGConserved hypothetical protein. 
J013089P11GCCACGTGNONE 
J013155O19GCCACGTGNONE 
J023054B01GCCACGTGNONE 
J033040D07GCCACGTGNONE 
J053090I05GCCACGTGNONE 
J065078G21GCCACGTGNONE 
J075083B15GCCACGTGNONE 
J090063L16GCCACGTGNONE 
Os01g0952700AK103457GCCACGTGTMetallo-dependent hydrolase, composite domain containing protein. 
Os02g0105500AK063929ACACGTGGCNONE 
AK102953ACACGTGGCIQ calmodulin-binding region domain containing protein. 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0197600003-113-H08GCCACGTGGCNONE 
003-129-H06GCCACGTGGCNONE 
006-021-H09GCCACGTGGCNONE 
006-022-B05GCCACGTGGCNONE 
006-022-G12GCCACGTGGCNONE 
006-023-A02GCCACGTGGCNONE 
006-023-C02GCCACGTGGCNONE 
006-023-G09GCCACGTGGCNONE 
006-024-D12GCCACGTGGCNONE 
006-025-C09GCCACGTGGCNONE 
006-025-E01GCCACGTGGCNONE 
006-026-A11GCCACGTGGCNONE 
006-026-A12GCCACGTGGCNONE 
006-028-E11GCCACGTGGCNONE 
006-028-G03GCCACGTGGCNONE 
006-029-A09GCCACGTGGCNONE 
006-029-A12GCCACGTGGCNONE 
006-029-D01GCCACGTGGCNONE 
006-029-F12GCCACGTGGCNONE 
006-029-G12GCCACGTGGCNONE 
006-030-A08GCCACGTGGCNONE 
006-030-C09GCCACGTGGCNONE 
006-030-G06GCCACGTGGCNONE 
006-031-D06GCCACGTGGCNONE 
006-032-C01GCCACGTGGCNONE 
006-034-B07GCCACGTGGCNONE 
006-035-G01GCCACGTGGCNONE 
006-036-H12GCCACGTGGCNONE 
006-040-C01GCCACGTGGCNONE 
006-041-G12GCCACGTGGCNONE 
006-041-H02GCCACGTGGCNONE 
006-041-H11GCCACGTGGCNONE 
006-042-B01GCCACGTGGCNONE 
006-042-F10GCCACGTGGCNONE 
006-043-C04GCCACGTGGCNONE 
006-044-D10GCCACGTGGCNONE 
006-048-D11GCCACGTGGCNONE 
006-049-D07GCCACGTGGCNONE 
006-050-H05GCCACGTGGCNONE 
006-051-D10GCCACGTGGCNONE 
006-051-E05GCCACGTGGCNONE 
006-053-C07GCCACGTGGCNONE 
006-054-B10GCCACGTGGCNONE 
006-054-C12GCCACGTGGCNONE 
006-054-G08GCCACGTGGCNONE 
006-055-D12GCCACGTGGCNONE 
006-056-C04GCCACGTGGCNONE 
006-056-H06GCCACGTGGCNONE 
006-057-E07GCCACGTGGCNONE 
006-058-C12GCCACGTGGCNONE 
006-059-B06GCCACGTGGCNONE 
006-059-B09GCCACGTGGCNONE 
006-059-D05GCCACGTGGCNONE 
006-060-D07GCCACGTGGCNONE 
006-061-D01GCCACGTGGCNONE 
006-061-G09GCCACGTGGCNONE 
006-062-A12GCCACGTGGCNONE 
006-062-D04GCCACGTGGCNONE 
006-062-G01GCCACGTGGCNONE 
006-063-C10GCCACGTGGCNONE 
006-064-A10GCCACGTGGCNONE 
006-067-E04GCCACGTGGCNONE 
006-067-H11GCCACGTGGCNONE 
006-069-G08GCCACGTGGCNONE 
006-071-G06GCCACGTGGCNONE 
006-073-E06GCCACGTGGCNONE 
006-074-B12GCCACGTGGCNONE 
006-074-F06GCCACGTGGCNONE 
006-074-H01GCCACGTGGCNONE 
006-076-D12GCCACGTGGCNONE 
006-077-C08GCCACGTGGCNONE 
006-083-H01GCCACGTGGCNONE 
006-083-H09GCCACGTGGCNONE 
006-084-C02GCCACGTGGCNONE 
006-086-D05GCCACGTGGCNONE 
006-086-E09GCCACGTGGCNONE 
006-087-D04GCCACGTGGCNONE 
006-087-E12GCCACGTGGCNONE 
006-088-A01GCCACGTGGCNONE 
006-088-H09GCCACGTGGCNONE 
006-089-G01GCCACGTGGCNONE 
006-090-G01GCCACGTGGCNONE 
006-092-H10GCCACGTGGCNONE 
006-096-G12GCCACGTGGCNONE 
006-097-C04GCCACGTGGCNONE 
006-098-B06GCCACGTGGCNONE 
006-099-A02GCCACGTGGCNONE 
006-099-B05GCCACGTGGCNONE 
006-100-F02GCCACGTGGCNONE 
006-100-F07GCCACGTGGCNONE 
006-104-A01GCCACGTGGCNONE 
006-107-F06GCCACGTGGCNONE 
006-109-A05GCCACGTGGCNONE 
006-110-G03GCCACGTGGCNONE 
006-111-A06GCCACGTGGCNONE 
006-111-C12GCCACGTGGCNONE 
006-112-B03GCCACGTGGCNONE 
006-113-A02GCCACGTGGCNONE 
006-113-H06GCCACGTGGCNONE 
006-115-D11GCCACGTGGCNONE 
006-116-F11GCCACGTGGCNONE 
006-117-A10GCCACGTGGCNONE 
006-117-C01GCCACGTGGCNONE 
006-117-D08GCCACGTGGCNONE 
006-118-B12GCCACGTGGCNONE 
006-118-D08GCCACGTGGCNONE 
006-118-E11GCCACGTGGCNONE 
006-118-H08GCCACGTGGCNONE 
006-119-C10GCCACGTGGCNONE 
006-120-H11GCCACGTGGCNONE 
009-025-G09GCCACGTGGCNONE 
009-061-H06GCCACGTGGCNONE 
009-070-E02GCCACGTGGCNONE 
009-077-A07GCCACGTGGCNONE 
009-114-A07GCCACGTGGCNONE 
009-115-G02GCCACGTGGCNONE 
009-123-C06GCCACGTGGCNONE 
009-125-H03GCCACGTGGCNONE 
009-127-H11GCCACGTGGCNONE 
009-136-G03GCCACGTGGCNONE 
009-154-B05GCCACGTGGCNONE 
009-162-B02GCCACGTGGCNONE 
009-176-D09GCCACGTGGCNONE 
009-178-F10GCCACGTGGCNONE 
009-190-F05GCCACGTGGCNONE 
009-200-C08GCCACGTGGCNONE 
011-064-H10GCCACGTGGCNONE 
AK060143GCCACGTGGCNONE 
AK060970GCCACGTGGCNONE 
AK068102GCCACGTGGCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096GCCACGTGGCNONE 
AK104215GCCACGTGGCNONE 
AK104348GCCACGTGGCNONE 
AK104385GCCACGTGGCNONE 
AK104392GCCACGTGGCNONE 
AK104446GCCACGTGGCNONE 
AK104458GCCACGTGGCNONE 
AK104469GCCACGTGGCNONE 
AK104522GCCACGTGGCNONE 
AK104535GCCACGTGGCNONE 
AK104557GCCACGTGGCNONE 
AK104636GCCACGTGGCNONE 
AK104646GCCACGTGGCNONE 
AK104734GCCACGTGGCNONE 
AK106085GCCACGTGGCNONE 
AK109398GCCACGTGGCNONE 
AK119554GCCACGTGGCNONE 
J013044I21GCCACGTGGCNONE 
J013090N21GCCACGTGGCNONE 
J013130I24GCCACGTGGCNONE 
J023038D09GCCACGTGGCNONE 
J023064C23GCCACGTGGCNONE 
J023088A09GCCACGTGGCNONE 
J023105K12GCCACGTGGCNONE 
J065022M15GCCACGTGGCNONE 
J075062L23GCCACGTGGCNONE 
J075069B05GCCACGTGGCNONE 
J075072D15GCCACGTGGCNONE 
J075090E24GCCACGTGGCNONE 
J075126D14GCCACGTGGCNONE 
J075154L21GCCACGTGGCNONE 
J075165F23GCCACGTGGCNONE 
J075166D04GCCACGTGGCNONE 
J080003O05GCCACGTGGCNONE 
J080005L07GCCACGTGGCNONE 
J080008K15GCCACGTGGCNONE 
J080009A07GCCACGTGGCNONE 
J080009F05GCCACGTGGCNONE 
J080010M06GCCACGTGGCNONE 
J080011E06GCCACGTGGCNONE 
J080011H20GCCACGTGGCNONE 
J080018I05GCCACGTGGCNONE 
J080021N17GCCACGTGGCNONE 
J080036E20GCCACGTGGCNONE 
J080040E22GCCACGTGGCNONE 
J080044D19GCCACGTGGCNONE 
J080045C21GCCACGTGGCNONE 
J080047B08GCCACGTGGCNONE 
J080048E24GCCACGTGGCNONE 
J080053D19GCCACGTGGCNONE 
J080053N09GCCACGTGGCNONE 
J080054A19GCCACGTGGCNONE 
J080061O16GCCACGTGGCNONE 
J080064P15GCCACGTGGCNONE 
J080065M06GCCACGTGGCNONE 
J080067G11GCCACGTGGCNONE 
J080072M09GCCACGTGGCNONE 
J080079I15GCCACGTGGCNONE 
J080082I12GCCACGTGGCNONE 
J080083K21GCCACGTGGCNONE 
J080096H12GCCACGTGGCNONE 
J080096J10GCCACGTGGCNONE 
J080097O13GCCACGTGGCNONE 
J080305P05GCCACGTGGCNONE 
J080311C21GCCACGTGGCNONE 
J080317C16GCCACGTGGCNONE 
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen. 
Os02g0265900006-102-B07CGCCACGTGGGCNONE 
016-087-A02CGCCACGTGGGCNONE 
AK059921CGCCACGTGGGCReticulon family protein. 
AK064290CGCCACGTGGGCNONE 
AK072628CGCCACGTGGGCNONE 
AK104196CGCCACGTGGGCNONE 
J023130B01CGCCACGTGGGCNONE 
J080010O13CGCCACGTGGGCNONE 
J100065C12CGCCACGTGGGCNONE 
J100067M20CGCCACGTGGGCNONE 
J100070I01CGCCACGTGGGCNONE 
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit. 
Os02g0509600AK111075CACGTGGCConserved hypothetical protein. 
AK111075CACGTGGCGConserved hypothetical protein. 
J065033B09CACGTGGCNONE 
J065033B09CACGTGGCGNONE 
J065069L04CACGTGGCNONE 
J065069L04CACGTGGCGNONE 
J065089H14CACGTGGCNONE 
J065089H14CACGTGGCGNONE 
J065119J16CACGTGGCNONE 
J065119J16CACGTGGCGNONE 
J065142J22CACGTGGCNONE 
J065142J22CACGTGGCGNONE 
J065168B14CACGTGGCNONE 
J065168B14CACGTGGCGNONE 
J065203L03CACGTGGCNONE 
J065203L03CACGTGGCGNONE 
J075044C18CACGTGGCNONE 
J075044C18CACGTGGCGNONE 
J075068D13CACGTGGCNONE 
J075068D13CACGTGGCGNONE 
J075152O09CACGTGGCNONE 
J075152O09CACGTGGCGNONE 
Os02g0520800AK102815ACACGTGGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09ACACGTGGCNONE 
J100038E09ACACGTGGCNONE 
J100076G11ACACGTGGCNONE 
Os02g0527200009-022-A08ACACGTGGCCCCCCGCGNONE 
009-030-A06ACACGTGGCCCCCCGCGNONE 
009-034-F08ACACGTGGCCCCCCGCGNONE 
009-041-E08ACACGTGGCCCCCCGCGNONE 
009-048-H03ACACGTGGCCCCCCGCGNONE 
009-067-E04ACACGTGGCCCCCCGCGNONE 
009-081-E04ACACGTGGCCCCCCGCGNONE 
009-124-C06ACACGTGGCCCCCCGCGNONE 
009-154-A07ACACGTGGCCCCCCGCGNONE 
009-180-G04ACACGTGGCCCCCCGCGNONE 
009-180-H01ACACGTGGCCCCCCGCGNONE 
009-183-C03ACACGTGGCCCCCCGCGNONE 
009-198-E04ACACGTGGCCCCCCGCGNONE 
009-199-A12ACACGTGGCCCCCCGCGNONE 
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein. 
J075041O08ACACGTGGCCCCCCGCGNONE 
J075112L20ACACGTGGCCCCCCGCGNONE 
J075193M15ACACGTGGCCCCCCGCGNONE 
Os02g0551600009-174-H09GCCACGTGGCNONE 
AK063102GCCACGTGGCConserved hypothetical protein. 
Os02g0556100006-100-D03CACGTGGCNONE 
AK059938CACGTGGCNONE 
AK103125CACGTGGCNAD-dependent epimerase/dehydratase family protein. 
J033107B22CACGTGGCNONE 
J033119M03CACGTGGCNONE 
J033120L06CACGTGGCNONE 
J043007B02CACGTGGCNONE 
J043012G03CACGTGGCNONE 
J043024A02CACGTGGCNONE 
J043027J18CACGTGGCNONE 
J100019E06CACGTGGCNONE 
J100069C22CACGTGGCNONE 
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein. 
J065115K07ATTGGGCCACGTGGCGNONE 
Os02g0578300012-035-D02GCCACGTGGCGNONE 
AK105275GCCACGTGGCGSimilar to Glucosyltransferase (Fragment). 
Os02g0612600009-058-F12CCCACGTGGCNONE 
AK062519CCCACGTGGCConserved hypothetical protein. 
Os02g0612650Os02g0612650CCCACGTGGCNONE 
Os02g0613200AK064869GCCCCCACGTGGCNONE 
AK065051GCCCCCACGTGGCNONE 
AK098853GCCCCCACGTGGCConserved hypothetical protein. 
AK098974GCCCCCACGTGGCNONE 
J013000H15GCCCCCACGTGGCNONE 
J013001I18GCCCCCACGTGGCNONE 
J013022I18GCCCCCACGTGGCNONE 
J013025D06GCCCCCACGTGGCNONE 
J013037H17GCCCCCACGTGGCNONE 
J013043F22GCCCCCACGTGGCNONE 
J013075E01GCCCCCACGTGGCNONE 
J013088D09GCCCCCACGTGGCNONE 
J013088E19GCCCCCACGTGGCNONE 
J013102O18GCCCCCACGTGGCNONE 
J013110C08GCCCCCACGTGGCNONE 
J013118C06GCCCCCACGTGGCNONE 
J013119F22GCCCCCACGTGGCNONE 
J013128K14GCCCCCACGTGGCNONE 
J013158C17GCCCCCACGTGGCNONE 
J023013P15GCCCCCACGTGGCNONE 
J023044L21GCCCCCACGTGGCNONE 
J033023I04GCCCCCACGTGGCNONE 
J033038I22GCCCCCACGTGGCNONE 
J033095M02GCCCCCACGTGGCNONE 
J043022F05GCCCCCACGTGGCNONE 
J080307N20GCCCCCACGTGGCNONE 
J080315C02GCCCCCACGTGGCNONE 
J080316A15GCCCCCACGTGGCNONE 
J080316G03GCCCCCACGTGGCNONE 
J090029E24GCCCCCACGTGGCNONE 
J090031H15GCCCCCACGTGGCNONE 
J090034F13GCCCCCACGTGGCNONE 
J090047G02GCCCCCACGTGGCNONE 
J090069M24GCCCCCACGTGGCNONE 
J100052E15GCCCCCACGTGGCNONE 
Os02g0649300014-043-A05CGCCACGTGTNONE 
014-043-A05GCCACGTGTCGNONE 
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0699700AK072471CGCCACGTGSimilar to DNA topoisomerase II. 
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein. 
J023031J12GGACACGTGGCGNONE 
J075195G22GGACACGTGGCGNONE 
J100088O11GGACACGTGGCGNONE 
Os02g0753000AK121015CACGTGGCGSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0754300009-048-D05CGCCACGTGNONE 
AK059012CGCCACGTGNONE 
AK068621CGCCACGTGNONE 
AK099805CGCCACGTGRibosomal protein L29 family protein. 
J065102P04CGCCACGTGNONE 
J065161I03CGCCACGTGNONE 
Os02g0789600AK101046GCCACGTGGCGNONE 
AK112100GCCACGTGGCGSimilar to DEM2. 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0803900AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein. 
AK121390GCCACGTGTCCConserved hypothetical protein. 
J023128P21CGCCACGTGTCCNONE 
J023128P21GCCACGTGTCCNONE 
J053097O16CGCCACGTGTCCNONE 
J053097O16GCCACGTGTCCNONE 
J065012I02CGCCACGTGTCCNONE 
J065012I02GCCACGTGTCCNONE 
J065049C06CGCCACGTGTCCNONE 
J065049C06GCCACGTGTCCNONE 
J065051H02CGCCACGTGTCCNONE 
J065051H02GCCACGTGTCCNONE 
J065069A13CGCCACGTGTCCNONE 
J065069A13GCCACGTGTCCNONE 
J065082E04CGCCACGTGTCCNONE 
J065082E04GCCACGTGTCCNONE 
J065102N09CGCCACGTGTCCNONE 
J065102N09GCCACGTGTCCNONE 
J065157O10CGCCACGTGTCCNONE 
J065157O10GCCACGTGTCCNONE 
J065188N23CGCCACGTGTCCNONE 
J065188N23GCCACGTGTCCNONE 
J065190J11CGCCACGTGTCCNONE 
J065190J11GCCACGTGTCCNONE 
J065202M09CGCCACGTGTCCNONE 
J065202M09GCCACGTGTCCNONE 
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin. 
AK111296GGACACGTGGCGSimilar to Remorin. 
J065048M11GGACACGTGGCNONE 
J065048M11GGACACGTGGCGNONE 
J065081F01GGACACGTGGCNONE 
J065081F01GGACACGTGGCGNONE 
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE 
AK105115GTGGGACCCACGTGGCConserved hypothetical protein. 
AY224538GTGGGACCCACGTGGCNONE 
J065029A19GTGGGACCCACGTGGCNONE 
J065109N11GTGGGACCCACGTGGCNONE 
Os03g0116800012-097-D10GACACGTGGCNONE 
012-097-D10GCCACGTGGGNONE 
016-024-H10GACACGTGGCNONE 
016-024-H10GCCACGTGGGNONE 
AK066955GACACGTGGCConserved hypothetical protein. 
AK066955GCCACGTGGGConserved hypothetical protein. 
AK068678GACACGTGGCNONE 
AK068678GCCACGTGGGNONE 
AK104839GACACGTGGCNONE 
AK104839GCCACGTGGGNONE 
J013033G16GACACGTGGCNONE 
J013033G16GCCACGTGGGNONE 
J013091C10GACACGTGGCNONE 
J013091C10GCCACGTGGGNONE 
J013158H22GACACGTGGCNONE 
J013158H22GCCACGTGGGNONE 
J023106K11GACACGTGGCNONE 
J023106K11GCCACGTGGGNONE 
J065051O15GACACGTGGCNONE 
J065051O15GCCACGTGGGNONE 
J065129G22GACACGTGGCNONE 
J065129G22GCCACGTGGGNONE 
J075001K02GACACGTGGCNONE 
J075001K02GCCACGTGGGNONE 
J075011O03GACACGTGGCNONE 
J075011O03GCCACGTGGGNONE 
J075024K04GACACGTGGCNONE 
J075024K04GCCACGTGGGNONE 
J075026E07GACACGTGGCNONE 
J075026E07GCCACGTGGGNONE 
J075037O14GACACGTGGCNONE 
J075037O14GCCACGTGGGNONE 
J075071D17GACACGTGGCNONE 
J075071D17GCCACGTGGGNONE 
J075084M05GACACGTGGCNONE 
J075084M05GCCACGTGGGNONE 
J075114B06GACACGTGGCNONE 
J075114B06GCCACGTGGGNONE 
J075128C23GACACGTGGCNONE 
J075128C23GCCACGTGGGNONE 
J075153A13GACACGTGGCNONE 
J075153A13GCCACGTGGGNONE 
J075158A15GACACGTGGCNONE 
J075158A15GCCACGTGGGNONE 
J075165P09GACACGTGGCNONE 
J075165P09GCCACGTGGGNONE 
J075167M21GACACGTGGCNONE 
J075167M21GCCACGTGGGNONE 
J075170F11GACACGTGGCNONE 
J075170F11GCCACGTGGGNONE 
J075186F12GACACGTGGCNONE 
J075186F12GCCACGTGGGNONE 
J075186L13GACACGTGGCNONE 
J075186L13GCCACGTGGGNONE 
J075189A01GACACGTGGCNONE 
J075189A01GCCACGTGGGNONE 
J075192D19GACACGTGGCNONE 
J075192D19GCCACGTGGGNONE 
Os03g0125400AK101342GCCACGTGGCConserved hypothetical protein 147 family protein. 
J043012L05GCCACGTGGCNONE 
J065013L10GCCACGTGGCNONE 
J065046D23GCCACGTGGCNONE 
J090074D20GCCACGTGGCNONE 
J090087F22GCCACGTGGCNONE 
J100047D05GCCACGTGGCNONE 
Os03g0184100AK067400CGCCACGTGHypothetical protein. 
J013030J24CGCCACGTGNONE 
J013037M23CGCCACGTGNONE 
J013106B15CGCCACGTGNONE 
J013130H10CGCCACGTGNONE 
J013152B03CGCCACGTGNONE 
J013157J24CGCCACGTGNONE 
J013157K04CGCCACGTGNONE 
J033093A19CGCCACGTGNONE 
J033106E24CGCCACGTGNONE 
J090043G12CGCCACGTGNONE 
Os03g0184300AK119613CGCCACGTGGCNONE 
AK120569CGCCACGTGGCGlycosyl transferase, family 8 protein. 
Os03g0218300015-078-G09CACGTGGCGConserved hypothetical protein. 
J090095I10CACGTGGCGNONE 
Os03g0218400AK069202GCCACGTGGCSimilar to Hexose transporter. 
AK099306GCCACGTGGCNONE 
AY342321GCCACGTGGCNONE 
J023066K08GCCACGTGGCNONE 
J100032N19GCCACGTGGCNONE 
Os03g0227800016-033-F09CGCCACGTGNONE 
AK063571CGCCACGTGNONE 
AK103846CGCCACGTGNONE 
J013028J20CGCCACGTGNONE 
J013091I04CGCCACGTGNONE 
J013100P18CGCCACGTGNONE 
J013128L15CGCCACGTGNONE 
J013153M09CGCCACGTGNONE 
J033072J03CGCCACGTGNONE 
J033074L07CGCCACGTGNONE 
J033106H15CGCCACGTGNONE 
J033148J22CGCCACGTGNONE 
J065005B02CGCCACGTGNONE 
J065009M20CGCCACGTGNONE 
J065035E23CGCCACGTGNONE 
J065039E24CGCCACGTGNONE 
J065057P20CGCCACGTGNONE 
J065066E10CGCCACGTGNONE 
J065072G21CGCCACGTGNONE 
J065076N07CGCCACGTGNONE 
J065093G14CGCCACGTGNONE 
J065127K10CGCCACGTGNONE 
J065142O20CGCCACGTGNONE 
J065165O18CGCCACGTGNONE 
J065179O07CGCCACGTGNONE 
J065203E15CGCCACGTGNONE 
J080305J16CGCCACGTGNONE 
J090008C14CGCCACGTGNONE 
J090083E01CGCCACGTGNONE 
J090092B02CGCCACGTGNONE 
J090098O14CGCCACGTGNONE 
J100042A12CGCCACGTGNONE 
J100090K14CGCCACGTGNONE 
Os03g0272300AK060183GCCACGTGTCNONE 
AK071865GCCACGTGTCZinc finger, RING-type domain containing protein. 
Os03g0282900006-088-H05GCCACGTGNONE 
AK061166GCCACGTGNONE 
AK102161GCCACGTGConserved hypothetical protein. 
AK104514GCCACGTGNONE 
Os03g0295800006-107-F02ACACGTGGCNONE 
AK106050ACACGTGGCNONE 
Os03g0300900014-046-H03CACGCCACGTGNONE 
AK064068CACGCCACGTGNONE 
Os03g0305400009-198-D04CGCCACGTGGCNONE 
013-012-C06CGCCACGTGGCNONE 
014-034-D01CGCCACGTGGCNONE 
AK071397CGCCACGTGGCUniversal stress protein (Usp) family protein. 
J023012O22CGCCACGTGGCNONE 
J023097A13CGCCACGTGGCNONE 
J023107P16CGCCACGTGGCNONE 
J023113C14CGCCACGTGGCNONE 
Os03g0322500009-014-F03GCCACGTGGCNONE 
009-014-F03GGACACGTGGCNONE 
009-076-G10GCCACGTGGCNONE 
009-076-G10GGACACGTGGCNONE 
009-100-C01GCCACGTGGCNONE 
009-100-C01GGACACGTGGCNONE 
009-106-F02GCCACGTGGCNONE 
009-106-F02GGACACGTGGCNONE 
009-123-H11GCCACGTGGCNONE 
009-123-H11GGACACGTGGCNONE 
009-158-C09GCCACGTGGCNONE 
009-158-C09GGACACGTGGCNONE 
009-172-D04GCCACGTGGCNONE 
009-172-D04GGACACGTGGCNONE 
009-179-C11GCCACGTGGCNONE 
009-179-C11GGACACGTGGCNONE 
009-188-B12GCCACGTGGCNONE 
009-188-B12GGACACGTGGCNONE 
009-194-D07GCCACGTGGCNONE 
009-194-D07GGACACGTGGCNONE 
AK103503GCCACGTGGCNONE 
AK103503GGACACGTGGCNONE 
AK121029GCCACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
AK121029GGACACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
J013066O21GCCACGTGGCNONE 
J013066O21GGACACGTGGCNONE 
J023050G22GCCACGTGGCNONE 
J023050G22GGACACGTGGCNONE 
J023103H15GCCACGTGGCNONE 
J023103H15GGACACGTGGCNONE 
J033075B11GCCACGTGGCNONE 
J033075B11GGACACGTGGCNONE 
J033091E24GCCACGTGGCNONE 
J033091E24GGACACGTGGCNONE 
J033098N14GCCACGTGGCNONE 
J033098N14GGACACGTGGCNONE 
J053089B02GCCACGTGGCNONE 
J053089B02GGACACGTGGCNONE 
J065039M05GCCACGTGGCNONE 
J065039M05GGACACGTGGCNONE 
J065210G05GCCACGTGGCNONE 
J065210G05GGACACGTGGCNONE 
J090036P06GCCACGTGGCNONE 
J090036P06GGACACGTGGCNONE 
J090040M04GCCACGTGGCNONE 
J090040M04GGACACGTGGCNONE 
Os03g0331600009-025-C11GCCACGTGGCNONE 
AK063782GCCACGTGGCConserved hypothetical protein. 
Os03g0333000AK109811GCCACGTGTConserved hypothetical protein. 
J065152D04GCCACGTGTNONE 
J090011B05GCCACGTGTNONE 
Os03g0333100AK101050ACACGTGGCProtein of unknown function DUF663 domain containing protein. 
Os03g0343900009-077-C03TCCACGCCACGTGGCNONE 
AK105813TCCACGCCACGTGGCPhotosystem II protein PsbX family protein. 
J100059N03TCCACGCCACGTGGCNONE 
J100079C20TCCACGCCACGTGGCNONE 
Os03g0379300006-039-F11CACGTGGCNONE 
AK061515CACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CACGTGGCNONE 
J013159M16CACGTGGCNONE 
J090067F01CACGTGGCNONE 
J090083F21CACGTGGCNONE 
J100040M08CACGTGGCNONE 
J100048C03CACGTGGCNONE 
J100056M07CACGTGGCNONE 
J100062N22CACGTGGCNONE 
J100086L07CACGTGGCNONE 
Os03g0381500AK108125CGCCACGTGTConserved hypothetical protein. 
Os03g0412300AK071008ACACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
J075120J12ACACGTGGCNONE 
J100068E17ACACGTGGCNONE 
Os03g0413000009-180-E02CCCACGTGGCNONE 
009-188-B06CCCACGTGGCNONE 
AK060225CCCACGTGGCNONE 
AY062181CCCACGTGGCSimilar to Potential histone-like transcription factor. 
Os03g0453800014-002-A05GCCACGTGGCNONE 
AK063623GCCACGTGGCConserved hypothetical protein. 
Os03g0587250J065002M05GCCACGTGConserved hypothetical protein. 
Os03g0670200011-069-G05CCCCCACGTGGCNONE 
AK069553CCCCCACGTGGCSimilar to YJR013Wp (Fragment). 
J023020O11CCCCCACGTGGCNONE 
J023114J22CCCCCACGTGGCNONE 
J100084F17CCCCCACGTGGCNONE 
J100087A11CCCCCACGTGGCNONE 
Os03g0701600AK071171CGCCACGTGConserved hypothetical protein. 
J013036F14CGCCACGTGNONE 
J075052I22CGCCACGTGNONE 
J100029D11CGCCACGTGNONE 
J100062B19CGCCACGTGNONE 
J100063H01CGCCACGTGNONE 
Os03g0704200AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein. 
J023083O08GCCACGTGGGTCCCACCNONE 
Os03g0712600015-008-G03ACACGTGGCNONE 
AK103705ACACGTGGCHypothetical protein. 
J033136N14ACACGTGGCNONE 
Os03g0723000011-021-G07CACGTGGCNONE 
012-075-F08CACGTGGCNONE 
012-077-F05CACGTGGCNONE 
AK064022CACGTGGCNONE 
AK101603CACGTGGCGRAS transcription factor domain containing protein. 
AK102857CACGTGGCNONE 
J100032K06CACGTGGCNONE 
J100075D20CACGTGGCNONE 
Os03g0723400AK107276CACGTGGCConserved hypothetical protein. 
J065104F19CACGTGGCNONE 
J075026E22CACGTGGCNONE 
J075047K21CACGTGGCNONE 
J075071K20CACGTGGCNONE 
J075071K21CACGTGGCNONE 
J075140F21CACGTGGCNONE 
J075177C18CACGTGGCNONE 
Os03g0757200AK071136GCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023078E19GCCACGTGNONE 
Os03g0766000AK070596CACGTGGCNONE 
AK104743CACGTGGCNONE 
AK106079CACGTGGCNONE 
J013063M09CACGTGGCNONE 
J023056A03CACGTGGCNONE 
J043038L07CACGTGGCNONE 
J053067N16CACGTGGCNONE 
J053073G09CACGTGGCNONE 
J053075I19CACGTGGCNONE 
Os03g0796800J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os03g0808900AK065100GCCACGTGGCSimilar to Seed imbibition protein (Fragment). 
Os03g0815900013-097-G08CGACACGTGGCGNONE 
AK065258CGACACGTGGCGNONE 
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase. 
J013002J17CGACACGTGGCGNONE 
J013074A12CGACACGTGGCGNONE 
J023045C17CGACACGTGGCGNONE 
J033050E21CGACACGTGGCGNONE 
J053094P05CGACACGTGGCGNONE 
J090038F11CGACACGTGGCGNONE 
J090072J01CGACACGTGGCGNONE 
J100026H07CGACACGTGGCGNONE 
J100040O06CGACACGTGGCGNONE 
J100083D07CGACACGTGGCGNONE 
Os03g0818100015-098-A09CACGTGGCGNONE 
AK064366CACGTGGCGNONE 
AK121701CACGTGGCGHistidine acid phosphatase family protein. 
Os03g0832200AK070712CACGTGGCSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0837300AK111243GCCACGTGTCGNONE 
AK121140GCCACGTGTCGNicotinate phosphoribosyltransferase and related family protein. 
AY214337GCCACGTGTCGNONE 
J023077G12GCCACGTGTCGNONE 
J023078M10GCCACGTGTCGNONE 
J033031B10GCCACGTGTCGNONE 
J033067L18GCCACGTGTCGNONE 
J043005P09GCCACGTGTCGNONE 
J090013J15GCCACGTGTCGNONE 
J090042E10GCCACGTGTCGNONE 
J090045A20GCCACGTGTCGNONE 
J100022H02GCCACGTGTCGNONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os04g0244800009-066-G06CCCACGTGGCNONE 
011-024-D02CCCACGTGGCNONE 
AK121488CCCACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CCCACGTGGCNONE 
J023150J09CCCACGTGGCNONE 
J053097G24CCCACGTGGCNONE 
J065001K24CCCACGTGGCNONE 
J065009O13CCCACGTGGCNONE 
J065076M12CCCACGTGGCNONE 
J065081I15CCCACGTGGCNONE 
J065105E10CCCACGTGGCNONE 
J065106G04CCCACGTGGCNONE 
J065123I12CCCACGTGGCNONE 
J065137H16CCCACGTGGCNONE 
J065151I11CCCACGTGGCNONE 
J065164H06CCCACGTGGCNONE 
J065173J07CCCACGTGGCNONE 
J065196F02CCCACGTGGCNONE 
J065198I17CCCACGTGGCNONE 
J065206I11CCCACGTGGCNONE 
J065216J02CCCACGTGGCNONE 
J075076D10CCCACGTGGCNONE 
J075098F06CCCACGTGGCNONE 
J075115A20CCCACGTGGCNONE 
J075184H05CCCACGTGGCNONE 
J075193E17CCCACGTGGCNONE 
J090014L09CCCACGTGGCNONE 
J090015H16CCCACGTGGCNONE 
J090024M04CCCACGTGGCNONE 
J090062K08CCCACGTGGCNONE 
J090082I08CCCACGTGGCNONE 
Os04g0274700J043039I02GCCACGTGConserved hypothetical protein. 
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein. 
Os04g0435700AK100857GCCACGTGGGACCSimilar to UVB-resistance protein UVR8. 
Os04g0457000006-027-A09CACGTGGCGNONE 
006-027-D01CACGTGGCGNONE 
006-030-G04CACGTGGCGNONE 
006-038-H12CACGTGGCGNONE 
006-042-E09CACGTGGCGNONE 
006-049-C02CACGTGGCGNONE 
006-049-C09CACGTGGCGNONE 
006-052-C03CACGTGGCGNONE 
006-053-C01CACGTGGCGNONE 
006-054-B08CACGTGGCGNONE 
006-054-G05CACGTGGCGNONE 
006-058-A06CACGTGGCGNONE 
006-059-G07CACGTGGCGNONE 
006-088-F04CACGTGGCGNONE 
006-091-G07CACGTGGCGNONE 
006-093-C04CACGTGGCGNONE 
006-093-H03CACGTGGCGNONE 
006-094-B05CACGTGGCGNONE 
006-097-B05CACGTGGCGNONE 
006-097-E02CACGTGGCGNONE 
006-098-G09CACGTGGCGNONE 
006-099-A11CACGTGGCGNONE 
006-099-B09CACGTGGCGNONE 
006-099-E10CACGTGGCGNONE 
006-111-A07CACGTGGCGNONE 
006-111-H12CACGTGGCGNONE 
006-114-B12CACGTGGCGNONE 
006-115-H03CACGTGGCGNONE 
009-042-G09CACGTGGCGNONE 
009-117-G09CACGTGGCGNONE 
009-121-E02CACGTGGCGNONE 
009-162-H07CACGTGGCGNONE 
011-063-C05CACGTGGCGNONE 
AK066070CACGTGGCGSimilar to Chlorophyll a/b-binding protein CP24, photosystem II (Fragment). 
AK104811CACGTGGCGNONE 
J013055K10CACGTGGCGNONE 
J013072C14CACGTGGCGNONE 
J013091A08CACGTGGCGNONE 
J013123L18CACGTGGCGNONE 
J013129M15CACGTGGCGNONE 
J013135J21CACGTGGCGNONE 
J013170D09CACGTGGCGNONE 
J023107N10CACGTGGCGNONE 
J065142G08CACGTGGCGNONE 
J075023K20CACGTGGCGNONE 
J075119K14CACGTGGCGNONE 
J075134I20CACGTGGCGNONE 
J075161H06CACGTGGCGNONE 
J080014L13CACGTGGCGNONE 
J080026H08CACGTGGCGNONE 
J080070F02CACGTGGCGNONE 
J080070G22CACGTGGCGNONE 
J080093H23CACGTGGCGNONE 
J080305C11CACGTGGCGNONE 
J080305H15CACGTGGCGNONE 
J080317P21CACGTGGCGNONE 
J090023F10CACGTGGCGNONE 
J100061O10CACGTGGCGNONE 
Os04g0462500006-073-E08GCCACGTGNONE 
AK062065GCCACGTGNONE 
AK071311GCCACGTGSimilar to 14-3-3-like protein GF14-6. 
AK071822GCCACGTGNONE 
AK099243GCCACGTGNONE 
AK101938GCCACGTGNONE 
J013056F02GCCACGTGNONE 
J023020E08GCCACGTGNONE 
J023085B16GCCACGTGNONE 
J023117D08GCCACGTGNONE 
J023133K12GCCACGTGNONE 
J033025G04GCCACGTGNONE 
J033052A15GCCACGTGNONE 
J033074G16GCCACGTGNONE 
J033090A16GCCACGTGNONE 
J033122A07GCCACGTGNONE 
J033133G09GCCACGTGNONE 
J065002F16GCCACGTGNONE 
J065030M09GCCACGTGNONE 
J065056B11GCCACGTGNONE 
J065115I10GCCACGTGNONE 
J065120O09GCCACGTGNONE 
J065124G21GCCACGTGNONE 
J075031C14GCCACGTGNONE 
J075040H07GCCACGTGNONE 
J075047F04GCCACGTGNONE 
J075065F14GCCACGTGNONE 
J075066G20GCCACGTGNONE 
J075105D01GCCACGTGNONE 
J075147B04GCCACGTGNONE 
J075149A12GCCACGTGNONE 
J075172D07GCCACGTGNONE 
J075190J11GCCACGTGNONE 
J090038H18GCCACGTGNONE 
J090087G05GCCACGTGNONE 
J100025A10GCCACGTGNONE 
J100025O10GCCACGTGNONE 
J100027D02GCCACGTGNONE 
J100027P06GCCACGTGNONE 
J100032K04GCCACGTGNONE 
J100056D21GCCACGTGNONE 
J100060J08GCCACGTGNONE 
J100063N19GCCACGTGNONE 
J100064C14GCCACGTGNONE 
J100064K18GCCACGTGNONE 
J100070L21GCCACGTGNONE 
J100072M17GCCACGTGNONE 
J100074F21GCCACGTGNONE 
J100087E05GCCACGTGNONE 
U65956GCCACGTGNONE 
Os04g0466600J065051L19GCCACGTGGCGNONE 
J090042O12GCCACGTGGCGNONE 
Os04g0474600J023064N16CCCACGTGGCCACGTCGlycoside hydrolase, family 1 protein. 
J075175P11CCCACGTGGCCACGTCNONE 
J090080I16CCCACGTGGCCACGTCNONE 
J090089B01CCCACGTGGCCACGTCNONE 
Os04g0478600AK073788GCCACGTGGCConserved hypothetical protein. 
Os04g0591300009-006-D05CGCCACGTGTCNONE 
AK105120CGCCACGTGTCConserved hypothetical protein. 
Os04g0625600AK070994GCCACGTGGCTRAF-like domain containing protein. 
J023080H04GCCACGTGGCNONE 
J023086H15GCCACGTGGCNONE 
J033037L21GCCACGTGGCNONE 
J033044P14GCCACGTGGCNONE 
J065075C23GCCACGTGGCNONE 
J065167C18GCCACGTGGCNONE 
J100024E02GCCACGTGGCNONE 
J100068N24GCCACGTGGCNONE 
J100070G20GCCACGTGGCNONE 
Os04g0652900AK071125ACACGTGGCPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK071125GCCACGTGTCGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03ACACGTGGCNONE 
J023082K03GCCACGTGTCGNONE 
J075142E01ACACGTGGCNONE 
J075142E01GCCACGTGTCGNONE 
Os04g0661200AK102842CACGTGGCProtein of unknown function DUF941 family protein. 
AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19CACGTGGCNONE 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19CACGTGGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12CACGTGGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22CACGTGGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05CACGTGGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22CACGTGGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14CACGTGGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02CACGTGGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19CACGTGGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14CACGTGGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17CACGTGGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02CACGTGGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05CACGTGGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04CACGTGGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0674600AK069645GCCACGTGGCOligopeptide transporter OPT superfamily protein. 
Os04g0676800J090004I20GCCACGTGGCNONE 
J090011E22GCCACGTGGCProtein of unknown function DUF1677, Oryza sativa family protein. 
Os04g0679800AK060662CACGTGGCSimilar to RNA-binding protein-like protein. 
AK099987CACGTGGCNONE 
J013130B11CACGTGGCNONE 
J065049C17CACGTGGCNONE 
J075191N12CACGTGGCNONE 
J075191P12CACGTGGCNONE 
J100031C07CACGTGGCNONE 
Os05g0122700J065185N19GCCACGTGGCCCAACTNONE 
J065188N05GCCACGTGGCCCAACTNONE 
J065198E09GCCACGTGGCCCAACTNONE 
J065215H08GCCACGTGGCCCAACTSimilar to Low-temperature induced protein lt101.2. 
Os05g0134200AK067074CGCCACGTGTCCSimilar to Protein phosphatase-2C. 
Os05g0135500006-091-E03CACGTGGCNONE 
006-095-F12CACGTGGCNONE 
013-017-A12CACGTGGCNONE 
013-019-H02CACGTGGCNONE 
013-029-D12CACGTGGCNONE 
AK060998CACGTGGCHaem peroxidase family protein. 
AK061553CACGTGGCNONE 
AK104219CACGTGGCNONE 
AK104300CACGTGGCNONE 
AK104641CACGTGGCNONE 
AK106200CACGTGGCNONE 
AK120246CACGTGGCNONE 
Os05g0176700009-076-A09CGCCACGTGTCCNONE 
009-147-H06CGCCACGTGTCCNONE 
009-161-C02CGCCACGTGTCCNONE 
AK071729CGCCACGTGTCCConserved hypothetical protein. 
J023110H11CGCCACGTGTCCNONE 
J075092I23CGCCACGTGTCCNONE 
J100038P12CGCCACGTGTCCNONE 
J100039J21CGCCACGTGTCCNONE 
J100039M13CGCCACGTGTCCNONE 
J100084A22CGCCACGTGTCCNONE 
Os05g0188100009-011-G07AGTGACACGTGGCNONE 
009-015-G06AGTGACACGTGGCNONE 
009-021-B03AGTGACACGTGGCNONE 
009-024-A09AGTGACACGTGGCNONE 
009-025-A03AGTGACACGTGGCNONE 
009-028-G03AGTGACACGTGGCNONE 
009-029-G10AGTGACACGTGGCNONE 
009-034-G12AGTGACACGTGGCNONE 
009-039-D05AGTGACACGTGGCNONE 
009-055-F08AGTGACACGTGGCNONE 
009-064-B05AGTGACACGTGGCNONE 
009-066-H12AGTGACACGTGGCNONE 
009-077-B10AGTGACACGTGGCNONE 
009-102-B06AGTGACACGTGGCNONE 
009-113-F04AGTGACACGTGGCNONE 
009-114-F04AGTGACACGTGGCConserved hypothetical protein. 
009-131-G06AGTGACACGTGGCNONE 
009-137-H11AGTGACACGTGGCNONE 
009-172-H10AGTGACACGTGGCNONE 
009-176-D08AGTGACACGTGGCNONE 
009-182-A01AGTGACACGTGGCNONE 
009-183-A04AGTGACACGTGGCNONE 
009-183-G03AGTGACACGTGGCNONE 
009-185-B10AGTGACACGTGGCNONE 
009-192-F10AGTGACACGTGGCNONE 
009-196-G01AGTGACACGTGGCNONE 
011-005-A09AGTGACACGTGGCNONE 
013-031-B12AGTGACACGTGGCNONE 
013-031-F12AGTGACACGTGGCNONE 
013-032-A08AGTGACACGTGGCNONE 
013-069-H06AGTGACACGTGGCNONE 
013-089-C10AGTGACACGTGGCNONE 
J065123I11AGTGACACGTGGCNONE 
J065124F15AGTGACACGTGGCNONE 
J065155D05AGTGACACGTGGCNONE 
J065181J22AGTGACACGTGGCNONE 
J065185B07AGTGACACGTGGCNONE 
J065186J11AGTGACACGTGGCNONE 
J075183H21AGTGACACGTGGCNONE 
J080003P06AGTGACACGTGGCNONE 
J080068G17AGTGACACGTGGCNONE 
J080069J05AGTGACACGTGGCNONE 
J080080D03AGTGACACGTGGCNONE 
J080080K22AGTGACACGTGGCNONE 
J080090D12AGTGACACGTGGCNONE 
J080092I03AGTGACACGTGGCNONE 
J100039B06AGTGACACGTGGCNONE 
J100047N15AGTGACACGTGGCNONE 
Os05g0198000J080004C03GCCACGTGProtein of unknown function DUF247, plant family protein. 
J080004M24GCCACGTGNONE 
J080004O15GCCACGTGNONE 
J080006E14GCCACGTGNONE 
J080006I07GCCACGTGNONE 
J080007N13GCCACGTGNONE 
J080009C21GCCACGTGNONE 
J080009L03GCCACGTGNONE 
J080010F10GCCACGTGNONE 
J080015H04GCCACGTGNONE 
J080015L04GCCACGTGNONE 
J080018C21GCCACGTGNONE 
J080022M22GCCACGTGNONE 
J080027O19GCCACGTGNONE 
J080030I07GCCACGTGNONE 
J080037P07GCCACGTGNONE 
J080044C18GCCACGTGNONE 
J080049F14GCCACGTGNONE 
J080050F04GCCACGTGNONE 
J080052B18GCCACGTGNONE 
J080081B11GCCACGTGNONE 
J080083G12GCCACGTGNONE 
J080086A11GCCACGTGNONE 
J080087C06GCCACGTGNONE 
J080088E06GCCACGTGNONE 
J080091O21GCCACGTGNONE 
J080094N23GCCACGTGNONE 
Os05g0214100AK100400GCCACGTGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105GCCACGTGNONE 
J013073B12GCCACGTGNONE 
J013093B07GCCACGTGNONE 
J023086N14GCCACGTGNONE 
J065143B06GCCACGTGNONE 
J090009B02GCCACGTGNONE 
J090075A13GCCACGTGNONE 
Os05g0225800AK070646GCCACGTGSimilar to Szp protein. 
J023063L01GCCACGTGNONE 
J023129H15GCCACGTGNONE 
Os05g0269500AK072871GCCACGTGConserved hypothetical protein. 
Os05g0312500AK069307CCCACGTGGCGReticulon family protein. 
J023075D16CCCACGTGGCGNONE 
J023097K08CCCACGTGGCGNONE 
Os05g0316400AK108681CACGTGGCConserved hypothetical protein. 
Os05g0346100012-005-C07GCCACGTGGGCGCGCGCGANONE 
AK066689GCCACGTGGGCGCGCGCGAPhox-like domain containing protein. 
J013073J06GCCACGTGGGCGCGCGCGANONE 
Os05g0350500013-071-D05CACGTGGCNONE 
AF020787CACGTGGCNONE 
AK061712CACGTGGCNONE 
AK102897CACGTGGCProliferation-associated protein 1 family protein. 
J033060G23CACGTGGCNONE 
J033112P14CACGTGGCNONE 
J033127J04CACGTGGCNONE 
J090015L18CACGTGGCNONE 
J090047K03CACGTGGCNONE 
J090097J17CACGTGGCNONE 
Os05g0406800AK062566GCCCAACTGCCACGTGNONE 
AK099640GCCCAACTGCCACGTGLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GCCCAACTGCCACGTGNONE 
J090013F14GCCCAACTGCCACGTGNONE 
J090062E13GCCCAACTGCCACGTGNONE 
J090063D09GCCCAACTGCCACGTGNONE 
J090075H10GCCCAACTGCCACGTGNONE 
J090096E22GCCCAACTGCCACGTGNONE 
Os05g0423701J100057H19CCCACGTGGCGGlycoside hydrolase, family 9 protein. 
Os05g0463500AK108773CCCACGTGGCConserved hypothetical protein. 
Os05g0490200016-097-B03CGCCACGTGTCCNONE 
AK101147CGCCACGTGTCCProtein of unknown function DUF1692 domain containing protein. 
AK105601CGCCACGTGTCCNONE 
J033026P06CGCCACGTGTCCNONE 
Os05g0501300006-075-B11CGCCACGTGGCGNONE 
006-083-H08CGCCACGTGGCGNONE 
AK059889CGCCACGTGGCGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CGCCACGTGGCGNONE 
Os05g0512000AK102433GGACCCACGTGGCZinc finger, RING-type domain containing protein. 
Os05g0519700014-100-B04CGCCACGTGGCNONE 
AF332981CGCCACGTGGCNONE 
AK100903CGCCACGTGGCNONE 
AK105433CGCCACGTGGCHeat shock protein 101. 
Os05g0519800AK069435GCCACGTGGCGProtein of unknown function DUF28 family protein. 
J023024L22GCCACGTGGCGNONE 
Os05g0521700AK070182ATTGGGCCACGTGGCGConserved hypothetical protein. 
AK070182GCCACGTGTCConserved hypothetical protein. 
J013170O04ATTGGGCCACGTGGCGNONE 
J013170O04GCCACGTGTCNONE 
J023045H17ATTGGGCCACGTGGCGNONE 
J023045H17GCCACGTGTCNONE 
Os05g0568600009-024-B09CGCCACGTGTCGNONE 
AK063781CGCCACGTGTCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCCACGTGTCGNONE 
J080062M08CGCCACGTGTCGNONE 
J080064I07CGCCACGTGTCGNONE 
J080068A12CGCCACGTGTCGNONE 
J080086J10CGCCACGTGTCGNONE 
Os05g0586600AB096011GCCCACGTGGCGPlastid sigma factor SIG5. 
AB096071GCCCACGTGGCGNONE 
AK105697GCCCACGTGGCGNONE 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0130800014-002-A12CGCCACGTGTNONE 
AK069863CGCCACGTGTHistone H5 family protein. 
J023037L12CGCCACGTGTNONE 
J065013F22CGCCACGTGTNONE 
J065021C09CGCCACGTGTNONE 
J065065E23CGCCACGTGTNONE 
J065066L24CGCCACGTGTNONE 
J065093N06CGCCACGTGTNONE 
J065135B12CGCCACGTGTNONE 
J065142J19CGCCACGTGTNONE 
J065163M21CGCCACGTGTNONE 
J065167K01CGCCACGTGTNONE 
J065178F24CGCCACGTGTNONE 
J065179A22CGCCACGTGTNONE 
J065196O19CGCCACGTGTNONE 
J075041I03CGCCACGTGTNONE 
J075071E18CGCCACGTGTNONE 
J075071F17CGCCACGTGTNONE 
J075125K04CGCCACGTGTNONE 
J075141I12CGCCACGTGTNONE 
J075142M02CGCCACGTGTNONE 
J075150G22CGCCACGTGTNONE 
J075151J04CGCCACGTGTNONE 
J075195A03CGCCACGTGTNONE 
J080023G18CGCCACGTGTNONE 
J080076P03CGCCACGTGTNONE 
J090051F21CGCCACGTGTNONE 
J090082L05CGCCACGTGTNONE 
U74296CGCCACGTGTNONE 
Os06g0149500AK102827GCCACGTGGGConserved hypothetical protein. 
J065050G14GCCACGTGGGNONE 
J065186O18GCCACGTGGGNONE 
J075006P12GCCACGTGGGNONE 
J075032I11GCCACGTGGGNONE 
J075099I15GCCACGTGGGNONE 
J075176B01GCCACGTGGGNONE 
J100039D04GCCACGTGGGNONE 
J100081M03GCCACGTGGGNONE 
J100088G01GCCACGTGGGNONE 
Os06g0163300006-112-F11CGCCACGTGGCNONE 
006-115-G04CGCCACGTGGCNONE 
012-079-D09CGCCACGTGGCNONE 
AK058295CGCCACGTGGCHarpin-induced 1 domain containing protein. 
AK060328CGCCACGTGGCNONE 
AK073824CGCCACGTGGCNONE 
AK106071CGCCACGTGGCNONE 
J023025D10CGCCACGTGGCNONE 
J033070N04CGCCACGTGGCNONE 
J065016B01CGCCACGTGGCNONE 
J065030K12CGCCACGTGGCNONE 
J065076I03CGCCACGTGGCNONE 
J065084L24CGCCACGTGGCNONE 
J065179O03CGCCACGTGGCNONE 
J090025I06CGCCACGTGGCNONE 
Os06g0258000AK107483CGCCACGTGSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0258900AK067794GCCACGTGGGGKetose-bisphosphate aldolase, class-II family protein. 
AK099384GCCACGTGGGGNONE 
Os06g0275500AK111743CACGTGGCGCCACGTCSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0291600AK100261GACACGTGGCSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGCNONE 
J090041B12GACACGTGGCNONE 
Os06g0345200AK107186CACGTGGCSimilar to Tyrosine aminotransferase. 
AK108576CACGTGGCNONE 
Os06g0498900AK065724GCCACGTGGCCCAATGTP-binding protein, HSR1-related domain containing protein. 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
Os06g0595900AK066655GCCACGTGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02GCCACGTGNONE 
J075055H13GCCACGTGNONE 
J075188H14GCCACGTGNONE 
Os06g0647900AK073750CGCCACGTGConserved hypothetical protein. 
J033029K17CGCCACGTGNONE 
J033070L21CGCCACGTGNONE 
Os06g0666400AK108002CACGTGGCVQ domain containing protein. 
J065043C22CACGTGGCNONE 
J065120O19CACGTGGCNONE 
J075197D23CACGTGGCNONE 
J100030E22CACGTGGCNONE 
J100031I22CACGTGGCNONE 
J100072I12CACGTGGCNONE 
Os06g0677400AK064044GCCACGTGGCHydroxyacid dehydrogenase/reductase family protein. 
Os06g0684000AK102878GCCACGTGSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os06g0688100AK063450CGCCACGTGTCNONE 
AK101144CGCCACGTGTCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0694800AK070249GCCACGTGConserved hypothetical protein. 
J075092B07GCCACGTGNONE 
J075099D09GCCACGTGNONE 
J075153F22GCCACGTGNONE 
Os06g0698300AK071637CGCCACGTGProtein phosphatase 2C family protein. 
AK071637CGCCACGTGProtein phosphatase 2C family protein. 
J023098M15CGCCACGTGNONE 
J023098M15CGCCACGTGNONE 
J023101G03CGCCACGTGNONE 
J023101G03CGCCACGTGNONE 
J023139A04CGCCACGTGNONE 
J023139A04CGCCACGTGNONE 
Os06g0716700AB037681CACGTGGCGSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681GCCACGTGSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CACGTGGCGNONE 
AK063385CGCCACGTGTCCGGCCCNONE 
AK063385GCCACGTGNONE 
AK102478CACGTGGCGNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
AK102478GCCACGTGNONE 
J013030D18CACGTGGCGNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J013030D18GCCACGTGNONE 
J090091L06CACGTGGCGNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
J090091L06GCCACGTGNONE 
Os06g0726400AF136268GGCCGTCCACGTGGCNONE 
AK065121GGCCGTCCACGTGGCNONE 
AK119436GGCCGTCCACGTGGCBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GGCCGTCCACGTGGCNONE 
AY302112GGCCGTCCACGTGGCNONE 
D10752GGCCGTCCACGTGGCNONE 
D11082GGCCGTCCACGTGGCNONE 
J013031L12GGCCGTCCACGTGGCNONE 
J013042M09GGCCGTCCACGTGGCNONE 
J013058E01GGCCGTCCACGTGGCNONE 
J013058O09GGCCGTCCACGTGGCNONE 
J013063J17GGCCGTCCACGTGGCNONE 
J013066I24GGCCGTCCACGTGGCNONE 
J013069F17GGCCGTCCACGTGGCNONE 
J013106E01GGCCGTCCACGTGGCNONE 
J013118D19GGCCGTCCACGTGGCNONE 
J013162M11GGCCGTCCACGTGGCNONE 
J023028B19GGCCGTCCACGTGGCNONE 
J023031A13GGCCGTCCACGTGGCNONE 
J023047H18GGCCGTCCACGTGGCNONE 
J023059N10GGCCGTCCACGTGGCNONE 
J023104N22GGCCGTCCACGTGGCNONE 
J033025J03GGCCGTCCACGTGGCNONE 
J033045B05GGCCGTCCACGTGGCNONE 
J033067M08GGCCGTCCACGTGGCNONE 
J033113D04GGCCGTCCACGTGGCNONE 
J043003D11GGCCGTCCACGTGGCNONE 
J043009O20GGCCGTCCACGTGGCNONE 
J043016P06GGCCGTCCACGTGGCNONE 
J043017C21GGCCGTCCACGTGGCNONE 
J043017J20GGCCGTCCACGTGGCNONE 
J043021P15GGCCGTCCACGTGGCNONE 
J043026I22GGCCGTCCACGTGGCNONE 
J043032L15GGCCGTCCACGTGGCNONE 
J043034G14GGCCGTCCACGTGGCNONE 
J043039L16GGCCGTCCACGTGGCNONE 
J075003D02GGCCGTCCACGTGGCNONE 
J075003O22GGCCGTCCACGTGGCNONE 
J075005I24GGCCGTCCACGTGGCNONE 
J075006N09GGCCGTCCACGTGGCNONE 
J075011A22GGCCGTCCACGTGGCNONE 
J075012K24GGCCGTCCACGTGGCNONE 
J075017D01GGCCGTCCACGTGGCNONE 
J075017I23GGCCGTCCACGTGGCNONE 
J075023D17GGCCGTCCACGTGGCNONE 
J075024B03GGCCGTCCACGTGGCNONE 
J075025H05GGCCGTCCACGTGGCNONE 
J075031D19GGCCGTCCACGTGGCNONE 
J075034B02GGCCGTCCACGTGGCNONE 
J075035C02GGCCGTCCACGTGGCNONE 
J075037J12GGCCGTCCACGTGGCNONE 
J075038M11GGCCGTCCACGTGGCNONE 
J075039J17GGCCGTCCACGTGGCNONE 
J075042P10GGCCGTCCACGTGGCNONE 
J075046J20GGCCGTCCACGTGGCNONE 
J075047F21GGCCGTCCACGTGGCNONE 
J075053E05GGCCGTCCACGTGGCNONE 
J075054D11GGCCGTCCACGTGGCNONE 
J075054K06GGCCGTCCACGTGGCNONE 
J075059E15GGCCGTCCACGTGGCNONE 
J075061O04GGCCGTCCACGTGGCNONE 
J075062I20GGCCGTCCACGTGGCNONE 
J075066I12GGCCGTCCACGTGGCNONE 
J075066L06GGCCGTCCACGTGGCNONE 
J075071H12GGCCGTCCACGTGGCNONE 
J075071N19GGCCGTCCACGTGGCNONE 
J075074K01GGCCGTCCACGTGGCNONE 
J075077H22GGCCGTCCACGTGGCNONE 
J075083H18GGCCGTCCACGTGGCNONE 
J075085F04GGCCGTCCACGTGGCNONE 
J075085K09GGCCGTCCACGTGGCNONE 
J075086C06GGCCGTCCACGTGGCNONE 
J075086E06GGCCGTCCACGTGGCNONE 
J075087A15GGCCGTCCACGTGGCNONE 
J075090N02GGCCGTCCACGTGGCNONE 
J075090N22GGCCGTCCACGTGGCNONE 
J075091C04GGCCGTCCACGTGGCNONE 
J075091G16GGCCGTCCACGTGGCNONE 
J075097E04GGCCGTCCACGTGGCNONE 
J075099E04GGCCGTCCACGTGGCNONE 
J075102P22GGCCGTCCACGTGGCNONE 
J075109B08GGCCGTCCACGTGGCNONE 
J075109J02GGCCGTCCACGTGGCNONE 
J075115I12GGCCGTCCACGTGGCNONE 
J075117E17GGCCGTCCACGTGGCNONE 
J075123C07GGCCGTCCACGTGGCNONE 
J075124N05GGCCGTCCACGTGGCNONE 
J075125E12GGCCGTCCACGTGGCNONE 
J075126B11GGCCGTCCACGTGGCNONE 
J075129E14GGCCGTCCACGTGGCNONE 
J075130N15GGCCGTCCACGTGGCNONE 
J075131I07GGCCGTCCACGTGGCNONE 
J075141B13GGCCGTCCACGTGGCNONE 
J075141B20GGCCGTCCACGTGGCNONE 
J075144D23GGCCGTCCACGTGGCNONE 
J075144N01GGCCGTCCACGTGGCNONE 
J075147M24GGCCGTCCACGTGGCNONE 
J075148L16GGCCGTCCACGTGGCNONE 
J075151A22GGCCGTCCACGTGGCNONE 
J075151D03GGCCGTCCACGTGGCNONE 
J075151D04GGCCGTCCACGTGGCNONE 
J075153E23GGCCGTCCACGTGGCNONE 
J075156D02GGCCGTCCACGTGGCNONE 
J075156P05GGCCGTCCACGTGGCNONE 
J075162E23GGCCGTCCACGTGGCNONE 
J075165J22GGCCGTCCACGTGGCNONE 
J075166A06GGCCGTCCACGTGGCNONE 
J075168H13GGCCGTCCACGTGGCNONE 
J075170D04GGCCGTCCACGTGGCNONE 
J075171C19GGCCGTCCACGTGGCNONE 
J075173B12GGCCGTCCACGTGGCNONE 
J075173M23GGCCGTCCACGTGGCNONE 
J075174C03GGCCGTCCACGTGGCNONE 
J075185O11GGCCGTCCACGTGGCNONE 
J075186G21GGCCGTCCACGTGGCNONE 
J075187D06GGCCGTCCACGTGGCNONE 
J075195G21GGCCGTCCACGTGGCNONE 
J090003D18GGCCGTCCACGTGGCNONE 
J090005I12GGCCGTCCACGTGGCNONE 
J090007D15GGCCGTCCACGTGGCNONE 
J090007G20GGCCGTCCACGTGGCNONE 
J090014G13GGCCGTCCACGTGGCNONE 
J090014L08GGCCGTCCACGTGGCNONE 
J090016J03GGCCGTCCACGTGGCNONE 
J090023P22GGCCGTCCACGTGGCNONE 
J090025C19GGCCGTCCACGTGGCNONE 
J090028F11GGCCGTCCACGTGGCNONE 
J090028G01GGCCGTCCACGTGGCNONE 
J090028H02GGCCGTCCACGTGGCNONE 
J090037I11GGCCGTCCACGTGGCNONE 
J090040F21GGCCGTCCACGTGGCNONE 
J090040N24GGCCGTCCACGTGGCNONE 
J090044M12GGCCGTCCACGTGGCNONE 
J090045B13GGCCGTCCACGTGGCNONE 
J090045M22GGCCGTCCACGTGGCNONE 
J090048C10GGCCGTCCACGTGGCNONE 
J090051J02GGCCGTCCACGTGGCNONE 
J090058O15GGCCGTCCACGTGGCNONE 
J090062F11GGCCGTCCACGTGGCNONE 
J090067D23GGCCGTCCACGTGGCNONE 
J090069G15GGCCGTCCACGTGGCNONE 
J090072I06GGCCGTCCACGTGGCNONE 
J090073H18GGCCGTCCACGTGGCNONE 
J090073L01GGCCGTCCACGTGGCNONE 
J090075O21GGCCGTCCACGTGGCNONE 
J090084K24GGCCGTCCACGTGGCNONE 
J090087P11GGCCGTCCACGTGGCNONE 
J090092B17GGCCGTCCACGTGGCNONE 
J100042H08GGCCGTCCACGTGGCNONE 
Os07g0100500J033026C11GGGGCCCACGTGGCNONE 
Os07g0124100014-015-G11ACACGTGGCGNONE 
AJ276693ACACGTGGCGPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647ACACGTGGCGNONE 
Os07g0127500009-139-F12ATTTGGGCCACGTGNONE 
AK062949ATTTGGGCCACGTGSimilar to PR-1a pathogenesis related protein (Hv-1a) precursor. 
J100077L01ATTTGGGCCACGTGNONE 
Os07g0142900003-001-H01CACGTGGCNONE 
AK060737CACGTGGCAldo/keto reductase family protein. 
AK064848CACGTGGCNONE 
Os07g0154900009-142-E09CACGTGGCNONE 
AK062969CACGTGGCConserved hypothetical protein. 
Os07g0162600015-024-F04GCCACGTGGCNONE 
AK105789GCCACGTGGCNONE 
AK106274GCCACGTGGCEsterase/lipase/thioesterase domain containing protein. 
J100026E18GCCACGTGGCNONE 
J100037B07GCCACGTGGCNONE 
J100090H11GCCACGTGGCNONE 
Os07g0181000AK066918CACGTGGCCCCACTCCNONE 
AK070512CACGTGGCCCCACTCCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0209100AK120944GCCACGTGTCSimilar to Seed imbibition protein (Fragment). 
Os07g0246200012-046-B07CACGTGGCGNONE 
AB021259CACGTGGCGNONE 
AK065341CACGTGGCGSimilar to Calreticulin (Fragment). 
AK099348CACGTGGCGNONE 
AK104328CACGTGGCGNONE 
AK104826CACGTGGCGNONE 
J013000E04CACGTGGCGNONE 
J013093M19CACGTGGCGNONE 
J013108J08CACGTGGCGNONE 
J013118G03CACGTGGCGNONE 
J013121I07CACGTGGCGNONE 
J013153K07CACGTGGCGNONE 
J023028N07CACGTGGCGNONE 
J023034F12CACGTGGCGNONE 
J023043J11CACGTGGCGNONE 
J023087A03CACGTGGCGNONE 
J023099N05CACGTGGCGNONE 
J023105B02CACGTGGCGNONE 
J023110H02CACGTGGCGNONE 
J023112E15CACGTGGCGNONE 
J023132C20CACGTGGCGNONE 
J023134G12CACGTGGCGNONE 
J023138O12CACGTGGCGNONE 
J033031E05CACGTGGCGNONE 
J033032C03CACGTGGCGNONE 
J033039K10CACGTGGCGNONE 
J033050P09CACGTGGCGNONE 
J033074D03CACGTGGCGNONE 
J033075G14CACGTGGCGNONE 
J033075I23CACGTGGCGNONE 
J033081H23CACGTGGCGNONE 
J033087N08CACGTGGCGNONE 
J033110B03CACGTGGCGNONE 
J033148H22CACGTGGCGNONE 
J043027F13CACGTGGCGNONE 
J043031H01CACGTGGCGNONE 
J080003O10CACGTGGCGNONE 
J080022D10CACGTGGCGNONE 
J080029I12CACGTGGCGNONE 
J080034A09CACGTGGCGNONE 
J080035H20CACGTGGCGNONE 
J080049C10CACGTGGCGNONE 
J080053G14CACGTGGCGNONE 
J080055J22CACGTGGCGNONE 
J080058J04CACGTGGCGNONE 
J080069E14CACGTGGCGNONE 
J080069M23CACGTGGCGNONE 
J080072E19CACGTGGCGNONE 
J080072I03CACGTGGCGNONE 
J080075B13CACGTGGCGNONE 
J080078I11CACGTGGCGNONE 
J080081F16CACGTGGCGNONE 
J080088O10CACGTGGCGNONE 
J080089G18CACGTGGCGNONE 
J090009C10CACGTGGCGNONE 
J090022D23CACGTGGCGNONE 
J090023A15CACGTGGCGNONE 
J090024M10CACGTGGCGNONE 
J090038F24CACGTGGCGNONE 
J090039O13CACGTGGCGNONE 
J090040N12CACGTGGCGNONE 
J090054I18CACGTGGCGNONE 
J090061C16CACGTGGCGNONE 
J090063H23CACGTGGCGNONE 
J090067F21CACGTGGCGNONE 
J090075A01CACGTGGCGNONE 
J090076K11CACGTGGCGNONE 
J090078L11CACGTGGCGNONE 
J090079P03CACGTGGCGNONE 
J090087D23CACGTGGCGNONE 
J090087G22CACGTGGCGNONE 
J090089F03CACGTGGCGNONE 
J090092A04CACGTGGCGNONE 
J100024L17CACGTGGCGNONE 
J100031P13CACGTGGCGNONE 
J100032H05CACGTGGCGNONE 
J100036P03CACGTGGCGNONE 
J100038L07CACGTGGCGNONE 
J100043I20CACGTGGCGNONE 
J100069A21CACGTGGCGNONE 
J100078G06CACGTGGCGNONE 
J100081J24CACGTGGCGNONE 
J100081N04CACGTGGCGNONE 
J100084K16CACGTGGCGNONE 
J100085O06CACGTGGCGNONE 
J100088L13CACGTGGCGNONE 
J100090O21CACGTGGCGNONE 
Os07g0296000AK073416GCCACGTGConserved hypothetical protein. 
AK121178GCCACGTGNONE 
J033040D17GCCACGTGNONE 
Os07g0406800AK064087CGCCACGTGTNONE 
AK101812CGCCACGTGTEukaryotic-type DNA primase, large subunit family protein. 
Os07g0407350J065005B03ACACGTGGCGTGNONE 
J065058G23ACACGTGGCGTGNONE 
J065144A11ACACGTGGCGTGNONE 
J065175J02ACACGTGGCGTGConserved hypothetical protein. 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0422100013-054-G11CACGTGGCNONE 
AK063592CACGTGGCNONE 
J065165K10CACGTGGCNONE 
J075021B01CACGTGGCNONE 
J075087H22CACGTGGCNONE 
J075118C10CACGTGGCNONE 
J075134N03CACGTGGCNONE 
J075151F23CACGTGGCNONE 
U57639CACGTGGCAWPM-19-like family protein. 
Os07g0470700AK120675CACGTGGCPAP fibrillin family protein. 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0509800Os07g0509800GCCACGTGGCCCCCACSimilar to APS reductase (Fragment). 
Os07g0544800009-021-C02GGTCCACGTGGCGNONE 
009-170-G02GGTCCACGTGGCGNONE 
009-178-H12GGTCCACGTGGCGNONE 
AK069170GGTCCACGTGGCGSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP). 
AK099127GGTCCACGTGGCGNONE 
J065088D21GGTCCACGTGGCGNONE 
J065106G19GGTCCACGTGGCGNONE 
J065156I24GGTCCACGTGGCGNONE 
J065162C10GGTCCACGTGGCGNONE 
J065211G14GGTCCACGTGGCGNONE 
J075003F05GGTCCACGTGGCGNONE 
J075046I10GGTCCACGTGGCGNONE 
J075055M11GGTCCACGTGGCGNONE 
J075074I12GGTCCACGTGGCGNONE 
J075088B06GGTCCACGTGGCGNONE 
J075091K13GGTCCACGTGGCGNONE 
J075093I10GGTCCACGTGGCGNONE 
J075097M09GGTCCACGTGGCGNONE 
J075106H11GGTCCACGTGGCGNONE 
J075121C22GGTCCACGTGGCGNONE 
J075145F05GGTCCACGTGGCGNONE 
J075173H16GGTCCACGTGGCGNONE 
J075190L07GGTCCACGTGGCGNONE 
J100063N21GGTCCACGTGGCGNONE 
J100073C24GGTCCACGTGGCGNONE 
J100085E01GGTCCACGTGGCGNONE 
J100088I23GGTCCACGTGGCGNONE 
Os07g0546000AF188065CACGTGGCNONE 
AK061800CACGTGGCNONE 
AK065871CACGTGGCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CACGTGGCNONE 
J013035F03CACGTGGCNONE 
J013044J20CACGTGGCNONE 
Os07g0558500AK064914GGACACGTGGCGInositol phosphatase-like protein. 
AY224446GGACACGTGGCGNONE 
J013000M13GGACACGTGGCGNONE 
Os07g0597625J065130O18GGTGGGACCCACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GGTGGGACCCACGTGGCNONE 
Os07g0615900AK066317ACACGTGGCZinc finger, GATA-type domain containing protein. 
AK073803ACACGTGGCNONE 
J013026A07ACACGTGGCNONE 
J013064I12ACACGTGGCNONE 
J033068D01ACACGTGGCNONE 
J033074A10ACACGTGGCNONE 
J033129C06ACACGTGGCNONE 
J100035K20ACACGTGGCNONE 
J100044G13ACACGTGGCNONE 
J100050K01ACACGTGGCNONE 
J100069P20ACACGTGGCNONE 
J100071O09ACACGTGGCNONE 
J100086K01ACACGTGGCNONE 
J100089G11ACACGTGGCNONE 
Os07g0618700AK066033GCCACGTGConserved hypothetical protein. 
J013043D16GCCACGTGNONE 
J065124E20GCCACGTGNONE 
Os07g0619400009-095-D09GCCACGTGGCNONE 
AK062716GCCACGTGGCCalcium-binding EF-hand domain containing protein. 
Os07g0622700AK107120CACGTGGCGEpoxide hydrolase family protein. 
Os07g0625800AK073694CGCCACGTGNONE 
AK103419CGCCACGTGPlant lipid transfer protein/Par allergen family protein. 
Os07g0633400AK071894CGCCACGTGTIQ calmodulin-binding region domain containing protein. 
Os07g0663600AK107157GCCACGTGGlucose/ribitol dehydrogenase family protein. 
J075003E02GCCACGTGNONE 
J075046H11GCCACGTGNONE 
J075156F16GCCACGTGNONE 
Os07g0674100AB183706CGCCACGTGGCGUDP-glucuronic acid decarboxylase. 
AK099614CGCCACGTGGCGNONE 
J013050E02CGCCACGTGGCGNONE 
J065162F06CGCCACGTGGCGNONE 
J065180F10CGCCACGTGGCGNONE 
J090049F09CGCCACGTGGCGNONE 
J100064L11CGCCACGTGGCGNONE 
Os07g0679300AK065079GCCACGTGTNONE 
AK099229GCCACGTGTSimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05GCCACGTGTNONE 
J013049N18GCCACGTGTNONE 
J013071C14GCCACGTGTNONE 
J013088P15GCCACGTGTNONE 
J013092D24GCCACGTGTNONE 
J013093O14GCCACGTGTNONE 
J023095E17GCCACGTGTNONE 
J043005E21GCCACGTGTNONE 
J043015E06GCCACGTGTNONE 
J043027P22GCCACGTGTNONE 
J065038B15GCCACGTGTNONE 
J065073M21GCCACGTGTNONE 
J065165P06GCCACGTGTNONE 
J065198I06GCCACGTGTNONE 
J075007E08GCCACGTGTNONE 
J075038I07GCCACGTGTNONE 
J075130L20GCCACGTGTNONE 
J090057G17GCCACGTGTNONE 
J100029K23GCCACGTGTNONE 
J100086O16GCCACGTGTNONE 
J100087M02GCCACGTGTNONE 
Os07g0691100AK071728GCCACGTGSimilar to Pectin methylesterase 6 (Fragment). 
J023108P03GCCACGTGNONE 
J023112F11GCCACGTGNONE 
J023143A10GCCACGTGNONE 
Os07g0692050J065164I07GCCACGTGGCGConserved hypothetical protein. 
Os07g0694700006-021-A10GCCACGTGGGCNONE 
006-027-C12GCCACGTGGGCNONE 
006-070-B12GCCACGTGGGCNONE 
006-077-D01GCCACGTGGGCNONE 
006-105-E07GCCACGTGGGCNONE 
006-111-H07GCCACGTGGGCNONE 
009-066-B07GCCACGTGGGCNONE 
009-199-H12GCCACGTGGGCNONE 
AB050724GCCACGTGGGCNONE 
AB053297GCCACGTGGGCNONE 
AK061715GCCACGTGGGCNONE 
AK068430GCCACGTGGGCL-ascorbate peroxidase. 
J013021I10GCCACGTGGGCNONE 
J013034P12GCCACGTGGGCNONE 
J013045L04GCCACGTGGGCNONE 
J013050F21GCCACGTGGGCNONE 
J013066C16GCCACGTGGGCNONE 
J013067N13GCCACGTGGGCNONE 
J013111K04GCCACGTGGGCNONE 
J013123I20GCCACGTGGGCNONE 
J013126F24GCCACGTGGGCNONE 
J013134J06GCCACGTGGGCNONE 
J013155B13GCCACGTGGGCNONE 
J013156P11GCCACGTGGGCNONE 
J023003N11GCCACGTGGGCNONE 
J023008D23GCCACGTGGGCNONE 
J023011I01GCCACGTGGGCNONE 
J023014M13GCCACGTGGGCNONE 
J023020A10GCCACGTGGGCNONE 
J023028F09GCCACGTGGGCNONE 
J023034I04GCCACGTGGGCNONE 
J023037L11GCCACGTGGGCNONE 
J023065M21GCCACGTGGGCNONE 
J023072C05GCCACGTGGGCNONE 
J023073M06GCCACGTGGGCNONE 
J023079M21GCCACGTGGGCNONE 
J023081M07GCCACGTGGGCNONE 
J023082O15GCCACGTGGGCNONE 
J023086M10GCCACGTGGGCNONE 
J023087H15GCCACGTGGGCNONE 
J023088K10GCCACGTGGGCNONE 
J023091G08GCCACGTGGGCNONE 
J023098C04GCCACGTGGGCNONE 
J023102D23GCCACGTGGGCNONE 
J023106M19GCCACGTGGGCNONE 
J023110D18GCCACGTGGGCNONE 
J023111B03GCCACGTGGGCNONE 
J023115I03GCCACGTGGGCNONE 
J023120G01GCCACGTGGGCNONE 
J023126C05GCCACGTGGGCNONE 
J023126C11GCCACGTGGGCNONE 
J023126F22GCCACGTGGGCNONE 
J023131L23GCCACGTGGGCNONE 
J023132K24GCCACGTGGGCNONE 
J023139P05GCCACGTGGGCNONE 
J023140F02GCCACGTGGGCNONE 
J023141F15GCCACGTGGGCNONE 
J023149G01GCCACGTGGGCNONE 
J033024O13GCCACGTGGGCNONE 
J033026M13GCCACGTGGGCNONE 
J033061C14GCCACGTGGGCNONE 
J033103E18GCCACGTGGGCNONE 
J033103L21GCCACGTGGGCNONE 
J033107I09GCCACGTGGGCNONE 
J033111N15GCCACGTGGGCNONE 
J033120G04GCCACGTGGGCNONE 
J033124J05GCCACGTGGGCNONE 
J043015A21GCCACGTGGGCNONE 
J043022H01GCCACGTGGGCNONE 
J043027O20GCCACGTGGGCNONE 
J043031F14GCCACGTGGGCNONE 
J065047K03GCCACGTGGGCNONE 
J065093N11GCCACGTGGGCNONE 
J065105P20GCCACGTGGGCNONE 
J065164L16GCCACGTGGGCNONE 
J065167K06GCCACGTGGGCNONE 
J075087I15GCCACGTGGGCNONE 
J080032F23GCCACGTGGGCNONE 
J080061N21GCCACGTGGGCNONE 
J080064L14GCCACGTGGGCNONE 
J080064L20GCCACGTGGGCNONE 
J080304B21GCCACGTGGGCNONE 
J080305A04GCCACGTGGGCNONE 
J080308L24GCCACGTGGGCNONE 
J080312J04GCCACGTGGGCNONE 
J080319N10GCCACGTGGGCNONE 
J090011C08GCCACGTGGGCNONE 
J090028G14GCCACGTGGGCNONE 
J090037N03GCCACGTGGGCNONE 
J090041I10GCCACGTGGGCNONE 
J090057B14GCCACGTGGGCNONE 
J090062P18GCCACGTGGGCNONE 
J090072L03GCCACGTGGGCNONE 
J090073A02GCCACGTGGGCNONE 
J090073C10GCCACGTGGGCNONE 
J090078N11GCCACGTGGGCNONE 
J090085L16GCCACGTGGGCNONE 
J100023N07GCCACGTGGGCNONE 
J100028F02GCCACGTGGGCNONE 
J100033K09GCCACGTGGGCNONE 
J100038K23GCCACGTGGGCNONE 
J100038O11GCCACGTGGGCNONE 
J100040G12GCCACGTGGGCNONE 
J100057L23GCCACGTGGGCNONE 
J100058N21GCCACGTGGGCNONE 
J100059N10GCCACGTGGGCNONE 
J100063D09GCCACGTGGGCNONE 
J100065O12GCCACGTGGGCNONE 
J100066G11GCCACGTGGGCNONE 
J100067I01GCCACGTGGGCNONE 
J100069J23GCCACGTGGGCNONE 
J100071M03GCCACGTGGGCNONE 
J100072C11GCCACGTGGGCNONE 
J100072D01GCCACGTGGGCNONE 
J100079M19GCCACGTGGGCNONE 
Os08g0104600005-006-A07CGCCACGTGGCNONE 
006-083-A08CGCCACGTGGCNONE 
009-022-C08CGCCACGTGGCNONE 
009-027-A01CGCCACGTGGCNONE 
009-030-E07CGCCACGTGGCNONE 
009-042-H08CGCCACGTGGCNONE 
009-048-E08CGCCACGTGGCNONE 
009-051-F07CGCCACGTGGCNONE 
009-051-H06CGCCACGTGGCNONE 
009-054-E02CGCCACGTGGCNONE 
009-084-D01CGCCACGTGGCNONE 
009-089-A03CGCCACGTGGCNONE 
009-105-H12CGCCACGTGGCNONE 
009-109-D02CGCCACGTGGCNONE 
009-110-H12CGCCACGTGGCNONE 
009-117-A05CGCCACGTGGCNONE 
009-117-C08CGCCACGTGGCNONE 
009-118-F09CGCCACGTGGCNONE 
009-119-E03CGCCACGTGGCNONE 
009-122-G10CGCCACGTGGCNONE 
009-125-H06CGCCACGTGGCNONE 
009-126-A06CGCCACGTGGCNONE 
009-127-H02CGCCACGTGGCNONE 
009-128-B09CGCCACGTGGCNONE 
009-129-B09CGCCACGTGGCNONE 
009-130-D05CGCCACGTGGCNONE 
009-130-D08CGCCACGTGGCNONE 
009-139-D08CGCCACGTGGCNONE 
009-149-D07CGCCACGTGGCNONE 
009-150-C04CGCCACGTGGCNONE 
009-154-E03CGCCACGTGGCNONE 
009-155-C06CGCCACGTGGCNONE 
009-165-B08CGCCACGTGGCNONE 
009-167-C06CGCCACGTGGCNONE 
009-181-H11CGCCACGTGGCNONE 
009-191-F03CGCCACGTGGCNONE 
009-192-C06CGCCACGTGGCNONE 
009-195-F03CGCCACGTGGCNONE 
009-196-G08CGCCACGTGGCNONE 
009-197-D08CGCCACGTGGCNONE 
014-052-E10CGCCACGTGGCNONE 
AF010320CGCCACGTGGCNONE 
AK061654CGCCACGTGGCNONE 
AK119206CGCCACGTGGCNONE 
AK119709CGCCACGTGGCNONE 
AK120393CGCCACGTGGCFerredoxin I, chloroplast precursor (Anti-disease protein 1). 
AY072818CGCCACGTGGCNONE 
D30763CGCCACGTGGCNONE 
J013043A04CGCCACGTGGCNONE 
J013058K06CGCCACGTGGCNONE 
J013059G01CGCCACGTGGCNONE 
J013067N20CGCCACGTGGCNONE 
J013074D04CGCCACGTGGCNONE 
J013075A06CGCCACGTGGCNONE 
J013093N12CGCCACGTGGCNONE 
J013094P22CGCCACGTGGCNONE 
J013119N05CGCCACGTGGCNONE 
J013120G18CGCCACGTGGCNONE 
J013129G02CGCCACGTGGCNONE 
J013129P10CGCCACGTGGCNONE 
J013159F22CGCCACGTGGCNONE 
J013160D20CGCCACGTGGCNONE 
J013160E23CGCCACGTGGCNONE 
J023034F18CGCCACGTGGCNONE 
J023048F04CGCCACGTGGCNONE 
J023048O08CGCCACGTGGCNONE 
J023049B18CGCCACGTGGCNONE 
J023061A17CGCCACGTGGCNONE 
J023072A03CGCCACGTGGCNONE 
J023085A16CGCCACGTGGCNONE 
J023087L09CGCCACGTGGCNONE 
J043012O13CGCCACGTGGCNONE 
J065038A14CGCCACGTGGCNONE 
J065187M18CGCCACGTGGCNONE 
J065205M17CGCCACGTGGCNONE 
J080301G10CGCCACGTGGCNONE 
J080311I12CGCCACGTGGCNONE 
J080311O19CGCCACGTGGCNONE 
J080312C16CGCCACGTGGCNONE 
J080317L04CGCCACGTGGCNONE 
J090027H09CGCCACGTGGCNONE 
J090053F07CGCCACGTGGCNONE 
J090055C23CGCCACGTGGCNONE 
J090071A18CGCCACGTGGCNONE 
J090084O10CGCCACGTGGCNONE 
J090091C23CGCCACGTGGCNONE 
J090093J04CGCCACGTGGCNONE 
J100061N06CGCCACGTGGCNONE 
J100070P06CGCCACGTGGCNONE 
J100074K15CGCCACGTGGCNONE 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0138500AK102951CACGTGGCGCCACGTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458CACGTGGCGCCACGTNONE 
J033115D14CACGTGGCGCCACGTNONE 
J065013F04CACGTGGCGCCACGTNONE 
J065050P11CACGTGGCGCCACGTNONE 
J065063K18CACGTGGCGCCACGTNONE 
J090054H10CACGTGGCGCCACGTNONE 
J100083F11CACGTGGCGCCACGTNONE 
Os08g0169600012-007-C10GCCACGTGGCNONE 
AK067305GCCACGTGGCRNA polymerase II transcription factor SIII subunit A family protein. 
J013100P11GCCACGTGGCNONE 
J033132G12GCCACGTGGCNONE 
J065005F08GCCACGTGGCNONE 
J065020C20GCCACGTGGCNONE 
J065029N08GCCACGTGGCNONE 
J065091M07GCCACGTGGCNONE 
J065123F14GCCACGTGGCNONE 
Os08g0183900J043001P15CGCCACGTGGCNONE 
J065080M03CGCCACGTGGCNONE 
J065215I09CGCCACGTGGCNAD-dependent epimerase/dehydratase family protein. 
Os08g0191900AK067587GCCCACACGTGGCProtein prenyltransferase domain containing protein. 
AK099016GCCCACACGTGGCNONE 
J013032I08GCCCACACGTGGCNONE 
J013050I24GCCCACACGTGGCNONE 
J013128E05GCCCACACGTGGCNONE 
Os08g0192800AK059490CGCCACGTGTCGNONE 
AK101678CGCCACGTGTCGNONE 
AK120613CGCCACGTGTCGBromodomain containing protein. 
J080039B22CGCCACGTGTCGNONE 
J080039I23CGCCACGTGTCGNONE 
J080074D19CGCCACGTGTCGNONE 
J080086N13CGCCACGTGTCGNONE 
Os08g0199400AK105852CACGTGGCSimilar to Stearoyl-acyl carrier protein desaturse (EC 1.14.99.6) (Fragment). 
Os08g0200300005-007-C01CGCCACGTGGCGNONE 
009-041-H05CGCCACGTGGCGNONE 
009-055-G10CGCCACGTGGCGNONE 
009-101-E05CGCCACGTGGCGNONE 
009-110-H11CGCCACGTGGCGNONE 
009-114-D06CGCCACGTGGCGNONE 
009-116-B08CGCCACGTGGCGNONE 
009-117-G06CGCCACGTGGCGNONE 
009-125-H04CGCCACGTGGCGNONE 
009-131-H10CGCCACGTGGCGNONE 
009-136-F02CGCCACGTGGCGNONE 
009-144-C04CGCCACGTGGCGNONE 
009-149-E10CGCCACGTGGCGNONE 
009-166-E04CGCCACGTGGCGNONE 
009-189-G08CGCCACGTGGCGNONE 
AK105055CGCCACGTGGCGNONE 
AK121083CGCCACGTGGCGSimilar to Photosystem II 10 kDa polypeptide (Fragment). 
J013051F20CGCCACGTGGCGNONE 
J013060E15CGCCACGTGGCGNONE 
J013070F24CGCCACGTGGCGNONE 
J013071K15CGCCACGTGGCGNONE 
J013091E11CGCCACGTGGCGNONE 
J013134L03CGCCACGTGGCGNONE 
J023063I15CGCCACGTGGCGNONE 
J023084E22CGCCACGTGGCGNONE 
J023084J06CGCCACGTGGCGNONE 
J033090D12CGCCACGTGGCGNONE 
J065001D08CGCCACGTGGCGNONE 
J065007K04CGCCACGTGGCGNONE 
J065040H06CGCCACGTGGCGNONE 
J065078N14CGCCACGTGGCGNONE 
J065093B19CGCCACGTGGCGNONE 
J065103D10CGCCACGTGGCGNONE 
J065107E16CGCCACGTGGCGNONE 
J065116E01CGCCACGTGGCGNONE 
J065129B10CGCCACGTGGCGNONE 
J065132F08CGCCACGTGGCGNONE 
J065135M15CGCCACGTGGCGNONE 
J065149C13CGCCACGTGGCGNONE 
J065155H23CGCCACGTGGCGNONE 
J065162P16CGCCACGTGGCGNONE 
J065169P09CGCCACGTGGCGNONE 
J065176B09CGCCACGTGGCGNONE 
J065187F07CGCCACGTGGCGNONE 
J065194H08CGCCACGTGGCGNONE 
J065197G22CGCCACGTGGCGNONE 
J065208D12CGCCACGTGGCGNONE 
J065210B17CGCCACGTGGCGNONE 
J065219D24CGCCACGTGGCGNONE 
J075009C14CGCCACGTGGCGNONE 
J075009O22CGCCACGTGGCGNONE 
J075012J06CGCCACGTGGCGNONE 
J075014G03CGCCACGTGGCGNONE 
J075015A03CGCCACGTGGCGNONE 
J075022B09CGCCACGTGGCGNONE 
J075023H11CGCCACGTGGCGNONE 
J075025J07CGCCACGTGGCGNONE 
J075026K15CGCCACGTGGCGNONE 
J075029D06CGCCACGTGGCGNONE 
J075038G19CGCCACGTGGCGNONE 
J075041N03CGCCACGTGGCGNONE 
J075048P22CGCCACGTGGCGNONE 
J075051J23CGCCACGTGGCGNONE 
J075051L15CGCCACGTGGCGNONE 
J075052P04CGCCACGTGGCGNONE 
J075058O21CGCCACGTGGCGNONE 
J075062E03CGCCACGTGGCGNONE 
J075063K18CGCCACGTGGCGNONE 
J075064K01CGCCACGTGGCGNONE 
J075067B03CGCCACGTGGCGNONE 
J075070I20CGCCACGTGGCGNONE 
J075071J04CGCCACGTGGCGNONE 
J075074F17CGCCACGTGGCGNONE 
J075076H02CGCCACGTGGCGNONE 
J075080E17CGCCACGTGGCGNONE 
J075081F04CGCCACGTGGCGNONE 
J075086K17CGCCACGTGGCGNONE 
J075090I07CGCCACGTGGCGNONE 
J075092F21CGCCACGTGGCGNONE 
J075096P11CGCCACGTGGCGNONE 
J075099K15CGCCACGTGGCGNONE 
J075102M12CGCCACGTGGCGNONE 
J075105B03CGCCACGTGGCGNONE 
J075110I07CGCCACGTGGCGNONE 
J075111C15CGCCACGTGGCGNONE 
J075111M09CGCCACGTGGCGNONE 
J075114I06CGCCACGTGGCGNONE 
J075115E15CGCCACGTGGCGNONE 
J075123K17CGCCACGTGGCGNONE 
J075125B03CGCCACGTGGCGNONE 
J075126A12CGCCACGTGGCGNONE 
J075129L20CGCCACGTGGCGNONE 
J075130B11CGCCACGTGGCGNONE 
J075137J12CGCCACGTGGCGNONE 
J075141G10CGCCACGTGGCGNONE 
J075141I06CGCCACGTGGCGNONE 
J075143A22CGCCACGTGGCGNONE 
J075148E07CGCCACGTGGCGNONE 
J075158D09CGCCACGTGGCGNONE 
J075168G18CGCCACGTGGCGNONE 
J075169K08CGCCACGTGGCGNONE 
J075170A10CGCCACGTGGCGNONE 
J075170E18CGCCACGTGGCGNONE 
J075179C15CGCCACGTGGCGNONE 
J075180L24CGCCACGTGGCGNONE 
J075181A22CGCCACGTGGCGNONE 
J075185C20CGCCACGTGGCGNONE 
J075191B07CGCCACGTGGCGNONE 
J075192D03CGCCACGTGGCGNONE 
J075192L04CGCCACGTGGCGNONE 
J075193G10CGCCACGTGGCGNONE 
J075193M18CGCCACGTGGCGNONE 
J075198F05CGCCACGTGGCGNONE 
J080001F14CGCCACGTGGCGNONE 
J080001J20CGCCACGTGGCGNONE 
J080002N10CGCCACGTGGCGNONE 
J080003I15CGCCACGTGGCGNONE 
J080004H05CGCCACGTGGCGNONE 
J080006J08CGCCACGTGGCGNONE 
J080007D08CGCCACGTGGCGNONE 
J080008B21CGCCACGTGGCGNONE 
J080009P16CGCCACGTGGCGNONE 
J080010F24CGCCACGTGGCGNONE 
J080011F18CGCCACGTGGCGNONE 
J080012J03CGCCACGTGGCGNONE 
J080013B21CGCCACGTGGCGNONE 
J080013N24CGCCACGTGGCGNONE 
J080017D22CGCCACGTGGCGNONE 
J080017E04CGCCACGTGGCGNONE 
J080018G06CGCCACGTGGCGNONE 
J080020M24CGCCACGTGGCGNONE 
J080021C22CGCCACGTGGCGNONE 
J080021E21CGCCACGTGGCGNONE 
J080021G12CGCCACGTGGCGNONE 
J080021N20CGCCACGTGGCGNONE 
J080022B02CGCCACGTGGCGNONE 
J080022D19CGCCACGTGGCGNONE 
J080024J07CGCCACGTGGCGNONE 
J080026M20CGCCACGTGGCGNONE 
J080028D11CGCCACGTGGCGNONE 
J080029E08CGCCACGTGGCGNONE 
J080030F06CGCCACGTGGCGNONE 
J080030J09CGCCACGTGGCGNONE 
J080032F19CGCCACGTGGCGNONE 
J080032L09CGCCACGTGGCGNONE 
J080032O15CGCCACGTGGCGNONE 
J080034J07CGCCACGTGGCGNONE 
J080035A04CGCCACGTGGCGNONE 
J080035A12CGCCACGTGGCGNONE 
J080037P21CGCCACGTGGCGNONE 
J080040F18CGCCACGTGGCGNONE 
J080040N13CGCCACGTGGCGNONE 
J080040P12CGCCACGTGGCGNONE 
J080041E09CGCCACGTGGCGNONE 
J080044A04CGCCACGTGGCGNONE 
J080044F21CGCCACGTGGCGNONE 
J080044P20CGCCACGTGGCGNONE 
J080045N06CGCCACGTGGCGNONE 
J080046H12CGCCACGTGGCGNONE 
J080047A12CGCCACGTGGCGNONE 
J080047O03CGCCACGTGGCGNONE 
J080047O20CGCCACGTGGCGNONE 
J080048G24CGCCACGTGGCGNONE 
J080049H08CGCCACGTGGCGNONE 
J080050G23CGCCACGTGGCGNONE 
J080050P05CGCCACGTGGCGNONE 
J080052J24CGCCACGTGGCGNONE 
J080056N20CGCCACGTGGCGNONE 
J080056O04CGCCACGTGGCGNONE 
J080058D10CGCCACGTGGCGNONE 
J080058G13CGCCACGTGGCGNONE 
J080059H10CGCCACGTGGCGNONE 
J080062G11CGCCACGTGGCGNONE 
J080064A12CGCCACGTGGCGNONE 
J080064E18CGCCACGTGGCGNONE 
J080064O19CGCCACGTGGCGNONE 
J080065F09CGCCACGTGGCGNONE 
J080065P22CGCCACGTGGCGNONE 
J080067A17CGCCACGTGGCGNONE 
J080067E09CGCCACGTGGCGNONE 
J080069M22CGCCACGTGGCGNONE 
J080070E21CGCCACGTGGCGNONE 
J080070K18CGCCACGTGGCGNONE 
J080071L21CGCCACGTGGCGNONE 
J080071P04CGCCACGTGGCGNONE 
J080072M02CGCCACGTGGCGNONE 
J080075K15CGCCACGTGGCGNONE 
J080075K19CGCCACGTGGCGNONE 
J080076L03CGCCACGTGGCGNONE 
J080079L23CGCCACGTGGCGNONE 
J080080O08CGCCACGTGGCGNONE 
J080081H06CGCCACGTGGCGNONE 
J080082L22CGCCACGTGGCGNONE 
J080083N23CGCCACGTGGCGNONE 
J080084J09CGCCACGTGGCGNONE 
J080085B01CGCCACGTGGCGNONE 
J080087M23CGCCACGTGGCGNONE 
J080088P08CGCCACGTGGCGNONE 
J080090A20CGCCACGTGGCGNONE 
J080092J18CGCCACGTGGCGNONE 
J080095G03CGCCACGTGGCGNONE 
J080097C14CGCCACGTGGCGNONE 
J080097P20CGCCACGTGGCGNONE 
J080301E13CGCCACGTGGCGNONE 
J080301G11CGCCACGTGGCGNONE 
J080301I11CGCCACGTGGCGNONE 
J080301O21CGCCACGTGGCGNONE 
J080302L09CGCCACGTGGCGNONE 
J080303E17CGCCACGTGGCGNONE 
J080304C05CGCCACGTGGCGNONE 
J080305E22CGCCACGTGGCGNONE 
J080305F22CGCCACGTGGCGNONE 
J080307B14CGCCACGTGGCGNONE 
J080310B22CGCCACGTGGCGNONE 
J080310J02CGCCACGTGGCGNONE 
J080312N01CGCCACGTGGCGNONE 
J080313I10CGCCACGTGGCGNONE 
J080315K16CGCCACGTGGCGNONE 
J080317B08CGCCACGTGGCGNONE 
J080317H10CGCCACGTGGCGNONE 
J080317M14CGCCACGTGGCGNONE 
J080317P17CGCCACGTGGCGNONE 
J080319M22CGCCACGTGGCGNONE 
J090052E23CGCCACGTGGCGNONE 
J090071I04CGCCACGTGGCGNONE 
J100045L08CGCCACGTGGCGNONE 
J100068N19CGCCACGTGGCGNONE 
U86018CGCCACGTGGCGNONE 
Os08g0205700009-047-A11CGCCACGTGNONE 
009-167-C10CGCCACGTGNONE 
014-088-E02CGCCACGTGNONE 
J065029D05CGCCACGTGNONE 
J065096A14CGCCACGTGNONE 
J065118E14CGCCACGTGNONE 
J065186J24CGCCACGTGNONE 
J065199O09CGCCACGTGNONE 
J100060I06CGCCACGTGNONE 
Os08g0208400AK066265GCCACGTGEn/Spm-like transposon proteins family protein. 
AK102509GCCACGTGNONE 
J013059M15GCCACGTGNONE 
J023080E16GCCACGTGNONE 
J033095G06GCCACGTGNONE 
J065170I05GCCACGTGNONE 
J090034L11GCCACGTGNONE 
Os08g0234400J065186B17GGCCGTCCACGTGGCCCAGCConserved hypothetical protein. 
Os08g0238200006-021-D04GCCACGTGTNONE 
006-049-C01GCCACGTGTNONE 
006-062-D11GCCACGTGTNONE 
006-078-D06GCCACGTGTNONE 
006-115-G09GCCACGTGTNONE 
009-166-B07GCCACGTGTNONE 
AK067264GCCACGTGTDienelactone hydrolase domain containing protein. 
AK104922GCCACGTGTNONE 
Os08g0280200AK069036GCCACGTGGACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0299200009-120-G12GCCACGTGGGNONE 
J075096F13GCCACGTGGGAdenylate cyclase domain containing protein. 
Os08g0353700AK058799CCCACGTGGCConserved hypothetical protein. 
Os08g0386300AK059323GTGGCCCACGTGGCNONE 
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein. 
J023054P20GTGGCCCACGTGGCNONE 
J033089H01GTGGCCCACGTGGCNONE 
J065013I01GTGGCCCACGTGGCNONE 
J065212E17GTGGCCCACGTGGCNONE 
J080317O15GTGGCCCACGTGGCNONE 
J090018O07GTGGCCCACGTGGCNONE 
Os08g0398700AK120068ACACGTGGCGPeptidase M1, membrane alanine aminopeptidase family protein. 
Os08g0425800009-168-F06GCCACGTGTCAGTGGNONE 
AK061339GCCACGTGTCAGTGGConserved hypothetical protein. 
AK101198GCCACGTGTCAGTGGNONE 
J033030L06GCCACGTGTCAGTGGNONE 
J100036D08GCCACGTGTCAGTGGNONE 
J100052I22GCCACGTGTCAGTGGNONE 
Os08g0440500AK058761GCCACGTGMIR domain containing protein. 
Os08g0485400AK068155GCCACGTGSimilar to 2-nitropropane dioxygenase-like protein. 
AK100705GCCACGTGNONE 
J065112C18GCCACGTGNONE 
J065217I09GCCACGTGNONE 
J100073C22GCCACGTGNONE 
J100073F01GCCACGTGNONE 
J100082I01GCCACGTGNONE 
Os08g0521600AK108208CGCCACGTGTCCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
AK108208GGACACGTGGCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
Os08g0532300009-122-A05CGACACGTGGCNONE 
009-129-H05CGACACGTGGCNONE 
AB011262CGACACGTGGCNONE 
AK065141CGACACGTGGCNONE 
AK119730CGACACGTGGCSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CGACACGTGGCNONE 
J013042K23CGACACGTGGCNONE 
J023057J08CGACACGTGGCNONE 
J023057N10CGACACGTGGCNONE 
J023113C21CGACACGTGGCNONE 
J053054E03CGACACGTGGCNONE 
J053062B07CGACACGTGGCNONE 
J053075O17CGACACGTGGCNONE 
J053075P09CGACACGTGGCNONE 
J065024H05CGACACGTGGCNONE 
J065049F22CGACACGTGGCNONE 
J065063L03CGACACGTGGCNONE 
J065102O07CGACACGTGGCNONE 
J065104M12CGACACGTGGCNONE 
J065119E04CGACACGTGGCNONE 
J065153E10CGACACGTGGCNONE 
J065168M24CGACACGTGGCNONE 
J065173I10CGACACGTGGCNONE 
J065181L04CGACACGTGGCNONE 
J065184I18CGACACGTGGCNONE 
J065203M15CGACACGTGGCNONE 
J075004C21CGACACGTGGCNONE 
J075047B11CGACACGTGGCNONE 
J075055F18CGACACGTGGCNONE 
J075065G09CGACACGTGGCNONE 
J075094O14CGACACGTGGCNONE 
J075143C22CGACACGTGGCNONE 
J075153K18CGACACGTGGCNONE 
J075164N10CGACACGTGGCNONE 
J075197C11CGACACGTGGCNONE 
J080001A01CGACACGTGGCNONE 
J080003B11CGACACGTGGCNONE 
J080006G17CGACACGTGGCNONE 
J080007J06CGACACGTGGCNONE 
J080010H12CGACACGTGGCNONE 
J080014I01CGACACGTGGCNONE 
J080015C16CGACACGTGGCNONE 
J080016P19CGACACGTGGCNONE 
J080020G24CGACACGTGGCNONE 
J080021E12CGACACGTGGCNONE 
J080023I11CGACACGTGGCNONE 
J080024H24CGACACGTGGCNONE 
J080025G18CGACACGTGGCNONE 
J080028H08CGACACGTGGCNONE 
J080030G08CGACACGTGGCNONE 
J080031H20CGACACGTGGCNONE 
J080034C20CGACACGTGGCNONE 
J080040H13CGACACGTGGCNONE 
J080044M04CGACACGTGGCNONE 
J080047D02CGACACGTGGCNONE 
J080049D17CGACACGTGGCNONE 
J080049J17CGACACGTGGCNONE 
J080050A05CGACACGTGGCNONE 
J080051C11CGACACGTGGCNONE 
J080051K06CGACACGTGGCNONE 
J080053A07CGACACGTGGCNONE 
J080053I08CGACACGTGGCNONE 
J080056L12CGACACGTGGCNONE 
J080061I19CGACACGTGGCNONE 
J080075G09CGACACGTGGCNONE 
J080078C23CGACACGTGGCNONE 
J080080I21CGACACGTGGCNONE 
J080084F04CGACACGTGGCNONE 
J080085K16CGACACGTGGCNONE 
J080097A12CGACACGTGGCNONE 
J080097N01CGACACGTGGCNONE 
J090027L10CGACACGTGGCNONE 
J100034N17CGACACGTGGCNONE 
Os08g0532400AK101608GCCACGTGTCGSimilar to AT.I.24-7 protein. 
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE 
009-033-G10CGCCACGTGGGCCCCACCNONE 
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CGCCACGTGGGCCCCACCNONE 
J023037A21CGCCACGTGGGCCCCACCNONE 
J023066D20CGCCACGTGGGCCCCACCNONE 
J033099K13CGCCACGTGGGCCCCACCNONE 
J065116C14CGCCACGTGGGCCCCACCNONE 
J075009K15CGCCACGTGGGCCCCACCNONE 
J075071P13CGCCACGTGGGCCCCACCNONE 
J075080D18CGCCACGTGGGCCCCACCNONE 
J075124F24CGCCACGTGGGCCCCACCNONE 
J075198F23CGCCACGTGGGCCCCACCNONE 
J080006B15CGCCACGTGGGCCCCACCNONE 
J090078H13CGCCACGTGGGCCCCACCNONE 
J090089J09CGCCACGTGGGCCCCACCNONE 
J100017A03CGCCACGTGGGCCCCACCNONE 
J100023G03CGCCACGTGGGCCCCACCNONE 
Os08g0557200AK108300GCCACGTGMetallophosphoesterase domain containing protein. 
Os08g0558000J080005K14CGCCACGTGGCGNONE 
Os08g0564300015-019-C05GCCACGTGNONE 
AK063134GCCACGTGNONE 
AK106260GCCACGTGNONE 
AK119880GCCACGTGABC transporter, transmembrane region domain containing protein. 
AK121506GCCACGTGNONE 
J033022P13GCCACGTGNONE 
Os08g0565200AK108143GCCACGTGGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0243200AK107718ACACGTGGCGZinc finger, RING-type domain containing protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0401900AK103519GCCACGTGGCNONE 
AK106516GCCACGTGGCConserved hypothetical protein. 
Os09g0424600AK073882ACAGGTGGGCCCCACGTGGCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0429350J065205M18GCCACGTGConserved hypothetical protein. 
Os09g0433000AK069858CACGTGGCGGlycosyl transferase, family 31 protein. 
Os09g0434200AK062015CACGTGGCNONE 
AK103447CACGTGGCZinc finger, RING-type domain containing protein. 
Os09g0445600AK107839GCCACGTGGCConserved hypothetical protein. 
Os09g0447900AK111436GCCACGTGConserved hypothetical protein. 
Os09g0456900AK073236GCCACGTGTNucleic acid-binding, OB-fold domain containing protein. 
Os09g0465500AK109671ACACGTGGCCGTCCConserved hypothetical protein. 
Os09g0466300AK102696CACGTGGCGRAM domain containing protein. 
J033103F22CACGTGGCNONE 
Os09g0474501J065129D17CACGTGGCConserved hypothetical protein. 
Os09g0519200009-006-A07GCCACGTGNONE 
009-092-E11GCCACGTGNONE 
009-124-A12GCCACGTGNONE 
009-140-E10GCCACGTGNONE 
009-151-A11GCCACGTGNONE 
AK063004GCCACGTGConserved hypothetical protein. 
AK067759GCCACGTGNONE 
J080001K23GCCACGTGNONE 
J080005M03GCCACGTGNONE 
J080010I19GCCACGTGNONE 
J080016E11GCCACGTGNONE 
J080020C09GCCACGTGNONE 
J080021H12GCCACGTGNONE 
J080022D22GCCACGTGNONE 
J080022H06GCCACGTGNONE 
J080028M15GCCACGTGNONE 
J080032J10GCCACGTGNONE 
J080034F22GCCACGTGNONE 
J080040E05GCCACGTGNONE 
J080042G22GCCACGTGNONE 
J080042N10GCCACGTGNONE 
J080050H02GCCACGTGNONE 
J080053L12GCCACGTGNONE 
J080058G15GCCACGTGNONE 
J080062O15GCCACGTGNONE 
J080063B17GCCACGTGNONE 
J080066C10GCCACGTGNONE 
J080066M23GCCACGTGNONE 
J080067L18GCCACGTGNONE 
J080069F06GCCACGTGNONE 
J080069F08GCCACGTGNONE 
J080069P19GCCACGTGNONE 
J080077P18GCCACGTGNONE 
J080079E24GCCACGTGNONE 
J080079J12GCCACGTGNONE 
J080086C03GCCACGTGNONE 
J080089I24GCCACGTGNONE 
J080090I06GCCACGTGNONE 
J080096D06GCCACGTGNONE 
J080096N03GCCACGTGNONE 
Os09g0531200AK064107GCCACGTGRNA recognition motif 2 domain containing protein. 
Os09g0534000AK100026GACGTGGCCACGTGGGConserved hypothetical protein. 
Os09g0553200003-101-F12CGCCACGTGTCCNONE 
003-125-E09CGCCACGTGTCCNONE 
011-031-H12CGCCACGTGTCCNONE 
012-033-A01CGCCACGTGTCCNONE 
015-046-H04CGCCACGTGTCCNONE 
015-056-F04CGCCACGTGTCCNONE 
016-029-H06CGCCACGTGTCCNONE 
016-080-D05CGCCACGTGTCCNONE 
AB062606CGCCACGTGTCCNONE 
AK065780CGCCACGTGTCCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGCCACGTGTCCNONE 
AK104344CGCCACGTGTCCNONE 
AK119197CGCCACGTGTCCNONE 
AK119232CGCCACGTGTCCNONE 
J013039M01CGCCACGTGTCCNONE 
J013043M01CGCCACGTGTCCNONE 
J013064F03CGCCACGTGTCCNONE 
J013066K19CGCCACGTGTCCNONE 
J013092G12CGCCACGTGTCCNONE 
J013123P09CGCCACGTGTCCNONE 
J013155F01CGCCACGTGTCCNONE 
J013158J12CGCCACGTGTCCNONE 
J013159H14CGCCACGTGTCCNONE 
J013169C10CGCCACGTGTCCNONE 
J013170L23CGCCACGTGTCCNONE 
J023010J18CGCCACGTGTCCNONE 
J023019E23CGCCACGTGTCCNONE 
J023045B14CGCCACGTGTCCNONE 
J023082K24CGCCACGTGTCCNONE 
J023086G04CGCCACGTGTCCNONE 
J023090N09CGCCACGTGTCCNONE 
J023113C08CGCCACGTGTCCNONE 
J023125H18CGCCACGTGTCCNONE 
J033034M08CGCCACGTGTCCNONE 
J033035K03CGCCACGTGTCCNONE 
J033039D15CGCCACGTGTCCNONE 
J033045P18CGCCACGTGTCCNONE 
J033058P08CGCCACGTGTCCNONE 
J033061D16CGCCACGTGTCCNONE 
J033070F14CGCCACGTGTCCNONE 
J033086F23CGCCACGTGTCCNONE 
J033095C05CGCCACGTGTCCNONE 
J033114H22CGCCACGTGTCCNONE 
J033133M20CGCCACGTGTCCNONE 
J043026G01CGCCACGTGTCCNONE 
J043037F17CGCCACGTGTCCNONE 
J065120K17CGCCACGTGTCCNONE 
J065123O07CGCCACGTGTCCNONE 
J080305H06CGCCACGTGTCCNONE 
J090001F11CGCCACGTGTCCNONE 
J090020C17CGCCACGTGTCCNONE 
J090043A19CGCCACGTGTCCNONE 
J090051J17CGCCACGTGTCCNONE 
J090068K06CGCCACGTGTCCNONE 
J090075P19CGCCACGTGTCCNONE 
J100036G10CGCCACGTGTCCNONE 
J100084F02CGCCACGTGTCCNONE 
Os11g0180000006-025-E11CGCCACGTGTCGNONE 
006-044-A07CGCCACGTGTCGNONE 
AK060077CGCCACGTGTCGPlant disease resistance response protein family protein. 
Os11g0200600AK101818GCCACGTGGGCCyclin-like F-box domain containing protein. 
AK111444GCCACGTGGGCNONE 
J065098I12GCCACGTGGGCNONE 
Os11g0219000AK066071GCCACGTGConserved hypothetical protein. 
J013056B11GCCACGTGNONE 
J080302O12GCCACGTGNONE 
J080317C21GCCACGTGNONE 
Os11g0291500AK108558ACACGTGGCGTGSimilar to Beta-D-xylosidase. 
Os11g0297300AK070171GACACGTGGCSimilar to Beta-D-xylosidase. 
Os11g0297800AK109882GCCACGTGGCGSimilar to Beta-D-xylosidase. 
Os11g0417700J075031P16CGACACGTGGCConserved hypothetical protein. 
J075034C16CGACACGTGGCNONE 
J075034J22CGACACGTGGCNONE 
J075042C07CGACACGTGGCNONE 
J075046O07CGACACGTGGCNONE 
J075062O13CGACACGTGGCNONE 
J075091G08CGACACGTGGCNONE 
J075135H20CGACACGTGGCNONE 
J075172B13CGACACGTGGCNONE 
J075179G14CGACACGTGGCNONE 
Os11g0432900AK107478GCCACGTGNONE 
J065069E03GCCACGTGNONE 
J075002H21GCCACGTGNONE 
J075017I09GCCACGTGNONE 
J075027G05GCCACGTGNONE 
J075027L05GCCACGTGNONE 
J075034G18GCCACGTGNONE 
J075047F18GCCACGTGNONE 
J075055L21GCCACGTGNONE 
J075072J22GCCACGTGNONE 
J075087F09GCCACGTGNONE 
J075105D12GCCACGTGNONE 
J075119G02GCCACGTGNONE 
J075125J19GCCACGTGNONE 
J075144D02GCCACGTGNONE 
J075162N18GCCACGTGNONE 
J075165J07GCCACGTGNONE 
J075173C09GCCACGTGNONE 
J075187M10GCCACGTGNONE 
J075189N21GCCACGTGNONE 
J075197F07GCCACGTGNONE 
J075197J19GCCACGTGNONE 
Os11g0498600AK071051CACGTGGCSimilar to HVA22 protein. 
Os11g0501000AK109615CGCCACGTGTCConserved hypothetical protein. 
Os11g0530600AB000801AGCCCACGTGGCSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810AGCCCACGTGGCNONE 
D29697AGCCCACGTGGCNONE 
J013119K06AGCCCACGTGGCNONE 
J023001C21AGCCCACGTGGCNONE 
J023081C19AGCCCACGTGGCNONE 
J065026K21AGCCCACGTGGCNONE 
J065040A17AGCCCACGTGGCNONE 
J065043H01AGCCCACGTGGCNONE 
J065093P05AGCCCACGTGGCNONE 
J065104P15AGCCCACGTGGCNONE 
J065127C09AGCCCACGTGGCNONE 
J065140D08AGCCCACGTGGCNONE 
X89859AGCCCACGTGGCNONE 
Os11g0533400014-020-B08CGCCACGTGTCNONE 
AK063652CGCCACGTGTCConserved hypothetical protein. 
Os11g0536900J100027G18GCCACGTGTCCConserved hypothetical protein. 
J100073G12GCCACGTGTCCNONE 
Os11g0573900AK064591CACGTGGCConserved hypothetical protein. 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0682600J090026G08GCCACGTGGGConserved hypothetical protein. 
J090037N19GCCACGTGGGNONE 
J090061M21GCCACGTGGGNONE 
Os11g0707000003-106-C01CGCCACGTGTNONE 
003-130-G06CGCCACGTGTNONE 
005-012-E05CGCCACGTGTNONE 
006-021-F04CGCCACGTGTNONE 
006-031-E07CGCCACGTGTNONE 
006-035-C03CGCCACGTGTNONE 
006-038-D10CGCCACGTGTNONE 
006-043-A10CGCCACGTGTNONE 
006-043-G08CGCCACGTGTNONE 
006-046-C03CGCCACGTGTNONE 
006-055-G09CGCCACGTGTNONE 
006-085-A03CGCCACGTGTNONE 
006-118-E05CGCCACGTGTNONE 
AB034698CGCCACGTGTNONE 
AB034748CGCCACGTGTNONE 
AB110180CGCCACGTGTNONE 
AK060841CGCCACGTGTNONE 
AK060847CGCCACGTGTNONE 
AK064986CGCCACGTGTNONE 
AK104332CGCCACGTGTSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513CGCCACGTGTNONE 
J013001C24CGCCACGTGTNONE 
J013024I02CGCCACGTGTNONE 
J013044O11CGCCACGTGTNONE 
J013048O10CGCCACGTGTNONE 
J013051A08CGCCACGTGTNONE 
J013055H23CGCCACGTGTNONE 
J013070N15CGCCACGTGTNONE 
J013074C16CGCCACGTGTNONE 
J013096P16CGCCACGTGTNONE 
J013109A14CGCCACGTGTNONE 
J013112C07CGCCACGTGTNONE 
J013112N16CGCCACGTGTNONE 
J013123B03CGCCACGTGTNONE 
J013128G01CGCCACGTGTNONE 
J013132L17CGCCACGTGTNONE 
J013158I17CGCCACGTGTNONE 
J013159L01CGCCACGTGTNONE 
J023001H04CGCCACGTGTNONE 
J023004L05CGCCACGTGTNONE 
J023013G12CGCCACGTGTNONE 
J023020K06CGCCACGTGTNONE 
J023031J19CGCCACGTGTNONE 
J023034A05CGCCACGTGTNONE 
J023034E21CGCCACGTGTNONE 
J023041M12CGCCACGTGTNONE 
J023041P06CGCCACGTGTNONE 
J023044C04CGCCACGTGTNONE 
J023047H01CGCCACGTGTNONE 
J023048D08CGCCACGTGTNONE 
J023052H08CGCCACGTGTNONE 
J023054D24CGCCACGTGTNONE 
J023063G11CGCCACGTGTNONE 
J023068O21CGCCACGTGTNONE 
J023074C13CGCCACGTGTNONE 
J023078O06CGCCACGTGTNONE 
J023089K10CGCCACGTGTNONE 
J023100O05CGCCACGTGTNONE 
J023107N16CGCCACGTGTNONE 
J023120L08CGCCACGTGTNONE 
J023123N23CGCCACGTGTNONE 
J023127M10CGCCACGTGTNONE 
J023128C22CGCCACGTGTNONE 
J023129C04CGCCACGTGTNONE 
J023146H08CGCCACGTGTNONE 
J053063N05CGCCACGTGTNONE 
J053066F02CGCCACGTGTNONE 
J053066N18CGCCACGTGTNONE 
J053076G01CGCCACGTGTNONE 
J065012O05CGCCACGTGTNONE 
J065035L06CGCCACGTGTNONE 
J065037M01CGCCACGTGTNONE 
J065045N23CGCCACGTGTNONE 
J065058F09CGCCACGTGTNONE 
J065072E14CGCCACGTGTNONE 
J065073I20CGCCACGTGTNONE 
J065076B05CGCCACGTGTNONE 
J065093B09CGCCACGTGTNONE 
J065117A22CGCCACGTGTNONE 
J065149J21CGCCACGTGTNONE 
J065155M04CGCCACGTGTNONE 
J065161J21CGCCACGTGTNONE 
J065163H19CGCCACGTGTNONE 
J065192A15CGCCACGTGTNONE 
J065211L18CGCCACGTGTNONE 
J075001K13CGCCACGTGTNONE 
J075002J24CGCCACGTGTNONE 
J075004N18CGCCACGTGTNONE 
J075025H21CGCCACGTGTNONE 
J075028F20CGCCACGTGTNONE 
J075039F23CGCCACGTGTNONE 
J075043M08CGCCACGTGTNONE 
J075057D02CGCCACGTGTNONE 
J075059I01CGCCACGTGTNONE 
J075069P10CGCCACGTGTNONE 
J075073D08CGCCACGTGTNONE 
J075084I17CGCCACGTGTNONE 
J075089I04CGCCACGTGTNONE 
J075093O18CGCCACGTGTNONE 
J075097N13CGCCACGTGTNONE 
J075114B02CGCCACGTGTNONE 
J075123E10CGCCACGTGTNONE 
J075128C19CGCCACGTGTNONE 
J075135F05CGCCACGTGTNONE 
J075136A04CGCCACGTGTNONE 
J075141B05CGCCACGTGTNONE 
J075169H18CGCCACGTGTNONE 
J075183L14CGCCACGTGTNONE 
J075191N03CGCCACGTGTNONE 
J080001C11CGCCACGTGTNONE 
J080004F18CGCCACGTGTNONE 
J080004H21CGCCACGTGTNONE 
J080004O09CGCCACGTGTNONE 
J080005J02CGCCACGTGTNONE 
J080006I03CGCCACGTGTNONE 
J080006J17CGCCACGTGTNONE 
J080009I09CGCCACGTGTNONE 
J080010I06CGCCACGTGTNONE 
J080011A17CGCCACGTGTNONE 
J080014N22CGCCACGTGTNONE 
J080016E24CGCCACGTGTNONE 
J080016P08CGCCACGTGTNONE 
J080017G22CGCCACGTGTNONE 
J080017P09CGCCACGTGTNONE 
J080018D23CGCCACGTGTNONE 
J080018E15CGCCACGTGTNONE 
J080020K04CGCCACGTGTNONE 
J080024P09CGCCACGTGTNONE 
J080025G15CGCCACGTGTNONE 
J080025N11CGCCACGTGTNONE 
J080026H10CGCCACGTGTNONE 
J080026N06CGCCACGTGTNONE 
J080027C07CGCCACGTGTNONE 
J080027M21CGCCACGTGTNONE 
J080028I03CGCCACGTGTNONE 
J080028K11CGCCACGTGTNONE 
J080029B19CGCCACGTGTNONE 
J080029G14CGCCACGTGTNONE 
J080029G20CGCCACGTGTNONE 
J080030A16CGCCACGTGTNONE 
J080031C05CGCCACGTGTNONE 
J080033M16CGCCACGTGTNONE 
J080034C24CGCCACGTGTNONE 
J080034F11CGCCACGTGTNONE 
J080036B03CGCCACGTGTNONE 
J080036C14CGCCACGTGTNONE 
J080037C01CGCCACGTGTNONE 
J080038M20CGCCACGTGTNONE 
J080039K03CGCCACGTGTNONE 
J080040M24CGCCACGTGTNONE 
J080040P19CGCCACGTGTNONE 
J080042L24CGCCACGTGTNONE 
J080042O06CGCCACGTGTNONE 
J080043A22CGCCACGTGTNONE 
J080043N19CGCCACGTGTNONE 
J080044A18CGCCACGTGTNONE 
J080044P14CGCCACGTGTNONE 
J080045K12CGCCACGTGTNONE 
J080045N16CGCCACGTGTNONE 
J080047A16CGCCACGTGTNONE 
J080047B09CGCCACGTGTNONE 
J080047E08CGCCACGTGTNONE 
J080047G06CGCCACGTGTNONE 
J080048H04CGCCACGTGTNONE 
J080049B17CGCCACGTGTNONE 
J080049D05CGCCACGTGTNONE 
J080049G23CGCCACGTGTNONE 
J080050D03CGCCACGTGTNONE 
J080050J24CGCCACGTGTNONE 
J080050O20CGCCACGTGTNONE 
J080052E24CGCCACGTGTNONE 
J080052K11CGCCACGTGTNONE 
J080053B04CGCCACGTGTNONE 
J080053D20CGCCACGTGTNONE 
J080053E16CGCCACGTGTNONE 
J080054H20CGCCACGTGTNONE 
J080054H22CGCCACGTGTNONE 
J080054N24CGCCACGTGTNONE 
J080055H08CGCCACGTGTNONE 
J080056H08CGCCACGTGTNONE 
J080056H12CGCCACGTGTNONE 
J080057N11CGCCACGTGTNONE 
J080058D08CGCCACGTGTNONE 
J080058D21CGCCACGTGTNONE 
J080058E10CGCCACGTGTNONE 
J080060J10CGCCACGTGTNONE 
J080061O04CGCCACGTGTNONE 
J080065M18CGCCACGTGTNONE 
J080066D15CGCCACGTGTNONE 
J080067E22CGCCACGTGTNONE 
J080067N20CGCCACGTGTNONE 
J080068F02CGCCACGTGTNONE 
J080069G20CGCCACGTGTNONE 
J080069O13CGCCACGTGTNONE 
J080070I20CGCCACGTGTNONE 
J080071H11CGCCACGTGTNONE 
J080071H17CGCCACGTGTNONE 
J080071O18CGCCACGTGTNONE 
J080077G14CGCCACGTGTNONE 
J080077H17CGCCACGTGTNONE 
J080078B18CGCCACGTGTNONE 
J080078D24CGCCACGTGTNONE 
J080079H02CGCCACGTGTNONE 
J080079J02CGCCACGTGTNONE 
J080081O20CGCCACGTGTNONE 
J080082E02CGCCACGTGTNONE 
J080082N12CGCCACGTGTNONE 
J080084E18CGCCACGTGTNONE 
J080085P08CGCCACGTGTNONE 
J080086B21CGCCACGTGTNONE 
J080086L10CGCCACGTGTNONE 
J080086L18CGCCACGTGTNONE 
J080087D12CGCCACGTGTNONE 
J080087E24CGCCACGTGTNONE 
J080087G12CGCCACGTGTNONE 
J080088J22CGCCACGTGTNONE 
J080090C18CGCCACGTGTNONE 
J080090L02CGCCACGTGTNONE 
J080092N05CGCCACGTGTNONE 
J080092P20CGCCACGTGTNONE 
J080094D15CGCCACGTGTNONE 
J080095A11CGCCACGTGTNONE 
J080095K13CGCCACGTGTNONE 
J080096L16CGCCACGTGTNONE 
J080097F16CGCCACGTGTNONE 
J080305J21CGCCACGTGTNONE 
J080308I22CGCCACGTGTNONE 
J080310E21CGCCACGTGTNONE 
J080310G09CGCCACGTGTNONE 
J090032M14CGCCACGTGTNONE 
J090045I12CGCCACGTGTNONE 
J090076M15CGCCACGTGTNONE 
J090088C17CGCCACGTGTNONE 
J090094B06CGCCACGTGTNONE 
U74321CGCCACGTGTNONE 
Os12g0102100J013134H02GCCACGTGTAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0115300006-059-B11CACGTGGCNONE 
009-025-B05CACGTGGCNONE 
009-110-D03CACGTGGCNONE 
009-117-F09CACGTGGCNONE 
009-123-C01CACGTGGCNONE 
009-125-D11CACGTGGCNONE 
009-137-A10CACGTGGCNONE 
009-147-C12CACGTGGCNONE 
009-195-D09CACGTGGCNONE 
013-021-G10CACGTGGCNONE 
AK059737CACGTGGCPlant lipid transfer protein/Par allergen family protein. 
AK062690CACGTGGCNONE 
J065041I24CACGTGGCNONE 
J065157E24CACGTGGCNONE 
J075067H06CACGTGGCNONE 
J075169N23CACGTGGCNONE 
Os12g0149100AK062909CACGTGGCHypothetical protein. 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0206700AK071313CGCCACGTGConserved hypothetical protein. 
J065179M24CGCCACGTGNONE 
Os12g0242500J065129F10CGCCACGTGTNONE 
J090032G12CGCCACGTGTConserved hypothetical protein. 
Os12g0291100013-021-D10CGACACGTGGCNONE 
013-038-B12CGACACGTGGCNONE 
AK068555CGACACGTGGCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627CGACACGTGGCNONE 
D00644CGACACGTGGCNONE 
J013156H12CGACACGTGGCNONE 
J023122F15CGACACGTGGCNONE 
J065001F13CGACACGTGGCNONE 
J065001O16CGACACGTGGCNONE 
J065006D15CGACACGTGGCNONE 
J065008I17CGACACGTGGCNONE 
J065008N22CGACACGTGGCNONE 
J065010K05CGACACGTGGCNONE 
J065015G11CGACACGTGGCNONE 
J065019H21CGACACGTGGCNONE 
J065020N17CGACACGTGGCNONE 
J065024O18CGACACGTGGCNONE 
J065025A04CGACACGTGGCNONE 
J065026I06CGACACGTGGCNONE 
J065028C06CGACACGTGGCNONE 
J065029C01CGACACGTGGCNONE 
J065029C06CGACACGTGGCNONE 
J065029D16CGACACGTGGCNONE 
J065029E02CGACACGTGGCNONE 
J065030P11CGACACGTGGCNONE 
J065032M13CGACACGTGGCNONE 
J065034C06CGACACGTGGCNONE 
J065037H24CGACACGTGGCNONE 
J065037O14CGACACGTGGCNONE 
J065038A12CGACACGTGGCNONE 
J065043A05CGACACGTGGCNONE 
J065046C06CGACACGTGGCNONE 
J065046D22CGACACGTGGCNONE 
J065048C14CGACACGTGGCNONE 
J065048D24CGACACGTGGCNONE 
J065049F19CGACACGTGGCNONE 
J065050C04CGACACGTGGCNONE 
J065052J16CGACACGTGGCNONE 
J065055E07CGACACGTGGCNONE 
J065055I04CGACACGTGGCNONE 
J065060L04CGACACGTGGCNONE 
J065062I15CGACACGTGGCNONE 
J065062J11CGACACGTGGCNONE 
J065065I12CGACACGTGGCNONE 
J065068C24CGACACGTGGCNONE 
J065069M04CGACACGTGGCNONE 
J065071J22CGACACGTGGCNONE 
J065076A12CGACACGTGGCNONE 
J065076C24CGACACGTGGCNONE 
J065076F09CGACACGTGGCNONE 
J065076F16CGACACGTGGCNONE 
J065077O06CGACACGTGGCNONE 
J065081E14CGACACGTGGCNONE 
J065082K22CGACACGTGGCNONE 
J065082L04CGACACGTGGCNONE 
J065085B02CGACACGTGGCNONE 
J065089C21CGACACGTGGCNONE 
J065092L07CGACACGTGGCNONE 
J065093G08CGACACGTGGCNONE 
J065093I19CGACACGTGGCNONE 
J065093K24CGACACGTGGCNONE 
J065093N04CGACACGTGGCNONE 
J065094I09CGACACGTGGCNONE 
J065094N19CGACACGTGGCNONE 
J065095J17CGACACGTGGCNONE 
J065095N24CGACACGTGGCNONE 
J065096B17CGACACGTGGCNONE 
J065096C02CGACACGTGGCNONE 
J065097P18CGACACGTGGCNONE 
J065099E07CGACACGTGGCNONE 
J065103D23CGACACGTGGCNONE 
J065104F04CGACACGTGGCNONE 
J065104L17CGACACGTGGCNONE 
J065111L14CGACACGTGGCNONE 
J065112K11CGACACGTGGCNONE 
J065115P09CGACACGTGGCNONE 
J065123A02CGACACGTGGCNONE 
J065127P14CGACACGTGGCNONE 
J065137E16CGACACGTGGCNONE 
J065138H20CGACACGTGGCNONE 
J065138J11CGACACGTGGCNONE 
J065141K23CGACACGTGGCNONE 
J065141L14CGACACGTGGCNONE 
J065143P04CGACACGTGGCNONE 
J065146N12CGACACGTGGCNONE 
J065147F21CGACACGTGGCNONE 
J065147N15CGACACGTGGCNONE 
J065154L06CGACACGTGGCNONE 
J065156C09CGACACGTGGCNONE 
J065156J18CGACACGTGGCNONE 
J065157C19CGACACGTGGCNONE 
J065159H23CGACACGTGGCNONE 
J065159M08CGACACGTGGCNONE 
J065163B19CGACACGTGGCNONE 
J065164K14CGACACGTGGCNONE 
J065166K07CGACACGTGGCNONE 
J065166O07CGACACGTGGCNONE 
J065168A18CGACACGTGGCNONE 
J065170B18CGACACGTGGCNONE 
J065170D18CGACACGTGGCNONE 
J065173E05CGACACGTGGCNONE 
J065174L23CGACACGTGGCNONE 
J065177F08CGACACGTGGCNONE 
J065177I05CGACACGTGGCNONE 
J065178P20CGACACGTGGCNONE 
J065181G24CGACACGTGGCNONE 
J065182A07CGACACGTGGCNONE 
J065183D24CGACACGTGGCNONE 
J065184K10CGACACGTGGCNONE 
J065185F09CGACACGTGGCNONE 
J065185P10CGACACGTGGCNONE 
J065186J16CGACACGTGGCNONE 
J065188K23CGACACGTGGCNONE 
J065190E22CGACACGTGGCNONE 
J065191D06CGACACGTGGCNONE 
J065193C05CGACACGTGGCNONE 
J065193N13CGACACGTGGCNONE 
J065194B15CGACACGTGGCNONE 
J065199C03CGACACGTGGCNONE 
J065200P19CGACACGTGGCNONE 
J065202O18CGACACGTGGCNONE 
J065203F16CGACACGTGGCNONE 
J065204A15CGACACGTGGCNONE 
J065206P13CGACACGTGGCNONE 
J065207P12CGACACGTGGCNONE 
J065210J24CGACACGTGGCNONE 
J065211K01CGACACGTGGCNONE 
J065213O21CGACACGTGGCNONE 
J065215L18CGACACGTGGCNONE 
J065216N22CGACACGTGGCNONE 
J065219A16CGACACGTGGCNONE 
J065219C24CGACACGTGGCNONE 
J075012P04CGACACGTGGCNONE 
J075013K19CGACACGTGGCNONE 
J075028N24CGACACGTGGCNONE 
J075028P16CGACACGTGGCNONE 
J075032H22CGACACGTGGCNONE 
J075032J18CGACACGTGGCNONE 
J075042O14CGACACGTGGCNONE 
J075047A04CGACACGTGGCNONE 
J075053A16CGACACGTGGCNONE 
J075064C23CGACACGTGGCNONE 
J075072H11CGACACGTGGCNONE 
J075073C03CGACACGTGGCNONE 
J075081G11CGACACGTGGCNONE 
J075093H04CGACACGTGGCNONE 
J075095A11CGACACGTGGCNONE 
J075095C13CGACACGTGGCNONE 
J075100D18CGACACGTGGCNONE 
J075101P08CGACACGTGGCNONE 
J075114G11CGACACGTGGCNONE 
J075118D19CGACACGTGGCNONE 
J075122K13CGACACGTGGCNONE 
J075125G22CGACACGTGGCNONE 
J075129E22CGACACGTGGCNONE 
J075129I07CGACACGTGGCNONE 
J075132C12CGACACGTGGCNONE 
J075135E24CGACACGTGGCNONE 
J075136I06CGACACGTGGCNONE 
J075136O07CGACACGTGGCNONE 
J075138I07CGACACGTGGCNONE 
J075142G08CGACACGTGGCNONE 
J075147J22CGACACGTGGCNONE 
J075150H20CGACACGTGGCNONE 
J075151A15CGACACGTGGCNONE 
J075151G24CGACACGTGGCNONE 
J075151J20CGACACGTGGCNONE 
J075156N21CGACACGTGGCNONE 
J075158O12CGACACGTGGCNONE 
J075161E05CGACACGTGGCNONE 
J075166F17CGACACGTGGCNONE 
J075169M10CGACACGTGGCNONE 
J075174K15CGACACGTGGCNONE 
J075179F17CGACACGTGGCNONE 
J075185G15CGACACGTGGCNONE 
J075188P12CGACACGTGGCNONE 
J075191P15CGACACGTGGCNONE 
J075192A13CGACACGTGGCNONE 
J075197E23CGACACGTGGCNONE 
J075197M02CGACACGTGGCNONE 
J075198M16CGACACGTGGCNONE 
J080020B11CGACACGTGGCNONE 
J080021M20CGACACGTGGCNONE 
J080066K02CGACACGTGGCNONE 
J080301F01CGACACGTGGCNONE 
J080301G19CGACACGTGGCNONE 
J080305G02CGACACGTGGCNONE 
J080306N09CGACACGTGGCNONE 
J080309D21CGACACGTGGCNONE 
J080309I02CGACACGTGGCNONE 
J080313J11CGACACGTGGCNONE 
J080313P09CGACACGTGGCNONE 
J080315B10CGACACGTGGCNONE 
J080315O13CGACACGTGGCNONE 
J080316G02CGACACGTGGCNONE 
J080317F03CGACACGTGGCNONE 
J080318D17CGACACGTGGCNONE 
J080319C10CGACACGTGGCNONE 
J090017E03CGACACGTGGCNONE 
J090034N22CGACACGTGGCNONE 
J090042G07CGACACGTGGCNONE 
J090062P21CGACACGTGGCNONE 
J090082D08CGACACGTGGCNONE 
J090096M13CGACACGTGGCNONE 
J100086J22CGACACGTGGCNONE 
Os12g0437800AK063833CGCCACGTGSimilar to MPI. 
AK121693CGCCACGTGNONE 
AY878693CGCCACGTGNONE 
J065021K01CGCCACGTGNONE 
J065027K12CGCCACGTGNONE 
J065031I22CGCCACGTGNONE 
J065031L17CGCCACGTGNONE 
J065056K14CGCCACGTGNONE 
J065083J01CGCCACGTGNONE 
J065095J18CGCCACGTGNONE 
J065096N19CGCCACGTGNONE 
J065098F20CGCCACGTGNONE 
J065131F07CGCCACGTGNONE 
J065135H05CGCCACGTGNONE 
J065137E03CGCCACGTGNONE 
J065141F13CGCCACGTGNONE 
J065152E02CGCCACGTGNONE 
J065159J20CGCCACGTGNONE 
J065174J02CGCCACGTGNONE 
J065175I19CGCCACGTGNONE 
J065189P13CGCCACGTGNONE 
J065198J01CGCCACGTGNONE 
J065205F13CGCCACGTGNONE 
J065216A18CGCCACGTGNONE 
J100026N16CGCCACGTGNONE 
J100032E21CGCCACGTGNONE 
J100061K15CGCCACGTGNONE 
J100087B09CGCCACGTGNONE 
Os12g0443700AK069541CACGTGGCGSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881CACGTGGCGNONE 
Os12g0478100013-036-F11GCCACGTGTCCNONE 
AK063578GCCACGTGTCCGRAM domain containing protein. 
Os12g0501900AK108423CACGTGGCGConserved hypothetical protein. 
Os12g0509300AK108497GCCACGTGGCConserved hypothetical protein. 
Os12g0511300015-003-D12CACGTGGCACCCCCCANONE 
AK064077CACGTGGCACCCCCCANONE 
AK109892CACGTGGCACCCCCCANONE 
AK121419CACGTGGCACCCCCCAConserved hypothetical protein. 
J065020L21CACGTGGCACCCCCCANONE 
J065033D11CACGTGGCACCCCCCANONE 
J065038K03CACGTGGCACCCCCCANONE 
J065043A18CACGTGGCACCCCCCANONE 
J065056F02CACGTGGCACCCCCCANONE 
J065071M10CACGTGGCACCCCCCANONE 
J065158M05CACGTGGCACCCCCCANONE 
J065161E23CACGTGGCACCCCCCANONE 
J065202O07CACGTGGCACCCCCCANONE 
J065208N21CACGTGGCACCCCCCANONE 
J100069C18CACGTGGCACCCCCCANONE 
J100088H18CACGTGGCACCCCCCANONE 
J100090B10CACGTGGCACCCCCCANONE 
Os12g0548300009-148-D10ACACGTGGCNONE 
AK058388ACACGTGGCNONE 
Os12g0553200J013072P20GACACGTGGCNONE 
J033024I06GACACGTGGCNONE 
Os12g0569500AK066624GCCACGTGTThaumatin, pathogenesis-related family protein. 
J065041B03GCCACGTGTNONE 
J065046P11GCCACGTGTNONE 
J075140J11GCCACGTGTNONE 
Os12g0577900015-034-E07CGCCACGTGNONE 
AK106299CGCCACGTGProtein prenyltransferase domain containing protein. 
Os12g0580400AK099986GCCACGTGGGCCCACCAmino acid/polyamine transporter I family protein. 
J065120C05GCCACGTGGGCCCACCNONE 
Os12g0605800AK121511CACGTGGCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.