version

Summary of OsREG508 (All List)

OrganismOryza sativa  
IDOsREG508  
SequenceCACGTGGG  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE Motif 
Total Entry Count2139  

Entry Sequences (2139 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein. 
Os01g0184800AK073377GGGACCCACGTGPhosducin family protein. 
AK102544GGGACCCACGTGNONE 
J023047L21GGGACCCACGTGNONE 
J023135I09GGGACCCACGTGNONE 
J033028G17GGGACCCACGTGNONE 
J065164L07GGGACCCACGTGNONE 
J065193F22GGGACCCACGTGNONE 
J075035I10GGGACCCACGTGNONE 
J075168H15GGGACCCACGTGNONE 
Os01g0184900AF503585CACGTGGGTCCCNONE 
AK066832CACGTGGGTCCCSimilar to SSRP1 protein. 
AK068959CACGTGGGTCCCNONE 
J013055F18CACGTGGGTCCCNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0219100J065130F20CCCACGTGNONE 
J065208O10CCCACGTGSFT2-like family protein. 
Os01g0219500AK106863CCCACGTGNONE 
AK109524CCCACGTGPlant lipid transfer protein/Par allergen family protein. 
J075053J18CCCACGTGNONE 
J080023G09CCCACGTGNONE 
J080051F19CCCACGTGNONE 
J080085H15CCCACGTGNONE 
Os01g0229400AB029508GCCCCACGTGSmall GTP-binding protein OsRac1. 
J013111C23GCCCCACGTGNONE 
J023077H07GCCCCACGTGNONE 
J100039H15GCCCCACGTGNONE 
Os01g0258600J075028F17ACACGTGGGTCCNONE 
J075061L04ACACGTGGGTCCConserved hypothetical protein. 
J075071B09ACACGTGGGTCCNONE 
J075093E04ACACGTGGGTCCNONE 
J100033B11ACACGTGGGTCCNONE 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE 
009-084-B05ACAGCCCACGTGGCNONE 
009-100-E07ACAGCCCACGTGGCNONE 
009-133-B03ACAGCCCACGTGGCNONE 
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment). 
AK066266ACAGCCCACGTGGCNONE 
AK102013ACAGCCCACGTGGCNONE 
J065001I21ACAGCCCACGTGGCNONE 
J065025D22ACAGCCCACGTGGCNONE 
J065098M18ACAGCCCACGTGGCNONE 
J065105O22ACAGCCCACGTGGCNONE 
J065121F07ACAGCCCACGTGGCNONE 
J065181F03ACAGCCCACGTGGCNONE 
J075020M03ACAGCCCACGTGGCNONE 
J075028O06ACAGCCCACGTGGCNONE 
J075032F15ACAGCCCACGTGGCNONE 
J075033H07ACAGCCCACGTGGCNONE 
J075062F22ACAGCCCACGTGGCNONE 
J075083P19ACAGCCCACGTGGCNONE 
J075097J16ACAGCCCACGTGGCNONE 
J075099A15ACAGCCCACGTGGCNONE 
J075104P03ACAGCCCACGTGGCNONE 
J075118K12ACAGCCCACGTGGCNONE 
J075125H01ACAGCCCACGTGGCNONE 
J075127K12ACAGCCCACGTGGCNONE 
J075128F24ACAGCCCACGTGGCNONE 
J075151P06ACAGCCCACGTGGCNONE 
J075169K22ACAGCCCACGTGGCNONE 
J075170K24ACAGCCCACGTGGCNONE 
J075182A01ACAGCCCACGTGGCNONE 
J075199H16ACAGCCCACGTGGCNONE 
J080010O12ACAGCCCACGTGGCNONE 
J080013A02ACAGCCCACGTGGCNONE 
J080013F09ACAGCCCACGTGGCNONE 
J080017C19ACAGCCCACGTGGCNONE 
J080017G05ACAGCCCACGTGGCNONE 
J080022L04ACAGCCCACGTGGCNONE 
J080025B17ACAGCCCACGTGGCNONE 
J080029A08ACAGCCCACGTGGCNONE 
J080037C12ACAGCCCACGTGGCNONE 
J080037L14ACAGCCCACGTGGCNONE 
J080037M24ACAGCCCACGTGGCNONE 
J080038M21ACAGCCCACGTGGCNONE 
J080039E06ACAGCCCACGTGGCNONE 
J080039I10ACAGCCCACGTGGCNONE 
J080042H01ACAGCCCACGTGGCNONE 
J080042L18ACAGCCCACGTGGCNONE 
J080042N21ACAGCCCACGTGGCNONE 
J080043E01ACAGCCCACGTGGCNONE 
J080044H05ACAGCCCACGTGGCNONE 
J080047H10ACAGCCCACGTGGCNONE 
J080050H03ACAGCCCACGTGGCNONE 
J080060N21ACAGCCCACGTGGCNONE 
J080061M09ACAGCCCACGTGGCNONE 
J080062D15ACAGCCCACGTGGCNONE 
J080062I18ACAGCCCACGTGGCNONE 
J080063G05ACAGCCCACGTGGCNONE 
J080063H16ACAGCCCACGTGGCNONE 
J080067G16ACAGCCCACGTGGCNONE 
J080067M07ACAGCCCACGTGGCNONE 
J080068M13ACAGCCCACGTGGCNONE 
J080069A19ACAGCCCACGTGGCNONE 
J080069G14ACAGCCCACGTGGCNONE 
J080070F04ACAGCCCACGTGGCNONE 
J080070K15ACAGCCCACGTGGCNONE 
J080072O20ACAGCCCACGTGGCNONE 
J080075L02ACAGCCCACGTGGCNONE 
J080077I10ACAGCCCACGTGGCNONE 
J080077P03ACAGCCCACGTGGCNONE 
J080078F14ACAGCCCACGTGGCNONE 
J080092H15ACAGCCCACGTGGCNONE 
J080097J15ACAGCCCACGTGGCNONE 
J080305C10ACAGCCCACGTGGCNONE 
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0324400AK102854GCCACGTGGGNONE 
AK111299GCCACGTGGGNONE 
J033032A11GCCACGTGGGNONE 
J033110L02GCCACGTGGGNONE 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein. 
Os01g0557100Os01g0557100CACGTGGGAlpha/beta hydrolase family protein. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0604100AK099765CCCACGTGGACCUspA domain containing protein. 
J013094O21CCCACGTGGACCNONE 
Os01g0620800AK108846CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0673500AK065017GCCCACGTGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899GCCCACGTGNONE 
Os01g0685900AK064024CCCACGTGTCCNONE 
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0734600012-079-G06CCCACGTGGCNONE 
AK065450CCCACGTGGCNONE 
AK103129CCCACGTGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK119562CCCACGTGGCNONE 
J075086F18CCCACGTGGCNONE 
J075147G07CCCACGTGGCNONE 
Os01g0736100011-091-H04CCCACGTGNONE 
015-004-D10CCCACGTGNONE 
AK064298CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365CCCACGTGNONE 
AK103355CCCACGTGNONE 
J033044B20CCCACGTGNONE 
J033094G06CCCACGTGNONE 
J033111N02CCCACGTGNONE 
J033111P10CCCACGTGNONE 
J033126K03CCCACGTGNONE 
J043034D12CCCACGTGNONE 
Os01g0739000AK069568CACGTGGGSimilar to Mitochondrial processing peptidase. 
AK073810CACGTGGGNONE 
J013042N17CACGTGGGNONE 
J023128N16CACGTGGGNONE 
J033024F18CACGTGGGNONE 
J033037D09CACGTGGGNONE 
J033050E17CACGTGGGNONE 
J033065K22CACGTGGGNONE 
J033070E13CACGTGGGNONE 
J033087A13CACGTGGGNONE 
Os01g0745400AK107872CCCACGTGGCSec34-like protein family protein. 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672CCCACGTGGCConserved hypothetical protein. 
J013131M12CCCACGTGGCNONE 
J023027B15CCCACGTGGCNONE 
J023059I06CCCACGTGGCNONE 
J023095L05CCCACGTGGCNONE 
J033033E20CCCACGTGGCNONE 
J033105F24CCCACGTGGCNONE 
J033148N05CCCACGTGGCNONE 
J065060H14CCCACGTGGCNONE 
J090093E17CCCACGTGGCNONE 
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0772200AK060471CACGTGGGTranscription initiation factor IIF, beta subunit family protein. 
AK103491CACGTGGGNONE 
J023093E05CACGTGGGNONE 
J023101M03CACGTGGGNONE 
J033130N17CACGTGGGNONE 
J043021L02CACGTGGGNONE 
J065001E22CACGTGGGNONE 
J065070G06CACGTGGGNONE 
J065081D15CACGTGGGNONE 
J065123G09CACGTGGGNONE 
J065170K04CACGTGGGNONE 
J065187A01CACGTGGGNONE 
J065210E10CACGTGGGNONE 
J075172K06CACGTGGGNONE 
Os01g0817700003-108-A10CCCACGTGNONE 
AK060836CCCACGTGNONE 
AK065059CCCACGTGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10CCCACGTGNONE 
J013047D19CCCACGTGNONE 
J013056K09CCCACGTGNONE 
J013068P20CCCACGTGNONE 
J013108G18CCCACGTGNONE 
J023007N01CCCACGTGNONE 
J023008A22CCCACGTGNONE 
J023010B02CCCACGTGNONE 
J023029O13CCCACGTGNONE 
J023064F21CCCACGTGNONE 
J023073E22CCCACGTGNONE 
J023143E14CCCACGTGNONE 
J033027N20CCCACGTGNONE 
J033032G14CCCACGTGNONE 
J033037E03CCCACGTGNONE 
J033057N19CCCACGTGNONE 
J033065E16CCCACGTGNONE 
J033066B19CCCACGTGNONE 
J033069G01CCCACGTGNONE 
J033071B03CCCACGTGNONE 
J033080C12CCCACGTGNONE 
J033081K19CCCACGTGNONE 
J033096B19CCCACGTGNONE 
J033101E20CCCACGTGNONE 
J033135L21CCCACGTGNONE 
J033139I07CCCACGTGNONE 
J033150A21CCCACGTGNONE 
J043036J05CCCACGTGNONE 
J043039D03CCCACGTGNONE 
J043039F19CCCACGTGNONE 
J090006K04CCCACGTGNONE 
J090017G14CCCACGTGNONE 
J090034E23CCCACGTGNONE 
J090039D07CCCACGTGNONE 
J090039I09CCCACGTGNONE 
J090044F21CCCACGTGNONE 
J090049J12CCCACGTGNONE 
J090053A19CCCACGTGNONE 
J090061E23CCCACGTGNONE 
J090079K09CCCACGTGNONE 
J090092F21CCCACGTGNONE 
J100022E04CCCACGTGNONE 
J100038I01CCCACGTGNONE 
J100066C22CCCACGTGNONE 
J100067C11CCCACGTGNONE 
J100073F07CCCACGTGNONE 
J100084I24CCCACGTGNONE 
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein. 
Os01g0837600AK108007CCCACGTGConserved hypothetical protein 1589, plant family protein. 
J065005C19CCCACGTGNONE 
J065025H20CCCACGTGNONE 
J065061E22CCCACGTGNONE 
J065065F14CCCACGTGNONE 
J065083O21CCCACGTGNONE 
J065201G05CCCACGTGNONE 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0891300AK063674CCCACGTGSimilar to Allyl alcohol dehydrogenase. 
AK099151CCCACGTGNONE 
Os01g0897600J065120F23CACGTGGGNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0923300AK067520CCCCACGTGTCBS domain containing protein. 
Os01g0924000004-020-C09CCCACGTGCTGGGCCGGCNONE 
005-014-A06CCCACGTGCTGGGCCGGCNONE 
009-085-G12CCCACGTGCTGGGCCGGCNONE 
009-123-A08CCCACGTGCTGGGCCGGCNONE 
009-134-A05CCCACGTGCTGGGCCGGCNONE 
009-137-F06CCCACGTGCTGGGCCGGCNONE 
016-016-B08CCCACGTGCTGGGCCGGCNONE 
AF050674CCCACGTGCTGGGCCGGCNONE 
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CCCACGTGCTGGGCCGGCNONE 
J013040A15CCCACGTGCTGGGCCGGCNONE 
J013104L20CCCACGTGCTGGGCCGGCNONE 
J013127E12CCCACGTGCTGGGCCGGCNONE 
J013158O05CCCACGTGCTGGGCCGGCNONE 
J023012E09CCCACGTGCTGGGCCGGCNONE 
J023126L23CCCACGTGCTGGGCCGGCNONE 
J023143B03CCCACGTGCTGGGCCGGCNONE 
J065005B16CCCACGTGCTGGGCCGGCNONE 
J065101J15CCCACGTGCTGGGCCGGCNONE 
J065105K16CCCACGTGCTGGGCCGGCNONE 
J065155K16CCCACGTGCTGGGCCGGCNONE 
J065171M17CCCACGTGCTGGGCCGGCNONE 
J065182F07CCCACGTGCTGGGCCGGCNONE 
J065187D10CCCACGTGCTGGGCCGGCNONE 
J065194I24CCCACGTGCTGGGCCGGCNONE 
J065207E24CCCACGTGCTGGGCCGGCNONE 
J075001C24CCCACGTGCTGGGCCGGCNONE 
J075090O10CCCACGTGCTGGGCCGGCNONE 
J075095H17CCCACGTGCTGGGCCGGCNONE 
J075109M24CCCACGTGCTGGGCCGGCNONE 
J075123C18CCCACGTGCTGGGCCGGCNONE 
J075148G22CCCACGTGCTGGGCCGGCNONE 
J090009B09CCCACGTGCTGGGCCGGCNONE 
J090075K17CCCACGTGCTGGGCCGGCNONE 
J090081H23CCCACGTGCTGGGCCGGCNONE 
J090097H21CCCACGTGCTGGGCCGGCNONE 
J100063P14CCCACGTGCTGGGCCGGCNONE 
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012ACACGTGGGCNONE 
AK104190ACACGTGGGCNONE 
Os02g0103800006-046-H11GTGGGTCCCACGTGNONE 
006-060-B05GTGGGTCCCACGTGNONE 
006-097-A09GTGGGTCCCACGTGNONE 
006-102-A10GTGGGTCCCACGTGNONE 
006-104-E11GTGGGTCCCACGTGNONE 
006-112-D09GTGGGTCCCACGTGNONE 
AK061774GTGGGTCCCACGTGNONE 
AK065309GTGGGTCCCACGTGNONE 
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGGTCCCACGTGNONE 
J013026F06GTGGGTCCCACGTGNONE 
J013037O14GTGGGTCCCACGTGNONE 
J013066N06GTGGGTCCCACGTGNONE 
J013108G22GTGGGTCCCACGTGNONE 
J023050M15GTGGGTCCCACGTGNONE 
J023054B21GTGGGTCCCACGTGNONE 
J023073C23GTGGGTCCCACGTGNONE 
J023086H17GTGGGTCCCACGTGNONE 
J023105A20GTGGGTCCCACGTGNONE 
J065019E16GTGGGTCCCACGTGNONE 
J065064G10GTGGGTCCCACGTGNONE 
J065071C18GTGGGTCCCACGTGNONE 
J065103B02GTGGGTCCCACGTGNONE 
J065153G06GTGGGTCCCACGTGNONE 
J075152G24GTGGGTCCCACGTGNONE 
J075166P04GTGGGTCCCACGTGNONE 
J080001F02GTGGGTCCCACGTGNONE 
J080001M07GTGGGTCCCACGTGNONE 
J080001O05GTGGGTCCCACGTGNONE 
J080003I19GTGGGTCCCACGTGNONE 
J080004C12GTGGGTCCCACGTGNONE 
J080008E17GTGGGTCCCACGTGNONE 
J080008M08GTGGGTCCCACGTGNONE 
J080010H21GTGGGTCCCACGTGNONE 
J080011F22GTGGGTCCCACGTGNONE 
J080012C16GTGGGTCCCACGTGNONE 
J080013D20GTGGGTCCCACGTGNONE 
J080018K15GTGGGTCCCACGTGNONE 
J080020O14GTGGGTCCCACGTGNONE 
J080020P21GTGGGTCCCACGTGNONE 
J080021A07GTGGGTCCCACGTGNONE 
J080021B06GTGGGTCCCACGTGNONE 
J080022G21GTGGGTCCCACGTGNONE 
J080022P14GTGGGTCCCACGTGNONE 
J080023H24GTGGGTCCCACGTGNONE 
J080023M08GTGGGTCCCACGTGNONE 
J080027E08GTGGGTCCCACGTGNONE 
J080027E18GTGGGTCCCACGTGNONE 
J080027O16GTGGGTCCCACGTGNONE 
J080029M22GTGGGTCCCACGTGNONE 
J080034A17GTGGGTCCCACGTGNONE 
J080038G04GTGGGTCCCACGTGNONE 
J080040F13GTGGGTCCCACGTGNONE 
J080040F22GTGGGTCCCACGTGNONE 
J080041L15GTGGGTCCCACGTGNONE 
J080042L04GTGGGTCCCACGTGNONE 
J080042M14GTGGGTCCCACGTGNONE 
J080043C22GTGGGTCCCACGTGNONE 
J080043O09GTGGGTCCCACGTGNONE 
J080045N17GTGGGTCCCACGTGNONE 
J080046N08GTGGGTCCCACGTGNONE 
J080047K11GTGGGTCCCACGTGNONE 
J080047O06GTGGGTCCCACGTGNONE 
J080048H10GTGGGTCCCACGTGNONE 
J080048N03GTGGGTCCCACGTGNONE 
J080050N02GTGGGTCCCACGTGNONE 
J080051A05GTGGGTCCCACGTGNONE 
J080052I20GTGGGTCCCACGTGNONE 
J080053E08GTGGGTCCCACGTGNONE 
J080055P05GTGGGTCCCACGTGNONE 
J080056F15GTGGGTCCCACGTGNONE 
J080056H07GTGGGTCCCACGTGNONE 
J080057M20GTGGGTCCCACGTGNONE 
J080059K09GTGGGTCCCACGTGNONE 
J080059M10GTGGGTCCCACGTGNONE 
J080060B12GTGGGTCCCACGTGNONE 
J080061N09GTGGGTCCCACGTGNONE 
J080062H11GTGGGTCCCACGTGNONE 
J080062M13GTGGGTCCCACGTGNONE 
J080063D14GTGGGTCCCACGTGNONE 
J080063G10GTGGGTCCCACGTGNONE 
J080063H18GTGGGTCCCACGTGNONE 
J080066J23GTGGGTCCCACGTGNONE 
J080067J06GTGGGTCCCACGTGNONE 
J080069I11GTGGGTCCCACGTGNONE 
J080069O22GTGGGTCCCACGTGNONE 
J080070P11GTGGGTCCCACGTGNONE 
J080072D06GTGGGTCCCACGTGNONE 
J080072J22GTGGGTCCCACGTGNONE 
J080075A20GTGGGTCCCACGTGNONE 
J080076F11GTGGGTCCCACGTGNONE 
J080076J24GTGGGTCCCACGTGNONE 
J080076K05GTGGGTCCCACGTGNONE 
J080077O10GTGGGTCCCACGTGNONE 
J080078L19GTGGGTCCCACGTGNONE 
J080080I08GTGGGTCCCACGTGNONE 
J080081J23GTGGGTCCCACGTGNONE 
J080083A17GTGGGTCCCACGTGNONE 
J080085C05GTGGGTCCCACGTGNONE 
J080086G24GTGGGTCCCACGTGNONE 
J080087H02GTGGGTCCCACGTGNONE 
J080089A13GTGGGTCCCACGTGNONE 
J080090K08GTGGGTCCCACGTGNONE 
J080092M01GTGGGTCCCACGTGNONE 
J080095A19GTGGGTCCCACGTGNONE 
J080095B20GTGGGTCCCACGTGNONE 
J100028F13GTGGGTCCCACGTGNONE 
J100040G22GTGGGTCCCACGTGNONE 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0122300016-074-F09CACGTGGGGNONE 
AK073059CACGTGGGGNONE 
AK106553CACGTGGGGConserved hypothetical protein. 
J065085D17CACGTGGGGNONE 
J065167I17CACGTGGGGNONE 
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein. 
AK069843GACACGTGGGGGConserved hypothetical protein. 
J023034H09GACACGTGGGGNONE 
J023034H09GACACGTGGGGGNONE 
J033090D08GACACGTGGGGNONE 
J033090D08GACACGTGGGGGNONE 
J100025N07GACACGTGGGGNONE 
J100025N07GACACGTGGGGGNONE 
J100075G18GACACGTGGGGNONE 
J100075G18GACACGTGGGGGNONE 
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein. 
AK100570CCCCCACGTGTCDNA polymerase V family protein. 
Os02g0186500AK068056CCCCACGTGGGSimilar to Protein kinase-like protein. 
AK099031CCCCACGTGGGNONE 
J013111A12CCCCACGTGGGNONE 
J013127K13CCCCACGTGGGNONE 
J013132O11CCCCACGTGGGNONE 
J023056A11CCCCACGTGGGNONE 
J023078M08CCCCACGTGGGNONE 
J033081F07CCCCACGTGGGNONE 
J090079E24CCCCACGTGGGNONE 
J090097I02CCCCACGTGGGNONE 
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0232400AK120755CCCACGTGSimilar to Citrate synthase, glyoxysomal precursor (EC 2.3.3.1) (GCS). 
Os02g0265900006-102-B07CGCCACGTGGGCNONE 
016-087-A02CGCCACGTGGGCNONE 
AK059921CGCCACGTGGGCReticulon family protein. 
AK064290CGCCACGTGGGCNONE 
AK072628CGCCACGTGGGCNONE 
AK104196CGCCACGTGGGCNONE 
J023130B01CGCCACGTGGGCNONE 
J080010O13CGCCACGTGGGCNONE 
J100065C12CGCCACGTGGGCNONE 
J100067M20CGCCACGTGGGCNONE 
J100070I01CGCCACGTGGGCNONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0461500AK108772CCCCACGTGBeta-Ig-H3/fasciclin domain containing protein. 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0602300AK065609GCCGGCCCACGTGNONE 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCGGCCCACGTGNONE 
J090040I23GCCGGCCCACGTGNONE 
Os02g0612600009-058-F12CCCACGTGGCNONE 
AK062519CCCACGTGGCConserved hypothetical protein. 
Os02g0612650Os02g0612650CCCACGTGGCNONE 
Os02g0613200AK064869ACACGTGGGACCCACNONE 
AK064869GCCCCCACGTGGCNONE 
AK065051ACACGTGGGACCCACNONE 
AK065051GCCCCCACGTGGCNONE 
AK098853ACACGTGGGACCCACConserved hypothetical protein. 
AK098853GCCCCCACGTGGCConserved hypothetical protein. 
AK098974ACACGTGGGACCCACNONE 
AK098974GCCCCCACGTGGCNONE 
J013000H15ACACGTGGGACCCACNONE 
J013000H15GCCCCCACGTGGCNONE 
J013001I18ACACGTGGGACCCACNONE 
J013001I18GCCCCCACGTGGCNONE 
J013022I18ACACGTGGGACCCACNONE 
J013022I18GCCCCCACGTGGCNONE 
J013025D06ACACGTGGGACCCACNONE 
J013025D06GCCCCCACGTGGCNONE 
J013037H17ACACGTGGGACCCACNONE 
J013037H17GCCCCCACGTGGCNONE 
J013043F22ACACGTGGGACCCACNONE 
J013043F22GCCCCCACGTGGCNONE 
J013075E01ACACGTGGGACCCACNONE 
J013075E01GCCCCCACGTGGCNONE 
J013088D09ACACGTGGGACCCACNONE 
J013088D09GCCCCCACGTGGCNONE 
J013088E19ACACGTGGGACCCACNONE 
J013088E19GCCCCCACGTGGCNONE 
J013102O18ACACGTGGGACCCACNONE 
J013102O18GCCCCCACGTGGCNONE 
J013110C08ACACGTGGGACCCACNONE 
J013110C08GCCCCCACGTGGCNONE 
J013118C06ACACGTGGGACCCACNONE 
J013118C06GCCCCCACGTGGCNONE 
J013119F22ACACGTGGGACCCACNONE 
J013119F22GCCCCCACGTGGCNONE 
J013128K14ACACGTGGGACCCACNONE 
J013128K14GCCCCCACGTGGCNONE 
J013158C17ACACGTGGGACCCACNONE 
J013158C17GCCCCCACGTGGCNONE 
J023013P15ACACGTGGGACCCACNONE 
J023013P15GCCCCCACGTGGCNONE 
J023044L21ACACGTGGGACCCACNONE 
J023044L21GCCCCCACGTGGCNONE 
J033023I04ACACGTGGGACCCACNONE 
J033023I04GCCCCCACGTGGCNONE 
J033038I22ACACGTGGGACCCACNONE 
J033038I22GCCCCCACGTGGCNONE 
J033095M02ACACGTGGGACCCACNONE 
J033095M02GCCCCCACGTGGCNONE 
J043022F05ACACGTGGGACCCACNONE 
J043022F05GCCCCCACGTGGCNONE 
J080307N20ACACGTGGGACCCACNONE 
J080307N20GCCCCCACGTGGCNONE 
J080315C02ACACGTGGGACCCACNONE 
J080315C02GCCCCCACGTGGCNONE 
J080316A15ACACGTGGGACCCACNONE 
J080316A15GCCCCCACGTGGCNONE 
J080316G03ACACGTGGGACCCACNONE 
J080316G03GCCCCCACGTGGCNONE 
J090029E24ACACGTGGGACCCACNONE 
J090029E24GCCCCCACGTGGCNONE 
J090031H15ACACGTGGGACCCACNONE 
J090031H15GCCCCCACGTGGCNONE 
J090034F13ACACGTGGGACCCACNONE 
J090034F13GCCCCCACGTGGCNONE 
J090047G02ACACGTGGGACCCACNONE 
J090047G02GCCCCCACGTGGCNONE 
J090069M24ACACGTGGGACCCACNONE 
J090069M24GCCCCCACGTGGCNONE 
J100052E15ACACGTGGGACCCACNONE 
J100052E15GCCCCCACGTGGCNONE 
Os02g0654700006-060-H09CACGTGGGGGATNONE 
AK073812CACGTGGGGGATSimilar to Ethylene-responsive transcription factor 5 (Ethylene-responsive element binding factor 5) (EREBP-5) (AtERF5). 
AK105940CACGTGGGGGATNONE 
AY831394CACGTGGGGGATNONE 
J013134K17CACGTGGGGGATNONE 
J023054H09CACGTGGGGGATNONE 
J033068P11CACGTGGGGGATNONE 
J065161B10CACGTGGGGGATNONE 
J065170K01CACGTGGGGGATNONE 
J100041G22CACGTGGGGGATNONE 
Os02g0709900AB110204GCCCCACGTGPrefoldin domain containing protein. 
AK109259GCCCCACGTGNONE 
J013093N22GCCCCACGTGNONE 
J033116F21GCCCCACGTGNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1. 
AK102767GGCCCCACGTGTCNONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0753000AK121015CCCCCACGTGSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE 
015-039-F09TGTGGGCCCACGTGNONE 
AK064105TGTGGGCCCACGTGNONE 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0814300AK111376GCCCCACGTGCytochrome c, monohaem domain containing protein. 
J065063I24GCCCCACGTGNONE 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE 
AK105115GTGGGACCCACGTGGCConserved hypothetical protein. 
AY224538GTGGGACCCACGTGGCNONE 
J065029A19GTGGGACCCACGTGGCNONE 
J065109N11GTGGGACCCACGTGGCNONE 
Os03g0116800012-097-D10GCCACGTGGGNONE 
016-024-H10GCCACGTGGGNONE 
AK066955GCCACGTGGGConserved hypothetical protein. 
AK068678GCCACGTGGGNONE 
AK104839GCCACGTGGGNONE 
J013033G16GCCACGTGGGNONE 
J013091C10GCCACGTGGGNONE 
J013158H22GCCACGTGGGNONE 
J023106K11GCCACGTGGGNONE 
J065051O15GCCACGTGGGNONE 
J065129G22GCCACGTGGGNONE 
J075001K02GCCACGTGGGNONE 
J075011O03GCCACGTGGGNONE 
J075024K04GCCACGTGGGNONE 
J075026E07GCCACGTGGGNONE 
J075037O14GCCACGTGGGNONE 
J075071D17GCCACGTGGGNONE 
J075084M05GCCACGTGGGNONE 
J075114B06GCCACGTGGGNONE 
J075128C23GCCACGTGGGNONE 
J075153A13GCCACGTGGGNONE 
J075158A15GCCACGTGGGNONE 
J075165P09GCCACGTGGGNONE 
J075167M21GCCACGTGGGNONE 
J075170F11GCCACGTGGGNONE 
J075186F12GCCACGTGGGNONE 
J075186L13GCCACGTGGGNONE 
J075189A01GCCACGTGGGNONE 
J075192D19GCCACGTGGGNONE 
Os03g0131300015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0132000AK105769CCCCACGTGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CCCCACGTGNONE 
Os03g0145200J090048J08CCCCCACGTGZinc finger, GATA-type domain containing protein. 
Os03g0156500011-075-F02CGGGCCCACGTGNONE 
012-077-G10CGGGCCCACGTGNONE 
AK103466CGGGCCCACGTGLupus La protein family protein. 
J013088H17CGGGCCCACGTGNONE 
J013135G21CGGGCCCACGTGNONE 
J033050E10CGGGCCCACGTGNONE 
J033050J01CGGGCCCACGTGNONE 
J033129N23CGGGCCCACGTGNONE 
J065085L16CGGGCCCACGTGNONE 
J065101B19CGGGCCCACGTGNONE 
J065167N03CGGGCCCACGTGNONE 
J090009O21CGGGCCCACGTGNONE 
J090049D11CGGGCCCACGTGNONE 
J100017F23CGGGCCCACGTGNONE 
J100040E12CGGGCCCACGTGNONE 
J100055O18CGGGCCCACGTGNONE 
J100061K08CGGGCCCACGTGNONE 
J100072M05CGGGCCCACGTGNONE 
J100077B08CGGGCCCACGTGNONE 
J100086G03CGGGCCCACGTGNONE 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0175600AK059981GGGTCCCACGTGSimilar to Nit protein 2 (CUA002). 
Os03g0192500AK068957ACACGTGGGGCProtein phosphatase 2C-like domain containing protein. 
AY603974ACACGTGGGGCNONE 
Os03g0262500AK071153CCCACGTGTNONE 
AK120384CCCACGTGTConserved hypothetical protein. 
J023078H24CCCACGTGTNONE 
Os03g0280400009-125-G04GCCCACGTGNONE 
AK063845GCCCACGTGConserved hypothetical protein 1589, plant family protein. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0310800009-126-C10CACGTGGGCCACNONE 
009-156-D02CACGTGGGCCACNONE 
AK058663CACGTGGGCCACNONE 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15CACGTGGGCCACNONE 
J075046C12CACGTGGGCCACNONE 
J075058D24CACGTGGGCCACNONE 
J075151M03CACGTGGGCCACNONE 
J075151M04CACGTGGGCCACNONE 
J075153I20CACGTGGGCCACNONE 
J075167J05CACGTGGGCCACNONE 
J075179G06CACGTGGGCCACNONE 
J100025I19CACGTGGGCCACNONE 
J100025L21CACGTGGGCCACNONE 
J100029C06CACGTGGGCCACNONE 
J100068E24CACGTGGGCCACNONE 
J100070F10CACGTGGGCCACNONE 
J100083H23CACGTGGGCCACNONE 
J100089H10CACGTGGGCCACNONE 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK109328CCCACGTGGGCCCCANONE 
Os03g0340500012-007-F10CACGTGGGCCATNONE 
012-007-F10GGCCCCACGTGTCAGTGNONE 
AK099406CACGTGGGCCATNONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13). 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CACGTGGGCCATNONE 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013063E02CACGTGGGCCATNONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063I02CACGTGGGCCATNONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013157O07CACGTGGGCCATNONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J023131N05CACGTGGGCCATNONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J033033P05CACGTGGGCCATNONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033040N16CACGTGGGCCATNONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033044M19CACGTGGGCCATNONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033086F24CACGTGGGCCATNONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033097H01CACGTGGGCCATNONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033106C22CACGTGGGCCATNONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033128M13CACGTGGGCCATNONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033133I15CACGTGGGCCATNONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J043027A21CACGTGGGCCATNONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J090028A09CACGTGGGCCATNONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090053D06CACGTGGGCCATNONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090083O17CACGTGGGCCATNONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090099H10CACGTGGGCCATNONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J100036M05CACGTGGGCCATNONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
Os03g0342900006-032-D01AGGTGGGCCACCCCACGTGNONE 
006-032-D01CACGTGGGCCTCNONE 
006-033-E10AGGTGGGCCACCCCACGTGNONE 
006-033-E10CACGTGGGCCTCNONE 
006-051-G06AGGTGGGCCACCCCACGTGNONE 
006-051-G06CACGTGGGCCTCNONE 
006-053-E05AGGTGGGCCACCCCACGTGNONE 
006-053-E05CACGTGGGCCTCNONE 
006-056-B05AGGTGGGCCACCCCACGTGNONE 
006-056-B05CACGTGGGCCTCNONE 
006-058-F04AGGTGGGCCACCCCACGTGNONE 
006-058-F04CACGTGGGCCTCNONE 
006-059-E05AGGTGGGCCACCCCACGTGNONE 
006-059-E05CACGTGGGCCTCNONE 
006-060-F10AGGTGGGCCACCCCACGTGNONE 
006-060-F10CACGTGGGCCTCNONE 
006-104-D12AGGTGGGCCACCCCACGTGNONE 
006-104-D12CACGTGGGCCTCNONE 
009-129-C12AGGTGGGCCACCCCACGTGNONE 
009-129-C12CACGTGGGCCTCNONE 
AK060136AGGTGGGCCACCCCACGTGNONE 
AK060136CACGTGGGCCTCNONE 
AK060980AGGTGGGCCACCCCACGTGNONE 
AK060980CACGTGGGCCTCNONE 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK104244AGGTGGGCCACCCCACGTGNONE 
AK104244CACGTGGGCCTCNONE 
AK104391AGGTGGGCCACCCCACGTGNONE 
AK104391CACGTGGGCCTCNONE 
AK104590AGGTGGGCCACCCCACGTGNONE 
AK104590CACGTGGGCCTCNONE 
AK104744AGGTGGGCCACCCCACGTGNONE 
AK104744CACGTGGGCCTCNONE 
AK106100AGGTGGGCCACCCCACGTGNONE 
AK106100CACGTGGGCCTCNONE 
J013000E10AGGTGGGCCACCCCACGTGNONE 
J013000E10CACGTGGGCCTCNONE 
J075027O22AGGTGGGCCACCCCACGTGNONE 
J075027O22CACGTGGGCCTCNONE 
J075052J03AGGTGGGCCACCCCACGTGNONE 
J075052J03CACGTGGGCCTCNONE 
J075066E15AGGTGGGCCACCCCACGTGNONE 
J075066E15CACGTGGGCCTCNONE 
J075095C17AGGTGGGCCACCCCACGTGNONE 
J075095C17CACGTGGGCCTCNONE 
J075118N05AGGTGGGCCACCCCACGTGNONE 
J075118N05CACGTGGGCCTCNONE 
J075187K22AGGTGGGCCACCCCACGTGNONE 
J075187K22CACGTGGGCCTCNONE 
J090026L04AGGTGGGCCACCCCACGTGNONE 
J090026L04CACGTGGGCCTCNONE 
J090059G16AGGTGGGCCACCCCACGTGNONE 
J090059G16CACGTGGGCCTCNONE 
J100055P20AGGTGGGCCACCCCACGTGNONE 
J100055P20CACGTGGGCCTCNONE 
J100062A10AGGTGGGCCACCCCACGTGNONE 
J100062A10CACGTGGGCCTCNONE 
J100068G20AGGTGGGCCACCCCACGTGNONE 
J100068G20CACGTGGGCCTCNONE 
Os03g0379300006-039-F11GCCCCCACGTGNONE 
AK061515GCCCCCACGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GCCCCCACGTGNONE 
J013159M16GCCCCCACGTGNONE 
J090067F01GCCCCCACGTGNONE 
J090083F21GCCCCCACGTGNONE 
J100040M08GCCCCCACGTGNONE 
J100048C03GCCCCCACGTGNONE 
J100056M07GCCCCCACGTGNONE 
J100062N22GCCCCCACGTGNONE 
J100086L07GCCCCCACGTGNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0413000009-180-E02CCCACGTGGCNONE 
009-188-B06CCCACGTGGCNONE 
AK060225CCCACGTGGCNONE 
AY062181CCCACGTGGCSimilar to Potential histone-like transcription factor. 
Os03g0441000AK070997CCCACGTGTNONE 
J023077I17CCCACGTGTNONE 
Os03g0578500Os03g0578500CCCCACGTGTConserved hypothetical protein. 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0587250J065002M05CCCACGTGConserved hypothetical protein. 
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein. 
J033052N01CCCACGTGTCAGTGNONE 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0644700AK072883CCCCACGTGConserved hypothetical protein. 
J075001E14CCCCACGTGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0670200011-069-G05CCCCCACGTGGCNONE 
AK069553CCCCCACGTGGCSimilar to YJR013Wp (Fragment). 
J023020O11CCCCCACGTGGCNONE 
J023114J22CCCCCACGTGGCNONE 
J100084F17CCCCCACGTGGCNONE 
J100087A11CCCCCACGTGGCNONE 
Os03g0679000AK059913CACGTGGGConserved hypothetical protein. 
J065094N08CACGTGGGNONE 
J065108H06CACGTGGGNONE 
Os03g0704200AK071176GACACGTGGGZinc finger, MYND-type domain containing protein. 
AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein. 
J023083O08GACACGTGGGNONE 
J023083O08GCCACGTGGGTCCCACCNONE 
Os03g0741100AK071734CCCACGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J100073C01CCCACGTGNONE 
Os03g0747500AK108009CCCACGTGTSeed maturation protein domain containing protein. 
Os03g0758500016-015-D02CACGTGGGCCCCNONE 
AK059403CACGTGGGCCCCNONE 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
J033079N03CACGTGGGCCCCNONE 
J065012M05CACGTGGGCCCCNONE 
J065045H19CACGTGGGCCCCNONE 
J065050J08CACGTGGGCCCCNONE 
J075189D02CACGTGGGCCCCNONE 
J090018L03CACGTGGGCCCCNONE 
J100043O22CACGTGGGCCCCNONE 
J100088G17CACGTGGGCCCCNONE 
Os03g0766000AK070596CCCACGTGGGNONE 
AK104743CCCACGTGGGNONE 
AK106079CCCACGTGGGNONE 
J013063M09CCCACGTGGGNONE 
J023056A03CCCACGTGGGNONE 
J043038L07CCCACGTGGGNONE 
J053067N16CCCACGTGGGNONE 
J053073G09CCCACGTGGGNONE 
J053075I19CCCACGTGGGNONE 
Os03g0770100AK108776CACGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0791800013-037-A12CACGTGGGACCCANONE 
AB079798CACGTGGGACCCANONE 
AK067703CACGTGGGACCCARad6 (Ubiquitin carrier protein). 
AK120251CACGTGGGACCCANONE 
J013045G10CACGTGGGACCCANONE 
J023102B18CACGTGGGACCCANONE 
J065020J23CACGTGGGACCCANONE 
J065127I21CACGTGGGACCCANONE 
J065151E11CACGTGGGACCCANONE 
J075076B05CACGTGGGACCCANONE 
J075116C15CACGTGGGACCCANONE 
J075136A07CACGTGGGACCCANONE 
J100029G21CACGTGGGACCCANONE 
J100030K01CACGTGGGACCCANONE 
J100041J02CACGTGGGACCCANONE 
J100049C22CACGTGGGACCCANONE 
J100057G17CACGTGGGACCCANONE 
J100086L12CACGTGGGACCCANONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0815800AK066670CCCACGTGSimilar to Ethylene-responsive transcription factor 5 (Ethylene-responsive element binding factor 5) (EREBP-5) (AtERF5). 
AK068252CCCACGTGNONE 
J080070O16CCCACGTGNONE 
Os03g0832200AK070712CCCACGTGTSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0839900AK067347CCCACGTGUspA domain containing protein. 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK069629CCAGCCCACGTGCyclin-like F-box domain containing protein. 
Os04g0244800009-066-G06CCCACGTGGCNONE 
009-066-G06GCCCACGTGTCNONE 
011-024-D02CCCACGTGGCNONE 
011-024-D02GCCCACGTGTCNONE 
AK121488CCCACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CCCACGTGGCNONE 
J023095P14GCCCACGTGTCNONE 
J023150J09CCCACGTGGCNONE 
J023150J09GCCCACGTGTCNONE 
J053097G24CCCACGTGGCNONE 
J053097G24GCCCACGTGTCNONE 
J065001K24CCCACGTGGCNONE 
J065001K24GCCCACGTGTCNONE 
J065009O13CCCACGTGGCNONE 
J065009O13GCCCACGTGTCNONE 
J065076M12CCCACGTGGCNONE 
J065076M12GCCCACGTGTCNONE 
J065081I15CCCACGTGGCNONE 
J065081I15GCCCACGTGTCNONE 
J065105E10CCCACGTGGCNONE 
J065105E10GCCCACGTGTCNONE 
J065106G04CCCACGTGGCNONE 
J065106G04GCCCACGTGTCNONE 
J065123I12CCCACGTGGCNONE 
J065123I12GCCCACGTGTCNONE 
J065137H16CCCACGTGGCNONE 
J065137H16GCCCACGTGTCNONE 
J065151I11CCCACGTGGCNONE 
J065151I11GCCCACGTGTCNONE 
J065164H06CCCACGTGGCNONE 
J065164H06GCCCACGTGTCNONE 
J065173J07CCCACGTGGCNONE 
J065173J07GCCCACGTGTCNONE 
J065196F02CCCACGTGGCNONE 
J065196F02GCCCACGTGTCNONE 
J065198I17CCCACGTGGCNONE 
J065198I17GCCCACGTGTCNONE 
J065206I11CCCACGTGGCNONE 
J065206I11GCCCACGTGTCNONE 
J065216J02CCCACGTGGCNONE 
J065216J02GCCCACGTGTCNONE 
J075076D10CCCACGTGGCNONE 
J075076D10GCCCACGTGTCNONE 
J075098F06CCCACGTGGCNONE 
J075098F06GCCCACGTGTCNONE 
J075115A20CCCACGTGGCNONE 
J075115A20GCCCACGTGTCNONE 
J075184H05CCCACGTGGCNONE 
J075184H05GCCCACGTGTCNONE 
J075193E17CCCACGTGGCNONE 
J075193E17GCCCACGTGTCNONE 
J090014L09CCCACGTGGCNONE 
J090014L09GCCCACGTGTCNONE 
J090015H16CCCACGTGGCNONE 
J090015H16GCCCACGTGTCNONE 
J090024M04CCCACGTGGCNONE 
J090024M04GCCCACGTGTCNONE 
J090062K08CCCACGTGGCNONE 
J090062K08GCCCACGTGTCNONE 
J090082I08CCCACGTGGCNONE 
J090082I08GCCCACGTGTCNONE 
Os04g0258900009-146-B02GTGGGACCCACGTGGGTCCCACNONE 
AK062983GTGGGACCCACGTGGGTCCCACCyclin-like F-box domain containing protein. 
Os04g0303950J065204E07CACGTGGGGNONE 
J075044A07CACGTGGGGNONE 
Os04g0389800AK109628CCCCACGTGTSimilar to Acetohydroxyacid synthase. 
Os04g0405500011-007-D12ACCCCCCACGTGNONE 
AK063263ACCCCCCACGTGConserved hypothetical protein. 
J065166G19ACCCCCCACGTGNONE 
J075180M09ACCCCCCACGTGNONE 
Os04g0428900009-068-A06ACACGTGGGNONE 
AK061355ACACGTGGGSimilar to CSN8. 
AK099153ACACGTGGGNONE 
AY336991ACACGTGGGNONE 
J023069F08ACACGTGGGNONE 
J065112H12ACACGTGGGNONE 
J075022F23ACACGTGGGNONE 
J090045D23ACACGTGGGNONE 
J090067E18ACACGTGGGNONE 
J090099H14ACACGTGGGNONE 
Os04g0435700AK100857GCCACGTGGGACCSimilar to UVB-resistance protein UVR8. 
Os04g0460300AK106202CCCACGTGAmino acid/polyamine transporter II family protein. 
Os04g0474600J023064N16CCCACGTGGCCACGTCGlycoside hydrolase, family 1 protein. 
J075175P11CCCACGTGGCCACGTCNONE 
J090080I16CCCACGTGGCCACGTCNONE 
J090089B01CCCACGTGGCCACGTCNONE 
Os04g0479300AK106088AGCCCACGTGTConserved hypothetical protein. 
Os04g0546800014-054-C05CACGTGGGNONE 
015-034-B06CACGTGGGNONE 
015-060-H04CACGTGGGNONE 
015-098-G01CACGTGGGNONE 
015-099-G05CACGTGGGNONE 
016-062-D01CACGTGGGNONE 
016-078-G01CACGTGGGNONE 
J023002C20CACGTGGGPathogenesis-related transcriptional factor and ERF domain containing protein. 
J065038P12CACGTGGGNONE 
J100039E18CACGTGGGNONE 
Os04g0561500AK065953CCCCCACGTGSimilar to Prolyl endopeptidase (EC 3.4.21.26) (Post-proline cleaving enzyme) (PE). 
AK069664CCCCCACGTGNONE 
Os04g0563300AK100487CCCACGTGGGTCCCACyclin-like F-box domain containing protein. 
J023097O18CCCACGTGGGTCCCANONE 
J065100E16CCCACGTGGGTCCCANONE 
J075022C23CCCACGTGGGTCCCANONE 
J075023L18CCCACGTGGGTCCCANONE 
J075040N10CCCACGTGGGTCCCANONE 
J075061L14CCCACGTGGGTCCCANONE 
J075069B15CCCACGTGGGTCCCANONE 
J075106C16CCCACGTGGGTCCCANONE 
J075138P13CCCACGTGGGTCCCANONE 
J075139H18CCCACGTGGGTCCCANONE 
J075139L06CCCACGTGGGTCCCANONE 
J075149B07CCCACGTGGGTCCCANONE 
J075177N21CCCACGTGGGTCCCANONE 
Os04g0602800AK100925GACACGTGGGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0616900013-094-A06CCCACGTGTCNONE 
013-099-B07CCCACGTGTCNONE 
015-083-G11CCCACGTGTCNONE 
AK066343CCCACGTGTCConserved hypothetical protein. 
AK104906CCCACGTGTCNONE 
J013066L21CCCACGTGTCNONE 
J023091I07CCCACGTGTCNONE 
J065056B15CCCACGTGTCNONE 
J065148E09CCCACGTGTCNONE 
J065162P19CCCACGTGTCNONE 
J065185N03CCCACGTGTCNONE 
J065198D13CCCACGTGTCNONE 
J090055O20CCCACGTGTCNONE 
J090067F24CCCACGTGTCNONE 
Os04g0626400006-050-B09GCCCACGTGGGCNONE 
006-072-C12GCCCACGTGGGCNONE 
006-092-C11GCCCACGTGGGCNONE 
AK059851GCCCACGTGGGCCalycin-like family protein. 
AK100069GCCCACGTGGGCNONE 
AK104062GCCCACGTGGGCNONE 
AK104663GCCCACGTGGGCNONE 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0642100011-074-F06CACGTGGGNONE 
J043006J10CACGTGGGSimilar to Microtubule-associated protein EB1. 
J043006P09CACGTGGGNONE 
Os04g0649700AK100096CCCACGTGProtein kinase domain containing protein. 
AK119579CCCACGTGNONE 
AK119889CCCACGTGNONE 
AK120146CCCACGTGNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0683800011-050-B05CCCACGTGNONE 
AK073897CCCACGTGSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CCCACGTGNONE 
J033075A06CCCACGTGNONE 
J033079F23CCCACGTGNONE 
J033093D20CCCACGTGNONE 
J033099B18CCCACGTGNONE 
J033129G13CCCACGTGNONE 
J065075F21CCCACGTGNONE 
J065093M19CCCACGTGNONE 
J075023K10CCCACGTGNONE 
J075046J08CCCACGTGNONE 
J090003I20CCCACGTGNONE 
J090017L12CCCACGTGNONE 
J090024B04CCCACGTGNONE 
J090033A20CCCACGTGNONE 
J090083F02CCCACGTGNONE 
Os04g0687900009-068-D03CCACTGACACGTGGGNONE 
015-097-H12CCACTGACACGTGGGNONE 
AK062547CCACTGACACGTGGGNONE 
AK066910CCACTGACACGTGGGNONE 
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333CCACTGACACGTGGGNONE 
J013023N16CCACTGACACGTGGGNONE 
J013031I07CCACTGACACGTGGGNONE 
J013063L06CCACTGACACGTGGGNONE 
J013091C11CCACTGACACGTGGGNONE 
J013123M06CCACTGACACGTGGGNONE 
J013126D14CCACTGACACGTGGGNONE 
J023023E09CCACTGACACGTGGGNONE 
J023039C19CCACTGACACGTGGGNONE 
J023068D23CCACTGACACGTGGGNONE 
J023080C21CCACTGACACGTGGGNONE 
J033092J17CCACTGACACGTGGGNONE 
J033112P12CCACTGACACGTGGGNONE 
J033135O08CCACTGACACGTGGGNONE 
J053023C13CCACTGACACGTGGGNONE 
J065030O05CCACTGACACGTGGGNONE 
J065065P07CCACTGACACGTGGGNONE 
J065190O06CCACTGACACGTGGGNONE 
J090011M19CCACTGACACGTGGGNONE 
J090061F08CCACTGACACGTGGGNONE 
J090064H09CCACTGACACGTGGGNONE 
J090064P11CCACTGACACGTGGGNONE 
Os04g0690866014-091-B08GTGGGACCCACGTGConserved hypothetical protein. 
J065085H18GTGGGACCCACGTGNONE 
J065099J05GTGGGACCCACGTGNONE 
J065194D12GTGGGACCCACGTGNONE 
J065197H01GTGGGACCCACGTGNONE 
Os05g0121700016-085-G05CACGTGGGNONE 
AK106510CACGTGGGNONE 
AK107571CACGTGGGRecA bacterial DNA recombination family protein. 
Os05g0129400AK102359TGGGACCCACGTGGGTCCCACAnkyrin repeat containing protein. 
J033091I05TGGGACCCACGTGGGTCCCACNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0169300AK071481CCCCCACGTGNONE 
AK071687CCCCCACGTGAllinase, C-terminal domain containing protein. 
J023091A07CCCCCACGTGNONE 
Os05g0171900012-005-F08CCCACGTGTCNONE 
012-048-G09CCCACGTGTCNONE 
013-046-A07CCCACGTGTCNONE 
013-050-D10CCCACGTGTCNONE 
014-003-G04CCCACGTGTCNONE 
014-008-G10CCCACGTGTCNONE 
014-011-E07CCCACGTGTCNONE 
014-011-F11CCCACGTGTCNONE 
014-019-C02CCCACGTGTCNONE 
014-037-G03CCCACGTGTCNONE 
014-043-G06CCCACGTGTCNONE 
014-045-A05CCCACGTGTCNONE 
014-047-C07CCCACGTGTCNONE 
014-052-F03CCCACGTGTCNONE 
014-088-G07CCCACGTGTCNONE 
014-090-B11CCCACGTGTCNONE 
015-010-A06CCCACGTGTCNONE 
015-013-B11CCCACGTGTCNONE 
015-026-A04CCCACGTGTCNONE 
015-041-G01CCCACGTGTCNONE 
015-046-D06CCCACGTGTCNONE 
015-050-B07CCCACGTGTCNONE 
015-053-C03CCCACGTGTCNONE 
015-056-C04CCCACGTGTCNONE 
015-057-B04CCCACGTGTCNONE 
015-075-C12CCCACGTGTCNONE 
015-079-F04CCCACGTGTCNONE 
016-025-F02CCCACGTGTCNONE 
016-030-B10CCCACGTGTCNONE 
016-034-B03CCCACGTGTCNONE 
016-034-E04CCCACGTGTCNONE 
016-035-B07CCCACGTGTCNONE 
016-035-D10CCCACGTGTCNONE 
016-039-C06CCCACGTGTCNONE 
016-042-D01CCCACGTGTCNONE 
016-043-C02CCCACGTGTCNONE 
016-044-B01CCCACGTGTCNONE 
016-045-G06CCCACGTGTCNONE 
016-049-G07CCCACGTGTCNONE 
016-052-C10CCCACGTGTCNONE 
016-070-D03CCCACGTGTCNONE 
016-077-H10CCCACGTGTCNONE 
016-082-F02CCCACGTGTCNONE 
016-087-D04CCCACGTGTCNONE 
016-093-B05CCCACGTGTCNONE 
016-093-F06CCCACGTGTCNONE 
AK069814CCCACGTGTCGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
AK106348CCCACGTGTCNONE 
AK119584CCCACGTGTCNONE 
AK119669CCCACGTGTCNONE 
J013074J12CCCACGTGTCNONE 
J023031G07CCCACGTGTCNONE 
J023072P16CCCACGTGTCNONE 
J023105N07CCCACGTGTCNONE 
J053023E11CCCACGTGTCNONE 
J053025H06CCCACGTGTCNONE 
J053029G08CCCACGTGTCNONE 
J053051L10CCCACGTGTCNONE 
J065011P09CCCACGTGTCNONE 
J065022O05CCCACGTGTCNONE 
J065071D04CCCACGTGTCNONE 
J065100B07CCCACGTGTCNONE 
J065104O10CCCACGTGTCNONE 
J065154H19CCCACGTGTCNONE 
J065183D19CCCACGTGTCNONE 
J065185I07CCCACGTGTCNONE 
J065205O17CCCACGTGTCNONE 
J075022N11CCCACGTGTCNONE 
J100033M17CCCACGTGTCNONE 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0195200015-031-H09CCCCCACGTGGGNONE 
015-031-H09GCCCCCACGTGTCNONE 
015-070-C11CCCCCACGTGGGNONE 
015-070-C11GCCCCCACGTGTCNONE 
016-063-C11CCCCCACGTGGGNONE 
016-063-C11GCCCCCACGTGTCNONE 
AK106392CCCCCACGTGGGZinc finger, CCCH-type domain containing protein. 
AK106392GCCCCCACGTGTCZinc finger, CCCH-type domain containing protein. 
J033051N05CCCCCACGTGGGNONE 
J033051N05GCCCCCACGTGTCNONE 
J065118P05CCCCCACGTGGGNONE 
J065118P05GCCCCCACGTGTCNONE 
J100071H15CCCCCACGTGGGNONE 
J100071H15GCCCCCACGTGTCNONE 
J100078J22CCCCCACGTGGGNONE 
J100078J22GCCCCCACGTGTCNONE 
Os05g0295800AK070232ACACGTGGGTCCSimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03ACACGTGGGTCCNONE 
Os05g0312500AK069307CCCACGTGGCGReticulon family protein. 
J023075D16CCCACGTGGCGNONE 
J023097K08CCCACGTGGCGNONE 
Os05g0316200AK060608CACGTGGGNONE 
AK101705CACGTGGGConserved hypothetical protein. 
AK111481CACGTGGGNONE 
Os05g0346100012-005-C07GCCACGTGGGCGCGCGCGANONE 
AK066689GCCACGTGGGCGCGCGCGAPhox-like domain containing protein. 
J013073J06GCCACGTGGGCGCGCGCGANONE 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
Os05g0369900015-049-C07CCCCACGTGNONE 
AK064110CCCCACGTGConserved hypothetical protein. 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
Os05g0373300Os05g0373300GACACGTGGGGCCSimilar to BONZAI1. 
Os05g0380900AK067214GCCCACGTGTSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962GCCCACGTGTNONE 
J065083M07GCCCACGTGTNONE 
Os05g0383000009-135-E10GGGACCCACGTGNONE 
AK058345GGGACCCACGTGTetratricopeptide-like helical domain containing protein. 
AK102079GGGACCCACGTGNONE 
J033082J04GGGACCCACGTGNONE 
J033142L02GGGACCCACGTGNONE 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0423500015-048-C11CACGTGGGCCCACCTNONE 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
J013049L02CACGTGGGCCCACCTNONE 
Os05g0423701J100057H19CCCACGTGGCGGlycoside hydrolase, family 9 protein. 
Os05g0440100015-006-F06CACGTGGGTCCCACNONE 
015-076-D04CACGTGGGTCCCACNONE 
AK073094CACGTGGGTCCCACNONE 
AK102786CACGTGGGTCCCACHistone deacetylase superfamily protein. 
J033107M16CACGTGGGTCCCACNONE 
Os05g0463500AK108773CCCACGTGGCConserved hypothetical protein. 
Os05g0487600AK100817TGTGGGGCCCACGTGNONE 
AK103104TGTGGGGCCCACGTGNONE 
J043027P10TGTGGGGCCCACGTGNONE 
J065183N17TGTGGGGCCCACGTGNONE 
Os05g0491200AK068637CCCACGTGSimilar to SNF1 kinase complex anchoring protein (Fragment). 
AK071229CCCACGTGNONE 
Os05g0507000AK108025CACGTGGGACCCAConserved hypothetical protein. 
Os05g0512000AK102433GGACCCACGTGGCZinc finger, RING-type domain containing protein. 
Os05g0512400011-014-B07CACGTGGGGCNONE 
AK120770CACGTGGGGCConserved hypothetical protein. 
Os05g0514300AK061747GGCCCCACGTGTCSimilar to Tubby-like protein 3. 
AK098851GGCCCCACGTGTCNONE 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0549100AK072422CCCACGTGTCSimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0586600AB096011GCCCACGTGGCGPlastid sigma factor SIG5. 
AB096071GCCCACGTGGCGNONE 
AK105697GCCCACGTGGCGNONE 
Os06g0114700AK061552CCCACGTGProtein of unknown function DUF1218 family protein. 
AK098848CCCACGTGNONE 
AK122142CCCACGTGNONE 
J013000D16CCCACGTGNONE 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0140100011-063-A02GCCCACGTGNONE 
AK063371GCCCACGTGLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein. 
J023001F16TGTGGGCCCACGTGNONE 
Os06g0149500AK102827GCCACGTGGGConserved hypothetical protein. 
J065050G14GCCACGTGGGNONE 
J065186O18GCCACGTGGGNONE 
J075006P12GCCACGTGGGNONE 
J075032I11GCCACGTGGGNONE 
J075099I15GCCACGTGGGNONE 
J075176B01GCCACGTGGGNONE 
J100039D04GCCACGTGGGNONE 
J100081M03GCCACGTGGGNONE 
J100088G01GCCACGTGGGNONE 
Os06g0194000006-041-H12CCACCTGTCCCACGTGGACCNONE 
006-077-B02CCACCTGTCCCACGTGGACCNONE 
013-029-A09CCACCTGTCCCACGTGGACCNONE 
AF190770CCACCTGTCCCACGTGGACCNONE 
AK060742CCACCTGTCCCACGTGGACCNONE 
AK069833CCACCTGTCCCACGTGGACCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCACCTGTCCCACGTGGACCNONE 
J013060G01CCACCTGTCCCACGTGGACCNONE 
J013069I06CCACCTGTCCCACGTGGACCNONE 
J013134D15CCACCTGTCCCACGTGGACCNONE 
J013149A16CCACCTGTCCCACGTGGACCNONE 
J023031B06CCACCTGTCCCACGTGGACCNONE 
J023074E17CCACCTGTCCCACGTGGACCNONE 
J023091C14CCACCTGTCCCACGTGGACCNONE 
J023101P18CCACCTGTCCCACGTGGACCNONE 
J023106O14CCACCTGTCCCACGTGGACCNONE 
J023110J17CCACCTGTCCCACGTGGACCNONE 
J023110N02CCACCTGTCCCACGTGGACCNONE 
J023128D07CCACCTGTCCCACGTGGACCNONE 
J033024O19CCACCTGTCCCACGTGGACCNONE 
J033068G19CCACCTGTCCCACGTGGACCNONE 
J033095G01CCACCTGTCCCACGTGGACCNONE 
J033108C12CCACCTGTCCCACGTGGACCNONE 
J033114C23CCACCTGTCCCACGTGGACCNONE 
J043003E04CCACCTGTCCCACGTGGACCNONE 
J053023J03CCACCTGTCCCACGTGGACCNONE 
J053026B01CCACCTGTCCCACGTGGACCNONE 
J065172F15CCACCTGTCCCACGTGGACCNONE 
J075036K13CCACCTGTCCCACGTGGACCNONE 
J090020A10CCACCTGTCCCACGTGGACCNONE 
J090073E10CCACCTGTCCCACGTGGACCNONE 
J100034P18CCACCTGTCCCACGTGGACCNONE 
J100048O18CCACCTGTCCCACGTGGACCNONE 
J100064K09CCACCTGTCCCACGTGGACCNONE 
Os06g0199300J065045H01GGCCCCACGTGTCCNONE 
J075177C22GGCCCCACGTGTCCNONE 
J080068H06GGCCCCACGTGTCCNONE 
J090048F01GGCCCCACGTGTCCNONE 
J100066F17GGCCCCACGTGTCCNONE 
Os06g0258900AK067794GCCACGTGGGGKetose-bisphosphate aldolase, class-II family protein. 
AK099384GCCACGTGGGGNONE 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0324000AK109614GTGGGACCCACGTGGACCConserved hypothetical protein. 
Os06g0335500AK121989CACGTGGGCAUX/IAA protein family protein. 
Os06g0485100014-052-D02CCCACGTGNONE 
016-028-B05CCCACGTGNONE 
AK073906CCCACGTGNONE 
AK104282CCCACGTGNONE 
J013151L16CCCACGTGNONE 
J033040K10CCCACGTGNONE 
J033068B07CCCACGTGNONE 
J033073E23CCCACGTGNONE 
J053077E05CCCACGTGNONE 
J080311J15CCCACGTGNONE 
J100048C16CCCACGTGNONE 
J100067E21CCCACGTGNONE 
J100075B06CCCACGTGNONE 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0621300AK068751TGGGACCCACGTGGACCConserved hypothetical protein. 
J013159I20TGGGACCCACGTGGACCNONE 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os07g0100500J033026C11GGGGCCCACGTGGCNONE 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0152800AK065458CCCCACGTGTConserved hypothetical protein. 
AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05CCCCACGTGTNONE 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18CCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16CCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03CCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12CCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22CCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09CCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17CCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18CCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02CCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17CCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18CCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12CCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10CCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07CCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14CCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0190600AK070975AGCCCACGTGSimilar to Helicase. 
Os07g0200900006-062-F11CCCCACGTGNONE 
006-071-A04CCCCACGTGNONE 
AK061082CCCCACGTGConserved hypothetical protein. 
Os07g0240300AK072205AGGTGGGCCCCACGTGConserved hypothetical protein. 
AK098977AGGTGGGCCCCACGTGNONE 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0245100J023048C16CCCCACGTGNONE 
J023110L14CCCCACGTGNONE 
J053023B18CCCCACGTGNONE 
J053031L17CCCCACGTGNONE 
J065035I22CCCCACGTGNONE 
J065043D21CCCCACGTGNONE 
J065072L16CCCCACGTGNONE 
J065214I23CCCCACGTGNONE 
Os07g0301200AB110202AGCCCACGTGNONE 
AB110202CACGTGGGCCGGCNONE 
AK073463AGCCCACGTGSimilar to RNA helicase (Fragment). 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0459200AK066819CTCCCCCACGTGTCNONE 
AK102099CTCCCCCACGTGTCSimilar to Possible kinase. 
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0589400AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGTGGGCCGGTNONE 
AK104756CACGTGGGCCGGTNONE 
Os07g0591400Os07g0591400TGGGGCCCACGTGGGCCCACANONE 
Os07g0597625J065130O18GGTGGGACCCACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GGTGGGACCCACGTGGCNONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0676600J065060E08CACGTGGGHelix-loop-helix DNA-binding domain containing protein. 
J075101F12CACGTGGGNONE 
Os07g0694700006-021-A10GCCACGTGGGCNONE 
006-027-C12GCCACGTGGGCNONE 
006-070-B12GCCACGTGGGCNONE 
006-077-D01GCCACGTGGGCNONE 
006-105-E07GCCACGTGGGCNONE 
006-111-H07GCCACGTGGGCNONE 
009-066-B07GCCACGTGGGCNONE 
009-199-H12GCCACGTGGGCNONE 
AB050724GCCACGTGGGCNONE 
AB053297GCCACGTGGGCNONE 
AK061715GCCACGTGGGCNONE 
AK068430GCCACGTGGGCL-ascorbate peroxidase. 
J013021I10GCCACGTGGGCNONE 
J013034P12GCCACGTGGGCNONE 
J013045L04GCCACGTGGGCNONE 
J013050F21GCCACGTGGGCNONE 
J013066C16GCCACGTGGGCNONE 
J013067N13GCCACGTGGGCNONE 
J013111K04GCCACGTGGGCNONE 
J013123I20GCCACGTGGGCNONE 
J013126F24GCCACGTGGGCNONE 
J013134J06GCCACGTGGGCNONE 
J013155B13GCCACGTGGGCNONE 
J013156P11GCCACGTGGGCNONE 
J023003N11GCCACGTGGGCNONE 
J023008D23GCCACGTGGGCNONE 
J023011I01GCCACGTGGGCNONE 
J023014M13GCCACGTGGGCNONE 
J023020A10GCCACGTGGGCNONE 
J023028F09GCCACGTGGGCNONE 
J023034I04GCCACGTGGGCNONE 
J023037L11GCCACGTGGGCNONE 
J023065M21GCCACGTGGGCNONE 
J023072C05GCCACGTGGGCNONE 
J023073M06GCCACGTGGGCNONE 
J023079M21GCCACGTGGGCNONE 
J023081M07GCCACGTGGGCNONE 
J023082O15GCCACGTGGGCNONE 
J023086M10GCCACGTGGGCNONE 
J023087H15GCCACGTGGGCNONE 
J023088K10GCCACGTGGGCNONE 
J023091G08GCCACGTGGGCNONE 
J023098C04GCCACGTGGGCNONE 
J023102D23GCCACGTGGGCNONE 
J023106M19GCCACGTGGGCNONE 
J023110D18GCCACGTGGGCNONE 
J023111B03GCCACGTGGGCNONE 
J023115I03GCCACGTGGGCNONE 
J023120G01GCCACGTGGGCNONE 
J023126C05GCCACGTGGGCNONE 
J023126C11GCCACGTGGGCNONE 
J023126F22GCCACGTGGGCNONE 
J023131L23GCCACGTGGGCNONE 
J023132K24GCCACGTGGGCNONE 
J023139P05GCCACGTGGGCNONE 
J023140F02GCCACGTGGGCNONE 
J023141F15GCCACGTGGGCNONE 
J023149G01GCCACGTGGGCNONE 
J033024O13GCCACGTGGGCNONE 
J033026M13GCCACGTGGGCNONE 
J033061C14GCCACGTGGGCNONE 
J033103E18GCCACGTGGGCNONE 
J033103L21GCCACGTGGGCNONE 
J033107I09GCCACGTGGGCNONE 
J033111N15GCCACGTGGGCNONE 
J033120G04GCCACGTGGGCNONE 
J033124J05GCCACGTGGGCNONE 
J043015A21GCCACGTGGGCNONE 
J043022H01GCCACGTGGGCNONE 
J043027O20GCCACGTGGGCNONE 
J043031F14GCCACGTGGGCNONE 
J065047K03GCCACGTGGGCNONE 
J065093N11GCCACGTGGGCNONE 
J065105P20GCCACGTGGGCNONE 
J065164L16GCCACGTGGGCNONE 
J065167K06GCCACGTGGGCNONE 
J075087I15GCCACGTGGGCNONE 
J080032F23GCCACGTGGGCNONE 
J080061N21GCCACGTGGGCNONE 
J080064L14GCCACGTGGGCNONE 
J080064L20GCCACGTGGGCNONE 
J080304B21GCCACGTGGGCNONE 
J080305A04GCCACGTGGGCNONE 
J080308L24GCCACGTGGGCNONE 
J080312J04GCCACGTGGGCNONE 
J080319N10GCCACGTGGGCNONE 
J090011C08GCCACGTGGGCNONE 
J090028G14GCCACGTGGGCNONE 
J090037N03GCCACGTGGGCNONE 
J090041I10GCCACGTGGGCNONE 
J090057B14GCCACGTGGGCNONE 
J090062P18GCCACGTGGGCNONE 
J090072L03GCCACGTGGGCNONE 
J090073A02GCCACGTGGGCNONE 
J090073C10GCCACGTGGGCNONE 
J090078N11GCCACGTGGGCNONE 
J090085L16GCCACGTGGGCNONE 
J100023N07GCCACGTGGGCNONE 
J100028F02GCCACGTGGGCNONE 
J100033K09GCCACGTGGGCNONE 
J100038K23GCCACGTGGGCNONE 
J100038O11GCCACGTGGGCNONE 
J100040G12GCCACGTGGGCNONE 
J100057L23GCCACGTGGGCNONE 
J100058N21GCCACGTGGGCNONE 
J100059N10GCCACGTGGGCNONE 
J100063D09GCCACGTGGGCNONE 
J100065O12GCCACGTGGGCNONE 
J100066G11GCCACGTGGGCNONE 
J100067I01GCCACGTGGGCNONE 
J100069J23GCCACGTGGGCNONE 
J100071M03GCCACGTGGGCNONE 
J100072C11GCCACGTGGGCNONE 
J100072D01GCCACGTGGGCNONE 
J100079M19GCCACGTGGGCNONE 
Os07g0695100AB189039GGACACGTGGGNONE 
AB189042GGACACGTGGGNONE 
AK059514GGACACGTGGGNONE 
AK066112GGACACGTGGGCheY-like domain containing protein. 
J013051N02GGACACGTGGGNONE 
J013127M02GGACACGTGGGNONE 
J023007I05GGACACGTGGGNONE 
Os08g0122700AK111089GGACGGACCCACGTGTCConserved hypothetical protein. 
Os08g0195400006-057-E04CACGTGGGCTGGNONE 
006-060-B10CACGTGGGCTGGNONE 
AK070464CACGTGGGCTGGConserved hypothetical protein. 
AK104389CACGTGGGCTGGNONE 
AK106140CACGTGGGCTGGNONE 
J023013G08CACGTGGGCTGGNONE 
J023054K19CACGTGGGCTGGNONE 
J023089D18CACGTGGGCTGGNONE 
J023092K05CACGTGGGCTGGNONE 
J033025A08CACGTGGGCTGGNONE 
J033067P12CACGTGGGCTGGNONE 
J033098A10CACGTGGGCTGGNONE 
J065219L04CACGTGGGCTGGNONE 
J090021P06CACGTGGGCTGGNONE 
J090062M05CACGTGGGCTGGNONE 
J090079F15CACGTGGGCTGGNONE 
J100041H19CACGTGGGCTGGNONE 
Os08g0224200AK101331CACGTGGGCTGGSimilar to Ythdf2-prov protein. 
Os08g0299200009-120-G12GCCACGTGGGNONE 
J075096F13GCCACGTGGGAdenylate cyclase domain containing protein. 
Os08g0305000AK102896TGTGGGGCCCACGTGGGNONE 
AK107492TGTGGGGCCCACGTGGGHypothetical protein. 
Os08g0337300AK067509CACGTGGGNONE 
AK072420CACGTGGGZinc finger, FYVE/PHD-type domain containing protein. 
Os08g0353700AK058799CCCACGTGGCConserved hypothetical protein. 
Os08g0360100AK066365ACACGTGGGTCCCACCRS1/YhbY domain containing protein. 
Os08g0379000AK105647CACGTGGGProtein prenyltransferase domain containing protein. 
Os08g0386300AK059323GTGGCCCACGTGGCNONE 
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein. 
J023054P20GTGGCCCACGTGGCNONE 
J033089H01GTGGCCCACGTGGCNONE 
J065013I01GTGGCCCACGTGGCNONE 
J065212E17GTGGCCCACGTGGCNONE 
J080317O15GTGGCCCACGTGGCNONE 
J090018O07GTGGCCCACGTGGCNONE 
Os08g0397900006-033-G02CCCACGTGNONE 
009-131-F03CCCACGTGNONE 
AK060114CCCACGTGNONE 
AK098973CCCACGTGNONE 
AK109817CCCACGTGConserved hypothetical protein. 
J013089E18CCCACGTGNONE 
J100081N17CCCACGTGNONE 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0459300AK060409CCCACGTGConserved hypothetical protein. 
AK101386CCCACGTGNONE 
J033034E20CCCACGTGNONE 
J033036F14CCCACGTGNONE 
J065047G22CCCACGTGNONE 
J065173C14CCCACGTGNONE 
J065188O22CCCACGTGNONE 
J065189C17CCCACGTGNONE 
J065197I16CCCACGTGNONE 
J065202E05CCCACGTGNONE 
J075022D03CCCACGTGNONE 
J075023K21CCCACGTGNONE 
J075096D12CCCACGTGNONE 
J075129K24CCCACGTGNONE 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0519600012-027-B02GACACGTGGGNONE 
AK072374GACACGTGGGNONE 
AK105273GACACGTGGGProtein of unknown function DUF1666 family protein. 
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE 
009-033-G10CGCCACGTGGGCCCCACCNONE 
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CGCCACGTGGGCCCCACCNONE 
J023037A21CGCCACGTGGGCCCCACCNONE 
J023066D20CGCCACGTGGGCCCCACCNONE 
J033099K13CGCCACGTGGGCCCCACCNONE 
J065116C14CGCCACGTGGGCCCCACCNONE 
J075009K15CGCCACGTGGGCCCCACCNONE 
J075071P13CGCCACGTGGGCCCCACCNONE 
J075080D18CGCCACGTGGGCCCCACCNONE 
J075124F24CGCCACGTGGGCCCCACCNONE 
J075198F23CGCCACGTGGGCCCCACCNONE 
J080006B15CGCCACGTGGGCCCCACCNONE 
J090078H13CGCCACGTGGGCCCCACCNONE 
J090089J09CGCCACGTGGGCCCCACCNONE 
J100017A03CGCCACGTGGGCCCCACCNONE 
J100023G03CGCCACGTGGGCCCCACCNONE 
Os08g0558200AK069761CCCACGTGTGlutathione S-transferase, N-terminal domain containing protein. 
J013041N12CCCACGTGTNONE 
J013093H08CCCACGTGTNONE 
J023020B17CCCACGTGTNONE 
J023028D17CCCACGTGTNONE 
J023039B10CCCACGTGTNONE 
J065045O11CCCACGTGTNONE 
J065206N10CCCACGTGTNONE 
J075032G11CCCACGTGTNONE 
J075037C22CCCACGTGTNONE 
J075074J23CCCACGTGTNONE 
J090023A08CCCACGTGTNONE 
J090028N16CCCACGTGTNONE 
J100081G01CCCACGTGTNONE 
Os09g0360400009-192-H06CCCCCACGTGNONE 
AK071395CCCCCACGTGConserved hypothetical protein. 
J013045J21CCCCCACGTGNONE 
J023095O09CCCCCACGTGNONE 
J065207K01CCCCCACGTGNONE 
Os09g0412900014-003-F10GACACGTGGGTCCCACNONE 
AK102254GACACGTGGGTCCCACProtein prenyltransferase domain containing protein. 
AK102867GACACGTGGGTCCCACNONE 
J033088H22GACACGTGGGTCCCACNONE 
Os09g0424600AK073882ACAGGTGGGCCCCACGTGGCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0445600AK107839CCCACGTGConserved hypothetical protein. 
Os09g0448100AK070293CACGTGGGTCCCACyclin-like F-box domain containing protein. 
AK070628CACGTGGGTCCCANONE 
J023050H06CACGTGGGTCCCANONE 
J053091I22CACGTGGGTCCCANONE 
J065051I11CACGTGGGTCCCANONE 
J065066L13CACGTGGGTCCCANONE 
Os09g0462200AK064734CACGTGGGCCACEsterase/lipase/thioesterase domain containing protein. 
Os09g0462300J065097M23GTGGCCCACGTGEsterase/lipase/thioesterase domain containing protein. 
J065161K12GTGGCCCACGTGNONE 
Os09g0464000AK060777CCCCCACGTGNONE 
AK069530CCCCCACGTGSimilar to Carbonate dehydratase-like protein. 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0534000AK100026GACGTGGCCACGTGGGConserved hypothetical protein. 
Os09g0541900AB031299CACGTGGGNONE 
AK100985CACGTGGGNONE 
AK101536CACGTGGGSimilar to 26S proteasome subunit RPN3a. 
Os09g0551600005-020-H08TGTGGGCCCCACGTGNONE 
006-043-E02TGTGGGCCCCACGTGNONE 
013-043-F03TGTGGGCCCCACGTGNONE 
AK066658TGTGGGCCCCACGTGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11TGTGGGCCCCACGTGNONE 
J065177J20TGTGGGCCCCACGTGNONE 
J075041D06TGTGGGCCCCACGTGNONE 
J075199H24TGTGGGCCCCACGTGNONE 
J080001G07TGTGGGCCCCACGTGNONE 
J080024A12TGTGGGCCCCACGTGNONE 
J080025B15TGTGGGCCCCACGTGNONE 
J090017G07TGTGGGCCCCACGTGNONE 
J090050G23TGTGGGCCCCACGTGNONE 
J090083G11TGTGGGCCCCACGTGNONE 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0131900AK065240CCCACGTGTSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0159000AK065738CAGGTGGGCCCCACGTGConserved hypothetical protein. 
AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0200600AK101818GCCACGTGGGCCyclin-like F-box domain containing protein. 
AK111444GCCACGTGGGCNONE 
J065098I12GCCACGTGGGCNONE 
Os11g0229100AK105557TGGGACCCACGTGTConserved hypothetical protein. 
Os11g0244800AK103215GTGGGCCCCACGTGTCSimilar to Alfin-1. 
J065009E13GTGGGCCCCACGTGTCNONE 
J065027D16GTGGGCCCCACGTGTCNONE 
J065085B06GTGGGCCCCACGTGTCNONE 
J065180O17GTGGGCCCCACGTGTCNONE 
J090010C16GTGGGCCCCACGTGTCNONE 
J090039K20GTGGGCCCCACGTGTCNONE 
Os11g0530600AB000801AGCCCACGTGGCSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810AGCCCACGTGGCNONE 
D29697AGCCCACGTGGCNONE 
J013119K06AGCCCACGTGGCNONE 
J023001C21AGCCCACGTGGCNONE 
J023081C19AGCCCACGTGGCNONE 
J065026K21AGCCCACGTGGCNONE 
J065040A17AGCCCACGTGGCNONE 
J065043H01AGCCCACGTGGCNONE 
J065093P05AGCCCACGTGGCNONE 
J065104P15AGCCCACGTGGCNONE 
J065127C09AGCCCACGTGGCNONE 
J065140D08AGCCCACGTGGCNONE 
X89859AGCCCACGTGGCNONE 
Os11g0595200009-005-A06GCCCACGTGNONE 
AK071115GCCCACGTGNONE 
AK106159GCCCACGTGPAP fibrillin family protein. 
AY387683GCCCACGTGNONE 
AY387684GCCCACGTGNONE 
J065166K17GCCCACGTGNONE 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os11g0648000AK066444GGACCCACGTGSimilar to Na+/H+ antiporter. 
AK072026GGACCCACGTGNONE 
Os11g0682600J090026G08GCCACGTGGGConserved hypothetical protein. 
J090037N19GCCACGTGGGNONE 
J090061M21GCCACGTGGGNONE 
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1. 
J065208D22GTGGGACCCACGTGGGCCCCACANONE 
Os12g0233500Os12g0233500CCCACGTGGGCCCCANONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0403800AK059940ACGTGGGCCTCACGTGGGNONE 
AK064189ACGTGGGCCTCACGTGGGExoribonuclease domain containing protein. 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0532600AK066369ACACGTGGGGHypothetical protein. 
J013059K17ACACGTGGGGNONE 
J065082J04ACACGTGGGGNONE 
J065158C15ACACGTGGGGNONE 
J090017A09ACACGTGGGGNONE 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0578500AK065485ACACGTGGGCGlycosyl transferase, family 8 protein. 
J043027D21ACACGTGGGCNONE 
J075120F12ACACGTGGGCNONE 
J080010J21ACACGTGGGCNONE 
J080015L10ACACGTGGGCNONE 
J080016C19ACACGTGGGCNONE 
J080016F10ACACGTGGGCNONE 
J080022A12ACACGTGGGCNONE 
J080024B10ACACGTGGGCNONE 
J080025C16ACACGTGGGCNONE 
J080026B03ACACGTGGGCNONE 
J080028B11ACACGTGGGCNONE 
J080028M19ACACGTGGGCNONE 
J080030I02ACACGTGGGCNONE 
J080032F18ACACGTGGGCNONE 
J080038O16ACACGTGGGCNONE 
J080040D01ACACGTGGGCNONE 
J080043H19ACACGTGGGCNONE 
J080045N21ACACGTGGGCNONE 
J080046H14ACACGTGGGCNONE 
J080053B20ACACGTGGGCNONE 
J080053P14ACACGTGGGCNONE 
J080056L15ACACGTGGGCNONE 
J080057F14ACACGTGGGCNONE 
J080060C10ACACGTGGGCNONE 
J080061D20ACACGTGGGCNONE 
J080061J12ACACGTGGGCNONE 
J080062F17ACACGTGGGCNONE 
J080065M15ACACGTGGGCNONE 
J080066N15ACACGTGGGCNONE 
J080069K21ACACGTGGGCNONE 
J080070L14ACACGTGGGCNONE 
J080072L05ACACGTGGGCNONE 
J080072L16ACACGTGGGCNONE 
J080075D08ACACGTGGGCNONE 
J080075I19ACACGTGGGCNONE 
J080076M24ACACGTGGGCNONE 
J080077M11ACACGTGGGCNONE 
J080078O10ACACGTGGGCNONE 
J080081K24ACACGTGGGCNONE 
J080082J02ACACGTGGGCNONE 
J080083N20ACACGTGGGCNONE 
J080085M09ACACGTGGGCNONE 
J080093K05ACACGTGGGCNONE 
J080094J19ACACGTGGGCNONE 
J080095E06ACACGTGGGCNONE 
J080096B04ACACGTGGGCNONE 
J080096H08ACACGTGGGCNONE 
J090034I21ACACGTGGGCNONE 
J090045J19ACACGTGGGCNONE 
J090065F20ACACGTGGGCNONE 
J100077M24ACACGTGGGCNONE 
Os12g0580400AK099986GCCACGTGGGCCCACCAmino acid/polyamine transporter I family protein. 
J065120C05GCCACGTGGGCCCACCNONE 
Os12g0586600AK066259GACACGTGGGTCCSimilar to Plasma membrane Ca2+-ATPase. 
AK100436GACACGTGGGTCCNONE 
Os12g0620400015-008-B10CACGTGGGGCCCGCNONE 
AK059006CACGTGGGGCCCGCNONE 
AK059973CACGTGGGGCCCGCNONE 
AK063843CACGTGGGGCCCGCMethyl-CpG binding domain containing protein. 
AK072503CACGTGGGGCCCGCNONE 
AK072934CACGTGGGGCCCGCNONE 
J023126H05CACGTGGGGCCCGCNONE 
J023131G11CACGTGGGGCCCGCNONE 
J023146E17CACGTGGGGCCCGCNONE 
J033064P08CACGTGGGGCCCGCNONE 
J033095L07CACGTGGGGCCCGCNONE 
J065101N06CACGTGGGGCCCGCNONE 
J065186F11CACGTGGGGCCCGCNONE 
J065215J15CACGTGGGGCCCGCNONE 
J080049H05CACGTGGGGCCCGCNONE 
J080059L05CACGTGGGGCCCGCNONE 
J080061M17CACGTGGGGCCCGCNONE 
J080063D16CACGTGGGGCCCGCNONE 
J090012D01CACGTGGGGCCCGCNONE 
J090023D20CACGTGGGGCCCGCNONE 
J090040A09CACGTGGGGCCCGCNONE 
J090044K08CACGTGGGGCCCGCNONE 
J100019H03CACGTGGGGCCCGCNONE 
J100054N04CACGTGGGGCCCGCNONE 
Os12g0621500AK111785TGTGGGGCCCACGTGSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.