version

Summary of OsREG510 (All List)

OrganismOryza sativa  
IDOsREG510  
SequenceCACTGACA  
Annotation  
PPDB Motif 
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count2028  

Entry Sequences (2028 entries)

LocusGene modelSequenceDescription
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0145200J100017K24TGTCAGTGGNONE 
Os01g0151200AK110801TGTCAGTGNONE 
Os01g0156300AK107993GTGTCACTGACASimilar to Cappuccino protein. 
Os01g0167400AB051107CCTGTCAGTGSimilar to Protein synthesis inhibitor II (EC 3.2.2.22) (Ribosome-inactivating protein II) (rRNA N-glycosidase). 
AK120073CCTGTCAGTGNONE 
J065062A04CCTGTCAGTGNONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
006-024-C04TGTCAGTGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK070272TGTCAGTGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
AK104558TGTCAGTGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23TGTCAGTGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15TGTCAGTGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20TGTCAGTGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02TGTCAGTGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17TGTCAGTGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12TGTCAGTGNONE 
Os01g0214200AK061229CACTGACALipolytic enzyme, G-D-S-L family protein. 
J065042C12CACTGACANONE 
J065045M22CACTGACANONE 
J065112H11CACTGACANONE 
Os01g0218700AK064992TGTCAGTGABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0229400AB029508TGTCAGTGSmall GTP-binding protein OsRac1. 
J013111C23TGTCAGTGNONE 
J023077H07TGTCAGTGNONE 
J100039H15TGTCAGTGNONE 
Os01g0246400009-143-G05CACTGACACGTGGCNONE 
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0255100AK058528CACTGACASimilar to Soluble epoxide hydrolase. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0272600015-046-G06CCACTGACANONE 
AK067786CCACTGACAConserved hypothetical protein. 
Os01g0276900009-014-B04TGTCAGTGGNONE 
AK105130TGTCAGTGGConserved hypothetical protein. 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0286200AK111156CACTGACAConserved hypothetical protein. 
Os01g0293100AK106850CTGTCAGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein. 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
Os01g0663300AK071667CCACTGACASimilar to (1-4)-beta-mannan endohydrolase-like protein. 
J023055F22CCACTGACANONE 
J023105N15CCACTGACANONE 
J090042C10CCACTGACANONE 
Os01g0663500006-024-H09CCACCTGTCAGTGNONE 
AK058452CCACCTGTCAGTGNONE 
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein. 
Os01g0673500AK065017CACTGACASimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899CACTGACANONE 
Os01g0716200AK062106GTGTCACTGACAGIQ calmodulin-binding region domain containing protein. 
AK098920GTGTCACTGACAGNONE 
J013002N06GTGTCACTGACAGNONE 
J013050O19GTGTCACTGACAGNONE 
J013074N19GTGTCACTGACAGNONE 
J013127F17GTGTCACTGACAGNONE 
J013155C17GTGTCACTGACAGNONE 
J013158K07GTGTCACTGACAGNONE 
J053086D01GTGTCACTGACAGNONE 
Os01g0739500009-085-C03TGTCAGTGNONE 
AK121118TGTCAGTGConserved hypothetical protein. 
J013110A12TGTCAGTGNONE 
J013111F24TGTCAGTGNONE 
J013123D24TGTCAGTGNONE 
J023043I01TGTCAGTGNONE 
J023074B04TGTCAGTGNONE 
J023086O13TGTCAGTGNONE 
J023100C19TGTCAGTGNONE 
J033040N08TGTCAGTGNONE 
J033068E10TGTCAGTGNONE 
J043010A07TGTCAGTGNONE 
J053061P15TGTCAGTGNONE 
J053065H08TGTCAGTGNONE 
J053096B10TGTCAGTGNONE 
J065155H09TGTCAGTGNONE 
J075033D14TGTCAGTGNONE 
J075035H20TGTCAGTGNONE 
J075035L23TGTCAGTGNONE 
J075059H22TGTCAGTGNONE 
J090097L13TGTCAGTGNONE 
J090097P11TGTCAGTGNONE 
J100036D16TGTCAGTGNONE 
J100049M23TGTCAGTGNONE 
J100058P13TGTCAGTGNONE 
J100072G10TGTCAGTGNONE 
J100072N11TGTCAGTGNONE 
J100083D04TGTCAGTGNONE 
J100089M03TGTCAGTGNONE 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0763600AK061563TGTCAGTGNONE 
AK066596TGTCAGTGGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15TGTCAGTGNONE 
J065016A16TGTCAGTGNONE 
J065039L06TGTCAGTGNONE 
J090001E03TGTCAGTGNONE 
J090012J18TGTCAGTGNONE 
J090085E15TGTCAGTGNONE 
Os01g0778700AK064933CACTGACAConserved hypothetical protein. 
Os01g0827500AK111814TGTCAGTGExo70 exocyst complex subunit family protein. 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0844800AK099801TGTCAGTGSimilar to Pumilio RBD (Fragment). 
AK102882TGTCAGTGNONE 
AK103686TGTCAGTGNONE 
Os01g0846600AK070193CCACTGACAProtein of unknown function DUF248, methyltransferase putative family protein. 
J023041I24CCACTGACANONE 
J065002B03CCACTGACANONE 
J065140C09CCACTGACANONE 
J090052A18CCACTGACANONE 
J090081O13CCACTGACANONE 
J100056L06CCACTGACANONE 
Os01g0847800014-071-E03CACTGACANONE 
AK100718CACTGACASimilar to Aldose reductase (EC 1.1.1.21) (AR) (Aldehyde reductase) (20-alpha- hydroxysteroid dehydrogenase) (EC 1.1.1.149) (20-alpha-HSD). 
J023049O07CACTGACANONE 
J023115O16CACTGACANONE 
J033093E24CACTGACANONE 
J033094E24CACTGACANONE 
J043024M05CACTGACANONE 
J065082P08CACTGACANONE 
J065106C07CACTGACANONE 
J100062I02CACTGACANONE 
Os01g0847900006-030-E09TGTCAGTGNONE 
AK059798TGTCAGTGPrenylated rab acceptor PRA1 family protein. 
AK073643TGTCAGTGNONE 
J065091G23TGTCAGTGNONE 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK103428CACTGACAGGTGGGGCNONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0884400AK072566CCTGTCAGTGU box domain containing protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0904500AK119437TGTCAGTGConserved hypothetical protein. 
J065022O22TGTCAGTGNONE 
J065102M14TGTCAGTGNONE 
J065192C12TGTCAGTGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0961200011-099-H06CCACTGACAGGNONE 
AK105424CCACTGACAGGCBS domain containing protein. 
J065169J18CCACTGACAGGNONE 
J075109H12CCACTGACAGGNONE 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0133900AK107180CACTGACACTGACAProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0138600AK071778CACTGACAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07CACTGACANONE 
Os02g0194400AK110011TGTCAGTGProtein kinase-like domain containing protein. 
Os02g0199300AK064726TGTCAGTGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
AK101434GTGTCACTGACAWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
J043024M20GTGTCACTGACANONE 
Os02g0215100AK110993CACTGACAConserved hypothetical protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0315600AK102703TGTCAGTGNONE 
AK106848TGTCAGTGNONE 
AK107002TGTCAGTGHelix-loop-helix DNA-binding domain containing protein. 
Os02g0316200AK073932CACTGACAGGCyclin-like F-box domain containing protein. 
AK105757CACTGACAGGNONE 
J023039G03CACTGACAGGNONE 
J033076K03CACTGACAGGNONE 
J075157J22CACTGACAGGNONE 
J090097K02CACTGACAGGNONE 
J100053F10CACTGACAGGNONE 
Os02g0491400AK073233CACTGACASimilar to Peptidylprolyl isomerase. 
J090046J15CACTGACANONE 
Os02g0533800009-149-F12CACTGACANONE 
013-058-H02CACTGACANONE 
014-017-G07CACTGACANONE 
014-028-F04CACTGACANONE 
014-050-G04CACTGACANONE 
014-095-F04CACTGACANONE 
014-099-C08CACTGACANONE 
016-046-F05CACTGACANONE 
AK121139CACTGACAConserved hypothetical protein. 
J013104A14CACTGACANONE 
J023077F13CACTGACANONE 
J023145I11CACTGACANONE 
J065033D14CACTGACANONE 
J065079I15CACTGACANONE 
J065104E21CACTGACANONE 
J065128E06CACTGACANONE 
J065174F07CACTGACANONE 
J065195B12CACTGACANONE 
J065207B12CACTGACANONE 
J080304M24CACTGACANONE 
J090040A13CACTGACANONE 
J090054B18CACTGACANONE 
J100037A06CACTGACANONE 
J100042F24CACTGACANONE 
J100043N23CACTGACANONE 
J100044H14CACTGACANONE 
J100056K24CACTGACANONE 
J100063O22CACTGACANONE 
J100071G05CACTGACANONE 
J100078G15CACTGACANONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0578201J065065K19CACTGACAConserved hypothetical protein. 
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE 
AK058978CACTGACAAGTGGGTCCAGANONE 
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein. 
Os02g0601800AB060276CACTGACAGGTGGNONE 
AK099539CACTGACAGGTGGNONE 
AK101873CACTGACAGGTGGBromodomain containing protein. 
AK106801CACTGACAGGTGGNONE 
AK121758CACTGACAGGTGGNONE 
AK121891CACTGACAGGTGGNONE 
J013059H01CACTGACAGGTGGNONE 
J013092F08CACTGACAGGTGGNONE 
J013146J04CACTGACAGGTGGNONE 
J023001K12CACTGACAGGTGGNONE 
J023002H16CACTGACAGGTGGNONE 
J023013B10CACTGACAGGTGGNONE 
J023081I22CACTGACAGGTGGNONE 
J023084K19CACTGACAGGTGGNONE 
J023150E24CACTGACAGGTGGNONE 
J033023B18CACTGACAGGTGGNONE 
J033025F18CACTGACAGGTGGNONE 
J033048P08CACTGACAGGTGGNONE 
J033060M24CACTGACAGGTGGNONE 
J033070G06CACTGACAGGTGGNONE 
J033088P12CACTGACAGGTGGNONE 
J033105C13CACTGACAGGTGGNONE 
J043009N18CACTGACAGGTGGNONE 
J065103G21CACTGACAGGTGGNONE 
J075039H15CACTGACAGGTGGNONE 
J090014K10CACTGACAGGTGGNONE 
J090022N02CACTGACAGGTGGNONE 
J090033F18CACTGACAGGTGGNONE 
J090033I04CACTGACAGGTGGNONE 
J090041F11CACTGACAGGTGGNONE 
J090045P20CACTGACAGGTGGNONE 
J090054B01CACTGACAGGTGGNONE 
J090055M12CACTGACAGGTGGNONE 
J090071K09CACTGACAGGTGGNONE 
J090098O16CACTGACAGGTGGNONE 
J090099P15CACTGACAGGTGGNONE 
J100050I16CACTGACAGGTGGNONE 
Os02g0608500AK071922CCACTGACANONE 
AK099756CCACTGACASimilar to Ankyrin-kinase protein (Fragment). 
Os02g0621700011-079-F10TGTCAGTGNONE 
AK101006TGTCAGTGSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TGTCAGTGNONE 
J013026C02TGTCAGTGNONE 
J013104M10TGTCAGTGNONE 
J023003D01TGTCAGTGNONE 
J023007H13TGTCAGTGNONE 
J023019G09TGTCAGTGNONE 
J023020L19TGTCAGTGNONE 
J023022L12TGTCAGTGNONE 
J023022O14TGTCAGTGNONE 
J023036F16TGTCAGTGNONE 
J023047D16TGTCAGTGNONE 
J023052P08TGTCAGTGNONE 
J023077C01TGTCAGTGNONE 
J023083M06TGTCAGTGNONE 
J023105A11TGTCAGTGNONE 
J023117F21TGTCAGTGNONE 
J023119D20TGTCAGTGNONE 
J023148E03TGTCAGTGNONE 
J023149B13TGTCAGTGNONE 
J033029A10TGTCAGTGNONE 
J033046L17TGTCAGTGNONE 
J033052M04TGTCAGTGNONE 
J033057M14TGTCAGTGNONE 
J033066K24TGTCAGTGNONE 
J033069K02TGTCAGTGNONE 
J033079G14TGTCAGTGNONE 
J033101E06TGTCAGTGNONE 
J033116E06TGTCAGTGNONE 
J033118L18TGTCAGTGNONE 
J033135B13TGTCAGTGNONE 
J033136C10TGTCAGTGNONE 
J033136P08TGTCAGTGNONE 
J043027B13TGTCAGTGNONE 
J065039I03TGTCAGTGNONE 
J065185N21TGTCAGTGNONE 
J090008D14TGTCAGTGNONE 
J090029K17TGTCAGTGNONE 
J090047H20TGTCAGTGNONE 
J090048N17TGTCAGTGNONE 
J090085G08TGTCAGTGNONE 
J090089F07TGTCAGTGNONE 
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE 
Os02g0680500015-074-F11TGTCAGTGNONE 
AK106401TGTCAGTGProtein prenyltransferase domain containing protein. 
Os02g0697700AK120209CACTGACAConserved hypothetical protein. 
J013038N05CACTGACANONE 
J013170I01CACTGACANONE 
J033144L08CACTGACANONE 
J033145L08CACTGACANONE 
J043004E24CACTGACANONE 
J065032A08CACTGACANONE 
J065166F03CACTGACANONE 
J075174D13CACTGACANONE 
J100019I19CACTGACANONE 
J100073F13CACTGACANONE 
Os02g0725100AK071759CACTGACAAGTGGGACCCNONE 
Os02g0732600AK108709TGTCAGTGSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os02g0735200015-035-A06CCACTGACANONE 
015-048-A05CCACTGACANONE 
015-091-A06CCACTGACANONE 
016-082-G07CCACTGACANONE 
016-086-G04CCACTGACANONE 
AB037595CCACTGACANONE 
AK061157CCACTGACANONE 
AK071969CCACTGACANONE 
AK104987CCACTGACANONE 
AK109397CCACTGACAGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28). 
X14245CCACTGACANONE 
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein. 
AK108072AAAAGCCCCACATGTCAGTGACACNONE 
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE 
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE 
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE 
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE 
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE 
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE 
Os02g0759500AK072404TGTCAGTGGProtein prenyltransferase domain containing protein. 
AK110954TGTCAGTGGNONE 
J023077D13TGTCAGTGGNONE 
J065053L15TGTCAGTGGNONE 
J065087D20TGTCAGTGGNONE 
Os02g0761600AK120494CCACTGACAConserved hypothetical protein. 
AK120494TGTCAGTGConserved hypothetical protein. 
Os02g0766700AK072062ATCCCCCACACCACTGACASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09ATCCCCCACACCACTGACANONE 
Os02g0773300AK071811CACTGACAPyridoxal phosphate-dependent deaminase family protein. 
J013056D10CACTGACANONE 
J013096G18CACTGACANONE 
Os02g0781700006-066-G01CACTGACANONE 
006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03CACTGACANONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04CACTGACANONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791CACTGACAConserved hypothetical protein. 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223CACTGACANONE 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477CACTGACANONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09CACTGACANONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22CACTGACANONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11CACTGACANONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07CACTGACANONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23CACTGACANONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07CACTGACANONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01CACTGACANONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15CACTGACANONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0820400AK060511CACTGACANONE 
AK100771CACTGACATransferase family protein. 
J023120A02CACTGACANONE 
Os03g0100500013-056-B11TGTCAGTGNONE 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
AK101458CACTGACAProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013035K10CACTGACANONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10CACTGACANONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13CACTGACANONE 
Os03g0135300004-017-A10AGCCCATCTGTCAGTGNONE 
004-017-A10CTGTCAGTGNONE 
006-046-A11AGCCCATCTGTCAGTGNONE 
006-046-A11CTGTCAGTGNONE 
006-110-B05AGCCCATCTGTCAGTGNONE 
006-110-B05CTGTCAGTGNONE 
AF309384AGCCCATCTGTCAGTGNONE 
AF309384CTGTCAGTGNONE 
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK071745CTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK104680AGCCCATCTGTCAGTGNONE 
AK104680CTGTCAGTGNONE 
J013100M12AGCCCATCTGTCAGTGNONE 
J013100M12CTGTCAGTGNONE 
J023107J18AGCCCATCTGTCAGTGNONE 
J023107J18CTGTCAGTGNONE 
J033081B13AGCCCATCTGTCAGTGNONE 
J033081B13CTGTCAGTGNONE 
J033087L03AGCCCATCTGTCAGTGNONE 
J033087L03CTGTCAGTGNONE 
J065120N18AGCCCATCTGTCAGTGNONE 
J065120N18CTGTCAGTGNONE 
J075032C15AGCCCATCTGTCAGTGNONE 
J075032C15CTGTCAGTGNONE 
J075172P14AGCCCATCTGTCAGTGNONE 
J075172P14CTGTCAGTGNONE 
J090049B05AGCCCATCTGTCAGTGNONE 
J090049B05CTGTCAGTGNONE 
Os03g0138700009-045-H03TGTCAGTGNONE 
AK072119TGTCAGTGTGF-beta receptor, type I/II extracellular region family protein. 
J013025I16TGTCAGTGNONE 
J013123D02TGTCAGTGNONE 
J023048B09TGTCAGTGNONE 
J023048C09TGTCAGTGNONE 
J065027O03TGTCAGTGNONE 
J065028C03TGTCAGTGNONE 
J065080H22TGTCAGTGNONE 
J065102H03TGTCAGTGNONE 
J065137P14TGTCAGTGNONE 
J065143C23TGTCAGTGNONE 
J065168G06TGTCAGTGNONE 
J065192N07TGTCAGTGNONE 
J065205I11TGTCAGTGNONE 
J075040F03TGTCAGTGNONE 
J075052H20TGTCAGTGNONE 
J075118L18TGTCAGTGNONE 
J075126C19TGTCAGTGNONE 
J075173L07TGTCAGTGNONE 
Os03g0151800AK064955CACTGACANONE 
AK098874CACTGACANONE 
AK098980CACTGACANONE 
AK099712CACTGACANONE 
AK099889CACTGACANONE 
AK121641CACTGACASimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CACTGACANONE 
J013001D04CACTGACANONE 
J013121O12CACTGACANONE 
Os03g0151900009-084-F09CACTGACANONE 
AB032761CACTGACANONE 
AK105389CACTGACANONE 
AK121527CACTGACASimilar to Small GTP-binding protein. 
J075028M03CACTGACANONE 
J075031H15CACTGACANONE 
J075045L24CACTGACANONE 
J075055K14CACTGACANONE 
J075100O08CACTGACANONE 
J075112B20CACTGACANONE 
J075188D21CACTGACANONE 
Os03g0158800AK108516AGTGACACACTGACASimilar to P69C protein. 
J065013G11AGTGACACACTGACANONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0174200AK060616TGTCAGTGNONE 
AK103762TGTCAGTGConserved hypothetical protein. 
J033143G15TGTCAGTGNONE 
J090025L02TGTCAGTGNONE 
Os03g0199500J065099N05CCCACCTGTCAGTGNONE 
J065152P14CCCACCTGTCAGTGConserved hypothetical protein. 
J080009C14CCCACCTGTCAGTGNONE 
J080011K01CCCACCTGTCAGTGNONE 
J080015H12CCCACCTGTCAGTGNONE 
J080022K05CCCACCTGTCAGTGNONE 
J080034G01CCCACCTGTCAGTGNONE 
J080038I04CCCACCTGTCAGTGNONE 
J080039F20CCCACCTGTCAGTGNONE 
J080042J22CCCACCTGTCAGTGNONE 
J080042N23CCCACCTGTCAGTGNONE 
J080043E07CCCACCTGTCAGTGNONE 
J080050A12CCCACCTGTCAGTGNONE 
J080050C11CCCACCTGTCAGTGNONE 
J080052B01CCCACCTGTCAGTGNONE 
J080052H22CCCACCTGTCAGTGNONE 
J080060E02CCCACCTGTCAGTGNONE 
J080063K24CCCACCTGTCAGTGNONE 
J080067I07CCCACCTGTCAGTGNONE 
J080081H22CCCACCTGTCAGTGNONE 
J080085J10CCCACCTGTCAGTGNONE 
J080089E20CCCACCTGTCAGTGNONE 
J080092N04CCCACCTGTCAGTGNONE 
J080093B01CCCACCTGTCAGTGNONE 
J080093N04CCCACCTGTCAGTGNONE 
J080097B03CCCACCTGTCAGTGNONE 
Os03g0200400AK107086TGTCAGTGConserved hypothetical protein. 
Os03g0206400AK066494CCACTGACAConserved hypothetical protein. 
AK107011CCACTGACANONE 
J065162G04CCACTGACANONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0232600AK068218TGTCAGTGU box domain containing protein. 
J013114N10TGTCAGTGNONE 
J013146E12TGTCAGTGNONE 
J023034C23TGTCAGTGNONE 
J033030J03TGTCAGTGNONE 
J033050L03TGTCAGTGNONE 
J033122E16TGTCAGTGNONE 
J090018C20TGTCAGTGNONE 
J090053P15TGTCAGTGNONE 
J090096C17TGTCAGTGNONE 
Os03g0238800AY224467CCACTGACAConserved hypothetical protein. 
J013042E23CCACTGACANONE 
Os03g0239300AK066038CACTGACAZinc finger, C2H2-type domain containing protein. 
AK068149CACTGACANONE 
AK071768CACTGACANONE 
J053027G22CACTGACANONE 
J075048G23CACTGACANONE 
J100060G19CACTGACANONE 
Os03g0245500AK064707ATCCCCCACTGACACurculin-like (mannose-binding) lectin domain containing protein. 
J100045N08ATCCCCCACTGACANONE 
Os03g0251500AK101151CACTGACANONE 
AK119298CACTGACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0281600AK070260CACTGACASimilar to Ca2+-ATPase. 
Os03g0284500012-066-D02GTGGCCCACATGTCAGTGNONE 
AK105295GTGGCCCACATGTCAGTGNONE 
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein. 
Os03g0298300AK061180CTGTCAGTGProtein of unknown function DUF588 family protein. 
AK099089CTGTCAGTGNONE 
Os03g0320800AK103265TGTCAGTGNONE 
Os03g0322200009-102-F01CCACTGACANONE 
009-144-G06CCACTGACANONE 
016-048-D06CCACTGACANONE 
AK062978CCACTGACAConserved hypothetical protein. 
Os03g0340500012-007-F10CCACTGACANONE 
012-007-F10GGCCCCACGTGTCAGTGNONE 
AK099406CCACTGACANONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK102158CCACTGACASimilar to Sucrose synthase (EC 2.4.1.13). 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CCACTGACANONE 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013063E02CCACTGACANONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063I02CCACTGACANONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013157O07CCACTGACANONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J023131N05CCACTGACANONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J033033P05CCACTGACANONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033040N16CCACTGACANONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033044M19CCACTGACANONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033086F24CCACTGACANONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033097H01CCACTGACANONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033106C22CCACTGACANONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033128M13CCACTGACANONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033133I15CCACTGACANONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J043027A21CCACTGACANONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J090028A09CCACTGACANONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090053D06CCACTGACANONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090083O17CCACTGACANONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090099H10CCACTGACANONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J100036M05CCACTGACANONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0422300012-087-G12TGTCAGTGNONE 
AK063543TGTCAGTGConserved hypothetical protein. 
J090010I02TGTCAGTGNONE 
J090079A01TGTCAGTGNONE 
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein. 
J033052N01CCCACGTGTCAGTGNONE 
Os03g0666200AK102364CACTGACAGPleckstrin homology-type domain containing protein. 
J033097E16CACTGACAGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0699700AB099850CACTGACA9-lipoxigenase. 
AK103565CACTGACANONE 
J033041M05CACTGACANONE 
J033074I05CACTGACANONE 
J033105I23CACTGACANONE 
J033126I24CACTGACANONE 
J033132L12CACTGACANONE 
Os03g0700700J023073A19CACTGACANONE 
J023079P11CACTGACANONE 
J023143H13CACTGACANONE 
J023143O17CACTGACANONE 
J033028E14CACTGACANONE 
J033050I07CACTGACANONE 
J033121L11CACTGACANONE 
J090086O16CACTGACANONE 
Os03g0709100AK061596CACTGACASimilar to Basic blue protein (Cusacyanin) (Plantacyanin) (CBP). 
J065217M09CACTGACANONE 
J080302M03CACTGACANONE 
J080306M12CACTGACANONE 
J080311O17CACTGACANONE 
J080313D12CACTGACANONE 
J080318C19CACTGACANONE 
J080319E08CACTGACANONE 
J090085H23CACTGACANONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0746700015-015-E02CACTGACANONE 
015-059-G01CACTGACANONE 
015-073-C05CACTGACANONE 
AK068199CACTGACAConserved hypothetical protein. 
J075066J09CACTGACANONE 
J100025E14CACTGACANONE 
Os03g0780400011-100-D09CCACTGACANONE 
011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCACTGACANONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCACTGACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCACTGACANONE 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCACTGACANONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCACTGACANONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCACTGACANONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCACTGACANONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0798300AK108034CACTGACASimilar to Cytosine-5 DNA methyltransferase MET1 (Fragment). 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE 
014-009-H06CCACTGACAAGTGGGTCCCNONE 
014-025-G05CCACTGACAAGTGGGTCCCNONE 
014-033-G02CCACTGACAAGTGGGTCCCNONE 
014-038-G06CCACTGACAAGTGGGTCCCNONE 
014-047-H10CCACTGACAAGTGGGTCCCNONE 
014-054-H04CCACTGACAAGTGGGTCCCNONE 
014-055-F05CCACTGACAAGTGGGTCCCNONE 
014-075-E04CCACTGACAAGTGGGTCCCNONE 
014-084-B02CCACTGACAAGTGGGTCCCNONE 
014-087-F10CCACTGACAAGTGGGTCCCNONE 
014-098-D02CCACTGACAAGTGGGTCCCNONE 
014-099-B04CCACTGACAAGTGGGTCCCNONE 
014-100-H10CCACTGACAAGTGGGTCCCNONE 
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein. 
AK102425CCACTGACAAGTGGGTCCCNONE 
J065134M15CCACTGACAAGTGGGTCCCNONE 
J090053B16CCACTGACAAGTGGGTCCCNONE 
Os03g0832200AK070712TGTCAGTGSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
AK068346TGTCAGTGStreptomyces cyclase/dehydrase family protein. 
Os03g0839900AK067347CTGTCAGTGACACUspA domain containing protein. 
Os04g0389800AK109628CACTGACASimilar to Acetohydroxyacid synthase. 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0416900J080302P15TGTCAGTGNONE 
J080312A22TGTCAGTGNONE 
Os04g0475600AK105400CACTGACANONE 
AK121520CACTGACA2OG-Fe(II) oxygenase domain containing protein. 
J065167F22CACTGACANONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0503500AK099404CCACTGACALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK099404TGTCAGTGLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CCACTGACANONE 
AK101695TGTCAGTGNONE 
Os04g0504700AK068596CCTGTCAGTGConserved hypothetical protein. 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0549300AK063296CCACTGACASimilar to GA protein (Fragment). 
J065073I11CCACTGACANONE 
J065172C13CCACTGACANONE 
J090004B10CCACTGACANONE 
J090039N18CCACTGACANONE 
J090088F09CCACTGACANONE 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
Os04g0662400AK108652CACTGACAAuxin responsive SAUR protein family protein. 
Os04g0675300AK111982CACTGACANONE 
Os04g0682800AK068406CACTGACANONE 
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein. 
J065021K04CACTGACAGTGGGTCCNONE 
J065097E18CACTGACAGTGGGTCCNONE 
J075004C12CACTGACAGTGGGTCCNONE 
J080301H10CACTGACAGTGGGTCCNONE 
J090087N02CACTGACAGTGGGTCCNONE 
J100060E19CACTGACAGTGGGTCCNONE 
Os04g0687900009-068-D03CCACTGACACGTGGGNONE 
015-097-H12CCACTGACACGTGGGNONE 
AK062547CCACTGACACGTGGGNONE 
AK066910CCACTGACACGTGGGNONE 
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333CCACTGACACGTGGGNONE 
J013023N16CCACTGACACGTGGGNONE 
J013031I07CCACTGACACGTGGGNONE 
J013063L06CCACTGACACGTGGGNONE 
J013091C11CCACTGACACGTGGGNONE 
J013123M06CCACTGACACGTGGGNONE 
J013126D14CCACTGACACGTGGGNONE 
J023023E09CCACTGACACGTGGGNONE 
J023039C19CCACTGACACGTGGGNONE 
J023068D23CCACTGACACGTGGGNONE 
J023080C21CCACTGACACGTGGGNONE 
J033092J17CCACTGACACGTGGGNONE 
J033112P12CCACTGACACGTGGGNONE 
J033135O08CCACTGACACGTGGGNONE 
J053023C13CCACTGACACGTGGGNONE 
J065030O05CCACTGACACGTGGGNONE 
J065065P07CCACTGACACGTGGGNONE 
J065190O06CCACTGACACGTGGGNONE 
J090011M19CCACTGACACGTGGGNONE 
J090061F08CCACTGACACGTGGGNONE 
J090064H09CCACTGACACGTGGGNONE 
J090064P11CCACTGACACGTGGGNONE 
Os05g0110100009-015-D08TGTCAGTGNONE 
009-023-C09TGTCAGTGNONE 
009-031-B11TGTCAGTGNONE 
009-034-C02TGTCAGTGNONE 
009-050-B08TGTCAGTGNONE 
009-065-D12TGTCAGTGNONE 
009-090-G08TGTCAGTGNONE 
009-111-H07TGTCAGTGNONE 
009-136-F12TGTCAGTGNONE 
009-138-E06TGTCAGTGNONE 
009-138-G12TGTCAGTGNONE 
009-141-D08TGTCAGTGNONE 
009-143-D01TGTCAGTGNONE 
009-179-D09TGTCAGTGNONE 
009-179-E03TGTCAGTGNONE 
009-196-A09TGTCAGTGNONE 
009-199-F04TGTCAGTGNONE 
013-021-E05TGTCAGTGNONE 
013-076-C04TGTCAGTGNONE 
013-096-F06TGTCAGTGNONE 
014-071-A05TGTCAGTGNONE 
014-077-F09TGTCAGTGNONE 
AK099779TGTCAGTGNONE 
AK121142TGTCAGTGConserved hypothetical protein. 
J013095A16TGTCAGTGNONE 
J013111A17TGTCAGTGNONE 
J013132G04TGTCAGTGNONE 
J023077M04TGTCAGTGNONE 
J065001B11TGTCAGTGNONE 
J065001E11TGTCAGTGNONE 
J065057G10TGTCAGTGNONE 
J065057L08TGTCAGTGNONE 
J065080E07TGTCAGTGNONE 
J065087K10TGTCAGTGNONE 
J065091M15TGTCAGTGNONE 
J065167A15TGTCAGTGNONE 
J075018F02TGTCAGTGNONE 
J075063F20TGTCAGTGNONE 
J075064F18TGTCAGTGNONE 
J075066N19TGTCAGTGNONE 
J075073I02TGTCAGTGNONE 
J075080P17TGTCAGTGNONE 
J075081F11TGTCAGTGNONE 
J075085E03TGTCAGTGNONE 
J075101G18TGTCAGTGNONE 
J075149N08TGTCAGTGNONE 
J075158I21TGTCAGTGNONE 
J075161M20TGTCAGTGNONE 
J075190F12TGTCAGTGNONE 
J075194K16TGTCAGTGNONE 
J080001E08TGTCAGTGNONE 
J080001F21TGTCAGTGNONE 
J080001H19TGTCAGTGNONE 
J080001O15TGTCAGTGNONE 
J080005I22TGTCAGTGNONE 
J080006K23TGTCAGTGNONE 
J080014D20TGTCAGTGNONE 
J080014I05TGTCAGTGNONE 
J080014K21TGTCAGTGNONE 
J080017I24TGTCAGTGNONE 
J080017K11TGTCAGTGNONE 
J080018F11TGTCAGTGNONE 
J080022L18TGTCAGTGNONE 
J080024N23TGTCAGTGNONE 
J080027J23TGTCAGTGNONE 
J080029B14TGTCAGTGNONE 
J080032F14TGTCAGTGNONE 
J080032K19TGTCAGTGNONE 
J080032O21TGTCAGTGNONE 
J080033P17TGTCAGTGNONE 
J080034I06TGTCAGTGNONE 
J080039F24TGTCAGTGNONE 
J080040O13TGTCAGTGNONE 
J080042B02TGTCAGTGNONE 
J080043E12TGTCAGTGNONE 
J080043J15TGTCAGTGNONE 
J080043N09TGTCAGTGNONE 
J080052J08TGTCAGTGNONE 
J080053K01TGTCAGTGNONE 
J080053K19TGTCAGTGNONE 
J080055J09TGTCAGTGNONE 
J080058D07TGTCAGTGNONE 
J080062F11TGTCAGTGNONE 
J080063J24TGTCAGTGNONE 
J080066H04TGTCAGTGNONE 
J080066I09TGTCAGTGNONE 
J080067B02TGTCAGTGNONE 
J080067N09TGTCAGTGNONE 
J080068D22TGTCAGTGNONE 
J080068K13TGTCAGTGNONE 
J080069N19TGTCAGTGNONE 
J080070D07TGTCAGTGNONE 
J080070E05TGTCAGTGNONE 
J080071G04TGTCAGTGNONE 
J080077G05TGTCAGTGNONE 
J080077O06TGTCAGTGNONE 
J080085F05TGTCAGTGNONE 
J080086E07TGTCAGTGNONE 
J080089G16TGTCAGTGNONE 
J080092K15TGTCAGTGNONE 
J080094A08TGTCAGTGNONE 
J080097A09TGTCAGTGNONE 
J080097J07TGTCAGTGNONE 
J090027N01TGTCAGTGNONE 
J090081J05TGTCAGTGNONE 
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein. 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0135200J100023D22TGTCAGTGNONE 
J100049H03TGTCAGTGNONE 
J100050K11TGTCAGTGNONE 
J100053B03TGTCAGTGHaem peroxidase family protein. 
J100072E18TGTCAGTGNONE 
Os05g0137200006-023-A08CACTGACANONE 
006-026-D10CACTGACANONE 
AK059748CACTGACANONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0148600003-016-C11CCACTGACAGGNONE 
AK066168CCACTGACAGGNONE 
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter. 
AY360145CCACTGACAGGNONE 
J013055J22CCACTGACAGGNONE 
J013057M24CCACTGACAGGNONE 
J013074N03CCACTGACAGGNONE 
J013158A22CCACTGACAGGNONE 
J075118H09CCACTGACAGGNONE 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
Os05g0186900AK111403TGTCAGTGConserved hypothetical protein. 
Os05g0207700AK102665CACTGACANONE 
AK103861CACTGACASimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0319800AK100483TGTCAGTGGSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6). 
Os05g0323100AK109472CACTGACARhodanese-like domain containing protein. 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE 
AK064069CCACTGACACGTGGACCNONE 
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein. 
J065038M01CCACTGACACGTGGACCNONE 
J065121C16CCACTGACACGTGGACCNONE 
J075173E09CCACTGACACGTGGACCNONE 
J080307A20CCACTGACACGTGGACCNONE 
J090046B19CCACTGACACGTGGACCNONE 
J100033N12CCACTGACACGTGGACCNONE 
J100036G01CCACTGACACGTGGACCNONE 
J100057B19CCACTGACACGTGGACCNONE 
Os05g0389800AK108808CACTGACASimilar to ATP-dependent helicase DHX8 (RNA helicase HRH1) (DEAH-box protein 8). 
Os05g0408200AK100057CACTGACASBP domain containing protein. 
J065182F20CACTGACANONE 
Os05g0467300006-113-H02CCACTGACANONE 
006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873CCACTGACASelT/selW/selH selenoprotein family protein. 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945CCACTGACANONE 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09CCACTGACANONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17CCACTGACANONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01CCACTGACANONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05CCACTGACANONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20CCACTGACANONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0490900AK111382CACTGACAConserved hypothetical protein. 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0505900AK105820TGTCAGTGNONE 
AK106936TGTCAGTGConserved hypothetical protein. 
Os05g0519900AK101078TGTCAGTGGNONE 
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560CACTGACATGTGGGCCGCNONE 
AY373258CACTGACATGTGGGCCGCNONE 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os05g0535900AK101539TGTCAGTGNONE 
AK101555TGTCAGTGIQ calmodulin-binding region domain containing protein. 
J013047J05TGTCAGTGNONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0557800009-156-G05AGGGCCCACTGTCAGTGNONE 
013-049-C12AGGGCCCACTGTCAGTGNONE 
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor. 
AK105327AGGGCCCACTGTCAGTGNONE 
J013153H24AGGGCCCACTGTCAGTGNONE 
J023003F16AGGGCCCACTGTCAGTGNONE 
J065216G02AGGGCCCACTGTCAGTGNONE 
J075037C20AGGGCCCACTGTCAGTGNONE 
J100032H16AGGGCCCACTGTCAGTGNONE 
Os05g0567100AK100749TGTCAGTGNONE 
J023118K01TGTCAGTGNONE 
Os06g0108100Os06g0108100TGTCAGTGNONE 
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0130500014-030-B02TGTCAGTGNONE 
AK105360TGTCAGTGSimilar to Cyclophilin-like protein PPIL3b. 
J065114L20TGTCAGTGNONE 
J075009J22TGTCAGTGNONE 
J100030K17TGTCAGTGNONE 
J100040E03TGTCAGTGNONE 
J100041F14TGTCAGTGNONE 
Os06g0136000AK060303CACTGACASimilar to Hypersensitive-induced reaction protein 4. 
AK102678CACTGACANONE 
J075185K19CACTGACANONE 
J090028C16CACTGACANONE 
J090099N12CACTGACANONE 
J100070O10CACTGACANONE 
Os06g0136600AK069316CACTGACATGTGGGCCCTSimilar to Enolase 1 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1). 
J075010L23CACTGACATGTGGGCCCTNONE 
Os06g0168700011-054-F04CACTGACAGNONE 
012-001-G03CACTGACAGNONE 
AK101305CACTGACAGNONE 
AK103637CACTGACAGSimilar to Prolin rich protein. 
J075082N06CACTGACAGNONE 
J100086I19CACTGACAGNONE 
Os06g0194400AK102980CACTGACAAGTGGGCCCACTTranscriptional factor B3 family protein. 
Os06g0199300J065045H01CACTGACATGTGGGCCCTNONE 
J075177C22CACTGACATGTGGGCCCTNONE 
J080068H06CACTGACATGTGGGCCCTNONE 
J090048F01CACTGACATGTGGGCCCTNONE 
J100066F17CACTGACATGTGGGCCCTNONE 
Os06g0209300AK066363TGTCAGTGNONE 
Os06g0224900AK065678TGTCAGTGGMitochodrial transcription termination factor-related family protein. 
AK105790TGTCAGTGGNONE 
Os06g0226600006-083-D04CACTGACANONE 
AK061806CACTGACANONE 
AK102752CACTGACATB2/DP1 and HVA22 related protein family protein. 
J013089J11CACTGACANONE 
J033106M05CACTGACANONE 
J100044M21CACTGACANONE 
J100056E06CACTGACANONE 
J100059F06CACTGACANONE 
Os06g0233000009-177-C07CACTGACANONE 
009-177-C07CACTGACANONE 
AK063118CACTGACAConserved hypothetical protein. 
AK063118CACTGACAConserved hypothetical protein. 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK121885CACTGACATGTGGGCCCCACANONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
Os06g0603000AK068856CACTGACANONE 
AK104955CACTGACASimilar to Heme oxygenase 1 (Fragment). 
Os06g0604000006-085-H11CCACTGACAGNONE 
AK061163CCACTGACAGNONE 
AK066422CCACTGACAGSimilar to Ethylene response factor 1. 
J065063N22CCACTGACAGNONE 
J065099J09CCACTGACAGNONE 
J090023J05CCACTGACAGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
AK110866CCACTGACAConserved hypothetical protein. 
Os06g0633900Os06g0633900TGTCAGTGGEsterase/lipase/thioesterase domain containing protein. 
Os06g0649000AK119644CACTGACANONE 
Os06g0695900011-023-F07CTGTCAGTGGNONE 
J023143A16CTGTCAGTGGZinc finger, RING-type domain containing protein. 
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE 
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein. 
Os06g0708500AK060865CACTGACANONE 
AK072490CACTGACASimilar to Cyclophilin. 
J013052B11CACTGACANONE 
J013052B13CACTGACANONE 
J065214H07CACTGACANONE 
J075192D20CACTGACANONE 
J090090C15CACTGACANONE 
J100051J18CACTGACANONE 
J100055A07CACTGACANONE 
J100060B10CACTGACANONE 
J100061D02CACTGACANONE 
Os06g0714000AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein. 
J023020A02CCCACCTGTCAGTGNONE 
J023039H03CCCACCTGTCAGTGNONE 
J100042E23CCCACCTGTCAGTGNONE 
J100069N01CCCACCTGTCAGTGNONE 
J100089L13CCCACCTGTCAGTGNONE 
Os06g0715500AK059749CTGTCAGTGGNONE 
AK060137CTGTCAGTGGNONE 
AK100782CTGTCAGTGGSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha). 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0147600AK099551CACTGACAGNONE 
AK102834CACTGACAGProtein kinase-like domain containing protein. 
J090004P22CACTGACAGNONE 
J090040K07CACTGACAGNONE 
J090044I03CACTGACAGNONE 
J090060I04CACTGACAGNONE 
J090063O16CACTGACAGNONE 
J090072C03CACTGACAGNONE 
J090072E05CACTGACAGNONE 
J090091P08CACTGACAGNONE 
J090099P14CACTGACAGNONE 
Os07g0166800006-038-C11TGTCAGTGNONE 
012-080-F02TGTCAGTGNONE 
AK070524TGTCAGTGRad6 (Ubiquitin carrier protein). 
AK121382TGTCAGTGNONE 
J023022D19TGTCAGTGNONE 
J023055G02TGTCAGTGNONE 
J023073E02TGTCAGTGNONE 
J023125B08TGTCAGTGNONE 
J023127H21TGTCAGTGNONE 
J033052G01TGTCAGTGNONE 
J033067F13TGTCAGTGNONE 
J065046L14TGTCAGTGNONE 
J065178D11TGTCAGTGNONE 
J065205N17TGTCAGTGNONE 
J075006K17TGTCAGTGNONE 
J075051D20TGTCAGTGNONE 
J075109L04TGTCAGTGNONE 
J090024K15TGTCAGTGNONE 
J090025N04TGTCAGTGNONE 
J090049N09TGTCAGTGNONE 
J090070N12TGTCAGTGNONE 
J090078O21TGTCAGTGNONE 
J090083L07TGTCAGTGNONE 
J100063K16TGTCAGTGNONE 
J100083D14TGTCAGTGNONE 
Os07g0173200AK061624CACTGACAFrigida-like family protein. 
AK065275CACTGACANONE 
AK098856CACTGACANONE 
AK098899CACTGACANONE 
Os07g0182100AK066734CACTGACANONE 
AK104002CACTGACASimilar to Tryptophan synthase alpha chain. 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0213600AK107696CCACTGACAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CCACTGACANONE 
J100082J05CCACTGACANONE 
Os07g0479300AK120117CACTGACAGGPeptidase S10, serine carboxypeptidase family protein. 
D17587CACTGACAGGNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0501900AK067791CACTGACAAGTGGGCCCCANONE 
AK120759CACTGACAAGTGGGCCCCANONE 
Os07g0522500AK105311TGTCAGTGGSimilar to PDR6 ABC transporter. 
Os07g0541600AK110523TGTCAGTGHypothetical protein. 
Os07g0565800009-114-F12TGTCAGTGNONE 
AK062834TGTCAGTGConserved hypothetical protein. 
J065026L16TGTCAGTGNONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0568500006-112-B12TGTCAGTGNONE 
009-073-H04TGTCAGTGNONE 
AK059994TGTCAGTGNONE 
AK100091TGTCAGTGNONE 
AK109391TGTCAGTGConserved hypothetical protein. 
J023003J19TGTCAGTGNONE 
J033023F10TGTCAGTGNONE 
J065162D02TGTCAGTGNONE 
J080025G21TGTCAGTGNONE 
J090022G10TGTCAGTGNONE 
J090070E15TGTCAGTGNONE 
Os07g0569100013-067-E02CACTGACANONE 
013-081-C06CACTGACANONE 
014-030-G06CACTGACANONE 
014-034-H09CACTGACANONE 
AK120160CACTGACARemorin, C-terminal region domain containing protein. 
J090034F20CACTGACANONE 
Os07g0569700009-185-D05CACTGACANONE 
AK062388CACTGACAZinc finger, C2H2-type domain containing protein. 
Os07g0601900AK105572CACTGACASimilar to NADPH HC toxin reductase (Fragment). 
Os07g0631900AK061072CACTGACAGTGGGCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0637300AF323611CCACTGACANONE 
AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACANONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACANONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0641400009-078-A04TGTCAGTGNONE 
AK062634TGTCAGTGHypothetical protein. 
Os07g0661400006-083-E05CCACTGACANONE 
006-084-B12CCACTGACANONE 
006-096-B03CCACTGACANONE 
009-013-C12CCACTGACANONE 
009-017-C10CCACTGACANONE 
009-027-A02CCACTGACANONE 
009-035-A06CCACTGACANONE 
009-047-H11CCACTGACANONE 
009-050-B11CCACTGACANONE 
009-051-C02CCACTGACANONE 
009-089-G06CCACTGACANONE 
009-091-C05CCACTGACANONE 
009-095-B11CCACTGACANONE 
009-151-C01CCACTGACANONE 
009-154-F06CCACTGACANONE 
009-169-F02CCACTGACANONE 
009-171-G01CCACTGACANONE 
009-179-F07CCACTGACANONE 
013-018-H06CCACTGACANONE 
013-024-E05CCACTGACANONE 
013-038-F09CCACTGACANONE 
013-099-F06CCACTGACANONE 
014-042-E09CCACTGACANONE 
014-086-C02CCACTGACANONE 
014-093-B08CCACTGACANONE 
015-039-G11CCACTGACANONE 
016-036-E05CCACTGACANONE 
AK068814CCACTGACANONE 
AK102682CCACTGACANONE 
AK105973CCACTGACANONE 
AK107202CCACTGACAConserved hypothetical protein. 
J053035N21CCACTGACANONE 
J053099D11CCACTGACANONE 
J065023B18CCACTGACANONE 
J065031M15CCACTGACANONE 
J065035G23CCACTGACANONE 
J065060M18CCACTGACANONE 
J065073J18CCACTGACANONE 
J065103E20CCACTGACANONE 
J065105N19CCACTGACANONE 
J065137A08CCACTGACANONE 
J065152K09CCACTGACANONE 
J065156M12CCACTGACANONE 
J065162G23CCACTGACANONE 
J065162L13CCACTGACANONE 
J065163H16CCACTGACANONE 
J065165E06CCACTGACANONE 
J065171J04CCACTGACANONE 
J065180L23CCACTGACANONE 
J065183K23CCACTGACANONE 
J065186H13CCACTGACANONE 
J065195D10CCACTGACANONE 
J065209G11CCACTGACANONE 
J075006J08CCACTGACANONE 
J075112O07CCACTGACANONE 
J080301H14CCACTGACANONE 
J100058C17CCACTGACANONE 
J100077I23CCACTGACANONE 
J100080I24CCACTGACANONE 
Os07g0679300AK065079CACTGACATGTGGGCCCCACANONE 
AK099229CACTGACATGTGGGCCCCACASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CACTGACATGTGGGCCCCACANONE 
J013049N18CACTGACATGTGGGCCCCACANONE 
J013071C14CACTGACATGTGGGCCCCACANONE 
J013088P15CACTGACATGTGGGCCCCACANONE 
J013092D24CACTGACATGTGGGCCCCACANONE 
J013093O14CACTGACATGTGGGCCCCACANONE 
J023095E17CACTGACATGTGGGCCCCACANONE 
J043005E21CACTGACATGTGGGCCCCACANONE 
J043015E06CACTGACATGTGGGCCCCACANONE 
J043027P22CACTGACATGTGGGCCCCACANONE 
J065038B15CACTGACATGTGGGCCCCACANONE 
J065073M21CACTGACATGTGGGCCCCACANONE 
J065165P06CACTGACATGTGGGCCCCACANONE 
J065198I06CACTGACATGTGGGCCCCACANONE 
J075007E08CACTGACATGTGGGCCCCACANONE 
J075038I07CACTGACATGTGGGCCCCACANONE 
J075130L20CACTGACATGTGGGCCCCACANONE 
J090057G17CACTGACATGTGGGCCCCACANONE 
J100029K23CACTGACATGTGGGCCCCACANONE 
J100086O16CACTGACATGTGGGCCCCACANONE 
J100087M02CACTGACATGTGGGCCCCACANONE 
Os07g0694500012-083-C10CACTGACANONE 
AK072101CACTGACANONE 
AK103290CACTGACANONE 
AK105310CACTGACAHMG-I and HMG-Y, DNA-binding domain containing protein. 
J023062C13CACTGACANONE 
J033124O22CACTGACANONE 
J100047D19CACTGACANONE 
J100056D03CACTGACANONE 
Os08g0114400009-103-H04CCACTGACANONE 
AK063165CCACTGACAConserved hypothetical protein. 
Os08g0115800AK109860CACTGACASimilar to NAM (No apical meristem)-like protein (No apical meristem family protein). 
Os08g0116400006-081-D11CCACTGACANONE 
006-090-D05CCACTGACANONE 
AK061804CCACTGACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103042CCACTGACANONE 
J033086K15CCACTGACANONE 
J065005G03CCACTGACANONE 
J065010M18CCACTGACANONE 
J065025G07CCACTGACANONE 
J065027C08CCACTGACANONE 
J065061M11CCACTGACANONE 
J065132K02CCACTGACANONE 
J065143J05CCACTGACANONE 
J065170E23CCACTGACANONE 
J065210I02CCACTGACANONE 
J090017N12CCACTGACANONE 
J090022C02CCACTGACANONE 
J090049B17CCACTGACANONE 
J090052B14CCACTGACANONE 
J090072D03CCACTGACANONE 
J100019C06CCACTGACANONE 
J100028N03CCACTGACANONE 
J100032N18CCACTGACANONE 
J100046E01CCACTGACANONE 
Os08g0120000006-042-E02GGCCCCACATGTCAGTGNONE 
006-051-F06GGCCCCACATGTCAGTGNONE 
006-052-G03GGCCCCACATGTCAGTGNONE 
006-095-B11GGCCCCACATGTCAGTGNONE 
AB017427GGCCCCACATGTCAGTGNONE 
AB017428GGCCCCACATGTCAGTGNONE 
AK059789GGCCCCACATGTCAGTGNONE 
AK059815GGCCCCACATGTCAGTGSuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077GGCCCCACATGTCAGTGNONE 
AK102607GGCCCCACATGTCAGTGNONE 
AK104303GGCCCCACATGTCAGTGNONE 
AK104304GGCCCCACATGTCAGTGNONE 
AK104421GGCCCCACATGTCAGTGNONE 
D10414GGCCCCACATGTCAGTGNONE 
J013170D08GGCCCCACATGTCAGTGNONE 
J023086D16GGCCCCACATGTCAGTGNONE 
J033099B04GGCCCCACATGTCAGTGNONE 
J065042P05GGCCCCACATGTCAGTGNONE 
J065144E22GGCCCCACATGTCAGTGNONE 
J065162J20GGCCCCACATGTCAGTGNONE 
J065196N13GGCCCCACATGTCAGTGNONE 
J090013B11GGCCCCACATGTCAGTGNONE 
Os08g0121900AK101512CACTGACAGGProtein of unknown function DUF23 family protein. 
Os08g0128200AK120428CCACTGACAConserved hypothetical protein. 
Os08g0143400015-006-A10CACTGACAAGTGGGACCCACNONE 
AK066792CACTGACAAGTGGGACCCACNONE 
AK120532CACTGACAAGTGGGACCCACSWIRM domain containing protein. 
J100083F02CACTGACAAGTGGGACCCACNONE 
Os08g0157900012-025-H08CCACTGACAGGNONE 
012-069-E02CCACTGACAGGNONE 
012-074-H11CCACTGACAGGNONE 
AK065294CCACTGACAGGSimilar to NAM protein. 
J013002N10CCACTGACAGGNONE 
J013042J10CCACTGACAGGNONE 
J023060K03CCACTGACAGGNONE 
J023145N12CCACTGACAGGNONE 
J033040L20CCACTGACAGGNONE 
J033044L13CCACTGACAGGNONE 
J033057C19CCACTGACAGGNONE 
J033107E01CCACTGACAGGNONE 
J033123M07CCACTGACAGGNONE 
J033136I18CCACTGACAGGNONE 
J065051P18CCACTGACAGGNONE 
J065055L08CCACTGACAGGNONE 
J065196D15CCACTGACAGGNONE 
Os08g0192800AK059490ATGGCCCACATGTCAGTGNONE 
AK101678ATGGCCCACATGTCAGTGNONE 
AK120613ATGGCCCACATGTCAGTGBromodomain containing protein. 
J080039B22ATGGCCCACATGTCAGTGNONE 
J080039I23ATGGCCCACATGTCAGTGNONE 
J080074D19ATGGCCCACATGTCAGTGNONE 
J080086N13ATGGCCCACATGTCAGTGNONE 
Os08g0351700AK109269TGTCAGTGConserved hypothetical protein. 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0408200AK111715CACTGACAGSimilar to GAMYB-binding protein (Fragment). 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
009-168-F06GCCACGTGTCAGTGGNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK061339GCCACGTGTCAGTGGConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
AK101198GCCACGTGTCAGTGGNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J033030L06GCCACGTGTCAGTGGNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100036D08GCCACGTGTCAGTGGNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
J100052I22GCCACGTGTCAGTGGNONE 
Os08g0450100AK058651CTGTCAGTGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
J090084L01CTGTCAGTGNONE 
Os08g0467400AK070501CCACTGACAZinc/iron permease family protein. 
AK102279CCACTGACANONE 
AK105607CCACTGACANONE 
Os08g0490300011-064-F08CACTGACANONE 
015-050-C06CACTGACANONE 
AK066895CACTGACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22CACTGACANONE 
J090060F02CACTGACANONE 
Os08g0503800AK101954CACTGACATGTGGGCCCCACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0517200AK058787CACTGACANONE 
Os08g0519100011-019-F03CACTGACANONE 
011-035-H12CACTGACANONE 
AK063287CACTGACANONE 
AK063323CACTGACAPlant-specific FAD-dependent oxidoreductase family protein. 
J065046G23CACTGACANONE 
J065099P05CACTGACANONE 
Os08g0530300J100034H18CACTGACAExo70 exocyst complex subunit family protein. 
Os08g0536300AF358777CTGGCCCACTGACANONE 
AK099722CTGGCCCACTGACASimilar to Hd1. 
J100054G13CTGGCCCACTGACANONE 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os08g0547800006-110-B11CCCCACACTGACANONE 
AK106054CCCCACACTGACAEsterase/lipase/thioesterase domain containing protein. 
Os08g0560900003-019-H10CACTGACAGNONE 
003-112-D04CACTGACAGNONE 
003-116-A09CACTGACAGNONE 
006-058-C09CACTGACAGNONE 
006-095-B02CACTGACAGNONE 
006-105-B12CACTGACAGNONE 
009-006-E06CACTGACAGNONE 
009-029-C10CACTGACAGNONE 
009-032-C06CACTGACAGNONE 
009-032-F04CACTGACAGNONE 
009-032-H04CACTGACAGNONE 
009-037-E04CACTGACAGNONE 
009-038-F10CACTGACAGNONE 
009-043-H08CACTGACAGNONE 
009-059-C01CACTGACAGNONE 
009-097-B10CACTGACAGNONE 
009-102-A07CACTGACAGNONE 
009-105-C05CACTGACAGNONE 
009-108-H08CACTGACAGNONE 
009-115-B01CACTGACAGNONE 
009-123-B08CACTGACAGNONE 
009-127-D01CACTGACAGNONE 
009-138-B01CACTGACAGNONE 
009-148-D08CACTGACAGNONE 
009-148-E07CACTGACAGNONE 
009-155-E12CACTGACAGNONE 
009-161-A05CACTGACAGNONE 
009-163-C07CACTGACAGNONE 
009-168-E06CACTGACAGNONE 
009-177-A04CACTGACAGNONE 
009-177-E04CACTGACAGNONE 
009-179-E01CACTGACAGNONE 
009-184-F07CACTGACAGNONE 
009-185-G04CACTGACAGNONE 
009-197-C11CACTGACAGNONE 
AK061775CACTGACAGNONE 
AK120366CACTGACAGNONE 
AK120372CACTGACAGSimilar to Photosystem I reaction center subunit II, chloroplast precursor (Photosystem I 20 kDa subunit) (PSI-D). 
AY224449CACTGACAGNONE 
J013025F24CACTGACAGNONE 
J013042G23CACTGACAGNONE 
J013070L10CACTGACAGNONE 
J023014L18CACTGACAGNONE 
J023054N16CACTGACAGNONE 
J023142N18CACTGACAGNONE 
J065032D16CACTGACAGNONE 
J065040K22CACTGACAGNONE 
J065164K07CACTGACAGNONE 
J075005D03CACTGACAGNONE 
J075010M23CACTGACAGNONE 
J075048F22CACTGACAGNONE 
J075048J19CACTGACAGNONE 
J075078L10CACTGACAGNONE 
J075092N16CACTGACAGNONE 
J075153D24CACTGACAGNONE 
J075172E20CACTGACAGNONE 
J075177L06CACTGACAGNONE 
J075189P17CACTGACAGNONE 
J080001L20CACTGACAGNONE 
J080005G19CACTGACAGNONE 
J080005N23CACTGACAGNONE 
J080008G20CACTGACAGNONE 
J080010K19CACTGACAGNONE 
J080014H07CACTGACAGNONE 
J080017K02CACTGACAGNONE 
J080017O16CACTGACAGNONE 
J080021G13CACTGACAGNONE 
J080021L11CACTGACAGNONE 
J080022B21CACTGACAGNONE 
J080024G06CACTGACAGNONE 
J080024K22CACTGACAGNONE 
J080025L08CACTGACAGNONE 
J080025N05CACTGACAGNONE 
J080027P04CACTGACAGNONE 
J080028D10CACTGACAGNONE 
J080028G18CACTGACAGNONE 
J080028I16CACTGACAGNONE 
J080029P10CACTGACAGNONE 
J080033M20CACTGACAGNONE 
J080039P03CACTGACAGNONE 
J080042N05CACTGACAGNONE 
J080042O19CACTGACAGNONE 
J080043F22CACTGACAGNONE 
J080043L09CACTGACAGNONE 
J080043P06CACTGACAGNONE 
J080044C24CACTGACAGNONE 
J080044P09CACTGACAGNONE 
J080046B22CACTGACAGNONE 
J080046I24CACTGACAGNONE 
J080048C06CACTGACAGNONE 
J080048O05CACTGACAGNONE 
J080052G23CACTGACAGNONE 
J080052H20CACTGACAGNONE 
J080052P04CACTGACAGNONE 
J080058H24CACTGACAGNONE 
J080059E03CACTGACAGNONE 
J080061M10CACTGACAGNONE 
J080063M21CACTGACAGNONE 
J080064E12CACTGACAGNONE 
J080065A13CACTGACAGNONE 
J080066P16CACTGACAGNONE 
J080067F06CACTGACAGNONE 
J080069L01CACTGACAGNONE 
J080070P08CACTGACAGNONE 
J080072D01CACTGACAGNONE 
J080072H07CACTGACAGNONE 
J080075G22CACTGACAGNONE 
J080076N13CACTGACAGNONE 
J080078P22CACTGACAGNONE 
J080079A05CACTGACAGNONE 
J080081M15CACTGACAGNONE 
J080082B16CACTGACAGNONE 
J080083G16CACTGACAGNONE 
J080083K10CACTGACAGNONE 
J080085A07CACTGACAGNONE 
J080086F24CACTGACAGNONE 
J080090O18CACTGACAGNONE 
J080092M14CACTGACAGNONE 
J080095K06CACTGACAGNONE 
J080096G07CACTGACAGNONE 
J080096N05CACTGACAGNONE 
J080097B20CACTGACAGNONE 
J080097E08CACTGACAGNONE 
J080309D01CACTGACAGNONE 
J090096F03CACTGACAGNONE 
J100048I20CACTGACAGNONE 
Os09g0115600AK060378CACTGACAPhosphatidylinositol-specific phospholipase C, X region domain containing protein. 
AK099343CACTGACANONE 
J075023B01CACTGACANONE 
J075025L06CACTGACANONE 
Os09g0280500AK106988CCACTGACASimilar to Transcription factor HBP-1b(C38) (Fragment). 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
Os09g0321300AK122141TGTCAGTGNONE 
Os09g0338500AK058543CTGTCAGTGSimilar to Desaturase/cytochrome b5 protein. 
Os09g0380400009-200-D01CCCACCACACTGACANONE 
AK063909CCCACCACACTGACANONE 
AK072517CCCACCACACTGACAConserved hypothetical protein. 
AK073073CCCACCACACTGACANONE 
J065205F20CCCACCACACTGACANONE 
J100036D22CCCACCACACTGACANONE 
J100047M01CCCACCACACTGACANONE 
J100071G04CCCACCACACTGACANONE 
Os09g0407300AK069164CCACTGACANONE 
AK103905CCACTGACAConserved hypothetical protein. 
Os09g0460100006-087-B02CACTGACAGConserved hypothetical protein. 
J065208G04CACTGACAGNONE 
Os09g0467200006-086-D04TGTCAGTGTCACTNONE 
006-093-B03TGTCAGTGTCACTNONE 
006-115-F01TGTCAGTGTCACTNONE 
009-132-H11TGTCAGTGTCACTNONE 
AF402804TGTCAGTGTCACTNONE 
AK060223TGTCAGTGTCACTNONE 
AK061838TGTCAGTGTCACTNONE 
AK099489TGTCAGTGTCACTSimilar to Glutathione S-transferase GST 23 (EC 2.5.1.18) (Fragment). 
J013024P12TGTCAGTGTCACTNONE 
J013026J15TGTCAGTGTCACTNONE 
J013067O05TGTCAGTGTCACTNONE 
J023025K15TGTCAGTGTCACTNONE 
J023038N16TGTCAGTGTCACTNONE 
J033090D10TGTCAGTGTCACTNONE 
J033108J22TGTCAGTGTCACTNONE 
J033132E03TGTCAGTGTCACTNONE 
J043015F15TGTCAGTGTCACTNONE 
J065039I10TGTCAGTGTCACTNONE 
J065041G24TGTCAGTGTCACTNONE 
J065095G11TGTCAGTGTCACTNONE 
J065105A02TGTCAGTGTCACTNONE 
J065163M03TGTCAGTGTCACTNONE 
J065179I01TGTCAGTGTCACTNONE 
J065189F19TGTCAGTGTCACTNONE 
J065218F23TGTCAGTGTCACTNONE 
J075083K12TGTCAGTGTCACTNONE 
J080002H04TGTCAGTGTCACTNONE 
J090098I19TGTCAGTGTCACTNONE 
J100045A04TGTCAGTGTCACTNONE 
J100086O07TGTCAGTGTCACTNONE 
J100090L17TGTCAGTGTCACTNONE 
Os09g0474501J065129D17TGTCAGTGConserved hypothetical protein. 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
015-091-G11CACTGACANONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK068501CACTGACASimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK099237CACTGACANONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08CACTGACANONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01CACTGACANONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23CACTGACANONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11CACTGACANONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19CACTGACANONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12CACTGACANONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09CACTGACANONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06CACTGACANONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10CACTGACANONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05CACTGACANONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03CACTGACANONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16CACTGACANONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11CACTGACANONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07CACTGACANONE 
Os09g0495200AK102989CACTGACATATGGGCCCTConserved hypothetical protein. 
J075062H18CACTGACATATGGGCCCTNONE 
J075098G06CACTGACATATGGGCCCTNONE 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0518700AK064305CCACTGACANONE 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0529300AK066042CTGTCAGTGGGGCCCCANONE 
AY702437CTGTCAGTGGGGCCCCAConserved hypothetical protein. 
J013048L17CTGTCAGTGGGGCCCCANONE 
Os09g0554000J065123C23CACTGACAGGTGGSimilar to Mitochondrial phosphate transporter. 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os11g0112100J075033D01CCACTGACANONE 
J075074L17CCACTGACAHypothetical protein. 
J075120E08CCACTGACANONE 
Os11g0131900AK065240TGTCAGTGGGCCCCSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0137200J013093A11CCACTGACANONE 
J013093B11CCACTGACANONE 
J023131E04CCACTGACANONE 
J033128M14CCACTGACANONE 
J065169D05CCACTGACANONE 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0256200AK107906CACTGACAProtein of unknown function DUF842, eukaryotic family protein. 
J065007J01CACTGACANONE 
J065167G22CACTGACANONE 
J075001G14CACTGACANONE 
J075121L13CACTGACANONE 
Os11g0297300AK070171CACTGACASimilar to Beta-D-xylosidase. 
Os11g0437600J065181M02CCACTGACAProtein of unknown function DUF506, plant family protein. 
Os11g0484000012-001-D04CACGTCACTGACANONE 
012-001-D04CACTGACANONE 
AK065321CACGTCACTGACAClass II aldolase/adducin, N-terminal family protein. 
AK065321CACTGACAClass II aldolase/adducin, N-terminal family protein. 
J013002P15CACGTCACTGACANONE 
J013002P15CACTGACANONE 
Os11g0544000AK066017CACTGACAConserved hypothetical protein. 
AK071393CACTGACANONE 
J013050C10CACTGACANONE 
J013118O12CACTGACANONE 
Os11g0581900AK069449CACTGACAProtein of unknown function UPF0005 family protein. 
AK069449GGCCCCACATGTCAGTGProtein of unknown function UPF0005 family protein. 
Os11g0606500AK065351TGTCAGTGDisease resistance protein family protein. 
Os11g0617800009-105-D10TGTCAGTGNONE 
AK062778TGTCAGTGConserved hypothetical protein. 
Os12g0104700AK067342CACTGACAGProtein of unknown function DUF231, plant domain containing protein. 
J013106M21CACTGACAGNONE 
J053037L07CACTGACAGNONE 
J053094I07CACTGACAGNONE 
J065167K17CACTGACAGNONE 
J065168N12CACTGACAGNONE 
J075029F14CACTGACAGNONE 
J075130H08CACTGACAGNONE 
J075190L10CACTGACAGNONE 
Os12g0134000AK066940CCACTGACASimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0170400012-013-C12CACTGACAGNONE 
012-078-F04CACTGACAGNONE 
016-038-B08CACTGACAGNONE 
AK121826CACTGACAGZinc finger, C2H2-type domain containing protein. 
J033086P08CACTGACAGNONE 
J033099G14CACTGACAGNONE 
J065019L01CACTGACAGNONE 
J065093E18CACTGACAGNONE 
J065138J04CACTGACAGNONE 
J065139B14CACTGACAGNONE 
J065193K21CACTGACAGNONE 
J075005D01CACTGACAGNONE 
J075057B19CACTGACAGNONE 
J075061A15CACTGACAGNONE 
J075105N16CACTGACAGNONE 
J075146K15CACTGACAGNONE 
J100026B22CACTGACAGNONE 
Os12g0242500J065129F10TGTCAGTGNONE 
J090032G12TGTCAGTGConserved hypothetical protein. 
Os12g0285600AK069104TGTCAGTGOxysterol-binding protein family protein. 
Os12g0292900AK067612GTGTCACTGACAConserved hypothetical protein. 
Os12g0443700AK069541CACTGACASimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881CACTGACANONE 
Os12g0460800J023003J21CACTGACANONE 
J023003J21CACTGACACGTGGGCCACNONE 
Os12g0472800AK063278CACTGACAB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0502100Os12g0502100TGTCAGTGGConserved hypothetical protein. 
Os12g0503200014-087-C11CCTGTCAGTGGNONE 
AK105377CCTGTCAGTGGNONE 
Os12g0566900AK109171CCACTGACANONE 
Os12g0576700AK073512CACTGACASimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os12g0613500009-028-C05CACTGACANONE 
009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CACTGACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CACTGACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CACTGACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CACTGACALissencephaly type-1-like homology motif domain containing protein. 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CACTGACANONE 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0618300AK101466TGTCAGTGACACSimilar to GTP-binding protein-like (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.