version

Summary of OsREG509 (All List)

OrganismOryza sativa  
IDOsREG509  
SequenceCACGTGTC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count2151  

Entry Sequences (2151 entries)

LocusGene modelSequenceDescription
Os01g0138500AK073435CACGTGTCCProtein of unknown function DUF789 family protein. 
J023118K18CACGTGTCCNONE 
J033039C22CACGTGTCCNONE 
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCCACGTGTCCNONE 
J065122H15CGCCACGTGTCCNONE 
J065140B19CGCCACGTGTCCNONE 
J100031E12CGCCACGTGTCCNONE 
J100068J03CGCCACGTGTCCNONE 
J100083E12CGCCACGTGTCCNONE 
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein. 
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein. 
Os01g0206600J065041P19CACGTGTCConserved hypothetical protein. 
Os01g0218700AK064992GGACACGTGTCCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0246400009-143-G05CACTGACACGTGGCNONE 
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0382450J065084M05GCCACGTGTCCHypothetical protein. 
J065155G18GCCACGTGTCCNONE 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0644200014-007-H12CACGTGTCGNONE 
AK063634CACGTGTCGConserved hypothetical protein. 
AY549310CACGTGTCGNONE 
J075068F10CACGTGTCGNONE 
J075082A11CACGTGTCGNONE 
Os01g0664500J075157K10GACACGTGTCCNONE 
J100023K08GACACGTGTCCNONE 
J100052N02GACACGTGTCCNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0685900AK064024CCCACGTGTCCNONE 
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein. 
Os01g0698100AK100466GACACGTGTCSWAP/Surp domain containing protein. 
AK106727GACACGTGTCNONE 
J065021C07GACACGTGTCNONE 
J065078F04GACACGTGTCNONE 
J065184H18GACACGTGTCNONE 
J065184L10GACACGTGTCNONE 
J075073I11GACACGTGTCNONE 
J075083E10GACACGTGTCNONE 
J075090K24GACACGTGTCNONE 
J075109B11GACACGTGTCNONE 
J075123H04GACACGTGTCNONE 
J075157O16GACACGTGTCNONE 
J075173D06GACACGTGTCNONE 
J075199A05GACACGTGTCNONE 
J090029H18GACACGTGTCNONE 
Os01g0705200011-075-B10CGACACGTGNONE 
014-056-F05CGACACGTGNONE 
014-072-F08CGACACGTGNONE 
014-082-E10CGACACGTGNONE 
014-085-E10CGACACGTGNONE 
AK064074CGACACGTGLate embryogenesis abundant protein repeat containing protein. 
AK073837CGACACGTGNONE 
D26536CGACACGTGNONE 
J033070H10CGACACGTGNONE 
J065138A19CGACACGTGNONE 
J065140A10CGACACGTGNONE 
Os01g0728700AK108000GACACGTGProtein of unknown function DUF1264 family protein. 
J065045G01GACACGTGNONE 
J065082L05GACACGTGNONE 
J065140O06GACACGTGNONE 
J065180C21GACACGTGNONE 
J075099B15GACACGTGNONE 
J075099P12GACACGTGNONE 
J075110I24GACACGTGNONE 
J075178E23GACACGTGNONE 
Os01g0738600AK073479GACACGTGENTH/VHS domain containing protein. 
AK120616GACACGTGNONE 
J013046M12GACACGTGNONE 
J013152B11GACACGTGNONE 
J023007A09GACACGTGNONE 
J023007N03GACACGTGNONE 
J023042A01GACACGTGNONE 
J023059P06GACACGTGNONE 
J023113A05GACACGTGNONE 
J033044K11GACACGTGNONE 
J033082E04GACACGTGNONE 
J090033B13GACACGTGNONE 
J090062H08GACACGTGNONE 
J100086G23GACACGTGNONE 
Os01g0767100AK109493CACGTGTCACCCGCGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein. 
Os01g0860700009-026-D05CCACGTGTCGNONE 
AK062402CCACGTGTCGConserved hypothetical protein. 
Os01g0867900AK061366CGACACGTGProtein of unknown function DUF502 family protein. 
Os01g0871600AK103248GACACGTGTGF-beta receptor, type I/II extracellular region family protein. 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0950900AK101121CACGTGTCGProtein of unknown function DUF221 domain containing protein. 
J023036H24CACGTGTCGNONE 
J023084G23CACGTGTCGNONE 
J033025J04CACGTGTCGNONE 
J033139J18CACGTGTCGNONE 
J090006A09CACGTGTCGNONE 
J090036D02CACGTGTCGNONE 
Os01g0956200006-108-G08CACGTGTCACTNONE 
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein. 
AK106051CACGTGTCACTNONE 
J013149N20CACGTGTCACTNONE 
J023085G19CACGTGTCACTNONE 
J033070C20CACGTGTCACTNONE 
J065080C11CACGTGTCACTNONE 
J090038M06CACGTGTCACTNONE 
J100038I20CACGTGTCACTNONE 
J100039D17CACGTGTCACTNONE 
Os01g0957600AK059235CGACACGTGSimilar to Elicitor-inducible cytochrome P450. 
Os02g0115900AF006825CCACGTGTCGNONE 
AK065743CCACGTGTCGEndosperm lumenal binding protein. 
AK119653CCACGTGTCGNONE 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0120300006-078-G12GACACGTGNONE 
AK066100GACACGTGConserved hypothetical protein. 
J013059H10GACACGTGNONE 
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein. 
AK069843GACACGTGGGGGConserved hypothetical protein. 
J023034H09GACACGTGGGGNONE 
J023034H09GACACGTGGGGGNONE 
J033090D08GACACGTGGGGNONE 
J033090D08GACACGTGGGGGNONE 
J100025N07GACACGTGGGGNONE 
J100025N07GACACGTGGGGGNONE 
J100075G18GACACGTGGGGNONE 
J100075G18GACACGTGGGGGNONE 
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein. 
AK100570CCCCCACGTGTCDNA polymerase V family protein. 
Os02g0148500AK068931GACACGTGSimilar to TIMING OF CAB 1 (Fragment). 
Os02g0148600AK059287GACACGTGTGGCConserved hypothetical protein. 
Os02g0176300AK066588GGACACGTGTCConserved hypothetical protein. 
J013072N24GGACACGTGTCNONE 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0193500009-092-G09GACACGTGNONE 
AK101237GACACGTGHypothetical protein. 
J033031K13GACACGTGNONE 
J033034P12GACACGTGNONE 
J080304L19GACACGTGNONE 
J100059N21GACACGTGNONE 
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0250600J075143F23CACGTGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0301800AK067818GACACGTGGNONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0453300006-099-D03GGCCGTCCACGTGTCCNONE 
009-120-D02GGCCGTCCACGTGTCCNONE 
AK071220GGCCGTCCACGTGTCCNONE 
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein. 
J023083M17GGCCGTCCACGTGTCCNONE 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0602300AK065609GGACACGTGNONE 
AK066929GGACACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GGACACGTGNONE 
J090040I23GGACACGTGNONE 
Os02g0649300014-043-A05GCCACGTGTCGNONE 
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0703800AK120025CACGTGTCConserved hypothetical protein. 
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein. 
J023031J12GGACACGTGGCGNONE 
J075195G22GGACACGTGGCGNONE 
J100088O11GGACACGTGGCGNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0733900AK111335GGACACGTGConserved hypothetical protein. 
J065092J17GGACACGTGNONE 
J065140P16GGACACGTGNONE 
J065191N21GGACACGTGNONE 
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1. 
AK102767GGCCCCACGTGTCNONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein. 
J023132N16CCCACCACGTGTCACTNONE 
J033069F17CCCACCACGTGTCACTNONE 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0817500AK072707GACACGTGKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135GACACGTGNONE 
U46758GACACGTGNONE 
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein. 
AK121390GCCACGTGTCCConserved hypothetical protein. 
J023128P21CGCCACGTGTCCNONE 
J023128P21GCCACGTGTCCNONE 
J053097O16CGCCACGTGTCCNONE 
J053097O16GCCACGTGTCCNONE 
J065012I02CGCCACGTGTCCNONE 
J065012I02GCCACGTGTCCNONE 
J065049C06CGCCACGTGTCCNONE 
J065049C06GCCACGTGTCCNONE 
J065051H02CGCCACGTGTCCNONE 
J065051H02GCCACGTGTCCNONE 
J065069A13CGCCACGTGTCCNONE 
J065069A13GCCACGTGTCCNONE 
J065082E04CGCCACGTGTCCNONE 
J065082E04GCCACGTGTCCNONE 
J065102N09CGCCACGTGTCCNONE 
J065102N09GCCACGTGTCCNONE 
J065157O10CGCCACGTGTCCNONE 
J065157O10GCCACGTGTCCNONE 
J065188N23CGCCACGTGTCCNONE 
J065188N23GCCACGTGTCCNONE 
J065190J11CGCCACGTGTCCNONE 
J065190J11GCCACGTGTCCNONE 
J065202M09CGCCACGTGTCCNONE 
J065202M09GCCACGTGTCCNONE 
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin. 
AK111296GGACACGTGGCGSimilar to Remorin. 
J065048M11GGACACGTGGCNONE 
J065048M11GGACACGTGGCGNONE 
J065081F01GGACACGTGGCNONE 
J065081F01GGACACGTGGCGNONE 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0106000011-049-C02CCACGTGTCNONE 
AK063343CCACGTGTCProtein of unknown function UPF0187 family protein. 
J065001I04CCACGTGTCNONE 
J065021G09CCACGTGTCNONE 
J065021I09CCACGTGTCNONE 
J100035C20CCACGTGTCNONE 
Os03g0116800012-097-D10GACACGTGGCNONE 
016-024-H10GACACGTGGCNONE 
AK066955GACACGTGGCConserved hypothetical protein. 
AK068678GACACGTGGCNONE 
AK104839GACACGTGGCNONE 
J013033G16GACACGTGGCNONE 
J013091C10GACACGTGGCNONE 
J013158H22GACACGTGGCNONE 
J023106K11GACACGTGGCNONE 
J065051O15GACACGTGGCNONE 
J065129G22GACACGTGGCNONE 
J075001K02GACACGTGGCNONE 
J075011O03GACACGTGGCNONE 
J075024K04GACACGTGGCNONE 
J075026E07GACACGTGGCNONE 
J075037O14GACACGTGGCNONE 
J075071D17GACACGTGGCNONE 
J075084M05GACACGTGGCNONE 
J075114B06GACACGTGGCNONE 
J075128C23GACACGTGGCNONE 
J075153A13GACACGTGGCNONE 
J075158A15GACACGTGGCNONE 
J075165P09GACACGTGGCNONE 
J075167M21GACACGTGGCNONE 
J075170F11GACACGTGGCNONE 
J075186F12GACACGTGGCNONE 
J075186L13GACACGTGGCNONE 
J075189A01GACACGTGGCNONE 
J075192D19GACACGTGGCNONE 
Os03g0122200009-052-H10CACGTGTCCGGCCCNONE 
AB042934CACGTGTCCGGCCCNONE 
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11. 
J013001H03CACGTGTCCGGCCCNONE 
J023149C23CACGTGTCCGGCCCNONE 
J065025J15CACGTGTCCGGCCCNONE 
J065093D22CACGTGTCCGGCCCNONE 
Os03g0154300J065112A07CCACGTGTCConserved hypothetical protein. 
J065192P15CCACGTGTCNONE 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0178400AK108257CACGTGTCEpoxide hydrolase family protein. 
Os03g0214200AK100623CACGTGTCGProtein of unknown function DUF1675 family protein. 
AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein. 
J075053B18CACGTGTCGNONE 
J075053B18CGACACGTGTCGCGCGCNONE 
Os03g0217900AK119980CGACACGTGConserved hypothetical protein. 
J053089K18CGACACGTGNONE 
J090058B20CGACACGTGNONE 
J090081L09CGACACGTGNONE 
Os03g0232101J075061A11GACACGTGHypothetical protein. 
J075166F13GACACGTGNONE 
Os03g0272300AK060183GCCACGTGTCNONE 
AK071865GCCACGTGTCZinc finger, RING-type domain containing protein. 
Os03g0298300AK061180CCACGTGTCCProtein of unknown function DUF588 family protein. 
AK099089CCACGTGTCCNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0322500009-014-F03GGACACGTGGCNONE 
009-076-G10GGACACGTGGCNONE 
009-100-C01GGACACGTGGCNONE 
009-106-F02GGACACGTGGCNONE 
009-123-H11GGACACGTGGCNONE 
009-158-C09GGACACGTGGCNONE 
009-172-D04GGACACGTGGCNONE 
009-179-C11GGACACGTGGCNONE 
009-188-B12GGACACGTGGCNONE 
009-194-D07GGACACGTGGCNONE 
AK103503GGACACGTGGCNONE 
AK121029GGACACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
J013066O21GGACACGTGGCNONE 
J023050G22GGACACGTGGCNONE 
J023103H15GGACACGTGGCNONE 
J033075B11GGACACGTGGCNONE 
J033091E24GGACACGTGGCNONE 
J033098N14GGACACGTGGCNONE 
J053089B02GGACACGTGGCNONE 
J065039M05GGACACGTGGCNONE 
J065210G05GGACACGTGGCNONE 
J090036P06GGACACGTGGCNONE 
J090040M04GGACACGTGGCNONE 
Os03g0340500012-007-F10GGCCCCACGTGTCAGTGNONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
Os03g0576900AK064861CACGTGTCCNONE 
J013000I01CACGTGTCCNONE 
J013169P21CACGTGTCCNONE 
J023001P03CACGTGTCCNONE 
J023009M10CACGTGTCCNONE 
J023025G11CACGTGTCCNONE 
J033046B19CACGTGTCCNONE 
J033149I10CACGTGTCCNONE 
J090081C04CACGTGTCCNONE 
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein. 
J033052N01CCCACGTGTCAGTGNONE 
Os03g0598200AK068322CACGTGTCNop14-like protein family protein. 
Os03g0606200009-030-E09GACACGTGGNONE 
009-076-H10GACACGTGGNONE 
009-122-H12GACACGTGGNONE 
009-153-F09GACACGTGGNONE 
AB055076GACACGTGGMitochondrial ATP synthase 6 KD subunit. 
AK072384GACACGTGGNONE 
AK107928GACACGTGGNONE 
J023078E13GACACGTGGNONE 
J053031N01GACACGTGGNONE 
J053046K19GACACGTGGNONE 
J053062P07GACACGTGGNONE 
J053091C23GACACGTGGNONE 
J053099N19GACACGTGGNONE 
J065005E06GACACGTGGNONE 
J065030N03GACACGTGGNONE 
J065138O21GACACGTGGNONE 
J065159K03GACACGTGGNONE 
J075030M08GACACGTGGNONE 
J080006E23GACACGTGGNONE 
J080010D10GACACGTGGNONE 
J080016N17GACACGTGGNONE 
J080024N09GACACGTGGNONE 
J080028E23GACACGTGGNONE 
J080035I11GACACGTGGNONE 
J080038D15GACACGTGGNONE 
J080040H08GACACGTGGNONE 
J080043L04GACACGTGGNONE 
J080047C06GACACGTGGNONE 
J080061G04GACACGTGGNONE 
J080066E10GACACGTGGNONE 
J080067P03GACACGTGGNONE 
J080082D07GACACGTGGNONE 
J080089M13GACACGTGGNONE 
J080094O09GACACGTGGNONE 
J080095C24GACACGTGGNONE 
J080309E21GACACGTGGNONE 
J090016G15GACACGTGGNONE 
J090031C20GACACGTGGNONE 
J090033A15GACACGTGGNONE 
J090037L07GACACGTGGNONE 
J090038I10GACACGTGGNONE 
J090072P19GACACGTGGNONE 
J100040J02GACACGTGGNONE 
J100047N05GACACGTGGNONE 
J100048M10GACACGTGGNONE 
J100076C02GACACGTGGNONE 
J100077G23GACACGTGGNONE 
J100080O08GACACGTGGNONE 
J100085C06GACACGTGGNONE 
J100085F16GACACGTGGNONE 
Os03g0623100014-072-D06GACACGTGNONE 
014-072-G11GACACGTGNONE 
AK063716GACACGTGConserved hypothetical protein. 
J065136O20GACACGTGNONE 
J075030G11GACACGTGNONE 
J075034O21GACACGTGNONE 
J075051D07GACACGTGNONE 
J075066M05GACACGTGNONE 
J075095G15GACACGTGNONE 
Os03g0648300AK067192GGACACGTGIQ calmodulin-binding region domain containing protein. 
J013098A04GGACACGTGNONE 
J075149P13GGACACGTGNONE 
J100044P16GGACACGTGNONE 
J100053G19GGACACGTGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0694000006-079-C12CACGTGTCCNONE 
AK059872CACGTGTCCSimilar to Oxalate oxidase 1 (EC 1.2.3.4) (Germin). 
J043027B01CACGTGTCCNONE 
J065071N13CACGTGTCCNONE 
J065159E22CACGTGTCCNONE 
Os03g0704200AK071176GACACGTGGGZinc finger, MYND-type domain containing protein. 
J023083O08GACACGTGGGNONE 
Os03g0747500AK108009CCACGTGTCCSeed maturation protein domain containing protein. 
AK108009GACACGTGSeed maturation protein domain containing protein. 
Os03g0767800004-017-A08CCACGTGTCCNONE 
006-025-G11CCACGTGTCCNONE 
006-088-G04CCACGTGTCCNONE 
009-055-C02CCACGTGTCCNONE 
AF283006CCACGTGTCCNONE 
AK060000CCACGTGTCCNONE 
AK060906CCACGTGTCCNONE 
AK066036CCACGTGTCCCold acclimation WCOR413 family protein. 
J023026I12CCACGTGTCCNONE 
J023049J16CCACGTGTCCNONE 
J033037M10CCACGTGTCCNONE 
J033057D13CCACGTGTCCNONE 
J033105H16CCACGTGTCCNONE 
J033119G10CCACGTGTCCNONE 
J065023C15CCACGTGTCCNONE 
J065080D13CCACGTGTCCNONE 
J080003C23CCACGTGTCCNONE 
J080003P09CCACGTGTCCNONE 
J080004K04CCACGTGTCCNONE 
J080010M14CCACGTGTCCNONE 
J080011J21CCACGTGTCCNONE 
J080013J01CCACGTGTCCNONE 
J080015A16CCACGTGTCCNONE 
J080021F07CCACGTGTCCNONE 
J080023F18CCACGTGTCCNONE 
J080034D18CCACGTGTCCNONE 
J080034O19CCACGTGTCCNONE 
J080038J08CCACGTGTCCNONE 
J080039N10CCACGTGTCCNONE 
J080042P09CCACGTGTCCNONE 
J080043E10CCACGTGTCCNONE 
J080051M02CCACGTGTCCNONE 
J080051O17CCACGTGTCCNONE 
J080053B01CCACGTGTCCNONE 
J080056N01CCACGTGTCCNONE 
J080058J20CCACGTGTCCNONE 
J080061B11CCACGTGTCCNONE 
J080064B15CCACGTGTCCNONE 
J080064O18CCACGTGTCCNONE 
J080071A15CCACGTGTCCNONE 
J080071C13CCACGTGTCCNONE 
J080071F14CCACGTGTCCNONE 
J080071M21CCACGTGTCCNONE 
J080072A10CCACGTGTCCNONE 
J080075J05CCACGTGTCCNONE 
J080076A05CCACGTGTCCNONE 
J080078F05CCACGTGTCCNONE 
J080078K01CCACGTGTCCNONE 
J080081F11CCACGTGTCCNONE 
J080081K15CCACGTGTCCNONE 
J080084K03CCACGTGTCCNONE 
J080089F18CCACGTGTCCNONE 
J080095A21CCACGTGTCCNONE 
J100022L11CCACGTGTCCNONE 
J100029I01CCACGTGTCCNONE 
J100032I15CCACGTGTCCNONE 
J100062N24CCACGTGTCCNONE 
J100067E13CCACGTGTCCNONE 
J100075G02CCACGTGTCCNONE 
J100080L14CCACGTGTCCNONE 
Os03g0796000AK064912GACACGTGGSimilar to Ripening-associated protein (Fragment). 
AK106661GACACGTGGNONE 
J013000M11GACACGTGGNONE 
Os03g0799300AK108023GACACGTGConserved hypothetical protein. 
J065161F04GACACGTGNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0815900013-097-G08CGACACGTGGCGNONE 
AK065258CGACACGTGGCGNONE 
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase. 
J013002J17CGACACGTGGCGNONE 
J013074A12CGACACGTGGCGNONE 
J023045C17CGACACGTGGCGNONE 
J033050E21CGACACGTGGCGNONE 
J053094P05CGACACGTGGCGNONE 
J090038F11CGACACGTGGCGNONE 
J090072J01CGACACGTGGCGNONE 
J100026H07CGACACGTGGCGNONE 
J100040O06CGACACGTGGCGNONE 
J100083D07CGACACGTGGCGNONE 
Os03g0835600AK101677CGACACGTGGAcyl-coA-binding protein, ACBP family protein. 
Os03g0837300AK111243GCCACGTGTCGNONE 
AK121140GCCACGTGTCGNicotinate phosphoribosyltransferase and related family protein. 
AY214337GCCACGTGTCGNONE 
J023077G12GCCACGTGTCGNONE 
J023078M10GCCACGTGTCGNONE 
J033031B10GCCACGTGTCGNONE 
J033067L18GCCACGTGTCGNONE 
J043005P09GCCACGTGTCGNONE 
J090013J15GCCACGTGTCGNONE 
J090042E10GCCACGTGTCGNONE 
J090045A20GCCACGTGTCGNONE 
J100022H02GCCACGTGTCGNONE 
Os03g0842700AK065755GACACGTGTTGGTGGNONE 
AK067436GACACGTGTTGGTGGNONE 
AK070821GACACGTGTTGGTGGVacuolar sorting protein 9 domain containing protein. 
J013036A18GACACGTGTTGGTGGNONE 
J013059F17GACACGTGTTGGTGGNONE 
J023043H05GACACGTGTTGGTGGNONE 
J023063L20GACACGTGTTGGTGGNONE 
J043020E01GACACGTGTTGGTGGNONE 
J065007C01GACACGTGTTGGTGGNONE 
J065023K08GACACGTGTTGGTGGNONE 
J065046H23GACACGTGTTGGTGGNONE 
J065080F24GACACGTGTTGGTGGNONE 
J065091L10GACACGTGTTGGTGGNONE 
J065102K05GACACGTGTTGGTGGNONE 
J065106E22GACACGTGTTGGTGGNONE 
J065128C20GACACGTGTTGGTGGNONE 
J065189O17GACACGTGTTGGTGGNONE 
J065219D10GACACGTGTTGGTGGNONE 
J075064C10GACACGTGTTGGTGGNONE 
J075098I17GACACGTGTTGGTGGNONE 
J075101I04GACACGTGTTGGTGGNONE 
J075153O11GACACGTGTTGGTGGNONE 
J075197E10GACACGTGTTGGTGGNONE 
J090011C21GACACGTGTTGGTGGNONE 
Os04g0244800009-066-G06GCCCACGTGTCNONE 
011-024-D02GCCCACGTGTCNONE 
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein. 
J023095P14GCCCACGTGTCNONE 
J023150J09GCCCACGTGTCNONE 
J053097G24GCCCACGTGTCNONE 
J065001K24GCCCACGTGTCNONE 
J065009O13GCCCACGTGTCNONE 
J065076M12GCCCACGTGTCNONE 
J065081I15GCCCACGTGTCNONE 
J065105E10GCCCACGTGTCNONE 
J065106G04GCCCACGTGTCNONE 
J065123I12GCCCACGTGTCNONE 
J065137H16GCCCACGTGTCNONE 
J065151I11GCCCACGTGTCNONE 
J065164H06GCCCACGTGTCNONE 
J065173J07GCCCACGTGTCNONE 
J065196F02GCCCACGTGTCNONE 
J065198I17GCCCACGTGTCNONE 
J065206I11GCCCACGTGTCNONE 
J065216J02GCCCACGTGTCNONE 
J075076D10GCCCACGTGTCNONE 
J075098F06GCCCACGTGTCNONE 
J075115A20GCCCACGTGTCNONE 
J075184H05GCCCACGTGTCNONE 
J075193E17GCCCACGTGTCNONE 
J090014L09GCCCACGTGTCNONE 
J090015H16GCCCACGTGTCNONE 
J090024M04GCCCACGTGTCNONE 
J090062K08GCCCACGTGTCNONE 
J090082I08GCCCACGTGTCNONE 
Os04g0266900011-064-A07CACGTGTCACTNONE 
AK069447CACGTGTCACTBacterial transketolase family protein. 
J023019B19CACGTGTCACTNONE 
Os04g0321700003-103-G02GACACGTGNONE 
AK068732GACACGTGSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397GACACGTGNONE 
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein. 
AK107261GGACACGTGGGlucose/ribitol dehydrogenase family protein. 
Os04g0503500AK099404CGACACGTGGLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGACACGTGGNONE 
Os04g0527900AK108116GCCACACGTGTCCSimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09GCCACACGTGTCCNONE 
J075023I21GCCACACGTGTCCNONE 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0552400AK069623CACGTGTCACTSimilar to ZPT2-13. 
J023023M18CACGTGTCACTNONE 
J023063H11CACGTGTCACTNONE 
Os04g0591300009-006-D05CGCCACGTGTCNONE 
AK105120CGCCACGTGTCConserved hypothetical protein. 
Os04g0602800AK100925GACACGTGGGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0616900013-094-A06CCCACGTGTCNONE 
013-099-B07CCCACGTGTCNONE 
015-083-G11CCCACGTGTCNONE 
AK066343CCCACGTGTCConserved hypothetical protein. 
AK104906CCCACGTGTCNONE 
J013066L21CCCACGTGTCNONE 
J023091I07CCCACGTGTCNONE 
J065056B15CCCACGTGTCNONE 
J065148E09CCCACGTGTCNONE 
J065162P19CCCACGTGTCNONE 
J065185N03CCCACGTGTCNONE 
J065198D13CCCACGTGTCNONE 
J090055O20CCCACGTGTCNONE 
J090067F24CCCACGTGTCNONE 
Os04g0617050J065197A20CGACACGTGNONE 
J090067K01CGACACGTGAuxin responsive SAUR protein family protein. 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0643200J013068H06GGACACGTGTCCNONE 
J013153F13GGACACGTGTCCNONE 
J013155G22GGACACGTGTCCNONE 
J013155P06GGACACGTGTCCNONE 
J033138C11GGACACGTGTCCNONE 
J065194O13GGACACGTGTCCNONE 
J075018G07GGACACGTGTCCNONE 
Os04g0652900AK071125GCCACGTGTCGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GCCACGTGTCGNONE 
J075142E01GCCACGTGTCGNONE 
Os04g0674350J065104O14CACGTGTCGNONE 
J065118J19CACGTGTCGNONE 
J065167I12CACGTGTCGHypothetical protein. 
Os04g0674400015-042-B08CGACACGTGNONE 
AK102124CGACACGTGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22CGACACGTGNONE 
J023022I24CGACACGTGNONE 
J023120A15CGACACGTGNONE 
J023123P20CGACACGTGNONE 
J033068P09CGACACGTGNONE 
J033107G22CGACACGTGNONE 
J033116G12CGACACGTGNONE 
J033133F03CGACACGTGNONE 
J033143B20CGACACGTGNONE 
J043006G12CGACACGTGNONE 
J043027M18CGACACGTGNONE 
J043034H17CGACACGTGNONE 
J090091E20CGACACGTGNONE 
J100035H09CGACACGTGNONE 
J100037J04CGACACGTGNONE 
J100047J24CGACACGTGNONE 
J100059G06CGACACGTGNONE 
J100066O12CGACACGTGNONE 
J100074G23CGACACGTGNONE 
J100077M12CGACACGTGNONE 
Os04g0687900009-068-D03CCACTGACACGTGGGNONE 
015-097-H12CCACTGACACGTGGGNONE 
AK062547CCACTGACACGTGGGNONE 
AK066910CCACTGACACGTGGGNONE 
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333CCACTGACACGTGGGNONE 
J013023N16CCACTGACACGTGGGNONE 
J013031I07CCACTGACACGTGGGNONE 
J013063L06CCACTGACACGTGGGNONE 
J013091C11CCACTGACACGTGGGNONE 
J013123M06CCACTGACACGTGGGNONE 
J013126D14CCACTGACACGTGGGNONE 
J023023E09CCACTGACACGTGGGNONE 
J023039C19CCACTGACACGTGGGNONE 
J023068D23CCACTGACACGTGGGNONE 
J023080C21CCACTGACACGTGGGNONE 
J033092J17CCACTGACACGTGGGNONE 
J033112P12CCACTGACACGTGGGNONE 
J033135O08CCACTGACACGTGGGNONE 
J053023C13CCACTGACACGTGGGNONE 
J065030O05CCACTGACACGTGGGNONE 
J065065P07CCACTGACACGTGGGNONE 
J065190O06CCACTGACACGTGGGNONE 
J090011M19CCACTGACACGTGGGNONE 
J090061F08CCACTGACACGTGGGNONE 
J090064H09CCACTGACACGTGGGNONE 
J090064P11CCACTGACACGTGGGNONE 
Os05g0134200AK067074CGCCACGTGTCCSimilar to Protein phosphatase-2C. 
Os05g0151200J065041L18CACGTGTCCTspO/MBR-related protein family protein. 
J065041L18CGACACGTGTspO/MBR-related protein family protein. 
J065168L08CACGTGTCCNONE 
J065168L08CGACACGTGNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0171900012-005-F08CCCACGTGTCNONE 
012-048-G09CCCACGTGTCNONE 
013-046-A07CCCACGTGTCNONE 
013-050-D10CCCACGTGTCNONE 
014-003-G04CCCACGTGTCNONE 
014-008-G10CCCACGTGTCNONE 
014-011-E07CCCACGTGTCNONE 
014-011-F11CCCACGTGTCNONE 
014-019-C02CCCACGTGTCNONE 
014-037-G03CCCACGTGTCNONE 
014-043-G06CCCACGTGTCNONE 
014-045-A05CCCACGTGTCNONE 
014-047-C07CCCACGTGTCNONE 
014-052-F03CCCACGTGTCNONE 
014-088-G07CCCACGTGTCNONE 
014-090-B11CCCACGTGTCNONE 
015-010-A06CCCACGTGTCNONE 
015-013-B11CCCACGTGTCNONE 
015-026-A04CCCACGTGTCNONE 
015-041-G01CCCACGTGTCNONE 
015-046-D06CCCACGTGTCNONE 
015-050-B07CCCACGTGTCNONE 
015-053-C03CCCACGTGTCNONE 
015-056-C04CCCACGTGTCNONE 
015-057-B04CCCACGTGTCNONE 
015-075-C12CCCACGTGTCNONE 
015-079-F04CCCACGTGTCNONE 
016-025-F02CCCACGTGTCNONE 
016-030-B10CCCACGTGTCNONE 
016-034-B03CCCACGTGTCNONE 
016-034-E04CCCACGTGTCNONE 
016-035-B07CCCACGTGTCNONE 
016-035-D10CCCACGTGTCNONE 
016-039-C06CCCACGTGTCNONE 
016-042-D01CCCACGTGTCNONE 
016-043-C02CCCACGTGTCNONE 
016-044-B01CCCACGTGTCNONE 
016-045-G06CCCACGTGTCNONE 
016-049-G07CCCACGTGTCNONE 
016-052-C10CCCACGTGTCNONE 
016-070-D03CCCACGTGTCNONE 
016-077-H10CCCACGTGTCNONE 
016-082-F02CCCACGTGTCNONE 
016-087-D04CCCACGTGTCNONE 
016-093-B05CCCACGTGTCNONE 
016-093-F06CCCACGTGTCNONE 
AK069814CCCACGTGTCGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
AK106348CCCACGTGTCNONE 
AK119584CCCACGTGTCNONE 
AK119669CCCACGTGTCNONE 
J013074J12CCCACGTGTCNONE 
J023031G07CCCACGTGTCNONE 
J023072P16CCCACGTGTCNONE 
J023105N07CCCACGTGTCNONE 
J053023E11CCCACGTGTCNONE 
J053025H06CCCACGTGTCNONE 
J053029G08CCCACGTGTCNONE 
J053051L10CCCACGTGTCNONE 
J065011P09CCCACGTGTCNONE 
J065022O05CCCACGTGTCNONE 
J065071D04CCCACGTGTCNONE 
J065100B07CCCACGTGTCNONE 
J065104O10CCCACGTGTCNONE 
J065154H19CCCACGTGTCNONE 
J065183D19CCCACGTGTCNONE 
J065185I07CCCACGTGTCNONE 
J065205O17CCCACGTGTCNONE 
J075022N11CCCACGTGTCNONE 
J100033M17CCCACGTGTCNONE 
Os05g0176700009-076-A09CGCCACGTGTCCNONE 
009-147-H06CGCCACGTGTCCNONE 
009-161-C02CGCCACGTGTCCNONE 
AK071729CGCCACGTGTCCConserved hypothetical protein. 
J023110H11CGCCACGTGTCCNONE 
J075092I23CGCCACGTGTCCNONE 
J100038P12CGCCACGTGTCCNONE 
J100039J21CGCCACGTGTCCNONE 
J100039M13CGCCACGTGTCCNONE 
J100084A22CGCCACGTGTCCNONE 
Os05g0188100009-011-G07AGTGACACGTGGCNONE 
009-015-G06AGTGACACGTGGCNONE 
009-021-B03AGTGACACGTGGCNONE 
009-024-A09AGTGACACGTGGCNONE 
009-025-A03AGTGACACGTGGCNONE 
009-028-G03AGTGACACGTGGCNONE 
009-029-G10AGTGACACGTGGCNONE 
009-034-G12AGTGACACGTGGCNONE 
009-039-D05AGTGACACGTGGCNONE 
009-055-F08AGTGACACGTGGCNONE 
009-064-B05AGTGACACGTGGCNONE 
009-066-H12AGTGACACGTGGCNONE 
009-077-B10AGTGACACGTGGCNONE 
009-102-B06AGTGACACGTGGCNONE 
009-113-F04AGTGACACGTGGCNONE 
009-114-F04AGTGACACGTGGCConserved hypothetical protein. 
009-131-G06AGTGACACGTGGCNONE 
009-137-H11AGTGACACGTGGCNONE 
009-172-H10AGTGACACGTGGCNONE 
009-176-D08AGTGACACGTGGCNONE 
009-182-A01AGTGACACGTGGCNONE 
009-183-A04AGTGACACGTGGCNONE 
009-183-G03AGTGACACGTGGCNONE 
009-185-B10AGTGACACGTGGCNONE 
009-192-F10AGTGACACGTGGCNONE 
009-196-G01AGTGACACGTGGCNONE 
011-005-A09AGTGACACGTGGCNONE 
013-031-B12AGTGACACGTGGCNONE 
013-031-F12AGTGACACGTGGCNONE 
013-032-A08AGTGACACGTGGCNONE 
013-069-H06AGTGACACGTGGCNONE 
013-089-C10AGTGACACGTGGCNONE 
J065123I11AGTGACACGTGGCNONE 
J065124F15AGTGACACGTGGCNONE 
J065155D05AGTGACACGTGGCNONE 
J065181J22AGTGACACGTGGCNONE 
J065185B07AGTGACACGTGGCNONE 
J065186J11AGTGACACGTGGCNONE 
J075183H21AGTGACACGTGGCNONE 
J080003P06AGTGACACGTGGCNONE 
J080068G17AGTGACACGTGGCNONE 
J080069J05AGTGACACGTGGCNONE 
J080080D03AGTGACACGTGGCNONE 
J080080K22AGTGACACGTGGCNONE 
J080090D12AGTGACACGTGGCNONE 
J080092I03AGTGACACGTGGCNONE 
J100039B06AGTGACACGTGGCNONE 
J100047N15AGTGACACGTGGCNONE 
Os05g0195200015-031-H09CCACGTGTCCNONE 
015-031-H09GCCCCCACGTGTCNONE 
015-070-C11CCACGTGTCCNONE 
015-070-C11GCCCCCACGTGTCNONE 
016-063-C11CCACGTGTCCNONE 
016-063-C11GCCCCCACGTGTCNONE 
AK106392CCACGTGTCCZinc finger, CCCH-type domain containing protein. 
AK106392GCCCCCACGTGTCZinc finger, CCCH-type domain containing protein. 
J033051N05CCACGTGTCCNONE 
J033051N05GCCCCCACGTGTCNONE 
J065118P05CCACGTGTCCNONE 
J065118P05GCCCCCACGTGTCNONE 
J100071H15CCACGTGTCCNONE 
J100071H15GCCCCCACGTGTCNONE 
J100078J22CCACGTGTCCNONE 
J100078J22GCCCCCACGTGTCNONE 
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE 
AK064069CCACTGACACGTGGACCNONE 
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein. 
J065038M01CCACTGACACGTGGACCNONE 
J065121C16CCACTGACACGTGGACCNONE 
J075173E09CCACTGACACGTGGACCNONE 
J080307A20CCACTGACACGTGGACCNONE 
J090046B19CCACTGACACGTGGACCNONE 
J100033N12CCACTGACACGTGGACCNONE 
J100036G01CCACTGACACGTGGACCNONE 
J100057B19CCACTGACACGTGGACCNONE 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
Os05g0373300Os05g0373300GACACGTGGGGCCSimilar to BONZAI1. 
Os05g0381400014-036-H12CCCATCCACCCACACGTGTCNONE 
014-036-H12CGACACGTGNONE 
014-085-H12CCCATCCACCCACACGTGTCNONE 
014-085-H12CGACACGTGNONE 
AK102039CCCATCCACCCACACGTGTCSimilar to ABA induced plasma membrane protein PM 19. 
AK102039CGACACGTGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CCCATCCACCCACACGTGTCNONE 
J075011E17CGACACGTGNONE 
J075057P04CCCATCCACCCACACGTGTCNONE 
J075057P04CGACACGTGNONE 
J075066K19CCCATCCACCCACACGTGTCNONE 
J075066K19CGACACGTGNONE 
J075068L13CCCATCCACCCACACGTGTCNONE 
J075068L13CGACACGTGNONE 
J075074J21CCCATCCACCCACACGTGTCNONE 
J075074J21CGACACGTGNONE 
J075076N10CCCATCCACCCACACGTGTCNONE 
J075076N10CGACACGTGNONE 
J075078L14CCCATCCACCCACACGTGTCNONE 
J075078L14CGACACGTGNONE 
J075099O16CCCATCCACCCACACGTGTCNONE 
J075099O16CGACACGTGNONE 
J075120C05CCCATCCACCCACACGTGTCNONE 
J075120C05CGACACGTGNONE 
J075140I24CCCATCCACCCACACGTGTCNONE 
J075140I24CGACACGTGNONE 
J075148F21CCCATCCACCCACACGTGTCNONE 
J075148F21CGACACGTGNONE 
J075151F01CCCATCCACCCACACGTGTCNONE 
J075151F01CGACACGTGNONE 
J075151I10CCCATCCACCCACACGTGTCNONE 
J075151I10CGACACGTGNONE 
J075156M15CCCATCCACCCACACGTGTCNONE 
J075156M15CGACACGTGNONE 
J075191F07CCCATCCACCCACACGTGTCNONE 
J075191F07CGACACGTGNONE 
J075192K20CCCATCCACCCACACGTGTCNONE 
J075192K20CGACACGTGNONE 
J075195M22CCCATCCACCCACACGTGTCNONE 
J075195M22CGACACGTGNONE 
Os05g0395300AK066212CCACGTGTCGProtein of unknown function DUF21 domain containing protein. 
Os05g0397700AK067298GCGCGCGACACGTGSecY protein family protein. 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0490200016-097-B03CGCCACGTGTCCNONE 
AK101147CGCCACGTGTCCProtein of unknown function DUF1692 domain containing protein. 
AK105601CGCCACGTGTCCNONE 
J033026P06CGCCACGTGTCCNONE 
Os05g0506000AF031609CGACACGTGACGCGACNONE 
AK062012CGACACGTGACGCGACNONE 
AK098900CGACACGTGACGCGACNONE 
AK122090CGACACGTGACGCGACSimilar to MS5-like protein (Fragment). 
J013002B13CGACACGTGACGCGACNONE 
J023149G13CGACACGTGACGCGACNONE 
J033123O20CGACACGTGACGCGACNONE 
J080315O17CGACACGTGACGCGACNONE 
Os05g0514300AK061747GGCCCCACGTGTCSimilar to Tubby-like protein 3. 
AK098851GGCCCCACGTGTCNONE 
Os05g0521700AK070182GCCACGTGTCConserved hypothetical protein. 
J013170O04GCCACGTGTCNONE 
J023045H17GCCACGTGTCNONE 
Os05g0549100AK072422CCCACGTGTCSimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0566800AK065748GGACACGTGGCold acclimation protein COR413-TM1. 
AY181210GGACACGTGGNONE 
Os05g0568600009-024-B09CGCCACGTGTCGNONE 
AK063781CGCCACGTGTCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCCACGTGTCGNONE 
J080062M08CGCCACGTGTCGNONE 
J080064I07CGCCACGTGTCGNONE 
J080068A12CGCCACGTGTCGNONE 
J080086J10CGCCACGTGTCGNONE 
Os05g0574900AK107256CACGTGTCCGRAS transcription factor domain containing protein. 
Os05g0576700013-062-H04CGACACGTGNONE 
AK063599CGACACGTGNONE 
AK108377CGACACGTGOleosin family protein. 
Os05g0586600AB096011CCACGTGTCACTPlastid sigma factor SIG5. 
AB096071CCACGTGTCACTNONE 
AK105697CCACGTGTCACTNONE 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os05g0596200009-059-G06GACACGTGAGCCGTTGGATNONE 
AK062521GACACGTGAGCCGTTGGATNONE 
AK107887GACACGTGAGCCGTTGGATConserved hypothetical protein. 
AK108209GACACGTGAGCCGTTGGATNONE 
J065154B01GACACGTGAGCCGTTGGATNONE 
Os06g0115300009-165-C05GGACACGTGTCCNONE 
AK058833GGACACGTGTCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09GGACACGTGTCCNONE 
J075002E09GGACACGTGTCCNONE 
J075015K23GGACACGTGTCCNONE 
J075043B06GGACACGTGTCCNONE 
J075057O21GGACACGTGTCCNONE 
J075085L21GGACACGTGTCCNONE 
J075134N20GGACACGTGTCCNONE 
J075155O22GGACACGTGTCCNONE 
J075198N22GGACACGTGTCCNONE 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0181500AK068950CGACACGTGNONE 
AK100878CGACACGTGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16CGACACGTGNONE 
Os06g0199300J065045H01GGCCCCACGTGTCCNONE 
J075177C22GGCCCCACGTGTCCNONE 
J080068H06GGCCCCACGTGTCCNONE 
J090048F01GGCCCCACGTGTCCNONE 
J100066F17GGCCCCACGTGTCCNONE 
Os06g0291600AK100261GACACGTGGCSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGCNONE 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGCNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0304500AK119441GACACGTGTCGCRS1/YhbY domain containing protein. 
J075143M24GACACGTGTCGNONE 
J075194D03GACACGTGTCGNONE 
Os06g0354700AK066777CGACACGTGEsterase/lipase/thioesterase domain containing protein. 
AK068937CGACACGTGNONE 
J013056F09CGACACGTGNONE 
J013065L21CGACACGTGNONE 
J013069H09CGACACGTGNONE 
J013070D15CGACACGTGNONE 
J013073L19CGACACGTGNONE 
J013075L23CGACACGTGNONE 
J013088D18CGACACGTGNONE 
J013095G23CGACACGTGNONE 
J013097K24CGACACGTGNONE 
J013106G04CGACACGTGNONE 
J013132J10CGACACGTGNONE 
J013135F08CGACACGTGNONE 
J013156B21CGACACGTGNONE 
J013159L05CGACACGTGNONE 
J013170J16CGACACGTGNONE 
J023007C08CGACACGTGNONE 
J023062F13CGACACGTGNONE 
J023085D05CGACACGTGNONE 
J033046C05CGACACGTGNONE 
J043015P17CGACACGTGNONE 
J090029M06CGACACGTGNONE 
J090035K04CGACACGTGNONE 
J090066H02CGACACGTGNONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os06g0688100AK063450CGCCACGTGTCNONE 
AK101144CGCCACGTGTCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE 
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein. 
Os06g0703400AK107025CACGTGTCCConserved hypothetical protein. 
Os06g0716700AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CGCCACGTGTCCGGCCCNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE 
AK065121GACACGTGAAGGCCCATGGNONE 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GACACGTGAAGGCCCATGGNONE 
AY302112GACACGTGAAGGCCCATGGNONE 
D10752GACACGTGAAGGCCCATGGNONE 
D11082GACACGTGAAGGCCCATGGNONE 
J013031L12GACACGTGAAGGCCCATGGNONE 
J013042M09GACACGTGAAGGCCCATGGNONE 
J013058E01GACACGTGAAGGCCCATGGNONE 
J013058O09GACACGTGAAGGCCCATGGNONE 
J013063J17GACACGTGAAGGCCCATGGNONE 
J013066I24GACACGTGAAGGCCCATGGNONE 
J013069F17GACACGTGAAGGCCCATGGNONE 
J013106E01GACACGTGAAGGCCCATGGNONE 
J013118D19GACACGTGAAGGCCCATGGNONE 
J013162M11GACACGTGAAGGCCCATGGNONE 
J023028B19GACACGTGAAGGCCCATGGNONE 
J023031A13GACACGTGAAGGCCCATGGNONE 
J023047H18GACACGTGAAGGCCCATGGNONE 
J023059N10GACACGTGAAGGCCCATGGNONE 
J023104N22GACACGTGAAGGCCCATGGNONE 
J033025J03GACACGTGAAGGCCCATGGNONE 
J033045B05GACACGTGAAGGCCCATGGNONE 
J033067M08GACACGTGAAGGCCCATGGNONE 
J033113D04GACACGTGAAGGCCCATGGNONE 
J043003D11GACACGTGAAGGCCCATGGNONE 
J043009O20GACACGTGAAGGCCCATGGNONE 
J043016P06GACACGTGAAGGCCCATGGNONE 
J043017C21GACACGTGAAGGCCCATGGNONE 
J043017J20GACACGTGAAGGCCCATGGNONE 
J043021P15GACACGTGAAGGCCCATGGNONE 
J043026I22GACACGTGAAGGCCCATGGNONE 
J043032L15GACACGTGAAGGCCCATGGNONE 
J043034G14GACACGTGAAGGCCCATGGNONE 
J043039L16GACACGTGAAGGCCCATGGNONE 
J075003D02GACACGTGAAGGCCCATGGNONE 
J075003O22GACACGTGAAGGCCCATGGNONE 
J075005I24GACACGTGAAGGCCCATGGNONE 
J075006N09GACACGTGAAGGCCCATGGNONE 
J075011A22GACACGTGAAGGCCCATGGNONE 
J075012K24GACACGTGAAGGCCCATGGNONE 
J075017D01GACACGTGAAGGCCCATGGNONE 
J075017I23GACACGTGAAGGCCCATGGNONE 
J075023D17GACACGTGAAGGCCCATGGNONE 
J075024B03GACACGTGAAGGCCCATGGNONE 
J075025H05GACACGTGAAGGCCCATGGNONE 
J075031D19GACACGTGAAGGCCCATGGNONE 
J075034B02GACACGTGAAGGCCCATGGNONE 
J075035C02GACACGTGAAGGCCCATGGNONE 
J075037J12GACACGTGAAGGCCCATGGNONE 
J075038M11GACACGTGAAGGCCCATGGNONE 
J075039J17GACACGTGAAGGCCCATGGNONE 
J075042P10GACACGTGAAGGCCCATGGNONE 
J075046J20GACACGTGAAGGCCCATGGNONE 
J075047F21GACACGTGAAGGCCCATGGNONE 
J075053E05GACACGTGAAGGCCCATGGNONE 
J075054D11GACACGTGAAGGCCCATGGNONE 
J075054K06GACACGTGAAGGCCCATGGNONE 
J075059E15GACACGTGAAGGCCCATGGNONE 
J075061O04GACACGTGAAGGCCCATGGNONE 
J075062I20GACACGTGAAGGCCCATGGNONE 
J075066I12GACACGTGAAGGCCCATGGNONE 
J075066L06GACACGTGAAGGCCCATGGNONE 
J075071H12GACACGTGAAGGCCCATGGNONE 
J075071N19GACACGTGAAGGCCCATGGNONE 
J075074K01GACACGTGAAGGCCCATGGNONE 
J075077H22GACACGTGAAGGCCCATGGNONE 
J075083H18GACACGTGAAGGCCCATGGNONE 
J075085F04GACACGTGAAGGCCCATGGNONE 
J075085K09GACACGTGAAGGCCCATGGNONE 
J075086C06GACACGTGAAGGCCCATGGNONE 
J075086E06GACACGTGAAGGCCCATGGNONE 
J075087A15GACACGTGAAGGCCCATGGNONE 
J075090N02GACACGTGAAGGCCCATGGNONE 
J075090N22GACACGTGAAGGCCCATGGNONE 
J075091C04GACACGTGAAGGCCCATGGNONE 
J075091G16GACACGTGAAGGCCCATGGNONE 
J075097E04GACACGTGAAGGCCCATGGNONE 
J075099E04GACACGTGAAGGCCCATGGNONE 
J075102P22GACACGTGAAGGCCCATGGNONE 
J075109B08GACACGTGAAGGCCCATGGNONE 
J075109J02GACACGTGAAGGCCCATGGNONE 
J075115I12GACACGTGAAGGCCCATGGNONE 
J075117E17GACACGTGAAGGCCCATGGNONE 
J075123C07GACACGTGAAGGCCCATGGNONE 
J075124N05GACACGTGAAGGCCCATGGNONE 
J075125E12GACACGTGAAGGCCCATGGNONE 
J075126B11GACACGTGAAGGCCCATGGNONE 
J075129E14GACACGTGAAGGCCCATGGNONE 
J075130N15GACACGTGAAGGCCCATGGNONE 
J075131I07GACACGTGAAGGCCCATGGNONE 
J075141B13GACACGTGAAGGCCCATGGNONE 
J075141B20GACACGTGAAGGCCCATGGNONE 
J075144D23GACACGTGAAGGCCCATGGNONE 
J075144N01GACACGTGAAGGCCCATGGNONE 
J075147M24GACACGTGAAGGCCCATGGNONE 
J075148L16GACACGTGAAGGCCCATGGNONE 
J075151A22GACACGTGAAGGCCCATGGNONE 
J075151D03GACACGTGAAGGCCCATGGNONE 
J075151D04GACACGTGAAGGCCCATGGNONE 
J075153E23GACACGTGAAGGCCCATGGNONE 
J075156D02GACACGTGAAGGCCCATGGNONE 
J075156P05GACACGTGAAGGCCCATGGNONE 
J075162E23GACACGTGAAGGCCCATGGNONE 
J075165J22GACACGTGAAGGCCCATGGNONE 
J075166A06GACACGTGAAGGCCCATGGNONE 
J075168H13GACACGTGAAGGCCCATGGNONE 
J075170D04GACACGTGAAGGCCCATGGNONE 
J075171C19GACACGTGAAGGCCCATGGNONE 
J075173B12GACACGTGAAGGCCCATGGNONE 
J075173M23GACACGTGAAGGCCCATGGNONE 
J075174C03GACACGTGAAGGCCCATGGNONE 
J075185O11GACACGTGAAGGCCCATGGNONE 
J075186G21GACACGTGAAGGCCCATGGNONE 
J075187D06GACACGTGAAGGCCCATGGNONE 
J075195G21GACACGTGAAGGCCCATGGNONE 
J090003D18GACACGTGAAGGCCCATGGNONE 
J090005I12GACACGTGAAGGCCCATGGNONE 
J090007D15GACACGTGAAGGCCCATGGNONE 
J090007G20GACACGTGAAGGCCCATGGNONE 
J090014G13GACACGTGAAGGCCCATGGNONE 
J090014L08GACACGTGAAGGCCCATGGNONE 
J090016J03GACACGTGAAGGCCCATGGNONE 
J090023P22GACACGTGAAGGCCCATGGNONE 
J090025C19GACACGTGAAGGCCCATGGNONE 
J090028F11GACACGTGAAGGCCCATGGNONE 
J090028G01GACACGTGAAGGCCCATGGNONE 
J090028H02GACACGTGAAGGCCCATGGNONE 
J090037I11GACACGTGAAGGCCCATGGNONE 
J090040F21GACACGTGAAGGCCCATGGNONE 
J090040N24GACACGTGAAGGCCCATGGNONE 
J090044M12GACACGTGAAGGCCCATGGNONE 
J090045B13GACACGTGAAGGCCCATGGNONE 
J090045M22GACACGTGAAGGCCCATGGNONE 
J090048C10GACACGTGAAGGCCCATGGNONE 
J090051J02GACACGTGAAGGCCCATGGNONE 
J090058O15GACACGTGAAGGCCCATGGNONE 
J090062F11GACACGTGAAGGCCCATGGNONE 
J090067D23GACACGTGAAGGCCCATGGNONE 
J090069G15GACACGTGAAGGCCCATGGNONE 
J090072I06GACACGTGAAGGCCCATGGNONE 
J090073H18GACACGTGAAGGCCCATGGNONE 
J090073L01GACACGTGAAGGCCCATGGNONE 
J090075O21GACACGTGAAGGCCCATGGNONE 
J090084K24GACACGTGAAGGCCCATGGNONE 
J090087P11GACACGTGAAGGCCCATGGNONE 
J090092B17GACACGTGAAGGCCCATGGNONE 
J100042H08GACACGTGAAGGCCCATGGNONE 
Os07g0102100AK066544GACACGTGGNONE 
AK099800GACACGTGGSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2. 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0209100AK120944GCCACGTGTCSimilar to Seed imbibition protein (Fragment). 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0459200AK066819CTCCCCCACGTGTCNONE 
AK102099CTCCCCCACGTGTCSimilar to Possible kinase. 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0509800Os07g0509800GACACGTGTCCSimilar to APS reductase (Fragment). 
Os07g0529600006-066-F05GACACGTGGNONE 
009-049-D10GACACGTGGNONE 
009-180-A06GACACGTGGNONE 
013-001-E04GACACGTGGNONE 
013-011-G03GACACGTGGNONE 
013-015-D04GACACGTGGNONE 
013-016-B02GACACGTGGNONE 
013-021-B11GACACGTGGNONE 
013-021-F07GACACGTGGNONE 
013-022-B02GACACGTGGNONE 
013-029-D10GACACGTGGNONE 
013-029-E04GACACGTGGNONE 
013-032-A07GACACGTGGNONE 
013-035-D07GACACGTGGNONE 
013-036-B03GACACGTGGNONE 
013-036-B10GACACGTGGNONE 
013-037-F08GACACGTGGNONE 
013-040-B02GACACGTGGNONE 
013-040-B10GACACGTGGNONE 
013-041-D07GACACGTGGNONE 
013-044-H10GACACGTGGNONE 
013-046-C06GACACGTGGNONE 
013-047-E03GACACGTGGNONE 
013-051-E06GACACGTGGNONE 
013-055-B07GACACGTGGNONE 
013-055-H04GACACGTGGNONE 
013-057-G06GACACGTGGNONE 
013-060-E04GACACGTGGNONE 
013-062-C07GACACGTGGNONE 
013-064-B11GACACGTGGNONE 
013-065-A09GACACGTGGNONE 
013-065-H03GACACGTGGNONE 
013-066-C07GACACGTGGNONE 
013-069-B03GACACGTGGNONE 
013-070-B08GACACGTGGNONE 
013-074-A03GACACGTGGNONE 
013-082-B08GACACGTGGNONE 
013-083-C10GACACGTGGNONE 
013-088-H12GACACGTGGNONE 
013-089-A10GACACGTGGNONE 
013-089-H06GACACGTGGNONE 
013-091-B09GACACGTGGNONE 
013-095-D09GACACGTGGNONE 
013-099-D03GACACGTGGNONE 
014-008-H04GACACGTGGNONE 
014-015-D12GACACGTGGNONE 
014-017-H12GACACGTGGNONE 
014-040-C05GACACGTGGNONE 
014-045-D07GACACGTGGNONE 
014-053-B03GACACGTGGNONE 
014-073-B05GACACGTGGNONE 
014-098-F10GACACGTGGNONE 
AB110170GACACGTGGNONE 
AK064916GACACGTGGNONE 
AK099918GACACGTGGSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GACACGTGGNONE 
J013039J16GACACGTGGNONE 
J013055B12GACACGTGGNONE 
J013059A13GACACGTGGNONE 
J013060H05GACACGTGGNONE 
J013067A05GACACGTGGNONE 
J013071H11GACACGTGGNONE 
J013075I24GACACGTGGNONE 
J013102B09GACACGTGGNONE 
J013123E11GACACGTGGNONE 
J013123I22GACACGTGGNONE 
J013123L17GACACGTGGNONE 
J013156A11GACACGTGGNONE 
J013158K17GACACGTGGNONE 
J013160E19GACACGTGGNONE 
J023022F22GACACGTGGNONE 
J023045D15GACACGTGGNONE 
J023063E21GACACGTGGNONE 
J023078H19GACACGTGGNONE 
J023107E18GACACGTGGNONE 
J023107O16GACACGTGGNONE 
J023108B07GACACGTGGNONE 
J023113M14GACACGTGGNONE 
J023122K02GACACGTGGNONE 
J023134I12GACACGTGGNONE 
J033024O07GACACGTGGNONE 
J033045E09GACACGTGGNONE 
J033050O12GACACGTGGNONE 
J033052B16GACACGTGGNONE 
J033052F10GACACGTGGNONE 
J033052L07GACACGTGGNONE 
J033055D16GACACGTGGNONE 
J033093C13GACACGTGGNONE 
J033107I04GACACGTGGNONE 
J033122D23GACACGTGGNONE 
J043029H01GACACGTGGNONE 
J053043E04GACACGTGGNONE 
J053059G17GACACGTGGNONE 
J053069L11GACACGTGGNONE 
J053095I18GACACGTGGNONE 
J065035I11GACACGTGGNONE 
J065087P10GACACGTGGNONE 
J065124B14GACACGTGGNONE 
J065198E12GACACGTGGNONE 
J065210N22GACACGTGGNONE 
J065210P16GACACGTGGNONE 
J080309H11GACACGTGGNONE 
J080316C05GACACGTGGNONE 
J090039D18GACACGTGGNONE 
J090053F06GACACGTGGNONE 
J090084D01GACACGTGGNONE 
J090085K24GACACGTGGNONE 
J090096C10GACACGTGGNONE 
J090097N18GACACGTGGNONE 
J100045M09GACACGTGGNONE 
Os07g0558400003-103-C02CCACGTGTCNONE 
003-115-G05CCACGTGTCNONE 
006-025-B09CCACGTGTCNONE 
006-025-G10CCACGTGTCNONE 
006-027-E03CCACGTGTCNONE 
006-036-C06CCACGTGTCNONE 
006-045-B10CCACGTGTCNONE 
006-051-H11CCACGTGTCNONE 
006-053-H03CCACGTGTCNONE 
006-057-B09CCACGTGTCNONE 
006-062-C10CCACGTGTCNONE 
006-075-B12CCACGTGTCNONE 
006-079-F01CCACGTGTCNONE 
006-082-D08CCACGTGTCNONE 
006-087-F04CCACGTGTCNONE 
006-089-E09CCACGTGTCNONE 
006-090-C04CCACGTGTCNONE 
006-091-H05CCACGTGTCNONE 
006-093-E02CCACGTGTCNONE 
006-093-E06CCACGTGTCNONE 
006-093-H05CCACGTGTCNONE 
006-095-C05CCACGTGTCNONE 
006-097-B04CCACGTGTCNONE 
006-097-C07CCACGTGTCNONE 
006-097-D02CCACGTGTCNONE 
006-097-H10CCACGTGTCNONE 
006-098-C05CCACGTGTCNONE 
006-099-H09CCACGTGTCNONE 
006-104-B06CCACGTGTCNONE 
006-105-B11CCACGTGTCNONE 
006-106-E12CCACGTGTCNONE 
006-107-B06CCACGTGTCNONE 
006-109-A09CCACGTGTCNONE 
006-112-D05CCACGTGTCNONE 
006-118-C12CCACGTGTCNONE 
006-118-E10CCACGTGTCNONE 
006-120-D05CCACGTGTCNONE 
006-120-E08CCACGTGTCNONE 
009-055-D12CCACGTGTCNONE 
009-108-E05CCACGTGTCNONE 
009-125-H05CCACGTGTCNONE 
009-150-A07CCACGTGTCNONE 
009-198-C07CCACGTGTCNONE 
AF058796CCACGTGTCNONE 
AK058293CCACGTGTCNONE 
AK098992CCACGTGTCNONE 
AK103924CCACGTGTCNONE 
AK104309CCACGTGTCNONE 
AK104619CCACGTGTCNONE 
AK119534CCACGTGTCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13CCACGTGTCNONE 
J043039O11CCACGTGTCNONE 
J065176D03CCACGTGTCNONE 
J075022K10CCACGTGTCNONE 
J075065A02CCACGTGTCNONE 
J075077D23CCACGTGTCNONE 
J075088P15CCACGTGTCNONE 
J075125D24CCACGTGTCNONE 
J075125H11CCACGTGTCNONE 
J075192H21CCACGTGTCNONE 
J090080H18CCACGTGTCNONE 
Os07g0558500AK064914GGACACGTGGCGInositol phosphatase-like protein. 
AY224446GGACACGTGGCGNONE 
J013000M13GGACACGTGGCGNONE 
Os07g0597000009-013-A01CACGTGTCCNONE 
009-077-A02CACGTGTCCNONE 
009-195-H04CACGTGTCCNONE 
AF094773CACGTGTCCNONE 
AK062134CACGTGTCCNONE 
AK103429CACGTGTCCSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19CACGTGTCCNONE 
J013152D01CACGTGTCCNONE 
J023024K09CACGTGTCCNONE 
J023058J15CACGTGTCCNONE 
J023097I07CACGTGTCCNONE 
J023132B05CACGTGTCCNONE 
J033065L11CACGTGTCCNONE 
J033086B12CACGTGTCCNONE 
J033128M07CACGTGTCCNONE 
J043010M23CACGTGTCCNONE 
J043024A05CACGTGTCCNONE 
J053057P08CACGTGTCCNONE 
J065022G24CACGTGTCCNONE 
J065028I10CACGTGTCCNONE 
J065065D08CACGTGTCCNONE 
J065103D22CACGTGTCCNONE 
J065153K16CACGTGTCCNONE 
J065210B16CACGTGTCCNONE 
J075015H18CACGTGTCCNONE 
J075102C14CACGTGTCCNONE 
J080302G09CACGTGTCCNONE 
J080302L20CACGTGTCCNONE 
J080303K11CACGTGTCCNONE 
J080312C18CACGTGTCCNONE 
J080316F08CACGTGTCCNONE 
J090023I05CACGTGTCCNONE 
J090023I07CACGTGTCCNONE 
J090053C21CACGTGTCCNONE 
J090067J22CACGTGTCCNONE 
J090070E24CACGTGTCCNONE 
J090078H04CACGTGTCCNONE 
J090089P06CACGTGTCCNONE 
J090092E21CACGTGTCCNONE 
J100014G01CACGTGTCCNONE 
J100022L20CACGTGTCCNONE 
J100024I05CACGTGTCCNONE 
J100025L08CACGTGTCCNONE 
J100030J03CACGTGTCCNONE 
J100031K12CACGTGTCCNONE 
J100036N01CACGTGTCCNONE 
J100050C23CACGTGTCCNONE 
J100062G12CACGTGTCCNONE 
J100067L17CACGTGTCCNONE 
J100074O09CACGTGTCCNONE 
Os07g0616900AK071047CGACACGTGTCCProtein of unknown function DUF500 family protein. 
J013106G03CGACACGTGTCCNONE 
J013124C20CGACACGTGTCCNONE 
J033096D16CGACACGTGTCCNONE 
J043005E08CGACACGTGTCCNONE 
J065197K12CGACACGTGTCCNONE 
J065211I03CGACACGTGTCCNONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0633200AK061338GGACACGTGTCSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GGACACGTGTCNONE 
J033096E22GGACACGTGTCNONE 
J033125D06GGACACGTGTCNONE 
J075048C23GGACACGTGTCNONE 
J075050G02GGACACGTGTCNONE 
J075104J04GGACACGTGTCNONE 
J075144N04GGACACGTGTCNONE 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0687900AK099548GGACACGTGNONE 
AK107065GGACACGTGWSI76 protein induced by water stress. 
D26537GGACACGTGNONE 
J080303H14GGACACGTGNONE 
J080309E11GGACACGTGNONE 
Os07g0695100AB189039GGACACGTGGGNONE 
AB189042GGACACGTGGGNONE 
AK059514GGACACGTGGGNONE 
AK066112GGACACGTGGGCheY-like domain containing protein. 
J013051N02GGACACGTGGGNONE 
J013127M02GGACACGTGGGNONE 
J023007I05GGACACGTGGGNONE 
Os08g0122700AK111089GGACGGACCCACGTGTCConserved hypothetical protein. 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0162500AK121633GACACGTGTCCConserved hypothetical protein. 
J033105E19GACACGTGTCCNONE 
J080012K11GACACGTGTCCNONE 
J080041I12GACACGTGTCCNONE 
J080049G05GACACGTGTCCNONE 
J080050P09GACACGTGTCCNONE 
J080051A10GACACGTGTCCNONE 
J080054G05GACACGTGTCCNONE 
J080058M08GACACGTGTCCNONE 
J080064N23GACACGTGTCCNONE 
J080072L15GACACGTGTCCNONE 
J080096H09GACACGTGTCCNONE 
J100079I08GACACGTGTCCNONE 
Os08g0175200AK072367CACGTGTCCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16CACGTGTCCNONE 
J023075K04CACGTGTCCNONE 
J023082L15CACGTGTCCNONE 
J043015G07CACGTGTCCNONE 
J065052L17CACGTGTCCNONE 
J065202P07CACGTGTCCNONE 
J075061D17CACGTGTCCNONE 
J100088P13CACGTGTCCNONE 
Os08g0192800AK059490CGCCACGTGTCGNONE 
AK101678CGCCACGTGTCGNONE 
AK120613CGCCACGTGTCGBromodomain containing protein. 
J080039B22CGCCACGTGTCGNONE 
J080039I23CGCCACGTGTCGNONE 
J080074D19CGCCACGTGTCGNONE 
J080086N13CGCCACGTGTCGNONE 
Os08g0205700009-047-A11CGACACGTGNONE 
009-167-C10CGACACGTGNONE 
014-088-E02CGACACGTGNONE 
J065029D05CGACACGTGNONE 
J065096A14CGACACGTGNONE 
J065118E14CGACACGTGNONE 
J065186J24CGACACGTGNONE 
J065199O09CGACACGTGNONE 
J100060I06CGACACGTGNONE 
Os08g0249000AK109938CCACGTGTCCZinc finger, B-box domain containing protein. 
Os08g0290500004-010-C07GGCCGTCCACGTGTCCNONE 
009-111-A08GGCCGTCCACGTGTCCNONE 
011-046-F10GGCCGTCCACGTGTCCNONE 
AK066894GGCCGTCCACGTGTCCNONE 
AK067122GGCCGTCCACGTGTCCNONE 
AK102868GGCCGTCCACGTGTCCSimilar to AF-10 protein. 
J013089O21GGCCGTCCACGTGTCCNONE 
J033072D17GGCCGTCCACGTGTCCNONE 
J033095M14GGCCGTCCACGTGTCCNONE 
J033111N23GGCCGTCCACGTGTCCNONE 
J043024M17GGCCGTCCACGTGTCCNONE 
J065176I24GGCCGTCCACGTGTCCNONE 
J090035C05GGCCGTCCACGTGTCCNONE 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0412800AK108716CGACACGTGProtein of unknown function DUF1262 family protein. 
Os08g0425100AK069134CCACGTGTCCDynamin family protein. 
AK072791CCACGTGTCCNONE 
Os08g0425800009-168-F06GCCACGTGTCAGTGGNONE 
009-168-F06GGACACGTGTCNONE 
AK061339GCCACGTGTCAGTGGConserved hypothetical protein. 
AK061339GGACACGTGTCConserved hypothetical protein. 
AK101198GCCACGTGTCAGTGGNONE 
AK101198GGACACGTGTCNONE 
J033030L06GCCACGTGTCAGTGGNONE 
J033030L06GGACACGTGTCNONE 
J100036D08GCCACGTGTCAGTGGNONE 
J100036D08GGACACGTGTCNONE 
J100052I22GCCACGTGTCAGTGGNONE 
J100052I22GGACACGTGTCNONE 
Os08g0449850J075182C20CGACACGTGConserved hypothetical protein. 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0481500J065054C23CCACGTGTCCConserved hypothetical protein. 
J065218E06CCACGTGTCCNONE 
Os08g0519600012-027-B02GACACGTGGGNONE 
AK072374GACACGTGGGNONE 
AK105273GACACGTGGGProtein of unknown function DUF1666 family protein. 
Os08g0521600AK108208CGCCACGTGTCCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
AK108208GGACACGTGGCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
Os08g0531900AY177701CGACACGTGGSimilar to MADS box transcription factor-like protein (MADS-box protein AGL72). 
J090094F15CGACACGTGGNONE 
Os08g0532300009-122-A05CGACACGTGGCNONE 
009-129-H05CGACACGTGGCNONE 
AB011262CGACACGTGGCNONE 
AK065141CGACACGTGGCNONE 
AK119730CGACACGTGGCSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CGACACGTGGCNONE 
J013042K23CGACACGTGGCNONE 
J023057J08CGACACGTGGCNONE 
J023057N10CGACACGTGGCNONE 
J023113C21CGACACGTGGCNONE 
J053054E03CGACACGTGGCNONE 
J053062B07CGACACGTGGCNONE 
J053075O17CGACACGTGGCNONE 
J053075P09CGACACGTGGCNONE 
J065024H05CGACACGTGGCNONE 
J065049F22CGACACGTGGCNONE 
J065063L03CGACACGTGGCNONE 
J065102O07CGACACGTGGCNONE 
J065104M12CGACACGTGGCNONE 
J065119E04CGACACGTGGCNONE 
J065153E10CGACACGTGGCNONE 
J065168M24CGACACGTGGCNONE 
J065173I10CGACACGTGGCNONE 
J065181L04CGACACGTGGCNONE 
J065184I18CGACACGTGGCNONE 
J065203M15CGACACGTGGCNONE 
J075004C21CGACACGTGGCNONE 
J075047B11CGACACGTGGCNONE 
J075055F18CGACACGTGGCNONE 
J075065G09CGACACGTGGCNONE 
J075094O14CGACACGTGGCNONE 
J075143C22CGACACGTGGCNONE 
J075153K18CGACACGTGGCNONE 
J075164N10CGACACGTGGCNONE 
J075197C11CGACACGTGGCNONE 
J080001A01CGACACGTGGCNONE 
J080003B11CGACACGTGGCNONE 
J080006G17CGACACGTGGCNONE 
J080007J06CGACACGTGGCNONE 
J080010H12CGACACGTGGCNONE 
J080014I01CGACACGTGGCNONE 
J080015C16CGACACGTGGCNONE 
J080016P19CGACACGTGGCNONE 
J080020G24CGACACGTGGCNONE 
J080021E12CGACACGTGGCNONE 
J080023I11CGACACGTGGCNONE 
J080024H24CGACACGTGGCNONE 
J080025G18CGACACGTGGCNONE 
J080028H08CGACACGTGGCNONE 
J080030G08CGACACGTGGCNONE 
J080031H20CGACACGTGGCNONE 
J080034C20CGACACGTGGCNONE 
J080040H13CGACACGTGGCNONE 
J080044M04CGACACGTGGCNONE 
J080047D02CGACACGTGGCNONE 
J080049D17CGACACGTGGCNONE 
J080049J17CGACACGTGGCNONE 
J080050A05CGACACGTGGCNONE 
J080051C11CGACACGTGGCNONE 
J080051K06CGACACGTGGCNONE 
J080053A07CGACACGTGGCNONE 
J080053I08CGACACGTGGCNONE 
J080056L12CGACACGTGGCNONE 
J080061I19CGACACGTGGCNONE 
J080075G09CGACACGTGGCNONE 
J080078C23CGACACGTGGCNONE 
J080080I21CGACACGTGGCNONE 
J080084F04CGACACGTGGCNONE 
J080085K16CGACACGTGGCNONE 
J080097A12CGACACGTGGCNONE 
J080097N01CGACACGTGGCNONE 
J090027L10CGACACGTGGCNONE 
J100034N17CGACACGTGGCNONE 
Os08g0532400AK101608GCCACGTGTCGSimilar to AT.I.24-7 protein. 
Os08g0541400003-128-C08AGTGACACGTGGACCNONE 
AK068255AGTGACACGTGGACCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104009AGTGACACGTGGACCNONE 
J013129J12AGTGACACGTGGACCNONE 
J013149F15AGTGACACGTGGACCNONE 
J065187N18AGTGACACGTGGACCNONE 
Os08g0547100006-088-E09GACACGTGTCCNONE 
AK073704GACACGTGTCCNONE 
AK109374GACACGTGTCC6-phosphogluconolactonase domain containing protein. 
J023055A08GACACGTGTCCNONE 
J023150G19GACACGTGTCCNONE 
J033060E10GACACGTGTCCNONE 
J033112J12GACACGTGTCCNONE 
Os09g0115400AK067816GGACACGTGCACGGCCCATGTNONE 
AK101706GGACACGTGCACGGCCCATGTSimilar to Poly(A)-binding protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0325700011-041-G03CACGTGTCCGGGCCTGGNONE 
011-041-G03GGACACGTGTCGNONE 
AK063334CACGTGTCCGGGCCTGGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
AK063334GGACACGTGTCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CACGTGTCCGGGCCTGGNONE 
J080317M24GGACACGTGTCGNONE 
Os09g0370300AK108199GCCACACGTGTCCGCGACGCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0401000AK064679GACACGTGMyb factor. 
J075155B13GACACGTGNONE 
Y11351GACACGTGNONE 
Os09g0412900014-003-F10GACACGTGGGTCCCACNONE 
AK102254GACACGTGGGTCCCACProtein prenyltransferase domain containing protein. 
AK102867GACACGTGGGTCCCACNONE 
J033088H22GACACGTGGGTCCCACNONE 
Os09g0465500AK109671GACACGTGGConserved hypothetical protein. 
Os09g0553200003-101-F12CGCCACGTGTCCNONE 
003-125-E09CGCCACGTGTCCNONE 
011-031-H12CGCCACGTGTCCNONE 
012-033-A01CGCCACGTGTCCNONE 
015-046-H04CGCCACGTGTCCNONE 
015-056-F04CGCCACGTGTCCNONE 
016-029-H06CGCCACGTGTCCNONE 
016-080-D05CGCCACGTGTCCNONE 
AB062606CGCCACGTGTCCNONE 
AK065780CGCCACGTGTCCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGCCACGTGTCCNONE 
AK104344CGCCACGTGTCCNONE 
AK119197CGCCACGTGTCCNONE 
AK119232CGCCACGTGTCCNONE 
J013039M01CGCCACGTGTCCNONE 
J013043M01CGCCACGTGTCCNONE 
J013064F03CGCCACGTGTCCNONE 
J013066K19CGCCACGTGTCCNONE 
J013092G12CGCCACGTGTCCNONE 
J013123P09CGCCACGTGTCCNONE 
J013155F01CGCCACGTGTCCNONE 
J013158J12CGCCACGTGTCCNONE 
J013159H14CGCCACGTGTCCNONE 
J013169C10CGCCACGTGTCCNONE 
J013170L23CGCCACGTGTCCNONE 
J023010J18CGCCACGTGTCCNONE 
J023019E23CGCCACGTGTCCNONE 
J023045B14CGCCACGTGTCCNONE 
J023082K24CGCCACGTGTCCNONE 
J023086G04CGCCACGTGTCCNONE 
J023090N09CGCCACGTGTCCNONE 
J023113C08CGCCACGTGTCCNONE 
J023125H18CGCCACGTGTCCNONE 
J033034M08CGCCACGTGTCCNONE 
J033035K03CGCCACGTGTCCNONE 
J033039D15CGCCACGTGTCCNONE 
J033045P18CGCCACGTGTCCNONE 
J033058P08CGCCACGTGTCCNONE 
J033061D16CGCCACGTGTCCNONE 
J033070F14CGCCACGTGTCCNONE 
J033086F23CGCCACGTGTCCNONE 
J033095C05CGCCACGTGTCCNONE 
J033114H22CGCCACGTGTCCNONE 
J033133M20CGCCACGTGTCCNONE 
J043026G01CGCCACGTGTCCNONE 
J043037F17CGCCACGTGTCCNONE 
J065120K17CGCCACGTGTCCNONE 
J065123O07CGCCACGTGTCCNONE 
J080305H06CGCCACGTGTCCNONE 
J090001F11CGCCACGTGTCCNONE 
J090020C17CGCCACGTGTCCNONE 
J090043A19CGCCACGTGTCCNONE 
J090051J17CGCCACGTGTCCNONE 
J090068K06CGCCACGTGTCCNONE 
J090075P19CGCCACGTGTCCNONE 
J100036G10CGCCACGTGTCCNONE 
J100084F02CGCCACGTGTCCNONE 
Os09g0565400AK067821GACACGTGGLipoprotein, type 6 family protein. 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0180000006-025-E11CGCCACGTGTCGNONE 
006-044-A07CGCCACGTGTCGNONE 
AK060077CGCCACGTGTCGPlant disease resistance response protein family protein. 
Os11g0181700006-062-E12AGCCGTCCACGTGTCNONE 
006-072-B05AGCCGTCCACGTGTCNONE 
006-118-G08AGCCGTCCACGTGTCNONE 
009-068-A10AGCCGTCCACGTGTCNONE 
AK062546AGCCGTCCACGTGTCSimilar to Short-chain dehydrogenase Tic32. 
AK065928AGCCGTCCACGTGTCNONE 
Os11g0184900011-088-C07CGACACGTGTCNONE 
011-088-C07CGACACGTGTCCNONE 
015-036-B03CGACACGTGTCNONE 
015-036-B03CGACACGTGTCCNONE 
016-087-F07CGACACGTGTCNONE 
016-087-F07CGACACGTGTCCNONE 
AB028184CGACACGTGTCNONE 
AB028184CGACACGTGTCCNONE 
AK063399CGACACGTGTCSimilar to NAC-domain protein 5-7. 
AK063399CGACACGTGTCCSimilar to NAC-domain protein 5-7. 
AK064292CGACACGTGTCNONE 
AK064292CGACACGTGTCCNONE 
AK102475CGACACGTGTCNONE 
AK102475CGACACGTGTCCNONE 
J033094I01CGACACGTGTCNONE 
J033094I01CGACACGTGTCCNONE 
J090087J16CGACACGTGTCNONE 
J090087J16CGACACGTGTCCNONE 
Os11g0202000AK063427GAGACGTGGACACGTGTCCyclin-like F-box domain containing protein. 
AK122020GAGACGTGGACACGTGTCNONE 
J033111N03GAGACGTGGACACGTGTCNONE 
Os11g0202300AK066860CGACACGTGNONE 
AK068673CGACACGTGConserved hypothetical protein. 
J013073M16CGACACGTGNONE 
J013088K08CGACACGTGNONE 
Os11g0220300AK068820CGACACGTGTCConserved hypothetical protein. 
Os11g0244800AK103215GTGGGCCCCACGTGTCSimilar to Alfin-1. 
J065009E13GTGGGCCCCACGTGTCNONE 
J065027D16GTGGGCCCCACGTGTCNONE 
J065085B06GTGGGCCCCACGTGTCNONE 
J065180O17GTGGGCCCCACGTGTCNONE 
J090010C16GTGGGCCCCACGTGTCNONE 
J090039K20GTGGGCCCCACGTGTCNONE 
Os11g0297300AK070171GACACGTGGCSimilar to Beta-D-xylosidase. 
Os11g0417700J075031P16CGACACGTGGCConserved hypothetical protein. 
J075034C16CGACACGTGGCNONE 
J075034J22CGACACGTGGCNONE 
J075042C07CGACACGTGGCNONE 
J075046O07CGACACGTGGCNONE 
J075062O13CGACACGTGGCNONE 
J075091G08CGACACGTGGCNONE 
J075135H20CGACACGTGGCNONE 
J075172B13CGACACGTGGCNONE 
J075179G14CGACACGTGGCNONE 
Os11g0429000AK067370CGACACGTGConserved hypothetical protein. 
Os11g0490100AK108872CACGTGTCCProtein of unknown function DUF579, plant family protein. 
Os11g0501000AK109615CGCCACGTGTCConserved hypothetical protein. 
Os11g0503900006-092-E06GACACGTGNONE 
AK061183GACACGTGSulfotransferase family protein. 
Os11g0530600AB000801CACGTGTCGSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810CACGTGTCGNONE 
D29697CACGTGTCGNONE 
J013119K06CACGTGTCGNONE 
J023001C21CACGTGTCGNONE 
J023081C19CACGTGTCGNONE 
J065026K21CACGTGTCGNONE 
J065040A17CACGTGTCGNONE 
J065043H01CACGTGTCGNONE 
J065093P05CACGTGTCGNONE 
J065104P15CACGTGTCGNONE 
J065127C09CACGTGTCGNONE 
J065140D08CACGTGTCGNONE 
X89859CACGTGTCGNONE 
Os11g0533400014-020-B08CGCCACGTGTCNONE 
AK063652CGCCACGTGTCConserved hypothetical protein. 
Os11g0536900J100027G18GCCACGTGTCCConserved hypothetical protein. 
J100073G12GCCACGTGTCCNONE 
Os11g0546300AK121962CGACACGTGTCGPatatin family protein. 
J075030A04CGACACGTGTCGNONE 
J075073J11CGACACGTGTCGNONE 
J075161G14CGACACGTGTCGNONE 
J075178C13CGACACGTGTCGNONE 
Os11g0581900AK069449GACACGTGTCCProtein of unknown function UPF0005 family protein. 
Os11g0648000AK066444GACACGTGGSimilar to Na+/H+ antiporter. 
AK072026GACACGTGGNONE 
Os11g0703900009-118-C12GGACACGTGNONE 
AK119710GGACACGTGNONE 
J080038G19GGACACGTGNONE 
J080054L02GGACACGTGNONE 
J080068K07GGACACGTGNONE 
J080069A04GGACACGTGNONE 
J080081I01GGACACGTGNONE 
J080091E17GGACACGTGNONE 
Os12g0166700AK071570CACGTGTCConserved hypothetical protein. 
J065023H24CACGTGTCNONE 
J090081C23CACGTGTCNONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0267500AK065740CGACACGTGConserved hypothetical protein. 
J013042N04CGACACGTGNONE 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0291100013-021-D10CGACACGTGGCNONE 
013-038-B12CGACACGTGGCNONE 
AK068555CGACACGTGGCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627CGACACGTGGCNONE 
D00644CGACACGTGGCNONE 
J013156H12CGACACGTGGCNONE 
J023122F15CGACACGTGGCNONE 
J065001F13CGACACGTGGCNONE 
J065001O16CGACACGTGGCNONE 
J065006D15CGACACGTGGCNONE 
J065008I17CGACACGTGGCNONE 
J065008N22CGACACGTGGCNONE 
J065010K05CGACACGTGGCNONE 
J065015G11CGACACGTGGCNONE 
J065019H21CGACACGTGGCNONE 
J065020N17CGACACGTGGCNONE 
J065024O18CGACACGTGGCNONE 
J065025A04CGACACGTGGCNONE 
J065026I06CGACACGTGGCNONE 
J065028C06CGACACGTGGCNONE 
J065029C01CGACACGTGGCNONE 
J065029C06CGACACGTGGCNONE 
J065029D16CGACACGTGGCNONE 
J065029E02CGACACGTGGCNONE 
J065030P11CGACACGTGGCNONE 
J065032M13CGACACGTGGCNONE 
J065034C06CGACACGTGGCNONE 
J065037H24CGACACGTGGCNONE 
J065037O14CGACACGTGGCNONE 
J065038A12CGACACGTGGCNONE 
J065043A05CGACACGTGGCNONE 
J065046C06CGACACGTGGCNONE 
J065046D22CGACACGTGGCNONE 
J065048C14CGACACGTGGCNONE 
J065048D24CGACACGTGGCNONE 
J065049F19CGACACGTGGCNONE 
J065050C04CGACACGTGGCNONE 
J065052J16CGACACGTGGCNONE 
J065055E07CGACACGTGGCNONE 
J065055I04CGACACGTGGCNONE 
J065060L04CGACACGTGGCNONE 
J065062I15CGACACGTGGCNONE 
J065062J11CGACACGTGGCNONE 
J065065I12CGACACGTGGCNONE 
J065068C24CGACACGTGGCNONE 
J065069M04CGACACGTGGCNONE 
J065071J22CGACACGTGGCNONE 
J065076A12CGACACGTGGCNONE 
J065076C24CGACACGTGGCNONE 
J065076F09CGACACGTGGCNONE 
J065076F16CGACACGTGGCNONE 
J065077O06CGACACGTGGCNONE 
J065081E14CGACACGTGGCNONE 
J065082K22CGACACGTGGCNONE 
J065082L04CGACACGTGGCNONE 
J065085B02CGACACGTGGCNONE 
J065089C21CGACACGTGGCNONE 
J065092L07CGACACGTGGCNONE 
J065093G08CGACACGTGGCNONE 
J065093I19CGACACGTGGCNONE 
J065093K24CGACACGTGGCNONE 
J065093N04CGACACGTGGCNONE 
J065094I09CGACACGTGGCNONE 
J065094N19CGACACGTGGCNONE 
J065095J17CGACACGTGGCNONE 
J065095N24CGACACGTGGCNONE 
J065096B17CGACACGTGGCNONE 
J065096C02CGACACGTGGCNONE 
J065097P18CGACACGTGGCNONE 
J065099E07CGACACGTGGCNONE 
J065103D23CGACACGTGGCNONE 
J065104F04CGACACGTGGCNONE 
J065104L17CGACACGTGGCNONE 
J065111L14CGACACGTGGCNONE 
J065112K11CGACACGTGGCNONE 
J065115P09CGACACGTGGCNONE 
J065123A02CGACACGTGGCNONE 
J065127P14CGACACGTGGCNONE 
J065137E16CGACACGTGGCNONE 
J065138H20CGACACGTGGCNONE 
J065138J11CGACACGTGGCNONE 
J065141K23CGACACGTGGCNONE 
J065141L14CGACACGTGGCNONE 
J065143P04CGACACGTGGCNONE 
J065146N12CGACACGTGGCNONE 
J065147F21CGACACGTGGCNONE 
J065147N15CGACACGTGGCNONE 
J065154L06CGACACGTGGCNONE 
J065156C09CGACACGTGGCNONE 
J065156J18CGACACGTGGCNONE 
J065157C19CGACACGTGGCNONE 
J065159H23CGACACGTGGCNONE 
J065159M08CGACACGTGGCNONE 
J065163B19CGACACGTGGCNONE 
J065164K14CGACACGTGGCNONE 
J065166K07CGACACGTGGCNONE 
J065166O07CGACACGTGGCNONE 
J065168A18CGACACGTGGCNONE 
J065170B18CGACACGTGGCNONE 
J065170D18CGACACGTGGCNONE 
J065173E05CGACACGTGGCNONE 
J065174L23CGACACGTGGCNONE 
J065177F08CGACACGTGGCNONE 
J065177I05CGACACGTGGCNONE 
J065178P20CGACACGTGGCNONE 
J065181G24CGACACGTGGCNONE 
J065182A07CGACACGTGGCNONE 
J065183D24CGACACGTGGCNONE 
J065184K10CGACACGTGGCNONE 
J065185F09CGACACGTGGCNONE 
J065185P10CGACACGTGGCNONE 
J065186J16CGACACGTGGCNONE 
J065188K23CGACACGTGGCNONE 
J065190E22CGACACGTGGCNONE 
J065191D06CGACACGTGGCNONE 
J065193C05CGACACGTGGCNONE 
J065193N13CGACACGTGGCNONE 
J065194B15CGACACGTGGCNONE 
J065199C03CGACACGTGGCNONE 
J065200P19CGACACGTGGCNONE 
J065202O18CGACACGTGGCNONE 
J065203F16CGACACGTGGCNONE 
J065204A15CGACACGTGGCNONE 
J065206P13CGACACGTGGCNONE 
J065207P12CGACACGTGGCNONE 
J065210J24CGACACGTGGCNONE 
J065211K01CGACACGTGGCNONE 
J065213O21CGACACGTGGCNONE 
J065215L18CGACACGTGGCNONE 
J065216N22CGACACGTGGCNONE 
J065219A16CGACACGTGGCNONE 
J065219C24CGACACGTGGCNONE 
J075012P04CGACACGTGGCNONE 
J075013K19CGACACGTGGCNONE 
J075028N24CGACACGTGGCNONE 
J075028P16CGACACGTGGCNONE 
J075032H22CGACACGTGGCNONE 
J075032J18CGACACGTGGCNONE 
J075042O14CGACACGTGGCNONE 
J075047A04CGACACGTGGCNONE 
J075053A16CGACACGTGGCNONE 
J075064C23CGACACGTGGCNONE 
J075072H11CGACACGTGGCNONE 
J075073C03CGACACGTGGCNONE 
J075081G11CGACACGTGGCNONE 
J075093H04CGACACGTGGCNONE 
J075095A11CGACACGTGGCNONE 
J075095C13CGACACGTGGCNONE 
J075100D18CGACACGTGGCNONE 
J075101P08CGACACGTGGCNONE 
J075114G11CGACACGTGGCNONE 
J075118D19CGACACGTGGCNONE 
J075122K13CGACACGTGGCNONE 
J075125G22CGACACGTGGCNONE 
J075129E22CGACACGTGGCNONE 
J075129I07CGACACGTGGCNONE 
J075132C12CGACACGTGGCNONE 
J075135E24CGACACGTGGCNONE 
J075136I06CGACACGTGGCNONE 
J075136O07CGACACGTGGCNONE 
J075138I07CGACACGTGGCNONE 
J075142G08CGACACGTGGCNONE 
J075147J22CGACACGTGGCNONE 
J075150H20CGACACGTGGCNONE 
J075151A15CGACACGTGGCNONE 
J075151G24CGACACGTGGCNONE 
J075151J20CGACACGTGGCNONE 
J075156N21CGACACGTGGCNONE 
J075158O12CGACACGTGGCNONE 
J075161E05CGACACGTGGCNONE 
J075166F17CGACACGTGGCNONE 
J075169M10CGACACGTGGCNONE 
J075174K15CGACACGTGGCNONE 
J075179F17CGACACGTGGCNONE 
J075185G15CGACACGTGGCNONE 
J075188P12CGACACGTGGCNONE 
J075191P15CGACACGTGGCNONE 
J075192A13CGACACGTGGCNONE 
J075197E23CGACACGTGGCNONE 
J075197M02CGACACGTGGCNONE 
J075198M16CGACACGTGGCNONE 
J080020B11CGACACGTGGCNONE 
J080021M20CGACACGTGGCNONE 
J080066K02CGACACGTGGCNONE 
J080301F01CGACACGTGGCNONE 
J080301G19CGACACGTGGCNONE 
J080305G02CGACACGTGGCNONE 
J080306N09CGACACGTGGCNONE 
J080309D21CGACACGTGGCNONE 
J080309I02CGACACGTGGCNONE 
J080313J11CGACACGTGGCNONE 
J080313P09CGACACGTGGCNONE 
J080315B10CGACACGTGGCNONE 
J080315O13CGACACGTGGCNONE 
J080316G02CGACACGTGGCNONE 
J080317F03CGACACGTGGCNONE 
J080318D17CGACACGTGGCNONE 
J080319C10CGACACGTGGCNONE 
J090017E03CGACACGTGGCNONE 
J090034N22CGACACGTGGCNONE 
J090042G07CGACACGTGGCNONE 
J090062P21CGACACGTGGCNONE 
J090082D08CGACACGTGGCNONE 
J090096M13CGACACGTGGCNONE 
J100086J22CGACACGTGGCNONE 
Os12g0407100J075130F11GCGCGCGACACGTGTCNONE 
J075150G14GCGCGCGACACGTGTCConserved hypothetical protein. 
J090089B20GCGCGCGACACGTGTCNONE 
J100042D22GCGCGCGACACGTGTCNONE 
Os12g0411700AK067639CACGTGTCGABC transporter related domain containing protein. 
J080005L02CACGTGTCGNONE 
J080009H17CACGTGTCGNONE 
J080025L24CACGTGTCGNONE 
J080063F18CACGTGTCGNONE 
J080086M05CACGTGTCGNONE 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0478100013-036-F11CGACACGTGTCNONE 
013-036-F11GCCACGTGTCCNONE 
AK063578CGACACGTGTCGRAM domain containing protein. 
AK063578GCCACGTGTCCGRAM domain containing protein. 
Os12g0535400004-008-H02GGCCGTCCACGTGTCCNONE 
AK065318GGCCGTCCACGTGTCCHypothetical protein. 
J013002P10GGCCGTCCACGTGTCCNONE 
Os12g0553200J013072P20GACACGTGGCNONE 
J033024I06GACACGTGGCNONE 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0575000009-057-B12CACGTGTCCNONE 
009-113-B05CACGTGTCCNONE 
009-170-F09CACGTGTCCNONE 
009-191-D05CACGTGTCCNONE 
AK059885CACGTGTCCNONE 
AK104945CACGTGTCCProtein of unknown function DUF1118 family protein. 
J013124C09CACGTGTCCNONE 
J013156G23CACGTGTCCNONE 
J023033G18CACGTGTCCNONE 
J065055H05CACGTGTCCNONE 
J065129P17CACGTGTCCNONE 
J065188E10CACGTGTCCNONE 
J065195J24CACGTGTCCNONE 
J075027I24CACGTGTCCNONE 
J075028H07CACGTGTCCNONE 
J075032A03CACGTGTCCNONE 
J075057M10CACGTGTCCNONE 
J075093K11CACGTGTCCNONE 
J075098D20CACGTGTCCNONE 
J075126N24CACGTGTCCNONE 
J075140M14CACGTGTCCNONE 
J075140M21CACGTGTCCNONE 
J075147P07CACGTGTCCNONE 
J075153F12CACGTGTCCNONE 
J075157C13CACGTGTCCNONE 
J075174K01CACGTGTCCNONE 
J075194B17CACGTGTCCNONE 
J075195E11CACGTGTCCNONE 
Os12g0586600AK066259GACACGTGGGTCCSimilar to Plasma membrane Ca2+-ATPase. 
AK100436GACACGTGGGTCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.