version

Summary of OsREG513 (All List)

OrganismOryza sativa  
IDOsREG513  
SequenceCAGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2281  

Entry Sequences (2281 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952CCTGGGCCTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCTGGGCCTGGNONE 
J013123J12CCTGGGCCTGGNONE 
J033026O19CCTGGGCCTGGNONE 
J033128C08CCTGGGCCTGGNONE 
J065116M14CCTGGGCCTGGNONE 
J090058F15CCTGGGCCTGGNONE 
J090079F20CCTGGGCCTGGNONE 
Os01g0172000012-070-G06GCTGGGCCTGNONE 
AK068405GCTGGGCCTGALG3 family protein. 
J013149A07GCTGGGCCTGNONE 
J053047H05GCTGGGCCTGNONE 
J065075N03GCTGGGCCTGNONE 
J065093G22GCTGGGCCTGNONE 
J065130N21GCTGGGCCTGNONE 
J065143P05GCTGGGCCTGNONE 
J065216H07GCTGGGCCTGNONE 
J075013B06GCTGGGCCTGNONE 
J075196M05GCTGGGCCTGNONE 
J100039G24GCTGGGCCTGNONE 
J100041B11GCTGGGCCTGNONE 
J100069A16GCTGGGCCTGNONE 
J100069L12GCTGGGCCTGNONE 
J100074P16GCTGGGCCTGNONE 
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE 
009-028-D05GCCCATGGGCCTGGNONE 
009-058-B11GCCCATGGGCCTGGNONE 
009-151-D09GCCCATGGGCCTGGNONE 
013-026-G03GCCCATGGGCCTGGNONE 
013-063-F04GCCCATGGGCCTGGNONE 
013-069-B05GCCCATGGGCCTGGNONE 
014-029-E04GCCCATGGGCCTGGNONE 
014-072-H04GCCCATGGGCCTGGNONE 
014-089-E09GCCCATGGGCCTGGNONE 
015-047-G05GCCCATGGGCCTGGNONE 
016-033-G06GCCCATGGGCCTGGNONE 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08GCCCATGGGCCTGGNONE 
J023077K21GCCCATGGGCCTGGNONE 
J023081F19GCCCATGGGCCTGGNONE 
J033052N11GCCCATGGGCCTGGNONE 
J033058N11GCCCATGGGCCTGGNONE 
J033114G05GCCCATGGGCCTGGNONE 
J033114O17GCCCATGGGCCTGGNONE 
J033129L14GCCCATGGGCCTGGNONE 
J053029I12GCCCATGGGCCTGGNONE 
J065067N19GCCCATGGGCCTGGNONE 
J065084I19GCCCATGGGCCTGGNONE 
J065099O03GCCCATGGGCCTGGNONE 
J065201I08GCCCATGGGCCTGGNONE 
J075035B08GCCCATGGGCCTGGNONE 
J075037B22GCCCATGGGCCTGGNONE 
J075054L16GCCCATGGGCCTGGNONE 
J075059D15GCCCATGGGCCTGGNONE 
J075164I08GCCCATGGGCCTGGNONE 
J075185J01GCCCATGGGCCTGGNONE 
J090042O06GCCCATGGGCCTGGNONE 
J090044F12GCCCATGGGCCTGGNONE 
J090063L02GCCCATGGGCCTGGNONE 
J090073I10GCCCATGGGCCTGGNONE 
J090078E18GCCCATGGGCCTGGNONE 
J100072K16GCCCATGGGCCTGGNONE 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0250600J075046P13CAGGCCCAATANONE 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0276500006-030-E04GGCTGGGCCTGANONE 
AK061002GGCTGGGCCTGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGCTGGGCCTGANONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0327600AK120216ATTTGGGCCTGANONE 
AK121799ATTTGGGCCTGAConserved hypothetical protein. 
J065081I07ATTTGGGCCTGANONE 
J065082D04ATTTGGGCCTGANONE 
J065082G10ATTTGGGCCTGANONE 
J065085G24ATTTGGGCCTGANONE 
J065105J24ATTTGGGCCTGANONE 
J065128D18ATTTGGGCCTGANONE 
J065155D13ATTTGGGCCTGANONE 
J065200C11ATTTGGGCCTGANONE 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
J065002A07TCATGGGCCTGNONE 
J065079J08TCATGGGCCTGNONE 
J065167M18TCATGGGCCTGNONE 
Os01g0560200AK102003TCAGGCCCAGGSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06TCAGGCCCAGGNONE 
J065092F14TCAGGCCCAGGNONE 
J065106D04TCAGGCCCAGGNONE 
J065194K23TCAGGCCCAGGNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0709000Os01g0709000TCAGGCCCAGCSimilar to Transcription factor MYB1. 
Os01g0754000014-081-F07CCAGGCCCATCTNONE 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
J065219A11CCAGGCCCATCTNONE 
J075136N13CCAGGCCCATCTNONE 
J100051G01CCAGGCCCATCTNONE 
J100053M22CCAGGCCCATCTNONE 
Os01g0764300J090053G03TCAGGCCCACCProtein of unknown function DUF155 family protein. 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0785700AK100774AGCCGTTGGGCCTGNONE 
AK102081AGCCGTTGGGCCTGProtein prenyltransferase domain containing protein. 
AY129829AGCCGTTGGGCCTGNONE 
J023120B17AGCCGTTGGGCCTGNONE 
J033082K10AGCCGTTGGGCCTGNONE 
Os01g0794100009-027-B12TGTGGGCCTGNONE 
AK062404TGTGGGCCTGConserved hypothetical protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0817700006-112-C04TGTTGGGCCTGNONE 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
J013098M23CAGGCCCATGANONE 
Os01g0833200AK121629ACTGGGCCTGGConserved hypothetical protein. 
J023093N07ACTGGGCCTGGNONE 
J033050C20ACTGGGCCTGGNONE 
J080302F22ACTGGGCCTGGNONE 
J080303H06ACTGGGCCTGGNONE 
J080306J04ACTGGGCCTGGNONE 
J080309K06ACTGGGCCTGGNONE 
J080311E18ACTGGGCCTGGNONE 
J080318A20ACTGGGCCTGGNONE 
J100031F20ACTGGGCCTGGNONE 
J100034P21ACTGGGCCTGGNONE 
J100042K08ACTGGGCCTGGNONE 
J100047H24ACTGGGCCTGGNONE 
J100065C14ACTGGGCCTGGNONE 
J100074E23ACTGGGCCTGGNONE 
Os01g0836400AK073540GTTGGGCCTGSAC3/GANP family protein. 
J023019D11GTTGGGCCTGNONE 
J023139O22GTTGGGCCTGNONE 
J033042J20GTTGGGCCTGNONE 
J033046M18GTTGGGCCTGNONE 
J033124J09GTTGGGCCTGNONE 
J090015E05GTTGGGCCTGNONE 
J090076J09GTTGGGCCTGNONE 
Os01g0839700006-051-C07TCTGGGCCTGNONE 
006-068-C11TCTGGGCCTGNONE 
006-110-B10TCTGGGCCTGNONE 
006-116-G06TCTGGGCCTGNONE 
009-105-F07TCTGGGCCTGNONE 
AK099038TCTGGGCCTGNONE 
AK104148TCTGGGCCTGNONE 
AK112030TCTGGGCCTGSimilar to Ubiquitin carrier protein. 
J013042A08TCTGGGCCTGNONE 
J013135H01TCTGGGCCTGNONE 
J033058E09TCTGGGCCTGNONE 
J043020K17TCTGGGCCTGNONE 
J065034F06TCTGGGCCTGNONE 
J065057B21TCTGGGCCTGNONE 
J065075F07TCTGGGCCTGNONE 
J065076D08TCTGGGCCTGNONE 
J065084E10TCTGGGCCTGNONE 
J065109L12TCTGGGCCTGNONE 
J065114J04TCTGGGCCTGNONE 
J065159L23TCTGGGCCTGNONE 
J075009L02TCTGGGCCTGNONE 
J075178P14TCTGGGCCTGNONE 
J075197L07TCTGGGCCTGNONE 
J090060O04TCTGGGCCTGNONE 
J100076I20TCTGGGCCTGNONE 
Os01g0848200AK069425GGCTGGGCCTGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GGCTGGGCCTGNONE 
Os01g0852200AK063954CCAGGCCCAAGCCCNONE 
Os01g0853800006-033-H02TCAGGCCCAATTNONE 
006-037-A10TCAGGCCCAATTNONE 
006-038-F10TCAGGCCCAATTNONE 
006-054-E01TCAGGCCCAATTNONE 
006-067-E10TCAGGCCCAATTNONE 
012-015-G05TCAGGCCCAATTNONE 
AK069147TCAGGCCCAATTC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929TCAGGCCCAATTNONE 
AK106144TCAGGCCCAATTNONE 
AK106186TCAGGCCCAATTNONE 
J023007P09TCAGGCCCAATTNONE 
J023007P10TCAGGCCCAATTNONE 
J065084L10TCAGGCCCAATTNONE 
J065179B10TCAGGCCCAATTNONE 
J065186D16TCAGGCCCAATTNONE 
J075040I08TCAGGCCCAATTNONE 
J075043K21TCAGGCCCAATTNONE 
J075051J08TCAGGCCCAATTNONE 
J075061D24TCAGGCCCAATTNONE 
J075095H04TCAGGCCCAATTNONE 
J075145J12TCAGGCCCAATTNONE 
J075148O18TCAGGCCCAATTNONE 
J075187J05TCAGGCCCAATTNONE 
J090042A20TCAGGCCCAATTNONE 
J100025K01TCAGGCCCAATTNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
Os01g0896800AK065268CCAGGCCCACANONE 
AK104693CCAGGCCCACAEukaryotic ribosomal protein L5 family protein. 
J013126P09CCAGGCCCACANONE 
J033046N15CCAGGCCCACANONE 
J090008K02CCAGGCCCACANONE 
J090024F15CCAGGCCCACANONE 
J090074I23CCAGGCCCACANONE 
J090093F03CCAGGCCCACANONE 
J090096N02CCAGGCCCACANONE 
Os01g0920200AK120182TCAGGCCCAGTASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14TCAGGCCCAGTANONE 
J013063O14TCAGGCCCAGTANONE 
J023023D20TCAGGCCCAGTANONE 
J075121J02TCAGGCCCAGTANONE 
Os01g0934500AK073211CAGGCCCATCTConserved hypothetical protein. 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0959900AK058375GCTGGGCCTGAConserved hypothetical protein. 
AK058375TCAGGCCCAGTConserved hypothetical protein. 
AK066497GCTGGGCCTGANONE 
AK066497TCAGGCCCAGTNONE 
Os01g0960800AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTGANONE 
AY313247TAATGGGCCTGGNONE 
J033075P16TAATGGGCCTGANONE 
J033075P16TAATGGGCCTGGNONE 
J065051H06TAATGGGCCTGANONE 
J065051H06TAATGGGCCTGGNONE 
J065167L02TAATGGGCCTGANONE 
J065167L02TAATGGGCCTGGNONE 
J090083C22TAATGGGCCTGANONE 
J090083C22TAATGGGCCTGGNONE 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CCAGGCCCATCANONE 
Os02g0188500AK102004TCAGGCCCATATNONE 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
J090039N13TCAGGCCCATATNONE 
Os02g0208200J023104K09AGATGGGCCTGANONE 
J033080L20AGATGGGCCTGANONE 
J033105D08AGATGGGCCTGANONE 
J090079N16AGATGGGCCTGANONE 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0245000AK119770CCAGGCCCACGANONE 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
J065038L11CCAGGCCCACGANONE 
J100059I06CCAGGCCCACGANONE 
J100076C23CCAGGCCCACGANONE 
J100081P08CCAGGCCCACGANONE 
J100084C13CCAGGCCCACGANONE 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AF139211TATTGGGCCTGANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK062577TATTGGGCCTGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK099051TATTGGGCCTGANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TATTGGGCCTGANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TATTGGGCCTGANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TATTGGGCCTGANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TATTGGGCCTGANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TATTGGGCCTGANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TATTGGGCCTGANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TATTGGGCCTGANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TATTGGGCCTGANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TATTGGGCCTGANONE 
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein. 
Os02g0266500AK100307TCAGGCCCATTSimilar to RASPBERRY3. 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0525400011-008-B01CAGGCCCAAANONE 
AK065368CAGGCCCAAASimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAGGCCCAAANONE 
J033046H10CAGGCCCAAANONE 
Os02g0530600012-040-G06TCTGGGCCTGNONE 
AK105277TCTGGGCCTGNONE 
J075004K11TCTGGGCCTGNONE 
J075024O04TCTGGGCCTGNONE 
J075031K02TCTGGGCCTGNONE 
J075067K01TCTGGGCCTGNONE 
J075087G22TCTGGGCCTGNONE 
J075097A07TCTGGGCCTGNONE 
J075109O12TCTGGGCCTGNONE 
J075110K07TCTGGGCCTGNONE 
J075117C17TCTGGGCCTGNONE 
J075143O07TCTGGGCCTGNONE 
J075146F13TCTGGGCCTGNONE 
J075166I18TCTGGGCCTGNONE 
J075176N09TCTGGGCCTGNONE 
J075182F16TCTGGGCCTGNONE 
Os02g0637900AK110708CAGGCCCAGCCConserved hypothetical protein. 
J065038O03CAGGCCCAGCCNONE 
J065052A19CAGGCCCAGCCNONE 
J065052A20CAGGCCCAGCCNONE 
J065063D06CAGGCCCAGCCNONE 
J065069D12CAGGCCCAGCCNONE 
J065074H07CAGGCCCAGCCNONE 
J065174K17CAGGCCCAGCCNONE 
J065215M12CAGGCCCAGCCNONE 
J075007E12CAGGCCCAGCCNONE 
J075057K20CAGGCCCAGCCNONE 
J075119I10CAGGCCCAGCCNONE 
Os02g0656500011-045-C08TCAGGCCCACTNONE 
011-045-E06TCAGGCCCACTNONE 
016-046-A01TCAGGCCCACTNONE 
016-046-B01TCAGGCCCACTNONE 
AK062239TCAGGCCCACTNONE 
AK066420TCAGGCCCACTDnaJ-like protein. 
J013067J21TCAGGCCCACTNONE 
J065047L09TCAGGCCCACTNONE 
J065104M20TCAGGCCCACTNONE 
J065134B04TCAGGCCCACTNONE 
J065152C10TCAGGCCCACTNONE 
J065161O03TCAGGCCCACTNONE 
J065169F18TCAGGCCCACTNONE 
J065210M21TCAGGCCCACTNONE 
J065217B03TCAGGCCCACTNONE 
J065218C10TCAGGCCCACTNONE 
J075041F09TCAGGCCCACTNONE 
J075048A02TCAGGCCCACTNONE 
J075083F21TCAGGCCCACTNONE 
J080005F10TCAGGCCCACTNONE 
J080013P21TCAGGCCCACTNONE 
J080027J09TCAGGCCCACTNONE 
J080037O17TCAGGCCCACTNONE 
J080039F02TCAGGCCCACTNONE 
J080039G01TCAGGCCCACTNONE 
J080041I09TCAGGCCCACTNONE 
J080043M01TCAGGCCCACTNONE 
J080060H17TCAGGCCCACTNONE 
J080062O07TCAGGCCCACTNONE 
J080079F05TCAGGCCCACTNONE 
J080093H04TCAGGCCCACTNONE 
J080096B15TCAGGCCCACTNONE 
J080097H24TCAGGCCCACTNONE 
J090032O11TCAGGCCCACTNONE 
J090044F01TCAGGCCCACTNONE 
J090045E04TCAGGCCCACTNONE 
J090048O03TCAGGCCCACTNONE 
J090049E04TCAGGCCCACTNONE 
J090070E19TCAGGCCCACTNONE 
J090079E13TCAGGCCCACTNONE 
J090089L14TCAGGCCCACTNONE 
J090095K13TCAGGCCCACTNONE 
J090096I19TCAGGCCCACTNONE 
J090098B04TCAGGCCCACTNONE 
J100027P13TCAGGCCCACTNONE 
J100048H06TCAGGCCCACTNONE 
J100060J15TCAGGCCCACTNONE 
J100070K16TCAGGCCCACTNONE 
J100074O22TCAGGCCCACTNONE 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
AK067833TCTGGGCCTGAAA ATPase domain containing protein. 
Os02g0741500AK068867CAGGCCCACCARibbon-helix-helix domain containing protein. 
Os02g0762300AK106684CAGGCCCATAAProtein of unknown function UPF0021 family protein. 
J090060M09CAGGCCCATAANONE 
J100083E05CAGGCCCATAANONE 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-154-G01GTTGGGCCTGGNONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
009-172-H09GTTGGGCCTGGNONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
AK099885GTTGGGCCTGGGlutaredoxin 2 family protein. 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
Os02g0800000J100043O08TATTGGGCCTGNONE 
J100064O18TATTGGGCCTGNONE 
Os02g0802400J065054M13AGGTGGGCCTGGNONE 
J065061I04AGGTGGGCCTGGNONE 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
J100050L24AGGTGGGCCTGGNONE 
J100059D20AGGTGGGCCTGGNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK099203CCAGGCCCATAANONE 
Os02g0814800AK109850TATTGGGCCTGGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
J065055C02CAGGCCCATGANONE 
J065098A17CAGGCCCATGANONE 
J065119B13CAGGCCCATGANONE 
J065146F10CAGGCCCATGANONE 
J065209G06CAGGCCCATGANONE 
J080001K12CAGGCCCATGANONE 
J080004O17CAGGCCCATGANONE 
J080005P21CAGGCCCATGANONE 
J080009M18CAGGCCCATGANONE 
J080013O18CAGGCCCATGANONE 
J080014B04CAGGCCCATGANONE 
J080014O21CAGGCCCATGANONE 
J080015B04CAGGCCCATGANONE 
J080016B17CAGGCCCATGANONE 
J080017G09CAGGCCCATGANONE 
J080022A17CAGGCCCATGANONE 
J080024M10CAGGCCCATGANONE 
J080025F17CAGGCCCATGANONE 
J080025O16CAGGCCCATGANONE 
J080029H09CAGGCCCATGANONE 
J080030G24CAGGCCCATGANONE 
J080031E02CAGGCCCATGANONE 
J080032A18CAGGCCCATGANONE 
J080032G24CAGGCCCATGANONE 
J080033C05CAGGCCCATGANONE 
J080033N19CAGGCCCATGANONE 
J080035H10CAGGCCCATGANONE 
J080035L05CAGGCCCATGANONE 
J080042N09CAGGCCCATGANONE 
J080044C14CAGGCCCATGANONE 
J080048K16CAGGCCCATGANONE 
J080050L07CAGGCCCATGANONE 
J080051L06CAGGCCCATGANONE 
J080051P22CAGGCCCATGANONE 
J080053D09CAGGCCCATGANONE 
J080053J15CAGGCCCATGANONE 
J080053O12CAGGCCCATGANONE 
J080057L01CAGGCCCATGANONE 
J080062E08CAGGCCCATGANONE 
J080062I09CAGGCCCATGANONE 
J080063A21CAGGCCCATGANONE 
J080063E04CAGGCCCATGANONE 
J080063E08CAGGCCCATGANONE 
J080064D15CAGGCCCATGANONE 
J080064N15CAGGCCCATGANONE 
J080068F13CAGGCCCATGANONE 
J080070L16CAGGCCCATGANONE 
J080072O17CAGGCCCATGANONE 
J080075A07CAGGCCCATGANONE 
J080076H10CAGGCCCATGANONE 
J080077K19CAGGCCCATGANONE 
J080078E19CAGGCCCATGANONE 
J080082A02CAGGCCCATGANONE 
J080083O05CAGGCCCATGANONE 
J080091I07CAGGCCCATGANONE 
J080094K10CAGGCCCATGANONE 
J080094N03CAGGCCCATGANONE 
J080096F09CAGGCCCATGANONE 
J080097O04CAGGCCCATGANONE 
J090037B19CAGGCCCATGANONE 
J100017A13CAGGCCCATGANONE 
J100068N22CAGGCCCATGANONE 
J100072C06CAGGCCCATGANONE 
Os02g0829900009-044-G07AGGTGGGCGTGGGCCTGNONE 
AK120917AGGTGGGCGTGGGCCTGSimilar to BRICK1. 
AY224582AGGTGGGCGTGGGCCTGNONE 
J023034L01AGGTGGGCGTGGGCCTGNONE 
J023034M01AGGTGGGCGTGGGCCTGNONE 
J090010G06AGGTGGGCGTGGGCCTGNONE 
J090020D07AGGTGGGCGTGGGCCTGNONE 
J100041L04AGGTGGGCGTGGGCCTGNONE 
J100061D05AGGTGGGCGTGGGCCTGNONE 
J100070L18AGGTGGGCGTGGGCCTGNONE 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
J065053F07TCAGGCCCATCGNONE 
J065095B09TCAGGCCCATCGNONE 
J065137I11TCAGGCCCATCGNONE 
J065187O12TCAGGCCCATCGNONE 
J075193O05TCAGGCCCATCGNONE 
Os02g0832700AK099439CAGGCCCATTASimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0104000AK063829TTATGGGCCTGSimilar to Centromere protein. 
Os03g0108600AK065776CAGGCCCATAADEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAGGCCCATAANONE 
Os03g0117100005-014-F09TCAGGCCCATATNONE 
006-027-C07TCAGGCCCATATNONE 
006-036-G11TCAGGCCCATATNONE 
006-038-H10TCAGGCCCATATNONE 
006-044-D08TCAGGCCCATATNONE 
006-105-H12TCAGGCCCATATNONE 
009-190-G08TCAGGCCCATATNONE 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK104570TCAGGCCCATATNONE 
AK104706TCAGGCCCATATNONE 
J013055H24TCAGGCCCATATNONE 
J023044I05TCAGGCCCATATNONE 
J075111G05TCAGGCCCATATNONE 
J080002K23TCAGGCCCATATNONE 
J080002N12TCAGGCCCATATNONE 
J080004B01TCAGGCCCATATNONE 
J080007H19TCAGGCCCATATNONE 
J080008M18TCAGGCCCATATNONE 
J080011D18TCAGGCCCATATNONE 
J080012J01TCAGGCCCATATNONE 
J080018C19TCAGGCCCATATNONE 
J080022C20TCAGGCCCATATNONE 
J080022I05TCAGGCCCATATNONE 
J080022M12TCAGGCCCATATNONE 
J080023P03TCAGGCCCATATNONE 
J080025A05TCAGGCCCATATNONE 
J080029C02TCAGGCCCATATNONE 
J080036H08TCAGGCCCATATNONE 
J080039P12TCAGGCCCATATNONE 
J080040H05TCAGGCCCATATNONE 
J080045I23TCAGGCCCATATNONE 
J080057O04TCAGGCCCATATNONE 
J080059K18TCAGGCCCATATNONE 
J080061E04TCAGGCCCATATNONE 
J080062C20TCAGGCCCATATNONE 
J080062F10TCAGGCCCATATNONE 
J080062L05TCAGGCCCATATNONE 
J080068L06TCAGGCCCATATNONE 
J080069N09TCAGGCCCATATNONE 
J080071M14TCAGGCCCATATNONE 
J080072K17TCAGGCCCATATNONE 
J080080A09TCAGGCCCATATNONE 
J080086A18TCAGGCCCATATNONE 
J080088O14TCAGGCCCATATNONE 
J080089O04TCAGGCCCATATNONE 
J080092G21TCAGGCCCATATNONE 
J080094K09TCAGGCCCATATNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0128500AB037900TTATGGGCCTGANONE 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TTATGGGCCTGANONE 
J090032P09TTATGGGCCTGANONE 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0143400AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21CAGGCCCATGANONE 
J033073C08CAGGCCCATGANONE 
J033094C19CAGGCCCATGANONE 
J065017L10CAGGCCCATGANONE 
J065070H22CAGGCCCATGANONE 
J065079M09CAGGCCCATGANONE 
J065091N18CAGGCCCATGANONE 
J065109N03CAGGCCCATGANONE 
J065113F05CAGGCCCATGANONE 
J065135D23CAGGCCCATGANONE 
J065156L16CAGGCCCATGANONE 
J065207O04CAGGCCCATGANONE 
J065208F03CAGGCCCATGANONE 
J090010M15CAGGCCCATGANONE 
J090056J18CAGGCCCATGANONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0193225012-084-B12TCAGGCCCACGTNONE 
AK069459TCAGGCCCACGTFrigida-like family protein. 
J023019D20TCAGGCCCACGTNONE 
Os03g0240500003-116-E06CAGGCCCAGCCCNONE 
AK058676CAGGCCCAGCCCSimilar to Toc34-2 protein. 
AK099032CAGGCCCAGCCCNONE 
J013128A13CAGGCCCAGCCCNONE 
J075064H17CAGGCCCAGCCCNONE 
J075075N03CAGGCCCAGCCCNONE 
J075079H24CAGGCCCAGCCCNONE 
J075127D23CAGGCCCAGCCCNONE 
J075132C09CAGGCCCAGCCCNONE 
J075159D02CAGGCCCAGCCCNONE 
J090053O11CAGGCCCAGCCCNONE 
J090062N04CAGGCCCAGCCCNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0321000AK103653CCAGGCCCAATASimilar to Steroid membrane binding protein-like. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0360500009-103-B05GGATGGGCCTGGNONE 
AK059166GGATGGGCCTGGNONE 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
J033061G19GGATGGGCCTGGNONE 
J065169P12GGATGGGCCTGGNONE 
J075104C18GGATGGGCCTGGNONE 
J075166G07GGATGGGCCTGGNONE 
J075170J04GGATGGGCCTGGNONE 
Os03g0364000J065042L07TCATGGGCCTGNONE 
J065061O16TCATGGGCCTGNONE 
J065075L02TCATGGGCCTGNONE 
J065138N02TCATGGGCCTGNONE 
J065209H20TCATGGGCCTGNONE 
J075019G03TCATGGGCCTGNONE 
J075086E23TCATGGGCCTGNONE 
J075094M12TCATGGGCCTGNONE 
J075139L07TCATGGGCCTGNONE 
J075162I16TCATGGGCCTGNONE 
J075199G20TCATGGGCCTGNONE 
Os03g0383100AK107106TCAGGCCCATAConserved hypothetical protein. 
Os03g0386000AK072984GGCTGGGCCTGGSimilar to WD domain protein-like. 
J065009K18GGCTGGGCCTGGNONE 
J065165P09GGCTGGGCCTGGNONE 
Os03g0579000AK061586CCAGGCCCATATNONE 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0581600J065037H09TCATGGGCCTGNONE 
J065183O12TCATGGGCCTGNONE 
Os03g0586800003-114-H11CCAGGCCCATTTNONE 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302CCAGGCCCATTTNONE 
J090004H06CCAGGCCCATTTNONE 
J090022N15CCAGGCCCATTTNONE 
J100035E05CCAGGCCCATTTNONE 
J100041L05CCAGGCCCATTTNONE 
J100041M18CCAGGCCCATTTNONE 
J100057P04CCAGGCCCATTTNONE 
J100089H06CCAGGCCCATTTNONE 
J100090C23CCAGGCCCATTTNONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0606200009-030-E09CCAGGCCCACTNONE 
009-076-H10CCAGGCCCACTNONE 
009-122-H12CCAGGCCCACTNONE 
009-153-F09CCAGGCCCACTNONE 
AB055076CCAGGCCCACTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCAGGCCCACTNONE 
AK107928CCAGGCCCACTNONE 
J023078E13CCAGGCCCACTNONE 
J053031N01CCAGGCCCACTNONE 
J053046K19CCAGGCCCACTNONE 
J053062P07CCAGGCCCACTNONE 
J053091C23CCAGGCCCACTNONE 
J053099N19CCAGGCCCACTNONE 
J065005E06CCAGGCCCACTNONE 
J065030N03CCAGGCCCACTNONE 
J065138O21CCAGGCCCACTNONE 
J065159K03CCAGGCCCACTNONE 
J075030M08CCAGGCCCACTNONE 
J080006E23CCAGGCCCACTNONE 
J080010D10CCAGGCCCACTNONE 
J080016N17CCAGGCCCACTNONE 
J080024N09CCAGGCCCACTNONE 
J080028E23CCAGGCCCACTNONE 
J080035I11CCAGGCCCACTNONE 
J080038D15CCAGGCCCACTNONE 
J080040H08CCAGGCCCACTNONE 
J080043L04CCAGGCCCACTNONE 
J080047C06CCAGGCCCACTNONE 
J080061G04CCAGGCCCACTNONE 
J080066E10CCAGGCCCACTNONE 
J080067P03CCAGGCCCACTNONE 
J080082D07CCAGGCCCACTNONE 
J080089M13CCAGGCCCACTNONE 
J080094O09CCAGGCCCACTNONE 
J080095C24CCAGGCCCACTNONE 
J080309E21CCAGGCCCACTNONE 
J090016G15CCAGGCCCACTNONE 
J090031C20CCAGGCCCACTNONE 
J090033A15CCAGGCCCACTNONE 
J090037L07CCAGGCCCACTNONE 
J090038I10CCAGGCCCACTNONE 
J090072P19CCAGGCCCACTNONE 
J100040J02CCAGGCCCACTNONE 
J100047N05CCAGGCCCACTNONE 
J100048M10CCAGGCCCACTNONE 
J100076C02CCAGGCCCACTNONE 
J100077G23CCAGGCCCACTNONE 
J100080O08CCAGGCCCACTNONE 
J100085C06CCAGGCCCACTNONE 
J100085F16CCAGGCCCACTNONE 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0669000AK067769CAGGCCCAATASimilar to RNA helicase (Fragment). 
AK099820CAGGCCCAATANONE 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
J065094N08TCATGGGCCTGNONE 
J065108H06TCATGGGCCTGNONE 
Os03g0712600015-008-G03CAGGCCCAGCCNONE 
015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CAGGCCCAGCCHypothetical protein. 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CAGGCCCAGCCNONE 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0735300AK071715CAGGCCCATTAlba, DNA/RNA-binding protein family protein. 
J065100I07CAGGCCCATTNONE 
Os03g0740800AK071772CAGGCCCAAAAXRCC4, N-terminal domain containing protein. 
J023110F02CAGGCCCAAAANONE 
J075054I11CAGGCCCAAAANONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0774600AK066871CAGGCCCACGGHypothetical protein. 
J053033J17CAGGCCCACGGNONE 
Os03g0785200003-116-B06TTGTGGGCCTGANONE 
J013098I23TTGTGGGCCTGANONE 
J023002I24TTGTGGGCCTGAMitochodrial transcription termination factor-related family protein. 
J075150G04TTGTGGGCCTGANONE 
Os03g0795900012-092-G05CCAGGCCCATTANONE 
015-043-D09CCAGGCCCATTANONE 
016-078-G11CCAGGCCCATTANONE 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CCAGGCCCATTANONE 
J023001L04CCAGGCCCATTANONE 
J053032K11CCAGGCCCATTANONE 
J065059E10CCAGGCCCATTANONE 
J065095H19CCAGGCCCATTANONE 
J065181M06CCAGGCCCATTANONE 
J100047D11CCAGGCCCATTANONE 
J100068G04CCAGGCCCATTANONE 
Os03g0800400AK071430CAGGCCCAGAProtein of unknown function DUF1618 domain containing protein. 
J023019H20CAGGCCCAGANONE 
J023097A10CAGGCCCAGANONE 
J023100K15CAGGCCCAGANONE 
J075095I09CAGGCCCAGANONE 
J090014B19CAGGCCCAGANONE 
J090072D02CAGGCCCAGANONE 
J100029E17CAGGCCCAGANONE 
J100047F04CAGGCCCAGANONE 
Os03g0801800AK067130CAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17CAGGCCCAAACNONE 
J090087F23CAGGCCCAAACNONE 
Os03g0807800AK064984CAGGCCCAATSimilar to 40S ribosomal protein S2 (Fragment). 
AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14CAGGCCCAATNONE 
J013001C14TGATGGGCCTGANONE 
J065015J20CAGGCCCAATNONE 
J065015J20TGATGGGCCTGANONE 
J065122L11CAGGCCCAATNONE 
J065122L11TGATGGGCCTGANONE 
J065217E10CAGGCCCAATNONE 
J065217E10TGATGGGCCTGANONE 
J075023C02CAGGCCCAATNONE 
J075023C02TGATGGGCCTGANONE 
J075102O04CAGGCCCAATNONE 
J075102O04TGATGGGCCTGANONE 
J080024G24CAGGCCCAATNONE 
J080024G24TGATGGGCCTGANONE 
J080033F02CAGGCCCAATNONE 
J080033F02TGATGGGCCTGANONE 
J080047M13CAGGCCCAATNONE 
J080047M13TGATGGGCCTGANONE 
J080048A22CAGGCCCAATNONE 
J080048A22TGATGGGCCTGANONE 
J080056E06CAGGCCCAATNONE 
J080056E06TGATGGGCCTGANONE 
J080064O11CAGGCCCAATNONE 
J080064O11TGATGGGCCTGANONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0850100AK101126TACTGGGCCTGNLI interacting factor domain containing protein. 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0194000AK102654TCAGGCCCATTCyclin-like F-box domain containing protein. 
J033101G08TCAGGCCCATTNONE 
J090084B18TCAGGCCCATTNONE 
Os04g0418000006-025-C05CAGGCCCACANONE 
006-025-D11CAGGCCCACANONE 
006-045-F02CAGGCCCACANONE 
006-060-B04CAGGCCCACANONE 
006-063-E03CAGGCCCACANONE 
006-070-G08CAGGCCCACANONE 
006-072-H05CAGGCCCACANONE 
AK061030CAGGCCCACANONE 
AK099124CAGGCCCACANONE 
AK106155CAGGCCCACAConserved hypothetical protein. 
AK119714CAGGCCCACANONE 
J023039I07CAGGCCCACANONE 
J065025N03CAGGCCCACANONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0436800015-053-A06ACGTGGGCCTGANONE 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
J033025G14ACGTGGGCCTGANONE 
J033073N23ACGTGGGCCTGANONE 
J033097L19ACGTGGGCCTGANONE 
Os04g0446500015-073-B06CCAGGCCCAATTNONE 
AB118009CCAGGCCCAATTNONE 
AK073743CCAGGCCCAATTNONE 
AK103814CCAGGCCCAATTSimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15CCAGGCCCAATTNONE 
J033067L09CCAGGCCCAATTNONE 
J033147C19CCAGGCCCAATTNONE 
J033147C20CCAGGCCCAATTNONE 
Os04g0476600014-086-A01TTTGGGCCTGANONE 
015-073-B12TTTGGGCCTGANONE 
AK105466TTTGGGCCTGAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os04g0486400AJ535489TGATGGGCCTGANONE 
AK103296TGATGGGCCTGARML1 protein. 
J013045L03TGATGGGCCTGANONE 
J013045M03TGATGGGCCTGANONE 
J033034L24TGATGGGCCTGANONE 
J033125B02TGATGGGCCTGANONE 
J075001G08TGATGGGCCTGANONE 
J075011I16TGATGGGCCTGANONE 
J075033M08TGATGGGCCTGANONE 
J075044G01TGATGGGCCTGANONE 
J075047D04TGATGGGCCTGANONE 
J075061J09TGATGGGCCTGANONE 
J075085L07TGATGGGCCTGANONE 
J075087D20TGATGGGCCTGANONE 
J075117A04TGATGGGCCTGANONE 
J075134H06TGATGGGCCTGANONE 
J075184J12TGATGGGCCTGANONE 
Os04g0497600AK059415TCAGGCCCACALupus La protein family protein. 
AK099054TCAGGCCCACANONE 
J013121K15TCAGGCCCACANONE 
J013149O10TCAGGCCCACANONE 
J023112H08TCAGGCCCACANONE 
J033050F07TCAGGCCCACANONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0565500006-022-C06CCAGGCCCACGTNONE 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK071118CCAGGCCCACGTNONE 
AK105902CCAGGCCCACGTNONE 
J023052I22CCAGGCCCACGTNONE 
J023082L01CCAGGCCCACGTNONE 
J023112P14CCAGGCCCACGTNONE 
J065043O12CCAGGCCCACGTNONE 
J065045B08CCAGGCCCACGTNONE 
J065059N01CCAGGCCCACGTNONE 
J065073A04CCAGGCCCACGTNONE 
J065078K06CCAGGCCCACGTNONE 
J065124J08CCAGGCCCACGTNONE 
J065140G16CCAGGCCCACGTNONE 
J065185E13CCAGGCCCACGTNONE 
J065197N09CCAGGCCCACGTNONE 
J100024A03CCAGGCCCACGTNONE 
J100042E11CCAGGCCCACGTNONE 
J100069L15CCAGGCCCACGTNONE 
J100078K13CCAGGCCCACGTNONE 
Os04g0584100012-063-E01GCTGGGCCTGGNONE 
AK105292GCTGGGCCTGGConserved hypothetical protein. 
Os04g0594500015-024-B07TCAGGCCCAGCNONE 
AK106269TCAGGCCCAGCProtein of unknown function DUF674 family protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0625000J065157C10CCAGGCCCAGATNONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-047-H10CCAGGCCCAATANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
006-107-D08CCAGGCCCAATANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
009-122-B09CCAGGCCCAATANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK059807CCAGGCCCAATANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK060875CCAGGCCCAATANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
AK071726CCAGGCCCAATAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J023110I24CCAGGCCCAATANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J033091O06CCAGGCCCAATANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053027N16CCAGGCCCAATANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053089E19CCAGGCCCAATANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053098H12CCAGGCCCAATANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J053099N13CCAGGCCCAATANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J075031B15CCAGGCCCAATANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013D12CCAGGCCCAATANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H05CCAGGCCCAATANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080013H07CCAGGCCCAATANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
J080088I03CCAGGCCCAATANONE 
Os05g0106100009-186-E05CAGGCCCAAAANONE 
013-067-H01CAGGCCCAAAANONE 
AK063178CAGGCCCAAAASimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15CAGGCCCAAAANONE 
J065073M24CAGGCCCAAAANONE 
J065077A22CAGGCCCAAAANONE 
J065167I04CAGGCCCAAAANONE 
J075084F11CAGGCCCAAAANONE 
J075086M18CAGGCCCAAAANONE 
Os05g0111000AK073598CAGGCCCATCTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein. 
J065163K08CAGGCCCATGNONE 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0128100009-051-B07CCTGGGCCTGANONE 
009-127-B08CCTGGGCCTGANONE 
009-144-H03CCTGGGCCTGANONE 
009-176-B05CCTGGGCCTGANONE 
AK108556CCTGGGCCTGANONE 
AK119308CCTGGGCCTGANONE 
AK120934CCTGGGCCTGAConserved hypothetical protein. 
J023036J15CCTGGGCCTGANONE 
J065122L01CCTGGGCCTGANONE 
J075104P10CCTGGGCCTGANONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0148300009-031-A08AGATGGGCCTGANONE 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0172100006-076-G10CAGGCCCAGGNONE 
AK068467CAGGCCCAGGGalactose oxidase, central domain containing protein. 
AK105962CAGGCCCAGGNONE 
J013156C03CAGGCCCAGGNONE 
J053091E24CAGGCCCAGGNONE 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0243200009-073-F12TCAGGCCCACTCCNONE 
AK061317TCAGGCCCACTCCSimilar to Ribosomal protein L13. 
J065120F21TCAGGCCCACTCCNONE 
J065185K05TCAGGCCCACTCCNONE 
Os05g0339200AK111022CAGGCCCAAAAConserved hypothetical protein. 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0443800AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0484000AK106829TCAGGCCCAAGProtein of unknown function DUF295 family protein. 
Os05g0494200006-042-H12GGGCCGCAGGCCCATANONE 
009-020-F06GGGCCGCAGGCCCATANONE 
009-069-C06GGGCCGCAGGCCCATANONE 
009-118-B01GGGCCGCAGGCCCATANONE 
AK059563GGGCCGCAGGCCCATANONE 
AK061025GGGCCGCAGGCCCATANONE 
J043031L14GGGCCGCAGGCCCATANONE 
J05595GGGCCGCAGGCCCATASimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
J075068F23GGGCCGCAGGCCCATANONE 
Os05g0541500AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
AK101531TCAGGCCCATCTNONE 
J033030F10TCAGGCCCATCTNONE 
Os05g0553700006-100-D08TCAGGCCCATATNONE 
AK099747TCAGGCCCATATNONE 
AK101606TCAGGCCCATATNONE 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCAGGCCCATATNONE 
J090086G01TCAGGCCCATATNONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0561500006-066-D12GGTTGGGCCTGGNONE 
AK061788GGTTGGGCCTGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862GGTTGGGCCTGGNONE 
J013000O09GGTTGGGCCTGGNONE 
J033145C24GGTTGGGCCTGGNONE 
Os05g0563600009-152-H06CCAGGCCCACGTNONE 
AK058836CCAGGCCCACGTNONE 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0571300AK072262CCAGGCCCAACAConserved hypothetical protein. 
AK109853CCAGGCCCAACANONE 
AK111014CCAGGCCCAACANONE 
Os05g0577900016-028-C02CAGGCCCACANONE 
AK064201CAGGCCCACAConserved hypothetical protein. 
Os05g0578000AK065040TGTGGGCCTGSimilar to PEX14 protein. 
J013001H17TGTGGGCCTGNONE 
J013036A06TGTGGGCCTGNONE 
J033122K08TGTGGGCCTGNONE 
Os05g0596600AK107823TCAGGCCCATTANONE 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0119300AK067271CCTGGGCCTGAProtein of unknown function DUF594 family protein. 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0128500AK058563ATTTGGGCCTGARibosomal protein L47, mitochondrial family protein. 
AK122132ATTTGGGCCTGANONE 
J033133F04ATTTGGGCCTGANONE 
J065094M24ATTTGGGCCTGANONE 
J065122J07ATTTGGGCCTGANONE 
J065137G10ATTTGGGCCTGANONE 
J065178L09ATTTGGGCCTGANONE 
J080011E11ATTTGGGCCTGANONE 
J080020G21ATTTGGGCCTGANONE 
J080039H03ATTTGGGCCTGANONE 
J080039J04ATTTGGGCCTGANONE 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0146900AK071352CCAGGCCCAAAHypothetical protein. 
J065068D05CCAGGCCCAAANONE 
J075036G17CCAGGCCCAAANONE 
Os06g0187900009-171-C09CCAGGCCCAAACNONE 
AK063879CCAGGCCCAAACNONE 
AK071765CCAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CCAGGCCCAAACNONE 
J033098E13CCAGGCCCAAACNONE 
J100036J11CCAGGCCCAAACNONE 
J100047B19CCAGGCCCAAACNONE 
Os06g0251000J033111L12TCAGGCCCATAANONE 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17CCAGGCCCATCCNONE 
J065038I02CCAGGCCCATCCNONE 
J065214J02CCAGGCCCATCCNONE 
Os06g0292400J065040E24TATTGGGCCTGAConserved hypothetical protein. 
Os06g0343100AK058622CAGGCCCAGGNONE 
Os06g0472200AK059428CAGGCCCAGCCNONE 
AK103043CAGGCCCAGCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05CAGGCCCAGCCNONE 
Os06g0494400AK067594CCAGGCCCAATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0515400AK071571TTGTGGGCCTGAConserved hypothetical protein. 
Os06g0531600AK120456TGGTGGGCCTGANONE 
J013105I19TGGTGGGCCTGANONE 
J090006G02TGGTGGGCCTGANONE 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0573700015-015-F02CCAGGCCCATATNONE 
AK106254CCAGGCCCATATConserved hypothetical protein. 
J065172G24CCAGGCCCATATNONE 
Os06g0602600AK121619ACTGGGCCTGAlba, DNA/RNA-binding protein family protein. 
J033044O03ACTGGGCCTGNONE 
J043036G04ACTGGGCCTGNONE 
J075107E08ACTGGGCCTGNONE 
J090060N14ACTGGGCCTGNONE 
J090094K04ACTGGGCCTGNONE 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os06g0639000AK102470TGGGCCTGATGGGCTNONE 
J013106M02TGGGCCTGATGGGCTNONE 
J100051K23TGGGCCTGATGGGCTNONE 
Os06g0649500AK072591AGTTGGGCCTGAWD40-like domain containing protein. 
Os06g0678200AK059456CCAGGCCCATCGNONE 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
Os06g0681000009-105-G11AGATGGGCCTGNONE 
AK062780AGATGGGCCTGConserved hypothetical protein. 
J100021E01AGATGGGCCTGNONE 
Os06g0682800011-092-E01ACATGGGCCTGANONE 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
J013000E13ACATGGGCCTGANONE 
J013035J22ACATGGGCCTGANONE 
J013045M06ACATGGGCCTGANONE 
J013120A07ACATGGGCCTGANONE 
J033144H15ACATGGGCCTGANONE 
J033145H15ACATGGGCCTGANONE 
J033145N16ACATGGGCCTGANONE 
J090019J02ACATGGGCCTGANONE 
Os06g0688100AK063450CAGGCCCACTNONE 
AK063450CAGGCCCATCANONE 
AK101144CAGGCCCACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
AK101144CAGGCCCATCARNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0702800009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0704900AK103054TATTGGGCCTGASimilar to Cell division-like protein. 
J033117I21TATTGGGCCTGANONE 
Os06g0725400J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
J065114J19TCAGGCCCATTANONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0516000AK106685CAGGCCCACSialidase domain containing protein. 
Os07g0558200AK065243TCAGGCCCAAGInositol monophosphatase family protein. 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0603100AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
J023077E09TCATGGGCCTGGNONE 
J023081N15TCATGGGCCTGGNONE 
J033022N22TCATGGGCCTGGNONE 
J033024M18TCATGGGCCTGGNONE 
J033034P09TCATGGGCCTGGNONE 
J033046A06TCATGGGCCTGGNONE 
J033051K01TCATGGGCCTGGNONE 
J033081P09TCATGGGCCTGGNONE 
J033091B17TCATGGGCCTGGNONE 
J033092K23TCATGGGCCTGGNONE 
J033132J09TCATGGGCCTGGNONE 
J033144A14TCATGGGCCTGGNONE 
J033145A14TCATGGGCCTGGNONE 
J043021B20TCATGGGCCTGGNONE 
J053024D23TCATGGGCCTGGNONE 
J065212J10TCATGGGCCTGGNONE 
J090055M05TCATGGGCCTGGNONE 
J090065E14TCATGGGCCTGGNONE 
J090092J06TCATGGGCCTGGNONE 
Os07g0659500AK073537CAGGCCCACCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0680300009-195-E06TCAGGCCCATANONE 
AK063800TCAGGCCCATASimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCAGGCCCATANONE 
J075066A20TCAGGCCCATANONE 
J075088I17TCAGGCCCATANONE 
J075147M19TCAGGCCCATANONE 
J075153L02TCAGGCCCATANONE 
J080013A21TCAGGCCCATANONE 
J080051B13TCAGGCCCATANONE 
J080077I24TCAGGCCCATANONE 
J080302B14TCAGGCCCATANONE 
J080309D22TCAGGCCCATANONE 
J100083B16TCAGGCCCATANONE 
Os08g0117400006-086-A09TGATGGGCCTGNONE 
006-086-A09TGATGGGCCTGANONE 
006-103-C02TGATGGGCCTGNONE 
006-103-C02TGATGGGCCTGANONE 
AK059891TGATGGGCCTGSimilar to Calmodulin 1 (Fragment). 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
AK103863TGATGGGCCTGNONE 
AK103863TGATGGGCCTGANONE 
AY224521TGATGGGCCTGNONE 
AY224521TGATGGGCCTGANONE 
J033149E23TGATGGGCCTGNONE 
J033149E23TGATGGGCCTGANONE 
J065062E05TGATGGGCCTGNONE 
J065062E05TGATGGGCCTGANONE 
J065083O05TGATGGGCCTGNONE 
J065083O05TGATGGGCCTGANONE 
J065116D14TGATGGGCCTGNONE 
J065116D14TGATGGGCCTGANONE 
J065158F16TGATGGGCCTGNONE 
J065158F16TGATGGGCCTGANONE 
J065179N16TGATGGGCCTGNONE 
J065179N16TGATGGGCCTGANONE 
J065206N23TGATGGGCCTGNONE 
J065206N23TGATGGGCCTGANONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0154200AK103192CAGGCCCATGGConserved hypothetical protein. 
J033121O14CAGGCCCATGGNONE 
Os08g0162500AK121633ATCTGGGCCTGGConserved hypothetical protein. 
J033105E19ATCTGGGCCTGGNONE 
J080012K11ATCTGGGCCTGGNONE 
J080041I12ATCTGGGCCTGGNONE 
J080049G05ATCTGGGCCTGGNONE 
J080050P09ATCTGGGCCTGGNONE 
J080051A10ATCTGGGCCTGGNONE 
J080054G05ATCTGGGCCTGGNONE 
J080058M08ATCTGGGCCTGGNONE 
J080064N23ATCTGGGCCTGGNONE 
J080072L15ATCTGGGCCTGGNONE 
J080096H09ATCTGGGCCTGGNONE 
J100079I08ATCTGGGCCTGGNONE 
Os08g0236900AK109597GAGGCGTGGACTGGGCCTGConserved hypothetical protein. 
Os08g0299600AK107112CAGGCCCACCACyclin-like F-box domain containing protein. 
Os08g0438400Os08g0438400CAGGCCCATTAZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os08g0474600J075102L06CCAGGCCCATATNONE 
J075103J21CCAGGCCCATATNONE 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0511000AK107578TATTGGGCCTGGProtein prenyltransferase domain containing protein. 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os08g0550100AB070258CGATGGGCCTGANONE 
AK061287CGATGGGCCTGASimilar to 26S proteasome subunit RPN3a. 
Os09g0370300AK108199AAATGGGCCTGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0411700005-017-C05CCAGGCCCACAANONE 
009-163-B01CCAGGCCCACAANONE 
AK058290CCAGGCCCACAAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919CCAGGCCCACAANONE 
AK121091CCAGGCCCACAANONE 
J013039D20CCAGGCCCACAANONE 
J023066F16CCAGGCCCACAANONE 
J023082H09CCAGGCCCACAANONE 
J023088H05CCAGGCCCACAANONE 
J065013G09CCAGGCCCACAANONE 
J065065C12CCAGGCCCACAANONE 
J065111I04CCAGGCCCACAANONE 
J065179H22CCAGGCCCACAANONE 
J075023N14CCAGGCCCACAANONE 
J090041J17CCAGGCCCACAANONE 
J100031J21CCAGGCCCACAANONE 
J100057A18CCAGGCCCACAANONE 
J100068P22CCAGGCCCACAANONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0498100015-046-G11TCAGGCCCATCANONE 
AK064108TCAGGCCCATCASimilar to 30S ribosomal protein S16. 
J065040H21TCAGGCCCATCANONE 
J065062F05TCAGGCCCATCANONE 
J065147B17TCAGGCCCATCANONE 
J075098J22TCAGGCCCATCANONE 
Os09g0498600AK066995CAGGCCCATANONE 
Os09g0511700AK101420ATTGGGCCTGSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19ATTGGGCCTGNONE 
J013036D23ATTGGGCCTGNONE 
J013037F22ATTGGGCCTGNONE 
J013111M23ATTGGGCCTGNONE 
J023109F14ATTGGGCCTGNONE 
J023119H17ATTGGGCCTGNONE 
J023133H23ATTGGGCCTGNONE 
J033032G17ATTGGGCCTGNONE 
J033038B10ATTGGGCCTGNONE 
J033071M16ATTGGGCCTGNONE 
J033096G04ATTGGGCCTGNONE 
J033109D06ATTGGGCCTGNONE 
J043016E22ATTGGGCCTGNONE 
J043022O09ATTGGGCCTGNONE 
J100023N11ATTGGGCCTGNONE 
J100046I21ATTGGGCCTGNONE 
Os09g0531900AK073015CAGGCCCAAATAGCCCAGCSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0538200009-076-A07CCAGGCCCATATNONE 
AB032061CCAGGCCCATATProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10CCAGGCCCATATNONE 
J075134I16CCAGGCCCATATNONE 
J100031G24CCAGGCCCATATNONE 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os09g0567000012-071-E09TCAGGCCCATGNONE 
013-099-E05TCAGGCCCATGNONE 
AK065613TCAGGCCCATGConserved hypothetical protein. 
J013026M04TCAGGCCCATGNONE 
J023103F04TCAGGCCCATGNONE 
J033119N04TCAGGCCCATGNONE 
J065011I19TCAGGCCCATGNONE 
J065042A10TCAGGCCCATGNONE 
J100023F16TCAGGCCCATGNONE 
Os09g0568000AK068829CAGGCCCAAAANONE 
Os09g0571100AK106869CAGGCCCAGAVirulence factor, pectin lyase fold family protein. 
Os11g0130200AK059458CTTGGGCCTGProtein of unknown function DUF309 family protein. 
J075195F21CTTGGGCCTGNONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0148600AK100066CAGGCCCAGATConserved hypothetical protein. 
AK100066CAGGCCCATATConserved hypothetical protein. 
AK102442CAGGCCCAGATNONE 
AK102442CAGGCCCATATNONE 
J065167F17CAGGCCCAGATNONE 
J065167F17CAGGCCCATATNONE 
Os11g0153600AK065028TTTTGGGCCTGAGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13TTTTGGGCCTGANONE 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0181900011-064-E11AGTGGGCCTGGNONE 
016-031-C07AGTGGGCCTGGNONE 
AK063374AGTGGGCCTGGPrefoldin domain containing protein. 
J065083K20AGTGGGCCTGGNONE 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0202000AK063427CAGGCCCATGACyclin-like F-box domain containing protein. 
AK122020CAGGCCCATGANONE 
J033111N03CAGGCCCATGANONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0586300AK072257CCAGGCCCAAGConserved hypothetical protein. 
Os11g0664700012-064-D03TCATGGGCCTGGGCCTGNONE 
AK100084TCATGGGCCTGGGCCTGConserved hypothetical protein. 
J023002K05TCATGGGCCTGGGCCTGNONE 
J023037C21TCATGGGCCTGGGCCTGNONE 
J033029N10TCATGGGCCTGGGCCTGNONE 
J090047F07TCATGGGCCTGGGCCTGNONE 
Os12g0120400AK099904TAATGGGCCTGASimilar to ATPase-like protein. 
J065169A07TAATGGGCCTGANONE 
Os12g0127500AK064595CAGGCCCATAAConserved hypothetical protein. 
J065067F11CAGGCCCATAANONE 
J090007D02CAGGCCCATAANONE 
J100035G10CAGGCCCATAANONE 
J100077J10CAGGCCCATAANONE 
Os12g0156400012-065-D02CCAGGCCCATTTNONE 
AK072086CCAGGCCCATTTNONE 
AK099278CCAGGCCCATTTDcp1-like decapping family protein. 
J013063H09CCAGGCCCATTTNONE 
J023125D09CCAGGCCCATTTNONE 
J023149G21CCAGGCCCATTTNONE 
J033064E07CCAGGCCCATTTNONE 
J033093C07CCAGGCCCATTTNONE 
J033107E06CCAGGCCCATTTNONE 
J075172A11CCAGGCCCATTTNONE 
J090009E07CCAGGCCCATTTNONE 
J090023F13CCAGGCCCATTTNONE 
J090071N18CCAGGCCCATTTNONE 
Os12g0168700AK065708CAGGCCCAGTAMP-dependent synthetase and ligase domain containing protein. 
AK065708CCAGGCCCAACAAMP-dependent synthetase and ligase domain containing protein. 
AK065718CAGGCCCAGTNONE 
AK065718CCAGGCCCAACANONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0291100013-021-D10TGATGGGCCTGNONE 
013-038-B12TGATGGGCCTGNONE 
AK068555TGATGGGCCTGSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627TGATGGGCCTGNONE 
D00644TGATGGGCCTGNONE 
J013156H12TGATGGGCCTGNONE 
J023122F15TGATGGGCCTGNONE 
J065001F13TGATGGGCCTGNONE 
J065001O16TGATGGGCCTGNONE 
J065006D15TGATGGGCCTGNONE 
J065008I17TGATGGGCCTGNONE 
J065008N22TGATGGGCCTGNONE 
J065010K05TGATGGGCCTGNONE 
J065015G11TGATGGGCCTGNONE 
J065019H21TGATGGGCCTGNONE 
J065020N17TGATGGGCCTGNONE 
J065024O18TGATGGGCCTGNONE 
J065025A04TGATGGGCCTGNONE 
J065026I06TGATGGGCCTGNONE 
J065028C06TGATGGGCCTGNONE 
J065029C01TGATGGGCCTGNONE 
J065029C06TGATGGGCCTGNONE 
J065029D16TGATGGGCCTGNONE 
J065029E02TGATGGGCCTGNONE 
J065030P11TGATGGGCCTGNONE 
J065032M13TGATGGGCCTGNONE 
J065034C06TGATGGGCCTGNONE 
J065037H24TGATGGGCCTGNONE 
J065037O14TGATGGGCCTGNONE 
J065038A12TGATGGGCCTGNONE 
J065043A05TGATGGGCCTGNONE 
J065046C06TGATGGGCCTGNONE 
J065046D22TGATGGGCCTGNONE 
J065048C14TGATGGGCCTGNONE 
J065048D24TGATGGGCCTGNONE 
J065049F19TGATGGGCCTGNONE 
J065050C04TGATGGGCCTGNONE 
J065052J16TGATGGGCCTGNONE 
J065055E07TGATGGGCCTGNONE 
J065055I04TGATGGGCCTGNONE 
J065060L04TGATGGGCCTGNONE 
J065062I15TGATGGGCCTGNONE 
J065062J11TGATGGGCCTGNONE 
J065065I12TGATGGGCCTGNONE 
J065068C24TGATGGGCCTGNONE 
J065069M04TGATGGGCCTGNONE 
J065071J22TGATGGGCCTGNONE 
J065076A12TGATGGGCCTGNONE 
J065076C24TGATGGGCCTGNONE 
J065076F09TGATGGGCCTGNONE 
J065076F16TGATGGGCCTGNONE 
J065077O06TGATGGGCCTGNONE 
J065081E14TGATGGGCCTGNONE 
J065082K22TGATGGGCCTGNONE 
J065082L04TGATGGGCCTGNONE 
J065085B02TGATGGGCCTGNONE 
J065089C21TGATGGGCCTGNONE 
J065092L07TGATGGGCCTGNONE 
J065093G08TGATGGGCCTGNONE 
J065093I19TGATGGGCCTGNONE 
J065093K24TGATGGGCCTGNONE 
J065093N04TGATGGGCCTGNONE 
J065094I09TGATGGGCCTGNONE 
J065094N19TGATGGGCCTGNONE 
J065095J17TGATGGGCCTGNONE 
J065095N24TGATGGGCCTGNONE 
J065096B17TGATGGGCCTGNONE 
J065096C02TGATGGGCCTGNONE 
J065097P18TGATGGGCCTGNONE 
J065099E07TGATGGGCCTGNONE 
J065103D23TGATGGGCCTGNONE 
J065104F04TGATGGGCCTGNONE 
J065104L17TGATGGGCCTGNONE 
J065111L14TGATGGGCCTGNONE 
J065112K11TGATGGGCCTGNONE 
J065115P09TGATGGGCCTGNONE 
J065123A02TGATGGGCCTGNONE 
J065127P14TGATGGGCCTGNONE 
J065137E16TGATGGGCCTGNONE 
J065138H20TGATGGGCCTGNONE 
J065138J11TGATGGGCCTGNONE 
J065141K23TGATGGGCCTGNONE 
J065141L14TGATGGGCCTGNONE 
J065143P04TGATGGGCCTGNONE 
J065146N12TGATGGGCCTGNONE 
J065147F21TGATGGGCCTGNONE 
J065147N15TGATGGGCCTGNONE 
J065154L06TGATGGGCCTGNONE 
J065156C09TGATGGGCCTGNONE 
J065156J18TGATGGGCCTGNONE 
J065157C19TGATGGGCCTGNONE 
J065159H23TGATGGGCCTGNONE 
J065159M08TGATGGGCCTGNONE 
J065163B19TGATGGGCCTGNONE 
J065164K14TGATGGGCCTGNONE 
J065166K07TGATGGGCCTGNONE 
J065166O07TGATGGGCCTGNONE 
J065168A18TGATGGGCCTGNONE 
J065170B18TGATGGGCCTGNONE 
J065170D18TGATGGGCCTGNONE 
J065173E05TGATGGGCCTGNONE 
J065174L23TGATGGGCCTGNONE 
J065177F08TGATGGGCCTGNONE 
J065177I05TGATGGGCCTGNONE 
J065178P20TGATGGGCCTGNONE 
J065181G24TGATGGGCCTGNONE 
J065182A07TGATGGGCCTGNONE 
J065183D24TGATGGGCCTGNONE 
J065184K10TGATGGGCCTGNONE 
J065185F09TGATGGGCCTGNONE 
J065185P10TGATGGGCCTGNONE 
J065186J16TGATGGGCCTGNONE 
J065188K23TGATGGGCCTGNONE 
J065190E22TGATGGGCCTGNONE 
J065191D06TGATGGGCCTGNONE 
J065193C05TGATGGGCCTGNONE 
J065193N13TGATGGGCCTGNONE 
J065194B15TGATGGGCCTGNONE 
J065199C03TGATGGGCCTGNONE 
J065200P19TGATGGGCCTGNONE 
J065202O18TGATGGGCCTGNONE 
J065203F16TGATGGGCCTGNONE 
J065204A15TGATGGGCCTGNONE 
J065206P13TGATGGGCCTGNONE 
J065207P12TGATGGGCCTGNONE 
J065210J24TGATGGGCCTGNONE 
J065211K01TGATGGGCCTGNONE 
J065213O21TGATGGGCCTGNONE 
J065215L18TGATGGGCCTGNONE 
J065216N22TGATGGGCCTGNONE 
J065219A16TGATGGGCCTGNONE 
J065219C24TGATGGGCCTGNONE 
J075012P04TGATGGGCCTGNONE 
J075013K19TGATGGGCCTGNONE 
J075028N24TGATGGGCCTGNONE 
J075028P16TGATGGGCCTGNONE 
J075032H22TGATGGGCCTGNONE 
J075032J18TGATGGGCCTGNONE 
J075042O14TGATGGGCCTGNONE 
J075047A04TGATGGGCCTGNONE 
J075053A16TGATGGGCCTGNONE 
J075064C23TGATGGGCCTGNONE 
J075072H11TGATGGGCCTGNONE 
J075073C03TGATGGGCCTGNONE 
J075081G11TGATGGGCCTGNONE 
J075093H04TGATGGGCCTGNONE 
J075095A11TGATGGGCCTGNONE 
J075095C13TGATGGGCCTGNONE 
J075100D18TGATGGGCCTGNONE 
J075101P08TGATGGGCCTGNONE 
J075114G11TGATGGGCCTGNONE 
J075118D19TGATGGGCCTGNONE 
J075122K13TGATGGGCCTGNONE 
J075125G22TGATGGGCCTGNONE 
J075129E22TGATGGGCCTGNONE 
J075129I07TGATGGGCCTGNONE 
J075132C12TGATGGGCCTGNONE 
J075135E24TGATGGGCCTGNONE 
J075136I06TGATGGGCCTGNONE 
J075136O07TGATGGGCCTGNONE 
J075138I07TGATGGGCCTGNONE 
J075142G08TGATGGGCCTGNONE 
J075147J22TGATGGGCCTGNONE 
J075150H20TGATGGGCCTGNONE 
J075151A15TGATGGGCCTGNONE 
J075151G24TGATGGGCCTGNONE 
J075151J20TGATGGGCCTGNONE 
J075156N21TGATGGGCCTGNONE 
J075158O12TGATGGGCCTGNONE 
J075161E05TGATGGGCCTGNONE 
J075166F17TGATGGGCCTGNONE 
J075169M10TGATGGGCCTGNONE 
J075174K15TGATGGGCCTGNONE 
J075179F17TGATGGGCCTGNONE 
J075185G15TGATGGGCCTGNONE 
J075188P12TGATGGGCCTGNONE 
J075191P15TGATGGGCCTGNONE 
J075192A13TGATGGGCCTGNONE 
J075197E23TGATGGGCCTGNONE 
J075197M02TGATGGGCCTGNONE 
J075198M16TGATGGGCCTGNONE 
J080020B11TGATGGGCCTGNONE 
J080021M20TGATGGGCCTGNONE 
J080066K02TGATGGGCCTGNONE 
J080301F01TGATGGGCCTGNONE 
J080301G19TGATGGGCCTGNONE 
J080305G02TGATGGGCCTGNONE 
J080306N09TGATGGGCCTGNONE 
J080309D21TGATGGGCCTGNONE 
J080309I02TGATGGGCCTGNONE 
J080313J11TGATGGGCCTGNONE 
J080313P09TGATGGGCCTGNONE 
J080315B10TGATGGGCCTGNONE 
J080315O13TGATGGGCCTGNONE 
J080316G02TGATGGGCCTGNONE 
J080317F03TGATGGGCCTGNONE 
J080318D17TGATGGGCCTGNONE 
J080319C10TGATGGGCCTGNONE 
J090017E03TGATGGGCCTGNONE 
J090034N22TGATGGGCCTGNONE 
J090042G07TGATGGGCCTGNONE 
J090062P21TGATGGGCCTGNONE 
J090082D08TGATGGGCCTGNONE 
J090096M13TGATGGGCCTGNONE 
J100086J22TGATGGGCCTGNONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0577900015-034-E07TCAGGCCCAACCNONE 
AK106299TCAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
Os12g0610100Os12g0610100CAGGCCCAATTConserved hypothetical protein. 
Os12g0624800AK103828TAATGGGCCTGGHypothetical protein. 
Os12g0633200009-073-D03TGATGGGCCTGNONE 
AK062615TGATGGGCCTGErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.