version

Summary of OsREG512 (All List)

OrganismOryza sativa  
IDOsREG512  
SequenceCAGCCCAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count975  

Entry Sequences (975 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0179300AB118015CCCAGCCCAGNONE 
AK066179CCCAGCCCAGConserved hypothetical protein. 
J013027I24CCCAGCCCAGNONE 
J013057C04CCCAGCCCAGNONE 
J013114A12CCCAGCCCAGNONE 
J033044D13CCCAGCCCAGNONE 
J033088C17CCCAGCCCAGNONE 
J065079P13CCCAGCCCAGNONE 
J065097I15CCCAGCCCAGNONE 
J100025A19CCCAGCCCAGNONE 
J100027L07CCCAGCCCAGNONE 
J100035E12CCCAGCCCAGNONE 
J100076G01CCCAGCCCAGNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0184000015-008-B06ACAGCCCAGNONE 
AK071130ACAGCCCAGNUC156 family protein. 
AK100604ACAGCCCAGNONE 
J075155H07ACAGCCCAGNONE 
J100047O19ACAGCCCAGNONE 
J100074A09ACAGCCCAGNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0348700009-125-H02GCAGCCCAGTTNONE 
009-156-F08GCAGCCCAGTTNONE 
009-177-A11GCAGCCCAGTTNONE 
009-195-D02GCAGCCCAGTTNONE 
013-040-B06GCAGCCCAGTTNONE 
013-051-B09GCAGCCCAGTTNONE 
AK120842GCAGCCCAGTTSimilar to 60S ribosomal protein L23a (L25). 
J013071O22GCAGCCCAGTTNONE 
J023022J07GCAGCCCAGTTNONE 
J033028J08GCAGCCCAGTTNONE 
J033109M11GCAGCCCAGTTNONE 
J043022K15GCAGCCCAGTTNONE 
J043031N11GCAGCCCAGTTNONE 
J053023I10GCAGCCCAGTTNONE 
J053045F16GCAGCCCAGTTNONE 
J053054F22GCAGCCCAGTTNONE 
J053094P15GCAGCCCAGTTNONE 
J065048F01GCAGCCCAGTTNONE 
J075012F16GCAGCCCAGTTNONE 
J075089C09GCAGCCCAGTTNONE 
J075179J20GCAGCCCAGTTNONE 
J080305E19GCAGCCCAGTTNONE 
J080309B21GCAGCCCAGTTNONE 
J090017L05GCAGCCCAGTTNONE 
J090058B11GCAGCCCAGTTNONE 
Os01g0373400AK110973GCTGGGCTGCHomeodomain-like containing protein. 
Os01g0559200AK102611GCAGCCCAGTAConserved hypothetical protein. 
J033099D01GCAGCCCAGTANONE 
J043003D13GCAGCCCAGTANONE 
J090030B01GCAGCCCAGTANONE 
J090044A12GCAGCCCAGTANONE 
Os01g0585400AK103584ACAGCCCAGConserved hypothetical protein. 
J033133B01ACAGCCCAGNONE 
Os01g0593600AK069058CTGGGCTGGConserved hypothetical protein. 
J023004I01CTGGGCTGGNONE 
Os01g0683400AB110983CCAGCCCAGCCNONE 
AK102997CCAGCCCAGCCSimilar to Origin recognition complex 4. 
J033116E22CCAGCCCAGCCNONE 
J090087A03CCAGCCCAGCCNONE 
Os01g0708600AK111377GCAGCCCAGCTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07GCAGCCCAGCNONE 
J065007E03GCAGCCCAGCNONE 
J065015A13GCAGCCCAGCNONE 
J065093J17GCAGCCCAGCNONE 
J065116C09GCAGCCCAGCNONE 
J065120E04GCAGCCCAGCNONE 
J065197I17GCAGCCCAGCNONE 
J065208L13GCAGCCCAGCNONE 
J065213P07GCAGCCCAGCNONE 
J075056K07GCAGCCCAGCNONE 
J090036L08GCAGCCCAGCNONE 
Os01g0730500AK100064TCAGCCCAGSimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0834900AK063898CCAGCCCAGCHypothetical protein. 
Os01g0848200AK069425GCTGGGCTGASimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GCTGGGCTGANONE 
Os01g0861000AK058707TCAGCCCAGConserved hypothetical protein. 
Os01g0867600AK102226CTGGGCTGCSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0876500J053026A07CCAGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CCAGCCCAGCNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0913300AK100698CCAGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07CCAGCCCAGCCNONE 
J023102B09CCAGCCCAGCCNONE 
J023102N03CCAGCCCAGCCNONE 
J023114K11CCAGCCCAGCCNONE 
J023140A21CCAGCCCAGCCNONE 
J043017F23CCAGCCCAGCCNONE 
J075058O15CCAGCCCAGCCNONE 
Os01g0929000AK073334CTGGGCTGGGConserved hypothetical protein. 
J033024D22CTGGGCTGGGNONE 
Os01g0934500AK073211TCAGCCCAGCConserved hypothetical protein. 
Os01g0948300009-023-A03GCAGCCCAGCNONE 
AK102153GCAGCCCAGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24GCAGCCCAGCNONE 
J023019C13GCAGCCCAGCNONE 
J023049L21GCAGCCCAGCNONE 
J023066H02GCAGCCCAGCNONE 
J033050A07GCAGCCCAGCNONE 
J033086E01GCAGCCCAGCNONE 
J033086F11GCAGCCCAGCNONE 
J090047I04GCAGCCCAGCNONE 
J100035E10GCAGCCCAGCNONE 
J100040L06GCAGCCCAGCNONE 
J100044G21GCAGCCCAGCNONE 
J100045F13GCAGCCCAGCNONE 
J100046G12GCAGCCCAGCNONE 
J100075N10GCAGCCCAGCNONE 
J100077I01GCAGCCCAGCNONE 
Os01g0972800AK110625CTGGGCTGGGNONE 
AY341842CTGGGCTGGGWRKY1 (WRKY transcription factor 17). 
AY870605CTGGGCTGGGNONE 
Os02g0103700009-031-C12CTGGGCTGCNONE 
AK062502CTGGGCTGCNONE 
AK102186CTGGGCTGCSimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17CTGGGCTGCNONE 
J065161I07CTGGGCTGCNONE 
J065184G15CTGGGCTGCNONE 
J075123E02CTGGGCTGCNONE 
Os02g0130300011-005-D07CTGGGCTGANONE 
011-041-B06CTGGGCTGANONE 
015-099-D11CTGGGCTGANONE 
016-049-D06CTGGGCTGANONE 
AK102708CTGGGCTGAZinc finger, RING-type domain containing protein. 
Os02g0160200AK109618GGCTGGGCTGGCyclin-like F-box domain containing protein. 
Os02g0192700004-020-H12AACTGGGCTGGNONE 
006-024-H06AACTGGGCTGGNONE 
006-042-F06AACTGGGCTGGNONE 
006-050-D04AACTGGGCTGGNONE 
006-059-E10AACTGGGCTGGNONE 
006-070-B02AACTGGGCTGGNONE 
006-084-A09AACTGGGCTGGNONE 
006-114-E11AACTGGGCTGGNONE 
006-117-E05AACTGGGCTGGNONE 
009-126-D11AACTGGGCTGGNONE 
AK061629AACTGGGCTGGSimilar to Thioredoxin peroxidase. 
AK065909AACTGGGCTGGNONE 
J013043E11AACTGGGCTGGNONE 
J065038I09AACTGGGCTGGNONE 
J065078C12AACTGGGCTGGNONE 
J065122O14AACTGGGCTGGNONE 
J065198H04AACTGGGCTGGNONE 
Os02g0510300AK067961CTGGGCTGTConserved hypothetical protein. 
AK104001CTGGGCTGTNONE 
J013123J20CTGGGCTGTNONE 
J065169H15CTGGGCTGTNONE 
Os02g0597300AK064487GCAGCCCAGHypothetical protein. 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0661900006-030-G12GCAGCCCAGATNONE 
AK061447GCAGCCCAGATSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2. 
AK068742GCAGCCCAGATNONE 
J075046K13GCAGCCCAGATNONE 
J075139O08GCAGCCCAGATNONE 
J075149I16GCAGCCCAGATNONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0729400J075028G02CCAGCCCAGNONE 
Os02g0732900AK065796CTGGGCTGGGProtein of unknown function DUF794, plant family protein. 
AK104342CTGGGCTGGGNONE 
Os02g0753200AK067176GCAGCCCAGCCConserved hypothetical protein. 
J013097D23GCAGCCCAGCCNONE 
J065085J01GCAGCCCAGCCNONE 
J065152L23GCAGCCCAGCCNONE 
J065162F18GCAGCCCAGCCNONE 
J075002K17GCAGCCCAGCCNONE 
J075047D24GCAGCCCAGCCNONE 
J075064A01GCAGCCCAGCCNONE 
J075075C09GCAGCCCAGCCNONE 
J075088M01GCAGCCCAGCCNONE 
J075130K03GCAGCCCAGCCNONE 
J075146K03GCAGCCCAGCCNONE 
J090049F07GCAGCCCAGCCNONE 
Os02g0758200AK111266CCAGCCCAGCCConserved hypothetical protein. 
Os02g0767500005-017-F10ACAGCCCAGATNONE 
AB016065ACAGCCCAGATNONE 
AK069611ACAGCCCAGATMitochondrial phosphate transporter. 
J013020K11ACAGCCCAGATNONE 
J013066I18ACAGCCCAGATNONE 
J023012D02ACAGCCCAGATNONE 
J023020J16ACAGCCCAGATNONE 
J023022H13ACAGCCCAGATNONE 
J023044N15ACAGCCCAGATNONE 
J023067E15ACAGCCCAGATNONE 
J023079C06ACAGCCCAGATNONE 
J023080B07ACAGCCCAGATNONE 
J023081G11ACAGCCCAGATNONE 
J023091H22ACAGCCCAGATNONE 
J023092J03ACAGCCCAGATNONE 
J023114D02ACAGCCCAGATNONE 
J023121J15ACAGCCCAGATNONE 
J023128G10ACAGCCCAGATNONE 
J023132B15ACAGCCCAGATNONE 
J023140G10ACAGCCCAGATNONE 
J023142B10ACAGCCCAGATNONE 
J033026C15ACAGCCCAGATNONE 
J033029F21ACAGCCCAGATNONE 
J033037I09ACAGCCCAGATNONE 
J033046D11ACAGCCCAGATNONE 
J033081L20ACAGCCCAGATNONE 
J033097J19ACAGCCCAGATNONE 
J033125D19ACAGCCCAGATNONE 
J033125I04ACAGCCCAGATNONE 
J033141M21ACAGCCCAGATNONE 
J033143K08ACAGCCCAGATNONE 
J053091N01ACAGCCCAGATNONE 
J065093C20ACAGCCCAGATNONE 
J065104K11ACAGCCCAGATNONE 
J065143L16ACAGCCCAGATNONE 
J065205I23ACAGCCCAGATNONE 
J090057C12ACAGCCCAGATNONE 
J090075P11ACAGCCCAGATNONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0831300AK106522CCAGCCCAGNONE 
J065042E05CCAGCCCAGNONE 
Os03g0101400AK120679GCTGGGCTGAConserved hypothetical protein. 
J013162J03GCTGGGCTGANONE 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0126000AK121680CTGGGCTGGSimilar to Phosphorybosyl anthranilate transferase 1. 
AY224452CTGGGCTGGNONE 
Os03g0131400015-012-D11CCAGCCCAGTANONE 
AK103714CCAGCCCAGTAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TACTGGGCTGGVitamin K epoxide reductase domain containing protein. 
Os03g0142900011-054-A05CCCAGCCCAGNONE 
AK067103CCCAGCCCAGNONE 
AK120438CCCAGCCCAGProtein of unknown function DUF946, plant family protein. 
J013097D18CCCAGCCCAGNONE 
J013098E18CCCAGCCCAGNONE 
J013099I17CCCAGCCCAGNONE 
J013108C09CCCAGCCCAGNONE 
J023045J15CCCAGCCCAGNONE 
J033034E13CCCAGCCCAGNONE 
J033095F07CCCAGCCCAGNONE 
J033102N22CCCAGCCCAGNONE 
J065016C14CCCAGCCCAGNONE 
J065034E13CCCAGCCCAGNONE 
J065065F21CCCAGCCCAGNONE 
J065159M09CCCAGCCCAGNONE 
J075012C13CCCAGCCCAGNONE 
J075017P18CCCAGCCCAGNONE 
J075018M03CCCAGCCCAGNONE 
J075021H19CCCAGCCCAGNONE 
J075070K23CCCAGCCCAGNONE 
J075077B18CCCAGCCCAGNONE 
J075085E20CCCAGCCCAGNONE 
J075090N23CCCAGCCCAGNONE 
J075137M16CCCAGCCCAGNONE 
J075151E03CCCAGCCCAGNONE 
J090042L02CCCAGCCCAGNONE 
J090060C21CCCAGCCCAGNONE 
J090089I17CCCAGCCCAGNONE 
J100024L19CCCAGCCCAGNONE 
J100025A06CCCAGCCCAGNONE 
J100033C24CCCAGCCCAGNONE 
J100052J17CCCAGCCCAGNONE 
J100063H10CCCAGCCCAGNONE 
J100073P04CCCAGCCCAGNONE 
J100075D01CCCAGCCCAGNONE 
J100077J17CCCAGCCCAGNONE 
J100087F03CCCAGCCCAGNONE 
J100087F09CCCAGCCCAGNONE 
Os03g0168200AK099530TCAGCCCAGATConserved hypothetical protein. 
Os03g0197400AK071413GCAGCCCAGCCCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905GCAGCCCAGCCCNONE 
J053023D18GCAGCCCAGCCCNONE 
Os03g0228200AK059414CTGGGCTGCConserved hypothetical protein. 
Os03g0241600004-009-G06TCAGCCCAGNONE 
AK060019TCAGCCCAGProtein kinase domain containing protein. 
J013043F06TCAGCCCAGNONE 
J013169B22TCAGCCCAGNONE 
J065048F13TCAGCCCAGNONE 
J065082G24TCAGCCCAGNONE 
J065195I20TCAGCCCAGNONE 
J100041A19TCAGCCCAGNONE 
J100043G20TCAGCCCAGNONE 
J100069E18TCAGCCCAGNONE 
J100084N06TCAGCCCAGNONE 
Os03g0249400009-059-H08GCTGGGCTGGNONE 
AK062522GCTGGGCTGGSimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05GCTGGGCTGGNONE 
J053052E06GCTGGGCTGGNONE 
J053061K22GCTGGGCTGGNONE 
J065108I02GCTGGGCTGGNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0261500AK061995ATCTGGGCTGANONE 
J013044K20ATCTGGGCTGANONE 
J033113A11ATCTGGGCTGANONE 
J100032O18ATCTGGGCTGANONE 
J100037K21ATCTGGGCTGANONE 
Os03g0269300011-021-H03CCAGCCCAGCNONE 
011-029-B01CCAGCCCAGCNONE 
AK111855CCAGCCCAGCNONE 
AK111884CCAGCCCAGCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0313600AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0315400AK120551CCAGCCCAGCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
J013130B13CCAGCCCAGCCNONE 
J065053B05CCAGCCCAGCCNONE 
J065169H20CCAGCCCAGCCNONE 
J065169M22CCAGCCCAGCCNONE 
J100061H19CCAGCCCAGCCNONE 
Os03g0331900AK063044CCAGCCCAGNONE 
AK099570CCAGCCCAGConserved hypothetical protein. 
J065064G01CCAGCCCAGNONE 
Os03g0336200AK059473CATCCCCCAGCCCAGNONE 
AK070466CATCCCCCAGCCCAGTranscription factor RF2b. 
AY466471CATCCCCCAGCCCAGNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0390400009-175-E06GCAGCCCAGNONE 
013-040-G01GCAGCCCAGNONE 
014-050-G05GCAGCCCAGNONE 
AB025187GCAGCCCAGSimilar to Cytochrome c oxidase subunit 6b. 
AK120174GCAGCCCAGNONE 
J013033A17GCAGCCCAGNONE 
J023028J08GCAGCCCAGNONE 
J023061N05GCAGCCCAGNONE 
J023077A03GCAGCCCAGNONE 
J023086E01GCAGCCCAGNONE 
J033022A08GCAGCCCAGNONE 
J033040F24GCAGCCCAGNONE 
J075073I24GCAGCCCAGNONE 
J075081H01GCAGCCCAGNONE 
J075175N19GCAGCCCAGNONE 
J100025M03GCAGCCCAGNONE 
J100036J06GCAGCCCAGNONE 
J100045O18GCAGCCCAGNONE 
J100062G15GCAGCCCAGNONE 
J100090N19GCAGCCCAGNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0604600J090093K23CCAGCCCAGATGGGCTConserved hypothetical protein. 
Os03g0639700AK099587AACTGGGCTGASimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
AK099587ATCTGGGCTGCSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0712600015-008-G03CCAGCCCAGNONE 
AK103705CCAGCCCAGHypothetical protein. 
J033136N14CCAGCCCAGNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0118100006-100-G08CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
AK058463CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
J065078C03CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
Os04g0170500AK103323GCAGCCCAGHypothetical protein. 
Os04g0376600J033065H17GGCTGGGCTGGGNONE 
Os04g0391900AK101777CCAGCCCAGCAmidohydrolase 2 family protein. 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0577500006-039-C03CTGGGCTGCNONE 
006-043-H01CTGGGCTGCNONE 
AK061538CTGGGCTGCNONE 
AK065648CTGGGCTGCTatD-related deoxyribonuclease family protein. 
AK104763CTGGGCTGCNONE 
J013035E21CTGGGCTGCNONE 
J013066M11CTGGGCTGCNONE 
J100026B02CTGGGCTGCNONE 
Os04g0589200AK068571AGCCCAGCCCAGCCConserved hypothetical protein. 
AK102463AGCCCAGCCCAGCCNONE 
J075083K10AGCCCAGCCCAGCCNONE 
Os04g0589600011-100-F04TACTGGGCTGTNONE 
AK061833TACTGGGCTGTGlycosyl transferase, group 1 domain containing protein. 
AK098964TACTGGGCTGTNONE 
AK100053TACTGGGCTGTNONE 
Os04g0675400AK068186TCAGCCCAGSimilar to Chaperone protein dnaJ. 
J013029J20TCAGCCCAGNONE 
J013072I16TCAGCCCAGNONE 
J013134H18TCAGCCCAGNONE 
J013159H06TCAGCCCAGNONE 
Os04g0682800AK121846CCAGCCCAGCCCAGCSodium/hydrogen exchanger family protein. 
Os04g0691900AK068257GCAGCCCAGCCACCAACChaperonin Cpn60/TCP-1 family protein. 
Os05g0104800006-022-G08AACTGGGCTGCNONE 
AK070215AACTGGGCTGCSimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f). 
AK104207AACTGGGCTGCNONE 
AK104554AACTGGGCTGCNONE 
J023043K07AACTGGGCTGCNONE 
J023079C24AACTGGGCTGCNONE 
J033050A14AACTGGGCTGCNONE 
J033095G11AACTGGGCTGCNONE 
J033097D16AACTGGGCTGCNONE 
J033108J11AACTGGGCTGCNONE 
J053037E01AACTGGGCTGCNONE 
J053061I17AACTGGGCTGCNONE 
J065040F22AACTGGGCTGCNONE 
J065055B15AACTGGGCTGCNONE 
J065091N23AACTGGGCTGCNONE 
J090062J16AACTGGGCTGCNONE 
J100065J21AACTGGGCTGCNONE 
Os05g0123400AK069521TCAGCCCAGCConserved hypothetical protein. 
J023022O05TCAGCCCAGCNONE 
Os05g0153400AK108071TCAGCCCAGProtein prenyltransferase domain containing protein. 
Os05g0168400006-039-A06TACTGGGCTGANONE 
AK069800TACTGGGCTGANONE 
AK106195TACTGGGCTGAConserved hypothetical protein. 
J065086N09TACTGGGCTGANONE 
J065137B10TACTGGGCTGANONE 
J075062B04TACTGGGCTGANONE 
J075193I07TACTGGGCTGANONE 
J075193K24TACTGGGCTGANONE 
J075194D10TACTGGGCTGANONE 
J100037F01TACTGGGCTGANONE 
J100071E09TACTGGGCTGANONE 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0459300009-006-D08GCTGGGCTGCNONE 
AK062312GCTGGGCTGCNONE 
AK119604GCTGGGCTGCNONE 
AK121463GCTGGGCTGCConserved hypothetical protein. 
J023145E12GCTGGGCTGCNONE 
Os05g0490800J065037L19CCAGCCCAGNONE 
Os05g0500500AK110627GCAGCCCAGTAHSP20-like chaperone domain containing protein. 
Os05g0540100AB021666CCCAGCCCAGCCNONE 
AK060623CCCAGCCCAGCCNONE 
AK103819CCCAGCCCAGCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0551700AK071216CCCAGCCCAGCCtRNA isopentenyltransferase family protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0594800AK058332CCAGCCCAGCAdhesion regulating molecule family protein. 
AK068013CCAGCCCAGCNONE 
J013129L24CCAGCCCAGCNONE 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0119300AK067271CCAGCCCAATCCAGCCCAGProtein of unknown function DUF594 family protein. 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0143700AK067270GCAGCCCAGTASimilar to Sulfate transporter 2. 
J013098O05GCAGCCCAGTANONE 
J065017H17GCAGCCCAGTANONE 
Os06g0183100AK073624CTGGGCTGCNONE 
AK101165CTGGGCTGCNONE 
AK102959CTGGGCTGCSimilar to Two-component response regulator ARR14. 
J013055G23CTGGGCTGCNONE 
J033028D10CTGGGCTGCNONE 
J033107A11CTGGGCTGCNONE 
J033115H14CTGGGCTGCNONE 
J043013A11CTGGGCTGCNONE 
J065111E06CTGGGCTGCNONE 
J100018K01CTGGGCTGCNONE 
J100088B08CTGGGCTGCNONE 
J100089C02CTGGGCTGCNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0351500006-083-H04CTGGGCTGGNONE 
006-090-H02CTGGGCTGGNONE 
006-113-H07CTGGGCTGGNONE 
AK061188CTGGGCTGGNONE 
AK067876CTGGGCTGGLipolytic enzyme, G-D-S-L family protein. 
AK099072CTGGGCTGGNONE 
J090059P21CTGGGCTGGNONE 
J090062K17CTGGGCTGGNONE 
Os06g0573600AK102756GCTGGGCTGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23GCTGGGCTGANONE 
J033107B05GCTGGGCTGANONE 
J090078G02GCTGGGCTGANONE 
J090099E09GCTGGGCTGANONE 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0691200AK108191CCAGCCCAGCSimilar to Thaumatin-like protein precursor. 
Os06g0731700J065089G16CTGGGCTGGGNONE 
J065157E16CTGGGCTGGGNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0198300006-052-H02GCAGCCCAGCCNONE 
009-097-B09GCAGCCCAGCCNONE 
009-116-E02GCAGCCCAGCCNONE 
009-186-A12GCAGCCCAGCCNONE 
AK060951GCAGCCCAGCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830GCAGCCCAGCCNONE 
J023117F24GCAGCCCAGCCNONE 
J065073D24GCAGCCCAGCCNONE 
J065116O11GCAGCCCAGCCNONE 
J065122C11GCAGCCCAGCCNONE 
Os07g0240400009-080-C04GCAGCCCAGCNONE 
AK062643GCAGCCCAGCConserved hypothetical protein. 
Os07g0256200AK072904GCTGGGCTGGGCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCTGGGCTGGGCTNONE 
Os07g0300200AK120733CCCAGCCCAGProtein prenyltransferase domain containing protein. 
Os07g0408100AK108466CCAGCCCAGNONE 
AK111780CCAGCCCAGWD40-like domain containing protein. 
Os07g0408700004-019-E03CCAGCCCAGNONE 
015-093-D01CCAGCCCAGNONE 
AJ251298CCAGCCCAGNONE 
AK060916CCAGCCCAGNONE 
AK099606CCAGCCCAGSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2). 
J013052G01CCAGCCCAGNONE 
Os07g0568900009-083-H02CCAGCCCAGTTNONE 
AK062660CCAGCCCAGTTConserved hypothetical protein. 
Os07g0569000AK073915AACTGGGCTGGConserved hypothetical protein. 
Os07g0571100AK119301CCCAGCCCAGCConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0195400006-057-E04ACAGCCCAGTANONE 
006-060-B10ACAGCCCAGTANONE 
AK070464ACAGCCCAGTAConserved hypothetical protein. 
AK104389ACAGCCCAGTANONE 
AK106140ACAGCCCAGTANONE 
J023013G08ACAGCCCAGTANONE 
J023054K19ACAGCCCAGTANONE 
J023089D18ACAGCCCAGTANONE 
J023092K05ACAGCCCAGTANONE 
J033025A08ACAGCCCAGTANONE 
J033067P12ACAGCCCAGTANONE 
J033098A10ACAGCCCAGTANONE 
J065219L04ACAGCCCAGTANONE 
J090021P06ACAGCCCAGTANONE 
J090062M05ACAGCCCAGTANONE 
J090079F15ACAGCCCAGTANONE 
J100041H19ACAGCCCAGTANONE 
Os08g0327700AK107930ACAGCCCAGLate embryogenesis abundant (LEA) group 1 family protein. 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0435800AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0471800AK105281CTGGGCTGTRemorin, C-terminal region domain containing protein. 
Os08g0471900015-099-E10GCAGCCCAGNONE 
AK069434GCAGCCCAGZinc finger, ZPR1-type domain containing protein. 
Os08g0476900AK101432CTGGGCTGGSimilar to Patatin-like protein 1. 
J033038K22CTGGGCTGGNONE 
J065089F13CTGGGCTGGNONE 
Os08g0511800011-007-H01AAGGCCCACTGGGCTGANONE 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0527100AK119411TCAGCCCAGCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TCAGCCCAGCCNONE 
J090029K18TCAGCCCAGCCNONE 
Os08g0532800AK061214GGCTGGGCTCTGGGCTGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK061387GGCTGGGCTCTGGGCTGTNONE 
AK067802GGCTGGGCTCTGGGCTGTNONE 
AK104251GGCTGGGCTCTGGGCTGTNONE 
Os08g0539700AB013451GGGCTGGGCTGANONE 
AK065693GGGCTGGGCTGADisease resistance protein family protein. 
AK099855GGGCTGGGCTGANONE 
J013022K17GGGCTGGGCTGANONE 
J013035D04GGGCTGGGCTGANONE 
J013037A20GGGCTGGGCTGANONE 
J013043I01GGGCTGGGCTGANONE 
J013051J07GGGCTGGGCTGANONE 
J013056G09GGGCTGGGCTGANONE 
J013067C09GGGCTGGGCTGANONE 
J013067M22GGGCTGGGCTGANONE 
J013089C05GGGCTGGGCTGANONE 
J013106J08GGGCTGGGCTGANONE 
J013110K12GGGCTGGGCTGANONE 
J013114K06GGGCTGGGCTGANONE 
J013135N19GGGCTGGGCTGANONE 
J013149H06GGGCTGGGCTGANONE 
J075111G14GGGCTGGGCTGANONE 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os09g0115500006-023-A12GCAGCCCAGCCNONE 
006-042-G01GCAGCCCAGCCNONE 
AK061717GCAGCCCAGCCCBS domain containing protein. 
AK065986GCAGCCCAGCCNONE 
J013043C13GCAGCCCAGCCNONE 
J013111D13GCAGCCCAGCCNONE 
J023114K12GCAGCCCAGCCNONE 
J065102N18GCAGCCCAGCCNONE 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0298500009-037-H05CTGGGCTGTNONE 
015-032-F11CTGGGCTGTNONE 
AK062446CTGGGCTGTNONE 
AK064311CTGGGCTGTZinc finger, RING-type domain containing protein. 
Os09g0381400AK070060CCAGCCCAGCSimilar to Ervatamin C (EC 3.4.22.-) (ERV-C). 
AK071091CCAGCCCAGCNONE 
AK121482CCAGCCCAGCNONE 
J023012A12CCAGCCCAGCNONE 
J023020C17CCAGCCCAGCNONE 
J023022A04CCAGCCCAGCNONE 
J023023L01CCAGCCCAGCNONE 
J023030H24CCAGCCCAGCNONE 
J023037K19CCAGCCCAGCNONE 
J023039D03CCAGCCCAGCNONE 
J023039L09CCAGCCCAGCNONE 
J023041D01CCAGCCCAGCNONE 
J023042B22CCAGCCCAGCNONE 
J023042J06CCAGCCCAGCNONE 
J023045I18CCAGCCCAGCNONE 
J023061G16CCAGCCCAGCNONE 
J023079N05CCAGCCCAGCNONE 
J023107I09CCAGCCCAGCNONE 
J023110N16CCAGCCCAGCNONE 
J023111F23CCAGCCCAGCNONE 
J023112D15CCAGCCCAGCNONE 
J023112P12CCAGCCCAGCNONE 
J023121J19CCAGCCCAGCNONE 
J023125B04CCAGCCCAGCNONE 
J023132B12CCAGCCCAGCNONE 
J023146J21CCAGCCCAGCNONE 
J090046I17CCAGCCCAGCNONE 
J090073M23CCAGCCCAGCNONE 
J090080L22CCAGCCCAGCNONE 
J100043P14CCAGCCCAGCNONE 
J100047M20CCAGCCCAGCNONE 
J100055M10CCAGCCCAGCNONE 
J100080J10CCAGCCCAGCNONE 
Os09g0433650J075094M19ACAGCCCAGTobacco mosaic virus coat protein family protein. 
Os09g0458100AK109625CTGGGCTGTXyloglucan fucosyltransferase family protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0489500AK100210GCAGCCCAGSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK103174GCAGCCCAGNONE 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0534800009-128-G09TCAGCCCAGTCGGACGGACNONE 
AF464908TCAGCCCAGTCGGACGGACNONE 
AK068941TCAGCCCAGTCGGACGGACTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08TCAGCCCAGTCGGACGGACNONE 
J023123L05TCAGCCCAGTCGGACGGACNONE 
J043020O05TCAGCCCAGTCGGACGGACNONE 
Os09g0557400AK099503GCAGCCCAGMitochondrial glycoprotein family protein. 
J065138P07GCAGCCCAGNONE 
J075092A17GCAGCCCAGNONE 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os11g0129800Os11g0129800CCAGCCCAGConserved hypothetical protein. 
Os11g0151700AK073222TCAGCCCAGSimilar to Purple acid phosphatase. 
J033148F11TCAGCCCAGNONE 
Os11g0168200005-010-H01CCCAGCCCAGCCCAGNONE 
009-156-F07CCCAGCCCAGCCCAGNONE 
012-025-F01CCCAGCCCAGCCCAGNONE 
012-089-A02CCCAGCCCAGCCCAGNONE 
016-016-E08CCCAGCCCAGCCCAGNONE 
AK073392CCCAGCCCAGCCCAG60S ribosomal protein L3. 
AK099225CCCAGCCCAGCCCAGNONE 
AK101469CCCAGCCCAGCCCAGNONE 
AY236158CCCAGCCCAGCCCAGNONE 
J013152M22CCCAGCCCAGCCCAGNONE 
J023013N11CCCAGCCCAGCCCAGNONE 
J023038J11CCCAGCCCAGCCCAGNONE 
J023054N21CCCAGCCCAGCCCAGNONE 
J033041E13CCCAGCCCAGCCCAGNONE 
J033050O09CCCAGCCCAGCCCAGNONE 
J033093G05CCCAGCCCAGCCCAGNONE 
J033094J17CCCAGCCCAGCCCAGNONE 
J033112J24CCCAGCCCAGCCCAGNONE 
J033113D05CCCAGCCCAGCCCAGNONE 
J033120K10CCCAGCCCAGCCCAGNONE 
J033121H19CCCAGCCCAGCCCAGNONE 
J033129C08CCCAGCCCAGCCCAGNONE 
J033140H24CCCAGCCCAGCCCAGNONE 
J065020I18CCCAGCCCAGCCCAGNONE 
J065058L01CCCAGCCCAGCCCAGNONE 
J065059G22CCCAGCCCAGCCCAGNONE 
J065212L09CCCAGCCCAGCCCAGNONE 
J075047P09CCCAGCCCAGCCCAGNONE 
J075063C18CCCAGCCCAGCCCAGNONE 
J075076E07CCCAGCCCAGCCCAGNONE 
J075077F14CCCAGCCCAGCCCAGNONE 
J075086C22CCCAGCCCAGCCCAGNONE 
J075161L09CCCAGCCCAGCCCAGNONE 
J075177K20CCCAGCCCAGCCCAGNONE 
J090007L06CCCAGCCCAGCCCAGNONE 
J090010M02CCCAGCCCAGCCCAGNONE 
J090013M20CCCAGCCCAGCCCAGNONE 
J090044I15CCCAGCCCAGCCCAGNONE 
J090045O06CCCAGCCCAGCCCAGNONE 
J090060L04CCCAGCCCAGCCCAGNONE 
J090061C17CCCAGCCCAGCCCAGNONE 
J090062F10CCCAGCCCAGCCCAGNONE 
J090066L03CCCAGCCCAGCCCAGNONE 
J090089E13CCCAGCCCAGCCCAGNONE 
J090096D21CCCAGCCCAGCCCAGNONE 
J100039F12CCCAGCCCAGCCCAGNONE 
J100053N06CCCAGCCCAGCCCAGNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0297900AK067692CCAGCCCAGSimilar to Txnl4b protein. 
J013118F01CCAGCCCAGNONE 
J023066E22CCAGCCCAGNONE 
J023066E24CCAGCCCAGNONE 
Os11g0306300006-102-D09GCTGGGCTGTNONE 
AK109384GCTGGGCTGTSimilar to Herbicide safener binding protein. 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0545800AK073687CCAGCCCAGCCCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
AK073687CCAGCCCAGTTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGCCCNONE 
J090050C14CCAGCCCAGTTNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0156400012-065-D02ACAGCCCAGNONE 
AK072086ACAGCCCAGNONE 
AK099278ACAGCCCAGDcp1-like decapping family protein. 
J013063H09ACAGCCCAGNONE 
J023125D09ACAGCCCAGNONE 
J023149G21ACAGCCCAGNONE 
J033064E07ACAGCCCAGNONE 
J033093C07ACAGCCCAGNONE 
J033107E06ACAGCCCAGNONE 
J075172A11ACAGCCCAGNONE 
J090009E07ACAGCCCAGNONE 
J090023F13ACAGCCCAGNONE 
J090071N18ACAGCCCAGNONE 
Os12g0244000AK106408CCAGCCCAGTTHypothetical protein. 
Os12g0421000AK071491CCAGCCCAGSimilar to Barley stem rust resistance protein. 
J023098J19CCAGCCCAGNONE 
J065215L22CCAGCCCAGNONE 
J090094F02CCAGCCCAGNONE 
Os12g0550800006-091-A05GCAGCCCAGNONE 
AK061828GCAGCCCAGNONE 
AK098944GCAGCCCAGNONE 
AK102550GCAGCCCAGHypothetical protein. 
J013045G24GCAGCCCAGNONE 
J065156K11GCAGCCCAGNONE 
J065201E21GCAGCCCAGNONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0596300AK109146CCAGCCCAGTTDC1 domain containing protein. 
AK109146CCAGCCCAGTTDC1 domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.