version

Summary of OsREG511 (All List)

OrganismOryza sativa  
IDOsREG511  
SequenceCAGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2109  

Entry Sequences (2109 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0132800AK068422CCAGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0206700J023047B12TTTGGGCTGANONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE 
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein. 
Os01g0295900J065076G19TCAGCCCAAACNONE 
Os01g0305900Os01g0305900ACAGCCCAAAASimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0527700006-102-G07GTTTGGGCTGGNONE 
012-094-B11GTTTGGGCTGGNONE 
015-096-C04GTTTGGGCTGGNONE 
AK061861GTTTGGGCTGGProtoheme IX farnesyltransferase family protein. 
AK099005GTTTGGGCTGGNONE 
J013109B04GTTTGGGCTGGNONE 
J033057L14GTTTGGGCTGGNONE 
J090072H04GTTTGGGCTGGNONE 
J100030A14GTTTGGGCTGGNONE 
Os01g0555100AK111255TCAGCCCAAAASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0580300AK063468GCAGCCCAATConserved hypothetical protein. 
Os01g0620100AK070122ACAGCCCAACTWD40-like domain containing protein. 
J023044A10ACAGCCCAACTNONE 
J033023C13ACAGCCCAACTNONE 
J033045E16ACAGCCCAACTNONE 
J033111H03ACAGCCCAACTNONE 
Os01g0626300016-070-G04AATTGGGCTGTNONE 
016-070-G04CCAGCCCAAACNONE 
016-070-G04GCAGCCCAATANONE 
AK122071AATTGGGCTGTSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
AK122071CCAGCCCAAACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
AK122071GCAGCCCAATASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04AATTGGGCTGTNONE 
J023108I04CCAGCCCAAACNONE 
J023108I04GCAGCCCAATANONE 
J033117J08AATTGGGCTGTNONE 
J033117J08CCAGCCCAAACNONE 
J033117J08GCAGCCCAATANONE 
J065007O12AATTGGGCTGTNONE 
J065007O12CCAGCCCAAACNONE 
J065007O12GCAGCCCAATANONE 
J065020K12AATTGGGCTGTNONE 
J065020K12CCAGCCCAAACNONE 
J065020K12GCAGCCCAATANONE 
J065142D24AATTGGGCTGTNONE 
J065142D24CCAGCCCAAACNONE 
J065142D24GCAGCCCAATANONE 
J065157K19AATTGGGCTGTNONE 
J065157K19CCAGCCCAAACNONE 
J065157K19GCAGCCCAATANONE 
J080307H19AATTGGGCTGTNONE 
J080307H19CCAGCCCAAACNONE 
J080307H19GCAGCCCAATANONE 
J080311D16AATTGGGCTGTNONE 
J080311D16CCAGCCCAAACNONE 
J080311D16GCAGCCCAATANONE 
J080316C12AATTGGGCTGTNONE 
J080316C12CCAGCCCAAACNONE 
J080316C12GCAGCCCAATANONE 
J080316E03AATTGGGCTGTNONE 
J080316E03CCAGCCCAAACNONE 
J080316E03GCAGCCCAATANONE 
J100033K16AATTGGGCTGTNONE 
J100033K16CCAGCCCAAACNONE 
J100033K16GCAGCCCAATANONE 
J100042J21AATTGGGCTGTNONE 
J100042J21CCAGCCCAAACNONE 
J100042J21GCAGCCCAATANONE 
J100051E06AATTGGGCTGTNONE 
J100051E06CCAGCCCAAACNONE 
J100051E06GCAGCCCAATANONE 
J100071E22AATTGGGCTGTNONE 
J100071E22CCAGCCCAAACNONE 
J100071E22GCAGCCCAATANONE 
Os01g0633000006-075-A01TCAGCCCAAACNONE 
009-064-A11TCAGCCCAAACNONE 
009-153-F07TCAGCCCAAACNONE 
AK062051TCAGCCCAAACSimilar to 50S ribosomal protein L31. 
J013073B08TCAGCCCAAACNONE 
J065006K19TCAGCCCAAACNONE 
J065053P08TCAGCCCAAACNONE 
J065057D08TCAGCCCAAACNONE 
J065086P07TCAGCCCAAACNONE 
J065095C14TCAGCCCAAACNONE 
J065116B05TCAGCCCAAACNONE 
J065164L20TCAGCCCAAACNONE 
J065185K19TCAGCCCAAACNONE 
J065191E21TCAGCCCAAACNONE 
J065199P21TCAGCCCAAACNONE 
J065216M12TCAGCCCAAACNONE 
J075002M09TCAGCCCAAACNONE 
J075016N10TCAGCCCAAACNONE 
J075041K05TCAGCCCAAACNONE 
J075094E04TCAGCCCAAACNONE 
J075154O04TCAGCCCAAACNONE 
J075176D22TCAGCCCAAACNONE 
J075186M09TCAGCCCAAACNONE 
J075191H20TCAGCCCAAACNONE 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0742000009-105-F08ATTGGGCTGANONE 
AK062779ATTGGGCTGAtRNA/rRNA methyltransferase, SpoU domain containing protein. 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0813400006-025-B06CATCCACCAGCCCAAANONE 
006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07CATCCACCAGCCCAAANONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06CATCCACCAGCCCAAANONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09CATCCACCAGCCCAAANONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11CATCCACCAGCCCAAANONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02CATCCACCAGCCCAAANONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251CATCCACCAGCCCAAANONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370CATCCACCAGCCCAAASimilar to ADP-ribosylation factor 1. 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24CATCCACCAGCCCAAANONE 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07CATCCACCAGCCCAAANONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17CATCCACCAGCCCAAANONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07CATCCACCAGCCCAAANONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05CATCCACCAGCCCAAANONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01CATCCACCAGCCCAAANONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17CATCCACCAGCCCAAANONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03CATCCACCAGCCCAAANONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20CATCCACCAGCCCAAANONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0825500AK060613AGTTGGGCTGGNONE 
AK072321AGTTGGGCTGGNONE 
AK103941AGTTGGGCTGGNodulin-like domain containing protein. 
J075053A14AGTTGGGCTGGNONE 
J075151J22AGTTGGGCTGGNONE 
J075174K14AGTTGGGCTGGNONE 
Os01g0832200004-009-E08ATTTGGGCTGGNONE 
009-103-F06ATTTGGGCTGGNONE 
AK060017ATTTGGGCTGGNONE 
AK068980ATTTGGGCTGGConserved hypothetical protein. 
J023085I24ATTTGGGCTGGNONE 
J090016I03ATTTGGGCTGGNONE 
J090078K06ATTTGGGCTGGNONE 
Os01g0833000AK067226CCAGCCCAACAProtein prenyltransferase domain containing protein. 
J013098M23CCAGCCCAACANONE 
Os01g0838800AK066366CCAGCCCAATANONE 
AK073775CCAGCCCAATAClathrin adaptor complex, small chain family protein. 
J013067M01CCAGCCCAATANONE 
J033030I24CCAGCCCAATANONE 
J090089A10CCAGCCCAATANONE 
Os01g0840100006-095-C03GGTTGGGCTGCNONE 
011-075-F07GGTTGGGCTGCNONE 
012-010-A08GGTTGGGCTGCNONE 
012-035-A09GGTTGGGCTGCNONE 
014-010-B01GGTTGGGCTGCNONE 
014-011-H07GGTTGGGCTGCNONE 
014-040-F03GGTTGGGCTGCNONE 
014-077-C11GGTTGGGCTGCNONE 
014-078-C11GGTTGGGCTGCNONE 
014-097-A10GGTTGGGCTGCNONE 
014-097-D02GGTTGGGCTGCNONE 
014-100-D02GGTTGGGCTGCNONE 
015-012-H01GGTTGGGCTGCNONE 
015-049-G07GGTTGGGCTGCNONE 
015-066-C09GGTTGGGCTGCNONE 
016-033-C09GGTTGGGCTGCHeat shock protein Hsp70 family protein. 
016-084-F08GGTTGGGCTGCNONE 
J023037O13GGTTGGGCTGCNONE 
J033116B07GGTTGGGCTGCNONE 
J033121N13GGTTGGGCTGCNONE 
J065057F16GGTTGGGCTGCNONE 
J065112D05GGTTGGGCTGCNONE 
J065157G17GGTTGGGCTGCNONE 
J090014O03GGTTGGGCTGCNONE 
J090015K13GGTTGGGCTGCNONE 
J090021I21GGTTGGGCTGCNONE 
J090048D02GGTTGGGCTGCNONE 
J090054D14GGTTGGGCTGCNONE 
J090060J03GGTTGGGCTGCNONE 
J090063G01GGTTGGGCTGCNONE 
J090063H04GGTTGGGCTGCNONE 
J090063L13GGTTGGGCTGCNONE 
J090074E03GGTTGGGCTGCNONE 
J090096A03GGTTGGGCTGCNONE 
J090096I11GGTTGGGCTGCNONE 
J090099E16GGTTGGGCTGCNONE 
J100050G20GGTTGGGCTGCNONE 
Os01g0848300AK120668TCAGCCCAACAProtein prenyltransferase domain containing protein. 
Os01g0867900AK061366CCAGCCCAAACProtein of unknown function DUF502 family protein. 
Os01g0868300AB004461TCAGCCCAATSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os02g0102600AK060523CCAGCCCAAGNONE 
AK103103CCAGCCCAAGAnkyrin repeat containing protein. 
J033118O11CCAGCCCAAGNONE 
J033133B21CCAGCCCAAGNONE 
J033145O05CCAGCCCAAGNONE 
J065001D20CCAGCCCAAGNONE 
J065028P14CCAGCCCAAGNONE 
J065054G04CCAGCCCAAGNONE 
J065058L16CCAGCCCAAGNONE 
J065063K15CCAGCCCAAGNONE 
J065102A18CCAGCCCAAGNONE 
J065174B01CCAGCCCAAGNONE 
J065175C10CCAGCCCAAGNONE 
J065205O04CCAGCCCAAGNONE 
J075018I16CCAGCCCAAGNONE 
J075067G03CCAGCCCAAGNONE 
J075087G10CCAGCCCAAGNONE 
J075166J07CCAGCCCAAGNONE 
J075179O17CCAGCCCAAGNONE 
J090004K08CCAGCCCAAGNONE 
J090029D14CCAGCCCAAGNONE 
J090066G23CCAGCCCAAGNONE 
J090075M15CCAGCCCAAGNONE 
J090090C06CCAGCCCAAGNONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0163600AK068043ACAGCCCAATAConserved hypothetical protein. 
J013131O20ACAGCCCAATANONE 
J065006E03ACAGCCCAATANONE 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0176400009-099-H11ACAGCCCAACCNONE 
AK062746ACAGCCCAACCProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0184200J075194A02TTTGGGCTGGNONE 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
AK103901GGCCCGTTACAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013058O03GGCCCGTTACAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J013124E21GGCCCGTTACAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L03GGCCCGTTACAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023023L21GGCCCGTTACAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023061N01GGCCCGTTACAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023065O09GGCCCGTTACAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023106J17GGCCCGTTACAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J023119N08GGCCCGTTACAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033058A19GGCCCGTTACAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033098O13GGCCCGTTACAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033100M18GGCCCGTTACAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033125A21GGCCCGTTACAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J033148C12GGCCCGTTACAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043017F03GGCCCGTTACAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J043032J02GGCCCGTTACAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053047N10GGCCCGTTACAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J053089P04GGCCCGTTACAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065051K09GGCCCGTTACAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J065064H24GGCCCGTTACAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090001L06GGCCCGTTACAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090017C24GGCCCGTTACAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058G15GGCCCGTTACAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090058H23GGCCCGTTACAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090061G20GGCCCGTTACAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090069N23GGCCCGTTACAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090071A08GGCCCGTTACAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08GGCCCGTTACAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090077B15GGCCCGTTACAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090081K06GGCCCGTTACAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090083I05GGCCCGTTACAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090091O22GGCCCGTTACAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J090097L10GGCCCGTTACAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100026B11GGCCCGTTACAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100044M01GGCCCGTTACAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100046F10GGCCCGTTACAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100051K14GGCCCGTTACAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060D22GGCCCGTTACAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100060H18GGCCCGTTACAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100070I06GGCCCGTTACAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100071C04GGCCCGTTACAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100078M13GGCCCGTTACAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100080E17GGCCCGTTACAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
J100083I09GGCCCGTTACAGCCCAACANONE 
Os02g0241100Os02g0241100CCAGCCCAAGProtein kinase-like domain containing protein. 
Os02g0321000AK121840ACAGCCCAACCTetratricopeptide-like helical domain containing protein. 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0510200AK058963ATTTGGGCTGCNONE 
Os02g0517333AK105573TCAGCCCAAAANONE 
AK111331TCAGCCCAAAAConserved hypothetical protein. 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0616600AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0618250009-115-E10CCAGCCCAACCNONE 
014-076-A03CCAGCCCAACCNONE 
J065096D10CCAGCCCAACCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAGCCCAACCNONE 
J075092J11CCAGCCCAACCNONE 
J075134F02CCAGCCCAACCNONE 
Os02g0618700AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15GCCCAGCCCAAATNONE 
Os02g0651500AK066333ACAGCCCAACTNONE 
AK121865ACAGCCCAACTHypothetical protein. 
J090038J11ACAGCCCAACTNONE 
Os02g0673000AK108650CCAGCCCAATAProtein of unknown function UPF0005 family protein. 
Os02g0700100AK102954TTTTGGGCTGCSimilar to WD-repeat protein. 
Os02g0720600006-086-D09ATTTGGGCTGTNONE 
AK101967ATTTGGGCTGTPeptidase A1, pepsin family protein. 
AK105989ATTTGGGCTGTNONE 
J023073N17ATTTGGGCTGTNONE 
J033076I21ATTTGGGCTGTNONE 
J065057O13ATTTGGGCTGTNONE 
J065101I01ATTTGGGCTGTNONE 
J065102J23ATTTGGGCTGTNONE 
J065122L12ATTTGGGCTGTNONE 
J065132N22ATTTGGGCTGTNONE 
J065167A04ATTTGGGCTGTNONE 
J065168G11ATTTGGGCTGTNONE 
J065188C07ATTTGGGCTGTNONE 
J100018E15ATTTGGGCTGTNONE 
J100035L14ATTTGGGCTGTNONE 
J100041M01ATTTGGGCTGTNONE 
J100056J07ATTTGGGCTGTNONE 
J100065J09ATTTGGGCTGTNONE 
J100072E07ATTTGGGCTGTNONE 
J100081G12ATTTGGGCTGTNONE 
J100083G22ATTTGGGCTGTNONE 
J100085E19ATTTGGGCTGTNONE 
J100090P18ATTTGGGCTGTNONE 
Os02g0754700AK066904TCAGCCCAAGCCCAAGSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TCAGCCCAAGCCCAAGNONE 
Os02g0756800013-074-D12ACAGCCCAAGNONE 
AK063605ACAGCCCAAGPhosphate-induced protein 1 conserved region family protein. 
J053100E11ACAGCCCAAGNONE 
J065045H15ACAGCCCAAGNONE 
J065099D22ACAGCCCAAGNONE 
J065142N08ACAGCCCAAGNONE 
Os02g0759800012-036-G11CCAGCCCAAGNONE 
012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153CCAGCCCAAGSimilar to GAMYB-binding protein (Fragment). 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666CCAGCCCAAGNONE 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03CCAGCCCAAGNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02CCAGCCCAAGNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20CCAGCCCAAGNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09CCAGCCCAAGNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19CCAGCCCAAGNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16CCAGCCCAAGNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17CCAGCCCAAGNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0762300AK106684TCAGCCCAAATProtein of unknown function UPF0021 family protein. 
J090060M09TCAGCCCAAATNONE 
J100083E05TCAGCCCAAATNONE 
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein. 
Os02g0771700011-075-D10CCAGCCCAAGNONE 
011-086-E10CCAGCCCAAGNONE 
AK058571CCAGCCCAAGGlycoside hydrolase, family 17 protein. 
AK102185CCAGCCCAAGNONE 
J023001D03CCAGCCCAAGNONE 
J023041N11CCAGCCCAAGNONE 
J033086N13CCAGCCCAAGNONE 
J033106K14CCAGCCCAAGNONE 
J033125P22CCAGCCCAAGNONE 
Os02g0774300AK065228GCAGCCCAACASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0794700003-103-F03CTTGGGCTGCNONE 
003-129-E08CTTGGGCTGCNONE 
006-086-A10CTTGGGCTGCNONE 
AK058513CTTGGGCTGCSimilar to Cytosol aminopeptidase (EC 3.4.11.1) (Leucine aminopeptidase) (LAP) (Leucyl aminopeptidase) (Proline aminopeptidase) (EC 3.4.11.5) (Prolyl aminopeptidase). 
AK104150CTTGGGCTGCNONE 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0811800011-036-F07ACAGCCCAATNONE 
AK063935ACAGCCCAATSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
AK119257ACAGCCCAATNONE 
J033022E13ACAGCCCAATNONE 
J033023F12ACAGCCCAATNONE 
J033028M20ACAGCCCAATNONE 
J033035L05ACAGCCCAATNONE 
J033043C20ACAGCCCAATNONE 
J033051O11ACAGCCCAATNONE 
J033071L10ACAGCCCAATNONE 
J033084E05ACAGCCCAATNONE 
J033101O21ACAGCCCAATNONE 
J033108A10ACAGCCCAATNONE 
J033115N15ACAGCCCAATNONE 
J033116N18ACAGCCCAATNONE 
J033117A11ACAGCCCAATNONE 
J033121C24ACAGCCCAATNONE 
J033131H15ACAGCCCAATNONE 
J033136O11ACAGCCCAATNONE 
J033138D20ACAGCCCAATNONE 
J033147C09ACAGCCCAATNONE 
J043036O15ACAGCCCAATNONE 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os03g0119900AK058741CCAGCCCAAGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CCAGCCCAAGNONE 
J065165C24CCAGCCCAAGNONE 
J075039M05CCAGCCCAAGNONE 
Os03g0121300AK120047TCAGCCCAACTNONE 
Os03g0124300AK069148ACAGCCCAAACConserved hypothetical protein. 
AK106076ACAGCCCAAACNONE 
J023003G19ACAGCCCAAACNONE 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
Os03g0192500AK068957ACAGCCCAAGProtein phosphatase 2C-like domain containing protein. 
AY603974ACAGCCCAAGNONE 
Os03g0198400AK059522GGTTGGGCTGTNONE 
AK103101GGTTGGGCTGTSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19GGTTGGGCTGTNONE 
J075036K08GGTTGGGCTGTNONE 
J075040J23GGTTGGGCTGTNONE 
J075041H18GGTTGGGCTGTNONE 
J075053H18GGTTGGGCTGTNONE 
J075055K15GGTTGGGCTGTNONE 
J075111K03GGTTGGGCTGTNONE 
J075125B22GGTTGGGCTGTNONE 
J075195L10GGTTGGGCTGTNONE 
Os03g0220100006-023-B05GCAGCCCAACNONE 
006-034-F08GCAGCCCAACNONE 
006-093-A02GCAGCCCAACNONE 
006-093-A06GCAGCCCAACNONE 
011-078-E04GCAGCCCAACNONE 
012-092-C04GCAGCCCAACNONE 
AK066587GCAGCCCAACSimilar to Very-long-chain fatty acid condensing enzyme CUT1. 
AK104714GCAGCCCAACNONE 
AK106150GCAGCCCAACNONE 
J013067C12GCAGCCCAACNONE 
J013074H08GCAGCCCAACNONE 
J013124K13GCAGCCCAACNONE 
J065007A03GCAGCCCAACNONE 
J065037H21GCAGCCCAACNONE 
J065081F03GCAGCCCAACNONE 
J090074C06GCAGCCCAACNONE 
Os03g0249900AK058379GCAGCCCAATAConserved hypothetical protein. 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0260100AK066143TCAGCCCAACAConserved hypothetical protein. 
Os03g0263500006-112-E09GTTTGGGCTGANONE 
009-122-C01GTTTGGGCTGANONE 
AK106060GTTTGGGCTGASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE 
014-027-E07TCCGGGCCAGCCCAACCNONE 
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase. 
J065009N21TCCGGGCCAGCCCAACCNONE 
Os03g0297400AK060653ACAGCCCAACNONE 
AK061403ACAGCCCAACNONE 
AK101597ACAGCCCAACMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0313600AK067474ATTGGGCTGGSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0335100AK107094CCAGCCCAAATConserved hypothetical protein. 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0372700AK064323TTTTGGGCTGGNONE 
AK073312TTTTGGGCTGGLow temperature viability protein family protein. 
Os03g0383100AK107106TCAGCCCAAAAConserved hypothetical protein. 
Os03g0388000009-082-H03TGTTGGGCTGCNONE 
AK062658TGTTGGGCTGCNONE 
Os03g0388500AK070350ATTGGGCTGCSimilar to Anther ethylene-upregulated protein ER1 (Fragment). 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0441000AK108726ACAGCCCAAGTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0566800AK103270GCAGCCCAACTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18GCAGCCCAACTNONE 
J023136P06GCAGCCCAACTNONE 
J033081A22GCAGCCCAACTNONE 
J033109N12GCAGCCCAACTNONE 
J033124H10GCAGCCCAACTNONE 
J033141B09GCAGCCCAACTNONE 
J090026G23GCAGCCCAACTNONE 
J090077J20GCAGCCCAACTNONE 
Os03g0576900AK064861CTTGGGCTGCNONE 
J013000I01CTTGGGCTGCNONE 
J013169P21CTTGGGCTGCNONE 
J023001P03CTTGGGCTGCNONE 
J023009M10CTTGGGCTGCNONE 
J023025G11CTTGGGCTGCNONE 
J033046B19CTTGGGCTGCNONE 
J033149I10CTTGGGCTGCNONE 
J090081C04CTTGGGCTGCNONE 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0647800003-103-H03ACAGCCCAACANONE 
003-103-H03TCAGCCCAACCNONE 
006-104-G09ACAGCCCAACANONE 
006-104-G09TCAGCCCAACCNONE 
AK070243ACAGCCCAACAConserved hypothetical protein. 
AK070243TCAGCCCAACCConserved hypothetical protein. 
J100056F22ACAGCCCAACANONE 
J100056F22TCAGCCCAACCNONE 
Os03g0689300AK068765CCCAGCCCAAAAPlasma membrane H+ ATPase (EC 3.6.3.6) (H-ATPase). 
AK100996CCCAGCCCAAAANONE 
D10207CCCAGCCCAAAANONE 
J013162E15CCCAGCCCAAAANONE 
J033116I16CCCAGCCCAAAANONE 
J043027N09CCCAGCCCAAAANONE 
J075112N21CCCAGCCCAAAANONE 
J090035D23CCCAGCCCAAAANONE 
J090095G13CCCAGCCCAAAANONE 
Os03g0699200005-016-G07TCAGCCCAACCCAAGGCCCNONE 
AK066652TCAGCCCAACCCAAGGCCCPescadillo, N-terminal domain containing protein. 
AK099383TCAGCCCAACCCAAGGCCCNONE 
J013069A12TCAGCCCAACCCAAGGCCCNONE 
J033085M11TCAGCCCAACCCAAGGCCCNONE 
J033111P09TCAGCCCAACCCAAGGCCCNONE 
J033128H17TCAGCCCAACCCAAGGCCCNONE 
Os03g0712600015-008-G03TCAGCCCAAAANONE 
AK103705TCAGCCCAAAAHypothetical protein. 
J033136N14TCAGCCCAAAANONE 
Os03g0740700011-093-H12AATTGGGCTGANONE 
AK102723AATTGGGCTGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19AATTGGGCTGANONE 
J013126N16AATTGGGCTGANONE 
J033105J16AATTGGGCTGANONE 
J090059D19AATTGGGCTGANONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0803800012-043-D10TCAGCCCAAGNONE 
AK063484TCAGCCCAAGConserved hypothetical protein. 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0843500AK067985GCAGCCCAATNONE 
AK101661GCAGCCCAATSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GCAGCCCAATNONE 
J080302L23GCAGCCCAATNONE 
Os03g0844100AK067164CCAGCCCAACCSimilar to Pti1 kinase-like protein. 
Os03g0845700009-075-D05AGTTGGGCTGGNONE 
AK062622AGTTGGGCTGGSimilar to RPB17 (Fragment). 
J065068H03AGTTGGGCTGGNONE 
J065075A18AGTTGGGCTGGNONE 
J065118C19AGTTGGGCTGGNONE 
J075001B15AGTTGGGCTGGNONE 
J075048D11AGTTGGGCTGGNONE 
J075056D01AGTTGGGCTGGNONE 
J075092P03AGTTGGGCTGGNONE 
J075111I04AGTTGGGCTGGNONE 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117200AK107523TCAGCCCAAASpectrin repeat containing protein. 
Os04g0196600AK121999ACAGCCCAAAProtein of unknown function DUF563 family protein. 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0316200AK110725GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
AY576676GCAGCCCAAAANONE 
J100043J22GCAGCCCAAAANONE 
J100049F15GCAGCCCAAAANONE 
J100081M23GCAGCCCAAAANONE 
Os04g0322100J075093H10GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
J100044L06GCAGCCCAAAANONE 
J100048J12GCAGCCCAAAANONE 
J100073D10GCAGCCCAAAANONE 
Os04g0329500015-081-E12TCAGCCCAACANONE 
AK064343TCAGCCCAACAProtein of unknown function DUF295 family protein. 
AK073994TCAGCCCAACANONE 
J033072H16TCAGCCCAACANONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0440000AK073064GCAGCCCAATTNONE 
AK101691GCAGCCCAATTConserved hypothetical protein. 
AK102407GCAGCCCAATTNONE 
Os04g0485400AK109290TCAGCCCAAGSimilar to Nucleotide-binding protein. 
AK120649TCAGCCCAAGNONE 
J013156K04TCAGCCCAAGNONE 
J043026O10TCAGCCCAAGNONE 
Os04g0496600AK065058TTTGGGCTGTConserved hypothetical protein. 
J013001J09TTTGGGCTGTNONE 
J013037C18TTTGGGCTGTNONE 
J013126H05TTTGGGCTGTNONE 
J090062G17TTTGGGCTGTNONE 
Os04g0521800006-043-D11AGTTGGGCTGCNONE 
AK061536AGTTGGGCTGCNONE 
AK102934AGTTGGGCTGCPeptidase M20 family protein. 
AK103369AGTTGGGCTGCNONE 
Os04g0531300016-006-E10ACAGCCCAAATNONE 
AK072647ACAGCCCAAATDihydrouridine synthase, DuS family protein. 
AK103911ACAGCCCAAATNONE 
J013038P22ACAGCCCAAATNONE 
J023130D01ACAGCCCAAATNONE 
J033150P13ACAGCCCAAATNONE 
J043026L14ACAGCCCAAATNONE 
J065049A08ACAGCCCAAATNONE 
J065215C17ACAGCCCAAATNONE 
Os04g0539000009-165-H09ACAGCCCAATANONE 
014-012-F10ACAGCCCAATANONE 
AK105343ACAGCCCAATALambda integrase-like, N-terminal domain containing protein. 
Os04g0542900AK068610TCAGCCCAACConserved hypothetical protein. 
Os04g0574500AK110934ACAGCCCAATSimilar to Growth-regulating factor 3. 
J065101K11ACAGCCCAATNONE 
J065207F18ACAGCCCAATNONE 
Os04g0577500006-039-C03ACAGCCCAACNONE 
006-043-H01ACAGCCCAACNONE 
AK061538ACAGCCCAACNONE 
AK065648ACAGCCCAACTatD-related deoxyribonuclease family protein. 
AK104763ACAGCCCAACNONE 
J013035E21ACAGCCCAACNONE 
J013066M11ACAGCCCAACNONE 
J100026B02ACAGCCCAACNONE 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0638800AK070319TTTGGGCTGAProtein of unknown function DUF617, plant family protein. 
AK071753TTTGGGCTGANONE 
Os04g0650200AK072573ATTGGGCTGGNONE 
AK109786ATTGGGCTGGLipolytic enzyme, G-D-S-L family protein. 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0665000009-149-A12TGTTGGGCTGGNONE 
AK062995TGTTGGGCTGGCHCH domain containing protein. 
J065017G19TGTTGGGCTGGNONE 
J080301G12TGTTGGGCTGGNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0106100009-186-E05TTTGGGCTGTNONE 
013-067-H01TTTGGGCTGTNONE 
AK063178TTTGGGCTGTSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15TTTGGGCTGTNONE 
J065073M24TTTGGGCTGTNONE 
J065077A22TTTGGGCTGTNONE 
J065167I04TTTGGGCTGTNONE 
J075084F11TTTGGGCTGTNONE 
J075086M18TTTGGGCTGTNONE 
Os05g0111000AK073598TCAGCCCAATTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0121800AK101222CCAGCCCAAGConserved hypothetical protein. 
J033031D02CCAGCCCAAGNONE 
J065078F10CCAGCCCAAGNONE 
J065151J16CCAGCCCAAGNONE 
J065151K04CCAGCCCAAGNONE 
J090057E18CCAGCCCAAGNONE 
Os05g0123400AK069521CCAGCCCAAACConserved hypothetical protein. 
J023022O05CCAGCCCAAACNONE 
Os05g0124700011-003-D10ATTGGGCTGANONE 
AK063257ATTGGGCTGADeoxynucleoside kinase family protein. 
Os05g0140800AK110652CCAGCCCAACCSimilar to Dormancy related protein (Fragment). 
J075019K14CCAGCCCAACCNONE 
J075020O11CCAGCCCAACCNONE 
J075028P06CCAGCCCAACCNONE 
J075050A16CCAGCCCAACCNONE 
J075051F18CCAGCCCAACCNONE 
J075085K03CCAGCCCAACCNONE 
J075112P22CCAGCCCAACCNONE 
J075118I09CCAGCCCAACCNONE 
J075144H09CCAGCCCAACCNONE 
J075166I07CCAGCCCAACCNONE 
J075191J02CCAGCCCAACCNONE 
J075195I23CCAGCCCAACCNONE 
Os05g0148300009-031-A08CCCAGCCCAACCNONE 
AK062421CCCAGCCCAACCRibosomal protein S27, mitochondrial family protein. 
Os05g0149600012-070-F05GCAGCCCAATTNONE 
012-080-A12GCAGCCCAATTNONE 
012-082-C06GCAGCCCAATTNONE 
AK073947GCAGCCCAATTSimilar to Cullin-1. 
J023063A09GCAGCCCAATTNONE 
J033073A13GCAGCCCAATTNONE 
J033093B09GCAGCCCAATTNONE 
J065017B10GCAGCCCAATTNONE 
J065037P19GCAGCCCAATTNONE 
J065142G16GCAGCCCAATTNONE 
J065147F13GCAGCCCAATTNONE 
J065195M20GCAGCCCAATTNONE 
J090011L24GCAGCCCAATTNONE 
J090018I19GCAGCCCAATTNONE 
J090040M12GCAGCCCAATTNONE 
J090054K21GCAGCCCAATTNONE 
J090059G09GCAGCCCAATTNONE 
J090070H17GCAGCCCAATTNONE 
J090071G17GCAGCCCAATTNONE 
J090077L09GCAGCCCAATTNONE 
J090091C15GCAGCCCAATTNONE 
J100032J17GCAGCCCAATTNONE 
J100061E08GCAGCCCAATTNONE 
Os05g0150300AK100732CCAGCCCAAGSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0220900AK109172CCCAGCCCAATTNONE 
AK109456CCCAGCCCAATTPrefoldin domain containing protein. 
Os05g0223200015-037-E09CCCAGCCCAAGNONE 
AK106308CCCAGCCCAAGSimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CCCAGCCCAAGNONE 
J065056N06CCCAGCCCAAGNONE 
J065080I11CCCAGCCCAAGNONE 
J065104F11CCCAGCCCAAGNONE 
J065183L10CCCAGCCCAAGNONE 
J065185H12CCCAGCCCAAGNONE 
J065186N17CCCAGCCCAAGNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE 
009-036-C03CGCGACGCCCCAGCCCAAGNONE 
009-040-H02CGCGACGCCCCAGCCCAAGNONE 
009-173-H12CGCGACGCCCCAGCCCAAGNONE 
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein. 
J065137N04CGCGACGCCCCAGCCCAAGNONE 
J065164C10CGCGACGCCCCAGCCCAAGNONE 
J065210H22CGCGACGCCCCAGCCCAAGNONE 
Os05g0427200AK070830ACAGCCCAACANONE 
AK106896ACAGCCCAACAGlycosyl transferase, family 31 protein. 
Os05g0443300Os05g0443300AGTTGGGCTGCSec23/Sec24 trunk region domain containing protein. 
Os05g0453500012-003-F05ACAGCCCAACNONE 
AK102175ACAGCCCAACConserved hypothetical protein. 
J033086K19ACAGCCCAACNONE 
Os05g0482400AK109526GCAGCCCAACCCytochrome P450 family protein. 
Os05g0486200009-099-B03CCAGCCCAACTNONE 
AK121022CCAGCCCAACTConserved hypothetical protein. 
J023049I09CCAGCCCAACTNONE 
J033029N07CCAGCCCAACTNONE 
J075074I18CCAGCCCAACTNONE 
Os05g0490200016-097-B03CCAGCCCAACCNONE 
AK101147CCAGCCCAACCProtein of unknown function DUF1692 domain containing protein. 
AK105601CCAGCCCAACCNONE 
J033026P06CCAGCCCAACCNONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0494700Os05g0494700ACAGCCCAAGNONE 
Os05g0521500AK066030TATTGGGCTGTPeptidase S16, lon N-terminal domain containing protein. 
Os05g0531700AK110982GGTTGGGCTGTConserved hypothetical protein. 
Os05g0535700009-067-F01GCAGCCCAAGCCCAAGCCCAAGNONE 
AK061590GCAGCCCAAGCCCAAGCCCAAGNONE 
AK062545GCAGCCCAAGCCCAAGCCCAAGConserved hypothetical protein. 
Os05g0552900AK102095CCAGCCCAATTMAP65/ASE1 family protein. 
Os05g0553000015-052-H09ACAGCCCAAAANONE 
AK061681ACAGCCCAAAAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143ACAGCCCAAAANONE 
J013068H04ACAGCCCAAAANONE 
J013124C06ACAGCCCAAAANONE 
J033127N11ACAGCCCAAAANONE 
J100056O04ACAGCCCAAAANONE 
Os05g0554400AK102948CCAGCCCAACANONE 
AK107427CCAGCCCAACAPhosphatidyl serine synthase family protein. 
J023089D16CCAGCCCAACANONE 
Os05g0559900AK067197GCAGCCCAAATtRNA-binding arm domain containing protein. 
J013074C15GCAGCCCAAATNONE 
J013098O16GCAGCCCAAATNONE 
J033030M01GCAGCCCAAATNONE 
J090058H12GCAGCCCAAATNONE 
J090075M06GCAGCCCAAATNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0574500006-021-A08ATTGGGCTGTNONE 
006-049-A11ATTGGGCTGTNONE 
006-086-F03ATTGGGCTGTNONE 
009-051-F06ATTGGGCTGTNONE 
AB015287ATTGGGCTGTNONE 
AB015972ATTGGGCTGTNONE 
AK061714ATTGGGCTGTNONE 
AK098889ATTGGGCTGTNONE 
AK121699ATTGGGCTGTSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATTGGGCTGTNONE 
J013072D17ATTGGGCTGTNONE 
J023028M04ATTGGGCTGTNONE 
J023031F01ATTGGGCTGTNONE 
J023114L22ATTGGGCTGTNONE 
J033058L12ATTGGGCTGTNONE 
J033073D17ATTGGGCTGTNONE 
J043031D08ATTGGGCTGTNONE 
J043036G01ATTGGGCTGTNONE 
J065144O04ATTGGGCTGTNONE 
J065181O08ATTGGGCTGTNONE 
J080066B20ATTGGGCTGTNONE 
Os05g0577200AK069756TCAGCCCAACACarboxylesterase, type B family protein. 
Os05g0589000AK061980CCAGCCCAAGNONE 
AK099181CCAGCCCAAGConserved hypothetical protein. 
Os05g0591600Os05g0591600GTTGGGCTGCSimilar to Lysine decarboxylase-like protein. 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0113900AK067430CCCAGCCCAACCNONE 
AK102259CCCAGCCCAACCNONE 
AK120464CCCAGCCCAACCConserved hypothetical protein. 
J065144I06CCCAGCCCAACCNONE 
Os06g0119300AK067271CCAGCCCAATCCAGCCCAGProtein of unknown function DUF594 family protein. 
Os06g0135340J065061D17ACAGCCCAAACNONE 
J065061D17TCAGCCCAATANONE 
J065159A10ACAGCCCAAACConserved hypothetical protein. 
J065159A10TCAGCCCAATAConserved hypothetical protein. 
Os06g0140100011-063-A02GCAGCCCAATNONE 
AK063371GCAGCCCAATLeucine carboxyl methyltransferase family protein. 
Os06g0156900AK110688CTTGGGCTGAGlycosyl transferase, family 31 protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
Os06g0192800AK070038ACAGCCCAAAASimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13ACAGCCCAAAANONE 
J100067A03ACAGCCCAAAANONE 
Os06g0199500AK060939ACAGCCCAATANONE 
AK064613ACAGCCCAATASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ACAGCCCAATANONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0257200J053059P05GCAGCCCAATNONE 
J075006K03GCAGCCCAATNONE 
J075067F07GCAGCCCAATNONE 
J075068F14GCAGCCCAATNONE 
J075068H14GCAGCCCAATNONE 
J075098N06GCAGCCCAATNONE 
J075099F08GCAGCCCAATNONE 
J075154G24GCAGCCCAATNONE 
J075195H09GCAGCCCAATNONE 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0332400AK058294CCAGCCCAAGNONE 
AK101738CCAGCCCAAGVHS domain containing protein. 
J013119B12CCAGCCCAAGNONE 
J013132G17CCAGCCCAAGNONE 
J023034E06CCAGCCCAAGNONE 
J023039I05CCAGCCCAAGNONE 
J033024E14CCAGCCCAAGNONE 
J033039N04CCAGCCCAAGNONE 
J033048P16CCAGCCCAAGNONE 
J033069F24CCAGCCCAAGNONE 
J033071D15CCAGCCCAAGNONE 
J033106D01CCAGCCCAAGNONE 
J033106D09CCAGCCCAAGNONE 
J033106F09CCAGCCCAAGNONE 
J033107K03CCAGCCCAAGNONE 
J033129G10CCAGCCCAAGNONE 
J065016B15CCAGCCCAAGNONE 
J065022H07CCAGCCCAAGNONE 
J065048E07CCAGCCCAAGNONE 
J065068B11CCAGCCCAAGNONE 
J065157C13CCAGCCCAAGNONE 
J100042J02CCAGCCCAAGNONE 
Os06g0335500AK121989TCAGCCCAAAAAUX/IAA protein family protein. 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0542200AK058589CCAGCCCAATANADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0556300AK063985CCCAGCCCAAGCyclin-like F-box domain containing protein. 
AK101552CCCAGCCCAAGNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0670100AK102577AGTTGGGCTGAHypothetical protein. 
Os06g0673500J100018J12GCAGCCCAAATNONE 
J100072F13GCAGCCCAAATSimilar to Ubiquitin. 
Os06g0674800J065007E09GCAGCCCAAGNONE 
J065037D21GCAGCCCAAGHypothetical protein. 
J065063P14GCAGCCCAAGNONE 
J065128K24GCAGCCCAAGNONE 
J065188F06GCAGCCCAAGNONE 
J065199I24GCAGCCCAAGNONE 
J065214N19GCAGCCCAAGNONE 
Os06g0683200AK060024AGTTGGGCTGGSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432AGTTGGGCTGGNONE 
J023002B12AGTTGGGCTGGNONE 
J023054E10AGTTGGGCTGGNONE 
J023123F19AGTTGGGCTGGNONE 
J065035K13AGTTGGGCTGGNONE 
J065129P09AGTTGGGCTGGNONE 
J065184B14AGTTGGGCTGGNONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0154300009-070-E08CCCAGCCCAACTNONE 
009-077-E01CCCAGCCCAACTNONE 
009-196-F05CCCAGCCCAACTNONE 
AK105386CCCAGCCCAACTConserved hypothetical protein. 
AK122093CCCAGCCCAACTNONE 
J033124K14CCCAGCCCAACTNONE 
J075006I22CCCAGCCCAACTNONE 
J075185G02CCCAGCCCAACTNONE 
J090039C02CCCAGCCCAACTNONE 
Os07g0176600AK066812TCAGCCCAATTNONE 
AK067073TCAGCCCAATTSimilar to Kinase-like protein. 
Os07g0181000AK060932TCAGCCCAAATNONE 
AK066918ACAGCCCAAATNONE 
AK070512ACAGCCCAAATSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0185900009-023-G07CCCAGCCCAAGNONE 
009-105-E06CCCAGCCCAAGNONE 
009-125-B01CCCAGCCCAAGNONE 
009-169-A01CCCAGCCCAAGNONE 
AK070315CCCAGCCCAAGConserved hypothetical protein. 
J065140H13CCCAGCCCAAGNONE 
J100024L12CCCAGCCCAAGNONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0479200005-017-H08ACAGCCCAAANONE 
AK058326ACAGCCCAAASimilar to SL15-like (Fragment). 
J013092A08ACAGCCCAAANONE 
J033139E04ACAGCCCAAANONE 
J043016M16ACAGCCCAAANONE 
J053050O18ACAGCCCAAANONE 
J053098B03ACAGCCCAAANONE 
J065068G10ACAGCCCAAANONE 
J065091I17ACAGCCCAAANONE 
J065109A03ACAGCCCAAANONE 
J065168B17ACAGCCCAAANONE 
J065177A05ACAGCCCAAANONE 
J065180J01ACAGCCCAAANONE 
J075006F13ACAGCCCAAANONE 
J075022J03ACAGCCCAAANONE 
J075024N09ACAGCCCAAANONE 
J075114B12ACAGCCCAAANONE 
J080023M06ACAGCCCAAANONE 
J080081N24ACAGCCCAAANONE 
J090060N07ACAGCCCAAANONE 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0513200015-004-B02TTTGGGCTGANONE 
AK101410TTTGGGCTGANONE 
AK106227TTTGGGCTGANONE 
AK119451TTTGGGCTGAProtein prenyltransferase domain containing protein. 
Os07g0530400AK107269TCAGCCCAAAConserved hypothetical protein. 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0585800006-106-A05CAGCCCAATANONE 
AK066419CAGCCCAATANONE 
AK105064CAGCCCAATASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01CAGCCCAATANONE 
J065085B08CAGCCCAATANONE 
J065099I23CAGCCCAATANONE 
J065169A01CAGCCCAATANONE 
J065187N13CAGCCCAATANONE 
J065191L18CAGCCCAATANONE 
J065194D04CAGCCCAATANONE 
J065211M09CAGCCCAATANONE 
J065212I02CAGCCCAATANONE 
J090003C10CAGCCCAATANONE 
J090025O11CAGCCCAATANONE 
J090092F10CAGCCCAATANONE 
J100055A04CAGCCCAATANONE 
J100064A01CAGCCCAATANONE 
J100080L02CAGCCCAATANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0602600AK065696CCAGCCCAACSimilar to RNA binding protein. 
J013035K23CCAGCCCAACNONE 
Os07g0604500009-018-C07AGTTGGGCTGANONE 
009-018-C07ATTTGGGCTGANONE 
009-018-C07CTTGGGCTGANONE 
009-194-C02AGTTGGGCTGANONE 
009-194-C02ATTTGGGCTGANONE 
009-194-C02CTTGGGCTGANONE 
011-023-C06AGTTGGGCTGANONE 
011-023-C06ATTTGGGCTGANONE 
011-023-C06CTTGGGCTGANONE 
015-035-B10AGTTGGGCTGANONE 
015-035-B10ATTTGGGCTGANONE 
015-035-B10CTTGGGCTGANONE 
AK064312AGTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312ATTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312CTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTTGGGCTGANONE 
AK069085ATTTGGGCTGANONE 
AK069085CTTGGGCTGANONE 
J090050I12AGTTGGGCTGANONE 
J090050I12ATTTGGGCTGANONE 
J090050I12CTTGGGCTGANONE 
J100027C10AGTTGGGCTGANONE 
J100027C10ATTTGGGCTGANONE 
J100027C10CTTGGGCTGANONE 
J100029A05AGTTGGGCTGANONE 
J100029A05ATTTGGGCTGANONE 
J100029A05CTTGGGCTGANONE 
J100031P17AGTTGGGCTGANONE 
J100031P17ATTTGGGCTGANONE 
J100031P17CTTGGGCTGANONE 
J100039E20AGTTGGGCTGANONE 
J100039E20ATTTGGGCTGANONE 
J100039E20CTTGGGCTGANONE 
J100064L15AGTTGGGCTGANONE 
J100064L15ATTTGGGCTGANONE 
J100064L15CTTGGGCTGANONE 
J100066K08AGTTGGGCTGANONE 
J100066K08ATTTGGGCTGANONE 
J100066K08CTTGGGCTGANONE 
Os07g0644300AK066726TCAGCCCAAAASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCAGCCCAAAANONE 
Os07g0667400AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22TCAGCCCAACTNONE 
J033027J22TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0679500AK102562CCAGCCCAATSimilar to Transcription factor RF2b. 
Os08g0102000009-020-B12CCCAGCCCAATNONE 
009-068-H05CCCAGCCCAATNONE 
009-119-F03CCCAGCCCAATNONE 
009-166-A06CCCAGCCCAATNONE 
009-176-G12CCCAGCCCAATNONE 
AK068156CCCAGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0128000AK069322ACAGCCCAAGNONE 
AK103896ACAGCCCAAGGalactose oxidase, central domain containing protein. 
J023013D19ACAGCCCAAGNONE 
J023013I07ACAGCCCAAGNONE 
J023037F21ACAGCCCAAGNONE 
J023106B02ACAGCCCAAGNONE 
J023134E22ACAGCCCAAGNONE 
J033027F15ACAGCCCAAGNONE 
J033150H12ACAGCCCAAGNONE 
J090088A10ACAGCCCAAGNONE 
Os08g0135900AK069187GTTTGGGCTGCNONE 
Os08g0158900AK067062TTTTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTTTGGGCTGGNONE 
J013092D16TTTTGGGCTGGNONE 
J033120K14TTTTGGGCTGGNONE 
J033133F24TTTTGGGCTGGNONE 
J033145A10TTTTGGGCTGGNONE 
J033145A11TTTTGGGCTGGNONE 
J053048H24TTTTGGGCTGGNONE 
J053075H10TTTTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCAAAANONE 
AK103973CCAGCCCAAAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCAAAANONE 
J033051J11CCAGCCCAAAANONE 
J065101C10CCAGCCCAAAANONE 
J065168B04CCAGCCCAAAANONE 
J065184E22CCAGCCCAAAANONE 
J080021D11CCAGCCCAAAANONE 
J080025H10CCAGCCCAAAANONE 
J080026N19CCAGCCCAAAANONE 
J080034A12CCAGCCCAAAANONE 
J080040L02CCAGCCCAAAANONE 
J080042H19CCAGCCCAAAANONE 
J080047B05CCAGCCCAAAANONE 
J080047E09CCAGCCCAAAANONE 
J080047I01CCAGCCCAAAANONE 
J080052H19CCAGCCCAAAANONE 
J080062K13CCAGCCCAAAANONE 
J080063A22CCAGCCCAAAANONE 
J080068G18CCAGCCCAAAANONE 
J080068N19CCAGCCCAAAANONE 
J080076G08CCAGCCCAAAANONE 
J080077H13CCAGCCCAAAANONE 
J080077K06CCAGCCCAAAANONE 
J080093D15CCAGCCCAAAANONE 
J080094D21CCAGCCCAAAANONE 
J080097A20CCAGCCCAAAANONE 
J080097E21CCAGCCCAAAANONE 
J080097N17CCAGCCCAAAANONE 
J100071K18CCAGCCCAAAANONE 
J100072F09CCAGCCCAAAANONE 
Os08g0161700009-088-D09CCAGCCCAACCNONE 
009-131-H02CCAGCCCAACCNONE 
009-182-D04CCAGCCCAACCNONE 
AK059272CCAGCCCAACCConserved hypothetical protein. 
J075002M21CCAGCCCAACCNONE 
J075090H12CCAGCCCAACCNONE 
J075129C21CCAGCCCAACCNONE 
J075146N03CCAGCCCAACCNONE 
J075178P18CCAGCCCAACCNONE 
J075190M03CCAGCCCAACCNONE 
J090030G01CCAGCCCAACCNONE 
J100088M23CCAGCCCAACCNONE 
Os08g0172300AK111274GCAGCCCAAAHAT dimerisation domain containing protein. 
J065184J06GCAGCCCAAANONE 
Os08g0195400006-057-E04TGTTGGGCTGTNONE 
006-060-B10TGTTGGGCTGTNONE 
AK070464TGTTGGGCTGTConserved hypothetical protein. 
AK104389TGTTGGGCTGTNONE 
AK106140TGTTGGGCTGTNONE 
J023013G08TGTTGGGCTGTNONE 
J023054K19TGTTGGGCTGTNONE 
J023089D18TGTTGGGCTGTNONE 
J023092K05TGTTGGGCTGTNONE 
J033025A08TGTTGGGCTGTNONE 
J033067P12TGTTGGGCTGTNONE 
J033098A10TGTTGGGCTGTNONE 
J065219L04TGTTGGGCTGTNONE 
J090021P06TGTTGGGCTGTNONE 
J090062M05TGTTGGGCTGTNONE 
J090079F15TGTTGGGCTGTNONE 
J100041H19TGTTGGGCTGTNONE 
Os08g0260600AK108529ACAGCCCAAAACD9/CD37/CD63 antigen family protein. 
Os08g0271400009-101-A03TGTTGGGCTGGNONE 
AK062750TGTTGGGCTGGConserved hypothetical protein. 
Os08g0299000AK061379GCAGCCCAAACNONE 
AK099389GCAGCCCAAACNONE 
AK101640GCAGCCCAAACProtein of unknown function DUF52 domain containing protein. 
J013100G13GCAGCCCAAACNONE 
J013153N09GCAGCCCAAACNONE 
J023097N06GCAGCCCAAACNONE 
J023123C12GCAGCCCAAACNONE 
J033088G14GCAGCCCAAACNONE 
J065033G10GCAGCCCAAACNONE 
J065128B01GCAGCCCAAACNONE 
J100085I01GCAGCCCAAACNONE 
Os08g0366000AK061683TTTGGGCTGTNONE 
J075038P08TTTGGGCTGTNONE 
J075078A19TTTGGGCTGTNONE 
J075116L15TTTGGGCTGTNONE 
J075117E22TTTGGGCTGTNONE 
J075118D04TTTGGGCTGTNONE 
J075139A08TTTGGGCTGTNONE 
J075175J19TTTGGGCTGTNONE 
J075197N24TTTGGGCTGTNONE 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0387050J043038F21CTTGGGCTGCConserved hypothetical protein. 
Os08g0430600009-181-E04ACAGCCCAATTNONE 
AK060045ACAGCCCAATTConserved hypothetical protein. 
AK068922ACAGCCCAATTNONE 
J013170B19ACAGCCCAATTNONE 
J065076C03ACAGCCCAATTNONE 
J065218G16ACAGCCCAATTNONE 
J090045N10ACAGCCCAATTNONE 
J100028O03ACAGCCCAATTNONE 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0492100AK060178ATTTGGGCTGGNONE 
AK071053ATTTGGGCTGGParaneoplastic encephalomyelitis antigen family protein. 
AK100101ATTTGGGCTGGNONE 
J023004I20ATTTGGGCTGGNONE 
J023067D13ATTTGGGCTGGNONE 
J033028G05ATTTGGGCTGGNONE 
J033060L15ATTTGGGCTGGNONE 
J033103N12ATTTGGGCTGGNONE 
J033125B19ATTTGGGCTGGNONE 
J065132A12ATTTGGGCTGGNONE 
J065161F02ATTTGGGCTGGNONE 
J065162L05ATTTGGGCTGGNONE 
J090093I18ATTTGGGCTGGNONE 
J100061I05ATTTGGGCTGGNONE 
J100081G13ATTTGGGCTGGNONE 
Os08g0494300AK066150GCAGCCCAAATvon Willebrand factor, type A domain containing protein. 
Os08g0496000011-009-D02TCAGCCCAAAANONE 
AK103187TCAGCCCAAAACytochrome oxidase assembly family protein. 
J033121L24TCAGCCCAAAANONE 
J033149A07TCAGCCCAAAANONE 
J065198L20TCAGCCCAAAANONE 
J090096F24TCAGCCCAAAANONE 
Os08g0565800009-034-G02AATTGGGCTGCNONE 
009-111-D12AATTGGGCTGCNONE 
AK062431AATTGGGCTGCSimilar to Glutaredoxin. 
AK062820AATTGGGCTGCNONE 
J075022E05AATTGGGCTGCNONE 
J075066F07AATTGGGCTGCNONE 
J075146B21AATTGGGCTGCNONE 
Os09g0100800AK072386TGTTGGGCTGTConserved hypothetical protein. 
J023081P06TGTTGGGCTGTNONE 
J090027B17TGTTGGGCTGTNONE 
Os09g0101800AK102345ATTTGGGCTGGGWD40-like domain containing protein. 
J090030C23ATTTGGGCTGGGNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0243200AK107718CCCAGCCCAACAZinc finger, RING-type domain containing protein. 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0324200AK109621TTTCGGCCTTTTGGGCTGACyclin-like F-box domain containing protein. 
Os09g0332100009-067-H06CTTGGGCTGCNONE 
009-092-B11CTTGGGCTGCNONE 
009-094-D10CTTGGGCTGCNONE 
009-095-C09CTTGGGCTGCNONE 
009-147-F07CTTGGGCTGCNONE 
AK069759CTTGGGCTGCConserved hypothetical protein. 
J080092G16CTTGGGCTGCNONE 
J090053I07CTTGGGCTGCNONE 
Os09g0370300AK108199TCAGCCCAACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0388400AK069644CTTGGGCTGTCof protein family protein. 
J023147A17CTTGGGCTGTNONE 
Os09g0419500016-067-D11CCAGCCCAATTNONE 
AK064394CCAGCCCAATTZinc finger, RING-type domain containing protein. 
AK073786CCAGCCCAATTNONE 
J033067G01CCAGCCCAATTNONE 
Os09g0459200AK110733AATTGGGCTGAConserved hypothetical protein. 
J065131C07AATTGGGCTGANONE 
Os09g0462300J065097M23TGTTGGGCTGTEsterase/lipase/thioesterase domain containing protein. 
J065161K12TGTTGGGCTGTNONE 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0475700AK101979AGTTGGGCTGCNONE 
Os09g0501100009-126-C12CCAGCCCAAACNONE 
AK063752CCAGCCCAAACSimilar to 60S ribosomal protein L32A. 
AK099282CCAGCCCAAACNONE 
J023130H04CCAGCCCAAACNONE 
J075013C11CCAGCCCAAACNONE 
J075060E07CCAGCCCAAACNONE 
J075106K07CCAGCCCAAACNONE 
J075124L15CCAGCCCAAACNONE 
J075161D15CCAGCCCAAACNONE 
J080311I18CCAGCCCAAACNONE 
J080315G08CCAGCCCAAACNONE 
J080316F09CCAGCCCAAACNONE 
J080318B05CCAGCCCAAACNONE 
J100052O18CCAGCCCAAACNONE 
J100064D07CCAGCCCAAACNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0530700AK058211ACAGCCCAATTConserved hypothetical protein. 
AK100759ACAGCCCAATTNONE 
J065039L02ACAGCCCAATTNONE 
J065043O03ACAGCCCAATTNONE 
J065070M16ACAGCCCAATTNONE 
Os09g0535000AK058712CTTGGGCTGTSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CTTGGGCTGTNONE 
AK069832CTTGGGCTGTNONE 
J100065D20CTTGGGCTGTNONE 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0535500AK108282ACAGCCCAAACSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0553200003-101-F12GCAGCCCAATNONE 
003-125-E09GCAGCCCAATNONE 
011-031-H12GCAGCCCAATNONE 
012-033-A01GCAGCCCAATNONE 
015-046-H04GCAGCCCAATNONE 
015-056-F04GCAGCCCAATNONE 
016-029-H06GCAGCCCAATNONE 
016-080-D05GCAGCCCAATNONE 
AB062606GCAGCCCAATNONE 
AK065780GCAGCCCAATSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930GCAGCCCAATNONE 
AK104344GCAGCCCAATNONE 
AK119197GCAGCCCAATNONE 
AK119232GCAGCCCAATNONE 
J013039M01GCAGCCCAATNONE 
J013043M01GCAGCCCAATNONE 
J013064F03GCAGCCCAATNONE 
J013066K19GCAGCCCAATNONE 
J013092G12GCAGCCCAATNONE 
J013123P09GCAGCCCAATNONE 
J013155F01GCAGCCCAATNONE 
J013158J12GCAGCCCAATNONE 
J013159H14GCAGCCCAATNONE 
J013169C10GCAGCCCAATNONE 
J013170L23GCAGCCCAATNONE 
J023010J18GCAGCCCAATNONE 
J023019E23GCAGCCCAATNONE 
J023045B14GCAGCCCAATNONE 
J023082K24GCAGCCCAATNONE 
J023086G04GCAGCCCAATNONE 
J023090N09GCAGCCCAATNONE 
J023113C08GCAGCCCAATNONE 
J023125H18GCAGCCCAATNONE 
J033034M08GCAGCCCAATNONE 
J033035K03GCAGCCCAATNONE 
J033039D15GCAGCCCAATNONE 
J033045P18GCAGCCCAATNONE 
J033058P08GCAGCCCAATNONE 
J033061D16GCAGCCCAATNONE 
J033070F14GCAGCCCAATNONE 
J033086F23GCAGCCCAATNONE 
J033095C05GCAGCCCAATNONE 
J033114H22GCAGCCCAATNONE 
J033133M20GCAGCCCAATNONE 
J043026G01GCAGCCCAATNONE 
J043037F17GCAGCCCAATNONE 
J065120K17GCAGCCCAATNONE 
J065123O07GCAGCCCAATNONE 
J080305H06GCAGCCCAATNONE 
J090001F11GCAGCCCAATNONE 
J090020C17GCAGCCCAATNONE 
J090043A19GCAGCCCAATNONE 
J090051J17GCAGCCCAATNONE 
J090068K06GCAGCCCAATNONE 
J090075P19GCAGCCCAATNONE 
J100036G10GCAGCCCAATNONE 
J100084F02GCAGCCCAATNONE 
Os09g0560600AK071381ATTTGGGCTGCNONE 
J023089I18ATTTGGGCTGCNONE 
J075015L11ATTTGGGCTGCNONE 
J075038B17ATTTGGGCTGCNONE 
J075059J18ATTTGGGCTGCNONE 
J075077H09ATTTGGGCTGCNONE 
J075091F07ATTTGGGCTGCNONE 
J075100O20ATTTGGGCTGCNONE 
J075118G11ATTTGGGCTGCNONE 
J075149F18ATTTGGGCTGCNONE 
J075156B19ATTTGGGCTGCNONE 
J075185L12ATTTGGGCTGCNONE 
J075189N02ATTTGGGCTGCNONE 
J075196A12ATTTGGGCTGCNONE 
J090024N23ATTTGGGCTGCNONE 
Os09g0568000AK068829ACAGCCCAAGNONE 
Os09g0571400AK103109ACAGCCCAACACyclophilin 1. 
J023011A12ACAGCCCAACANONE 
J033119A20ACAGCCCAACANONE 
J053034N16ACAGCCCAACANONE 
J053045N23ACAGCCCAACANONE 
J053052J12ACAGCCCAACANONE 
J053052K04ACAGCCCAACANONE 
J053099M15ACAGCCCAACANONE 
J065071H23ACAGCCCAACANONE 
J065131B16ACAGCCCAACANONE 
J075003F19ACAGCCCAACANONE 
J075116F02ACAGCCCAACANONE 
J075126G05ACAGCCCAACANONE 
J075145E09ACAGCCCAACANONE 
J075149O22ACAGCCCAACANONE 
J075163A09ACAGCCCAACANONE 
J075194A09ACAGCCCAACANONE 
L29471ACAGCCCAACANONE 
Os11g0106700006-055-F11CCAGCCCAAAANONE 
006-099-D08CCAGCCCAAAANONE 
009-155-A12CCAGCCCAAAANONE 
AF519570CCAGCCCAAAANONE 
AK059354CCAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0139500AK121845ATTTGGGCTGGNONE 
Os11g0175500015-087-F02TCAGCCCAACANONE 
AK064320TCAGCCCAACAZinc finger, RING-type domain containing protein. 
AK101592TCAGCCCAACANONE 
Os11g0181500006-025-C02GCAGCCCAAANONE 
AK060074GCAGCCCAAANONE 
AK067601GCAGCCCAAASimilar to Nitrogen fixation like protein. 
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein. 
Os11g0264600J100079I22TCAGCCCAAAANONE 
Os11g0438700012-011-H02TCAGCCCAAAANONE 
AK063434TCAGCCCAAAASimilar to Tropinone reductase-I (EC 1.1.1.206) (TR-I) (Tropine dehydrogenase). 
AK073524TCAGCCCAAAANONE 
J033046I10TCAGCCCAAAANONE 
J043029B09TCAGCCCAAAANONE 
J065033C17TCAGCCCAAAANONE 
J065062D11TCAGCCCAAAANONE 
J065138G10TCAGCCCAAAANONE 
J065184I11TCAGCCCAAAANONE 
J080030B02TCAGCCCAAAANONE 
J090063K06TCAGCCCAAAANONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0549690J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065218B08CCAGCCCAACANONE 
J065218B08CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os11g0664700012-064-D03ATTGGGCTGGNONE 
AK100084ATTGGGCTGGConserved hypothetical protein. 
J023002K05ATTGGGCTGGNONE 
J023037C21ATTGGGCTGGNONE 
J033029N10ATTGGGCTGGNONE 
J090047F07ATTGGGCTGGNONE 
Os11g0703900011-004-D05ACAGCCCAAAANONE 
011-014-C03ACAGCCCAAAANONE 
011-016-C01ACAGCCCAAAANONE 
011-017-B04ACAGCCCAAAANONE 
011-017-E09ACAGCCCAAAANONE 
011-019-E12ACAGCCCAAAANONE 
011-021-H12ACAGCCCAAAANONE 
011-025-H02ACAGCCCAAAANONE 
011-027-B09ACAGCCCAAAANONE 
011-039-G07ACAGCCCAAAANONE 
011-044-G07ACAGCCCAAAANONE 
011-046-F11ACAGCCCAAAANONE 
011-070-F02ACAGCCCAAAANONE 
011-071-A07ACAGCCCAAAANONE 
011-082-A03ACAGCCCAAAANONE 
011-086-B09ACAGCCCAAAANONE 
011-092-C04ACAGCCCAAAANONE 
012-006-F02ACAGCCCAAAANONE 
012-011-G08ACAGCCCAAAANONE 
012-026-C06ACAGCCCAAAANONE 
012-026-G06ACAGCCCAAAANONE 
012-028-E05ACAGCCCAAAANONE 
012-040-A05ACAGCCCAAAANONE 
012-045-C01ACAGCCCAAAANONE 
012-046-A10ACAGCCCAAAANONE 
012-047-H09ACAGCCCAAAANONE 
012-059-A12ACAGCCCAAAANONE 
012-072-D06ACAGCCCAAAANONE 
012-073-D05ACAGCCCAAAANONE 
012-076-D08ACAGCCCAAAANONE 
012-079-G05ACAGCCCAAAANONE 
012-080-A04ACAGCCCAAAANONE 
012-080-E01ACAGCCCAAAANONE 
012-083-C03ACAGCCCAAAANONE 
012-083-G06ACAGCCCAAAANONE 
012-086-G02ACAGCCCAAAANONE 
012-091-A07ACAGCCCAAAANONE 
012-094-G10ACAGCCCAAAANONE 
012-098-A07ACAGCCCAAAANONE 
012-100-G04ACAGCCCAAAANONE 
015-001-A11ACAGCCCAAAANONE 
015-033-E01ACAGCCCAAAANONE 
015-047-F12ACAGCCCAAAANONE 
015-054-E05ACAGCCCAAAANONE 
015-063-H02ACAGCCCAAAANONE 
015-075-E10ACAGCCCAAAANONE 
015-086-F05ACAGCCCAAAANONE 
016-031-A08ACAGCCCAAAANONE 
016-053-A03ACAGCCCAAAANONE 
016-054-C09ACAGCCCAAAANONE 
016-079-C08ACAGCCCAAAANONE 
AK065431ACAGCCCAAAAHeat shock protein 70. 
AK119255ACAGCCCAAAANONE 
J013021C12ACAGCCCAAAANONE 
J013021C17ACAGCCCAAAANONE 
J023027B08ACAGCCCAAAANONE 
J023078A21ACAGCCCAAAANONE 
J023097M06ACAGCCCAAAANONE 
J023100O04ACAGCCCAAAANONE 
J023107B17ACAGCCCAAAANONE 
J023108L24ACAGCCCAAAANONE 
J023109L05ACAGCCCAAAANONE 
J033022M22ACAGCCCAAAANONE 
J033023K21ACAGCCCAAAANONE 
J033031L11ACAGCCCAAAANONE 
J033034H10ACAGCCCAAAANONE 
J033037B16ACAGCCCAAAANONE 
J033037F16ACAGCCCAAAANONE 
J033037H07ACAGCCCAAAANONE 
J033046E22ACAGCCCAAAANONE 
J033050N12ACAGCCCAAAANONE 
J033064F10ACAGCCCAAAANONE 
J033064N10ACAGCCCAAAANONE 
J033066O09ACAGCCCAAAANONE 
J033068H01ACAGCCCAAAANONE 
J033068J07ACAGCCCAAAANONE 
J033070B10ACAGCCCAAAANONE 
J033070G13ACAGCCCAAAANONE 
J033073O13ACAGCCCAAAANONE 
J033075B07ACAGCCCAAAANONE 
J033079L15ACAGCCCAAAANONE 
J033081J06ACAGCCCAAAANONE 
J033086G13ACAGCCCAAAANONE 
J033086N07ACAGCCCAAAANONE 
J033086O05ACAGCCCAAAANONE 
J033091A15ACAGCCCAAAANONE 
J033091D05ACAGCCCAAAANONE 
J033094C12ACAGCCCAAAANONE 
J033099P03ACAGCCCAAAANONE 
J033107L09ACAGCCCAAAANONE 
J033108D16ACAGCCCAAAANONE 
J033109E12ACAGCCCAAAANONE 
J033109K14ACAGCCCAAAANONE 
J033112P22ACAGCCCAAAANONE 
J033116F12ACAGCCCAAAANONE 
J033116K01ACAGCCCAAAANONE 
J033118F19ACAGCCCAAAANONE 
J033121J10ACAGCCCAAAANONE 
J033126H04ACAGCCCAAAANONE 
J033131G17ACAGCCCAAAANONE 
J033131L05ACAGCCCAAAANONE 
J033136A08ACAGCCCAAAANONE 
J033136H22ACAGCCCAAAANONE 
J033143F01ACAGCCCAAAANONE 
J065040M10ACAGCCCAAAANONE 
J065046F17ACAGCCCAAAANONE 
J065048G20ACAGCCCAAAANONE 
J065071N06ACAGCCCAAAANONE 
J065084I24ACAGCCCAAAANONE 
J065171B01ACAGCCCAAAANONE 
J065191J21ACAGCCCAAAANONE 
J065199I20ACAGCCCAAAANONE 
J075076C02ACAGCCCAAAANONE 
J090002P12ACAGCCCAAAANONE 
J090003A11ACAGCCCAAAANONE 
J090003H11ACAGCCCAAAANONE 
J090009M22ACAGCCCAAAANONE 
J090009O11ACAGCCCAAAANONE 
J090014N09ACAGCCCAAAANONE 
J090015A18ACAGCCCAAAANONE 
J090016E16ACAGCCCAAAANONE 
J090016I07ACAGCCCAAAANONE 
J090017O07ACAGCCCAAAANONE 
J090019E10ACAGCCCAAAANONE 
J090020D24ACAGCCCAAAANONE 
J090021M16ACAGCCCAAAANONE 
J090022F13ACAGCCCAAAANONE 
J090023H03ACAGCCCAAAANONE 
J090024E15ACAGCCCAAAANONE 
J090024G19ACAGCCCAAAANONE 
J090026J19ACAGCCCAAAANONE 
J090030E20ACAGCCCAAAANONE 
J090030I15ACAGCCCAAAANONE 
J090032F04ACAGCCCAAAANONE 
J090033N22ACAGCCCAAAANONE 
J090033O19ACAGCCCAAAANONE 
J090036F08ACAGCCCAAAANONE 
J090039A13ACAGCCCAAAANONE 
J090042N07ACAGCCCAAAANONE 
J090043C15ACAGCCCAAAANONE 
J090043N09ACAGCCCAAAANONE 
J090053J10ACAGCCCAAAANONE 
J090054F14ACAGCCCAAAANONE 
J090057N12ACAGCCCAAAANONE 
J090061P13ACAGCCCAAAANONE 
J090062F17ACAGCCCAAAANONE 
J090065H15ACAGCCCAAAANONE 
J090067P11ACAGCCCAAAANONE 
J090068M09ACAGCCCAAAANONE 
J090069E24ACAGCCCAAAANONE 
J090069K16ACAGCCCAAAANONE 
J090070N07ACAGCCCAAAANONE 
J090072M09ACAGCCCAAAANONE 
J090075I24ACAGCCCAAAANONE 
J090075M04ACAGCCCAAAANONE 
J090077D24ACAGCCCAAAANONE 
J090080M17ACAGCCCAAAANONE 
J090080O14ACAGCCCAAAANONE 
J090081C12ACAGCCCAAAANONE 
J090084N21ACAGCCCAAAANONE 
J090084O21ACAGCCCAAAANONE 
J090087J18ACAGCCCAAAANONE 
J090092L17ACAGCCCAAAANONE 
J090097A08ACAGCCCAAAANONE 
J100017E24ACAGCCCAAAANONE 
J100018K11ACAGCCCAAAANONE 
J100019A16ACAGCCCAAAANONE 
J100023I23ACAGCCCAAAANONE 
J100024D07ACAGCCCAAAANONE 
J100025H12ACAGCCCAAAANONE 
J100027K19ACAGCCCAAAANONE 
J100028C23ACAGCCCAAAANONE 
J100029A14ACAGCCCAAAANONE 
J100029O19ACAGCCCAAAANONE 
J100030I09ACAGCCCAAAANONE 
J100030J16ACAGCCCAAAANONE 
J100031C01ACAGCCCAAAANONE 
J100031N06ACAGCCCAAAANONE 
J100033H04ACAGCCCAAAANONE 
J100034L20ACAGCCCAAAANONE 
J100036K13ACAGCCCAAAANONE 
J100039M02ACAGCCCAAAANONE 
J100040J01ACAGCCCAAAANONE 
J100042O21ACAGCCCAAAANONE 
J100042P20ACAGCCCAAAANONE 
J100047K22ACAGCCCAAAANONE 
J100049B16ACAGCCCAAAANONE 
J100052M10ACAGCCCAAAANONE 
J100053B05ACAGCCCAAAANONE 
J100053B20ACAGCCCAAAANONE 
J100055I11ACAGCCCAAAANONE 
J100056A13ACAGCCCAAAANONE 
J100057C08ACAGCCCAAAANONE 
J100057N11ACAGCCCAAAANONE 
J100057P07ACAGCCCAAAANONE 
J100059E16ACAGCCCAAAANONE 
J100063N14ACAGCCCAAAANONE 
J100069H01ACAGCCCAAAANONE 
J100071C17ACAGCCCAAAANONE 
J100071K09ACAGCCCAAAANONE 
J100077D07ACAGCCCAAAANONE 
J100078P22ACAGCCCAAAANONE 
J100080F11ACAGCCCAAAANONE 
J100081L07ACAGCCCAAAANONE 
J100083B10ACAGCCCAAAANONE 
J100083K17ACAGCCCAAAANONE 
J100085B22ACAGCCCAAAANONE 
J100085L21ACAGCCCAAAANONE 
J100086B11ACAGCCCAAAANONE 
J100087E06ACAGCCCAAAANONE 
J100087P07ACAGCCCAAAANONE 
J100089H24ACAGCCCAAAANONE 
Os12g0127500AK064595GCAGCCCAATConserved hypothetical protein. 
J065067F11GCAGCCCAATNONE 
J090007D02GCAGCCCAATNONE 
J100035G10GCAGCCCAATNONE 
J100077J10GCAGCCCAATNONE 
Os12g0131300J090086B06CTTGGGCTGTHypothetical protein. 
Os12g0136200AK068700TATTGGGCTGANONE 
AK069493TATTGGGCTGAWD40-like domain containing protein. 
Os12g0151500AK058389GCAGCCCAACCACACACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GCAGCCCAACCACACACCNONE 
Os12g0164300AK120100GCCCAGCCCAAGCyclin-like F-box domain containing protein. 
J013022J17GCCCAGCCCAAGNONE 
J013040L22GCCCAGCCCAAGNONE 
J013041G05GCCCAGCCCAAGNONE 
J013096I02GCCCAGCCCAAGNONE 
J013156F05GCCCAGCCCAAGNONE 
J023122E20GCCCAGCCCAAGNONE 
J065008K06GCCCAGCCCAAGNONE 
J065073G14GCCCAGCCCAAGNONE 
J065105H07GCCCAGCCCAAGNONE 
J065117A15GCCCAGCCCAAGNONE 
J075025K21GCCCAGCCCAAGNONE 
J075051A13GCCCAGCCCAAGNONE 
J075119C17GCCCAGCCCAAGNONE 
J075143A02GCCCAGCCCAAGNONE 
J075149K04GCCCAGCCCAAGNONE 
J080304A20GCCCAGCCCAAGNONE 
J080305H17GCCCAGCCCAAGNONE 
J080306D14GCCCAGCCCAAGNONE 
J080306N01GCCCAGCCCAAGNONE 
J080308P13GCCCAGCCCAAGNONE 
J080310C04GCCCAGCCCAAGNONE 
J090048B12GCCCAGCCCAAGNONE 
J090092A18GCCCAGCCCAAGNONE 
J090099G20GCCCAGCCCAAGNONE 
Os12g0223700J075049J03TGTTGGGCTGGHypothetical protein. 
J075101F23TGTTGGGCTGGNONE 
Os12g0287200009-067-B11ACAGCCCAACTNONE 
009-130-F06ACAGCCCAACTNONE 
009-185-H10ACAGCCCAACTNONE 
AF338343ACAGCCCAACTNONE 
AK063847ACAGCCCAACTSimilar to Mago nashi protein. 
AK121477ACAGCCCAACTNONE 
J023149H05ACAGCCCAACTNONE 
J065019G18ACAGCCCAACTNONE 
J065049J18ACAGCCCAACTNONE 
J065143C22ACAGCCCAACTNONE 
J075130D23ACAGCCCAACTNONE 
J090014I22ACAGCCCAACTNONE 
J090018A06ACAGCCCAACTNONE 
J090053H11ACAGCCCAACTNONE 
J090080N13ACAGCCCAACTNONE 
J100019H19ACAGCCCAACTNONE 
Os12g0477050J065069B06ATTGGGCTGTNONE 
J065105I23ATTGGGCTGTNONE 
J065203F03ATTGGGCTGTNONE 
J075019C20ATTGGGCTGTConserved hypothetical protein. 
J075164G13ATTGGGCTGTNONE 
J075187H10ATTGGGCTGTNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0527500AK109836CCCAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0590900J100033M15ACAGCCCAATConserved hypothetical protein. 
J100042H14ACAGCCCAATNONE 
J100059P17ACAGCCCAATNONE 
J100062H13ACAGCCCAATNONE 
Os12g0610950J075157D04ACAGCCCAAGHypothetical protein. 
Os12g0624000AK067726CCCACCACTTTGGGCTGGGNONE 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein. 
J013039E03CCCACCACTTTGGGCTGGGNONE 
J013040D22CCCACCACTTTGGGCTGGGNONE 
J013047K12CCCACCACTTTGGGCTGGGNONE 
J013056C04CCCACCACTTTGGGCTGGGNONE 
J013062K01CCCACCACTTTGGGCTGGGNONE 
J013108K09CCCACCACTTTGGGCTGGGNONE 
J013126I24CCCACCACTTTGGGCTGGGNONE 
J013128D18CCCACCACTTTGGGCTGGGNONE 
J013147D23CCCACCACTTTGGGCTGGGNONE 
J013154N13CCCACCACTTTGGGCTGGGNONE 
J023003C20CCCACCACTTTGGGCTGGGNONE 
J023003N19CCCACCACTTTGGGCTGGGNONE 
J023007B09CCCACCACTTTGGGCTGGGNONE 
J023008L12CCCACCACTTTGGGCTGGGNONE 
J023037O10CCCACCACTTTGGGCTGGGNONE 
J023044F11CCCACCACTTTGGGCTGGGNONE 
J023062H22CCCACCACTTTGGGCTGGGNONE 
J023064O07CCCACCACTTTGGGCTGGGNONE 
J023067D16CCCACCACTTTGGGCTGGGNONE 
J023082C19CCCACCACTTTGGGCTGGGNONE 
J023090A08CCCACCACTTTGGGCTGGGNONE 
J023102P21CCCACCACTTTGGGCTGGGNONE 
J023122G15CCCACCACTTTGGGCTGGGNONE 
J023123I24CCCACCACTTTGGGCTGGGNONE 
J023134N07CCCACCACTTTGGGCTGGGNONE 
J023140M21CCCACCACTTTGGGCTGGGNONE 
J033023G06CCCACCACTTTGGGCTGGGNONE 
J033025J02CCCACCACTTTGGGCTGGGNONE 
J033025L06CCCACCACTTTGGGCTGGGNONE 
J033026I21CCCACCACTTTGGGCTGGGNONE 
J033028G20CCCACCACTTTGGGCTGGGNONE 
J033028L03CCCACCACTTTGGGCTGGGNONE 
J033030P14CCCACCACTTTGGGCTGGGNONE 
J033031C02CCCACCACTTTGGGCTGGGNONE 
J033031I06CCCACCACTTTGGGCTGGGNONE 
J033037D21CCCACCACTTTGGGCTGGGNONE 
J033037M24CCCACCACTTTGGGCTGGGNONE 
J033040P06CCCACCACTTTGGGCTGGGNONE 
J033046J18CCCACCACTTTGGGCTGGGNONE 
J033048A14CCCACCACTTTGGGCTGGGNONE 
J033048B14CCCACCACTTTGGGCTGGGNONE 
J033051N03CCCACCACTTTGGGCTGGGNONE 
J033060A19CCCACCACTTTGGGCTGGGNONE 
J033060K19CCCACCACTTTGGGCTGGGNONE 
J033065O13CCCACCACTTTGGGCTGGGNONE 
J033067I23CCCACCACTTTGGGCTGGGNONE 
J033068N13CCCACCACTTTGGGCTGGGNONE 
J033070N02CCCACCACTTTGGGCTGGGNONE 
J033072K15CCCACCACTTTGGGCTGGGNONE 
J033073D09CCCACCACTTTGGGCTGGGNONE 
J033075H17CCCACCACTTTGGGCTGGGNONE 
J033076O22CCCACCACTTTGGGCTGGGNONE 
J033086K06CCCACCACTTTGGGCTGGGNONE 
J033086L03CCCACCACTTTGGGCTGGGNONE 
J033088J09CCCACCACTTTGGGCTGGGNONE 
J033091D17CCCACCACTTTGGGCTGGGNONE 
J033096B11CCCACCACTTTGGGCTGGGNONE 
J033099A05CCCACCACTTTGGGCTGGGNONE 
J033101B15CCCACCACTTTGGGCTGGGNONE 
J033101D20CCCACCACTTTGGGCTGGGNONE 
J033105D22CCCACCACTTTGGGCTGGGNONE 
J033106J20CCCACCACTTTGGGCTGGGNONE 
J033107J01CCCACCACTTTGGGCTGGGNONE 
J033111N08CCCACCACTTTGGGCTGGGNONE 
J033112B18CCCACCACTTTGGGCTGGGNONE 
J033113L04CCCACCACTTTGGGCTGGGNONE 
J033114F02CCCACCACTTTGGGCTGGGNONE 
J033118A22CCCACCACTTTGGGCTGGGNONE 
J033119J02CCCACCACTTTGGGCTGGGNONE 
J033120F22CCCACCACTTTGGGCTGGGNONE 
J033120O16CCCACCACTTTGGGCTGGGNONE 
J033127A12CCCACCACTTTGGGCTGGGNONE 
J033127J08CCCACCACTTTGGGCTGGGNONE 
J033127N13CCCACCACTTTGGGCTGGGNONE 
J033131N09CCCACCACTTTGGGCTGGGNONE 
J033135I05CCCACCACTTTGGGCTGGGNONE 
J033140D04CCCACCACTTTGGGCTGGGNONE 
J033142D04CCCACCACTTTGGGCTGGGNONE 
J033145B14CCCACCACTTTGGGCTGGGNONE 
J043007I15CCCACCACTTTGGGCTGGGNONE 
J043021N20CCCACCACTTTGGGCTGGGNONE 
J043037I05CCCACCACTTTGGGCTGGGNONE 
J065008P22CCCACCACTTTGGGCTGGGNONE 
J065038C05CCCACCACTTTGGGCTGGGNONE 
J065060A16CCCACCACTTTGGGCTGGGNONE 
J065111M10CCCACCACTTTGGGCTGGGNONE 
J065112L11CCCACCACTTTGGGCTGGGNONE 
J065114B07CCCACCACTTTGGGCTGGGNONE 
J065116M04CCCACCACTTTGGGCTGGGNONE 
J065152D15CCCACCACTTTGGGCTGGGNONE 
J065171C15CCCACCACTTTGGGCTGGGNONE 
J065173N07CCCACCACTTTGGGCTGGGNONE 
J065185N18CCCACCACTTTGGGCTGGGNONE 
J065187F09CCCACCACTTTGGGCTGGGNONE 
J065188L15CCCACCACTTTGGGCTGGGNONE 
J065190K15CCCACCACTTTGGGCTGGGNONE 
J065214C16CCCACCACTTTGGGCTGGGNONE 
J065215F05CCCACCACTTTGGGCTGGGNONE 
J075108J08CCCACCACTTTGGGCTGGGNONE 
J090002C16CCCACCACTTTGGGCTGGGNONE 
J090002K12CCCACCACTTTGGGCTGGGNONE 
J090003M10CCCACCACTTTGGGCTGGGNONE 
J090007J12CCCACCACTTTGGGCTGGGNONE 
J090010D06CCCACCACTTTGGGCTGGGNONE 
J090010F21CCCACCACTTTGGGCTGGGNONE 
J090014E20CCCACCACTTTGGGCTGGGNONE 
J090014J03CCCACCACTTTGGGCTGGGNONE 
J090017E15CCCACCACTTTGGGCTGGGNONE 
J090019J18CCCACCACTTTGGGCTGGGNONE 
J090021B21CCCACCACTTTGGGCTGGGNONE 
J090021H21CCCACCACTTTGGGCTGGGNONE 
J090021J12CCCACCACTTTGGGCTGGGNONE 
J090022K10CCCACCACTTTGGGCTGGGNONE 
J090024C24CCCACCACTTTGGGCTGGGNONE 
J090026D12CCCACCACTTTGGGCTGGGNONE 
J090034F08CCCACCACTTTGGGCTGGGNONE 
J090036H24CCCACCACTTTGGGCTGGGNONE 
J090036L04CCCACCACTTTGGGCTGGGNONE 
J090040C21CCCACCACTTTGGGCTGGGNONE 
J090045J21CCCACCACTTTGGGCTGGGNONE 
J090052D21CCCACCACTTTGGGCTGGGNONE 
J090053A01CCCACCACTTTGGGCTGGGNONE 
J090057E01CCCACCACTTTGGGCTGGGNONE 
J090059A01CCCACCACTTTGGGCTGGGNONE 
J090059M24CCCACCACTTTGGGCTGGGNONE 
J090062A08CCCACCACTTTGGGCTGGGNONE 
J090065H17CCCACCACTTTGGGCTGGGNONE 
J090073M22CCCACCACTTTGGGCTGGGNONE 
J090074J05CCCACCACTTTGGGCTGGGNONE 
J090074L22CCCACCACTTTGGGCTGGGNONE 
J090077E04CCCACCACTTTGGGCTGGGNONE 
J090077K10CCCACCACTTTGGGCTGGGNONE 
J090088E21CCCACCACTTTGGGCTGGGNONE 
J090088L13CCCACCACTTTGGGCTGGGNONE 
J090089M05CCCACCACTTTGGGCTGGGNONE 
J090092E18CCCACCACTTTGGGCTGGGNONE 
J090092P07CCCACCACTTTGGGCTGGGNONE 
J090096M04CCCACCACTTTGGGCTGGGNONE 
J090099I04CCCACCACTTTGGGCTGGGNONE 
J100023P11CCCACCACTTTGGGCTGGGNONE 
J100024K13CCCACCACTTTGGGCTGGGNONE 
J100026P20CCCACCACTTTGGGCTGGGNONE 
J100027I15CCCACCACTTTGGGCTGGGNONE 
J100027M21CCCACCACTTTGGGCTGGGNONE 
J100029H05CCCACCACTTTGGGCTGGGNONE 
J100030E10CCCACCACTTTGGGCTGGGNONE 
J100030F11CCCACCACTTTGGGCTGGGNONE 
J100031C13CCCACCACTTTGGGCTGGGNONE 
J100032P16CCCACCACTTTGGGCTGGGNONE 
J100034G02CCCACCACTTTGGGCTGGGNONE 
J100037D06CCCACCACTTTGGGCTGGGNONE 
J100050D08CCCACCACTTTGGGCTGGGNONE 
J100051J22CCCACCACTTTGGGCTGGGNONE 
J100055G12CCCACCACTTTGGGCTGGGNONE 
J100056O15CCCACCACTTTGGGCTGGGNONE 
J100057E06CCCACCACTTTGGGCTGGGNONE 
J100061P11CCCACCACTTTGGGCTGGGNONE 
J100064H05CCCACCACTTTGGGCTGGGNONE 
J100066D14CCCACCACTTTGGGCTGGGNONE 
J100067D10CCCACCACTTTGGGCTGGGNONE 
J100070L11CCCACCACTTTGGGCTGGGNONE 
J100071N11CCCACCACTTTGGGCTGGGNONE 
J100073D21CCCACCACTTTGGGCTGGGNONE 
J100074L06CCCACCACTTTGGGCTGGGNONE 
J100081I01CCCACCACTTTGGGCTGGGNONE 
J100083F08CCCACCACTTTGGGCTGGGNONE 
J100083I15CCCACCACTTTGGGCTGGGNONE 
J100084P13CCCACCACTTTGGGCTGGGNONE 
J100086N12CCCACCACTTTGGGCTGGGNONE 
Os12g0630600J100033A04ACAGCCCAAAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.