version

Summary of OsREG514 (All List)

OrganismOryza sativa  
IDOsREG514  
SequenceCAGGTGGG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2410  

Entry Sequences (2410 entries)

LocusGene modelSequenceDescription
Os01g0144600009-164-E06GGTCCCACCTGTCNONE 
AK063058GGTCCCACCTGTCNONE 
J065061I15GGTCCCACCTGTCNONE 
J065128M13GGTCCCACCTGTCNONE 
J065152N15GGTCCCACCTGTCNONE 
J075170M11GGTCCCACCTGTCNONE 
J090071M11GGTCCCACCTGTCNONE 
J090073B22GGTCCCACCTGTCNONE 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein. 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0391100012-001-B05GCCCACCTGNONE 
012-053-F01GCCCACCTGNONE 
AK063499GCCCACCTGNONE 
AK108533CGCGTGGGACCCACCTGNONE 
AK121200CGCGTGGGACCCACCTGSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11CGCGTGGGACCCACCTGNONE 
J023087I02CGCGTGGGACCCACCTGNONE 
J065021A04GCCCACCTGNONE 
J065076H06GCCCACCTGNONE 
J065099C01CGCGTGGGACCCACCTGNONE 
J065181E05GCCCACCTGNONE 
J065187A05GCCCACCTGNONE 
J075036C17GCCCACCTGNONE 
J075051C18GCCCACCTGNONE 
J075063L16GCCCACCTGNONE 
J075079M08GCCCACCTGNONE 
J075112H15GCCCACCTGNONE 
J075135F10GCCCACCTGNONE 
J075164H06GCCCACCTGNONE 
J075195N02GCCCACCTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0541900AK069784CAGGTGGGProtein kinase-like domain containing protein. 
J013033M01CAGGTGGGNONE 
J013159H24CAGGTGGGNONE 
J023008E13CAGGTGGGNONE 
J023030I11CAGGTGGGNONE 
J065137G08CAGGTGGGNONE 
J065139H16CAGGTGGGNONE 
J065154K13CAGGTGGGNONE 
J075176C02CAGGTGGGNONE 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0646700AK073060ACAGGTGGGNONE 
J075034M02ACAGGTGGGNONE 
Os01g0654500013-057-E05GACAGGTGGGACCCANONE 
AF155333GACAGGTGGGACCCANONE 
AK061752GACAGGTGGGACCCASimilar to NADP-isocitrate dehydrogenase. 
D21069GACAGGTGGGACCCANONE 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0693800006-060-A01GCCCCACCTGTCNONE 
006-074-B11GCCCCACCTGTCNONE 
AK073138GCCCCACCTGTCSimilar to Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS). 
AK109336GCCCCACCTGTCNONE 
J033024E01GCCCCACCTGTCNONE 
Os01g0695200015-090-F01GTCCCACCTGTCNONE 
AK064145GTCCCACCTGTCProtein of unknown function DUF266, plant family protein. 
J065163N10GTCCCACCTGTCNONE 
J100051F21GTCCCACCTGTCNONE 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0733200AK066316CCCACCTGSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493CCCACCTGNONE 
J013066G03CCCACCTGNONE 
J090034J08CCCACCTGNONE 
Os01g0758400AK059301CAGGTGGGGCCCNONE 
AK071777CAGGTGGGGCCCSimilar to Phosphatidate cytidylyltransferase (EC 2.7.7.41) (CDP-diglyceride synthetase) (CDP-diglyceride pyrophosphorylase) (CDP-diacylglycerol synthase) (CDS) (CTP:phosphatidate cytidylyltransferase) (CDP-DAG synthase) (CDP-DG synthetase). 
Os01g0763600AK061563GACAGGTGGGTCCNONE 
AK066596GACAGGTGGGTCCGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15GACAGGTGGGTCCNONE 
J065016A16GACAGGTGGGTCCNONE 
J065039L06GACAGGTGGGTCCNONE 
J090001E03GACAGGTGGGTCCNONE 
J090012J18GACAGGTGGGTCCNONE 
J090085E15GACAGGTGGGTCCNONE 
Os01g0766600AK061986CCCACCTGTNONE 
AK103570CCCACCTGTBSD domain containing protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
Os01g0780500AF225922GGCCCCACCTGTCNONE 
AK068498GGCCCCACCTGTCSCAMP family protein. 
J013157H06GGCCCCACCTGTCNONE 
J033088P18GGCCCCACCTGTCNONE 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0801600AY224556GCCCACCTGNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0836800006-021-C09CCCACCTGNONE 
006-091-F04CCCACCTGNONE 
014-013-D08CCCACCTGNONE 
015-018-F10CCCACCTGNONE 
015-058-H03CCCACCTGNONE 
AK061720CCCACCTGNONE 
AK066629CCCACCTGLung seven transmembrane receptor family protein. 
AK098958CCCACCTGNONE 
AK106145CCCACCTGNONE 
AK119783CCCACCTGNONE 
J013063N02CCCACCTGNONE 
J013071A10CCCACCTGNONE 
J013124C08CCCACCTGNONE 
J023055J07CCCACCTGNONE 
J023081H15CCCACCTGNONE 
J023082D01CCCACCTGNONE 
J023091F07CCCACCTGNONE 
J023091L13CCCACCTGNONE 
J023104G05CCCACCTGNONE 
J023110M16CCCACCTGNONE 
J023120F18CCCACCTGNONE 
J023128O11CCCACCTGNONE 
J023140B11CCCACCTGNONE 
J033023B15CCCACCTGNONE 
J033025E14CCCACCTGNONE 
J033027J21CCCACCTGNONE 
J033041F19CCCACCTGNONE 
J033044L10CCCACCTGNONE 
J033052M08CCCACCTGNONE 
J033084P07CCCACCTGNONE 
J033086P11CCCACCTGNONE 
J033090I20CCCACCTGNONE 
J033093D17CCCACCTGNONE 
J033099C04CCCACCTGNONE 
J033108M19CCCACCTGNONE 
J033124O20CCCACCTGNONE 
J033145D24CCCACCTGNONE 
J033145O09CCCACCTGNONE 
J043016F03CCCACCTGNONE 
J043037C06CCCACCTGNONE 
J053095L22CCCACCTGNONE 
J053100E09CCCACCTGNONE 
J065023G19CCCACCTGNONE 
J065197D03CCCACCTGNONE 
J090003E23CCCACCTGNONE 
J090012P18CCCACCTGNONE 
J090019E14CCCACCTGNONE 
J090021B01CCCACCTGNONE 
J090022J10CCCACCTGNONE 
J090045L06CCCACCTGNONE 
J090050J02CCCACCTGNONE 
J090065F15CCCACCTGNONE 
J100018A06CCCACCTGNONE 
J100022K07CCCACCTGNONE 
J100036H01CCCACCTGNONE 
J100044I09CCCACCTGNONE 
J100057M17CCCACCTGNONE 
J100058O04CCCACCTGNONE 
J100079C21CCCACCTGNONE 
J100079G13CCCACCTGNONE 
Os01g0838725J065088G05GGCCCCACCTGNONE 
J065135D24GGCCCCACCTGConserved hypothetical protein. 
Os01g0847800014-071-E03CAGGTGGGNONE 
AK100718CAGGTGGGSimilar to Aldose reductase (EC 1.1.1.21) (AR) (Aldehyde reductase) (20-alpha- hydroxysteroid dehydrogenase) (EC 1.1.1.149) (20-alpha-HSD). 
J023049O07CAGGTGGGNONE 
J023115O16CAGGTGGGNONE 
J033093E24CAGGTGGGNONE 
J033094E24CAGGTGGGNONE 
J043024M05CAGGTGGGNONE 
J065082P08CAGGTGGGNONE 
J065106C07CAGGTGGGNONE 
J100062I02CAGGTGGGNONE 
Os01g0858900AK107493GACGGCCCCACCTGTCGlycosyl transferase, family 29 protein. 
J065097H23GACGGCCCCACCTGTCNONE 
J100070A02GACGGCCCCACCTGTCNONE 
J100072M10GACGGCCCCACCTGTCNONE 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein. 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428CACTGACAGGTGGGGCNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0884400AK072566CAGGTGGGU box domain containing protein. 
Os01g0896400AK107067GGTCCCACCTGConserved hypothetical protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0926400AK063916GCCCACCTGNONE 
AK073976GCCCACCTGSimilar to Pectin-glucuronyltransferase. 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0976200006-044-A09CCCACCTGNONE 
AK061022CCCACCTG11-S plant seed storage protein family protein. 
J023012H20CCCACCTGNONE 
J023025O07CCCACCTGNONE 
J023082A14CCCACCTGNONE 
J023115H15CCCACCTGNONE 
J023133H14CCCACCTGNONE 
J023133L21CCCACCTGNONE 
J023136B16CCCACCTGNONE 
J023145P17CCCACCTGNONE 
J023146N03CCCACCTGNONE 
Os02g0119700AK108777GTCCCACCTGProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0122800AK062255CAGGTGGGCCCACANONE 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CAGGTGGGCCCACANONE 
J023037M12CAGGTGGGCCCACANONE 
J023099B21CAGGTGGGCCCACANONE 
J023126J16CAGGTGGGCCCACANONE 
J033031J05CAGGTGGGCCCACANONE 
J033048L07CAGGTGGGCCCACANONE 
J033052J23CAGGTGGGCCCACANONE 
J033076F24CAGGTGGGCCCACANONE 
J033085F01CAGGTGGGCCCACANONE 
J033101I11CAGGTGGGCCCACANONE 
J033128E01CAGGTGGGCCCACANONE 
J100070N12CAGGTGGGCCCACANONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0136900AK111638ACAGGTGGGProtein kinase-like domain containing protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0163533J065123M11CCCACCTGHypothetical protein. 
J065163D01CCCACCTGNONE 
J065173F08CCCACCTGNONE 
Os02g0169300006-023-D12CCCACCTGNONE 
006-062-B01CCCACCTGNONE 
015-049-F11CCCACCTGNONE 
015-057-G02CCCACCTGNONE 
015-092-F04CCCACCTGNONE 
015-095-H02CCCACCTGNONE 
015-097-B07CCCACCTGNONE 
AK070041CCCACCTGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCCACCTGNONE 
J013134H23CCCACCTGNONE 
J013134J23CCCACCTGNONE 
J023036N24CCCACCTGNONE 
J023049C06CCCACCTGNONE 
J023077E10CCCACCTGNONE 
J023077F10CCCACCTGNONE 
J023105N12CCCACCTGNONE 
J033036O12CCCACCTGNONE 
J033064P11CCCACCTGNONE 
J033079F01CCCACCTGNONE 
J033123M22CCCACCTGNONE 
J033143E10CCCACCTGNONE 
J075013D12CCCACCTGNONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0288100AK107019CAGGTGGGGTGGGGGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0297600AK064947CCCACCTGNONE 
AK101533CCCACCTGNONE 
AK122023CCCACCTGProtein of unknown function DUF707 family protein. 
Os02g0302900AK110752CCCACCTGTCReticulon family protein. 
Os02g0318400AK064642GGTCCCACCTGTCConserved hypothetical protein. 
J075032B17GGTCCCACCTGTCNONE 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09CCCACCTGTCAGConserved hypothetical protein. 
Os02g0491400AK073233CCCGGCCCCACCTGTCSimilar to Peptidylprolyl isomerase. 
J090046J15CCCGGCCCCACCTGTCNONE 
Os02g0498650J075129C20GGCCCCACCTGConserved hypothetical protein. 
J090063B16GGCCCCACCTGNONE 
J090081H04GGCCCCACCTGNONE 
J090087C03GGCCCCACCTGNONE 
Os02g0506500AK062572GACAGGTGGGACCNONE 
AK063549GACAGGTGGGACCNONE 
AK101016GACAGGTGGGACCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318GACAGGTGGGACCNONE 
J013000C16GACAGGTGGGACCNONE 
J013155N06GACAGGTGGGACCNONE 
J023067A02GACAGGTGGGACCNONE 
J023149E02GACAGGTGGGACCNONE 
J033033J18GACAGGTGGGACCNONE 
J033051O15GACAGGTGGGACCNONE 
J075034C22GACAGGTGGGACCNONE 
J075054O10GACAGGTGGGACCNONE 
J075108L14GACAGGTGGGACCNONE 
J090043O06GACAGGTGGGACCNONE 
J100024P03GACAGGTGGGACCNONE 
Os02g0510100AK058487GACAGGTGGGNONE 
AK122107GACAGGTGGGSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06GACAGGTGGGNONE 
J053077L04GACAGGTGGGNONE 
J065010C11GACAGGTGGGNONE 
J075104O14GACAGGTGGGNONE 
J080003G03GACAGGTGGGNONE 
J080014K05GACAGGTGGGNONE 
J080026F03GACAGGTGGGNONE 
J080027O05GACAGGTGGGNONE 
J080037K15GACAGGTGGGNONE 
J080039D24GACAGGTGGGNONE 
J080043G19GACAGGTGGGNONE 
J080047P05GACAGGTGGGNONE 
J080048D22GACAGGTGGGNONE 
J080049F23GACAGGTGGGNONE 
J080062A21GACAGGTGGGNONE 
J080063H20GACAGGTGGGNONE 
J080067P15GACAGGTGGGNONE 
J080068P19GACAGGTGGGNONE 
J080079J15GACAGGTGGGNONE 
J080092K19GACAGGTGGGNONE 
J080096M04GACAGGTGGGNONE 
Os02g0519900J013027E04CCCACCTGTNONE 
J090065E08CCCACCTGTNONE 
Os02g0527300AK101934GCCCACCTGSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11GCCCACCTGNONE 
J033073P11GCCCACCTGNONE 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0566400AK101019GGGCCCCACCTGConserved hypothetical protein. 
AK101019GTCCCACCTGConserved hypothetical protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
Os02g0697500AK105680CAGGTGGGACSimilar to Selenium-binding protein-like. 
Os02g0719100AK069715CCCACCTGSimilar to Fimbrin/plastin-like (Fragment). 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0768600006-034-F01GGGTGGGCCCACCTGNONE 
006-046-G07GGGTGGGCCCACCTGNONE 
006-054-C07GGGTGGGCCCACCTGNONE 
006-056-F07GGGTGGGCCCACCTGNONE 
006-100-C02GGGTGGGCCCACCTGNONE 
AK059725GGGTGGGCCCACCTGNONE 
AK098996GGGTGGGCCCACCTGNONE 
AK099120GGGTGGGCCCACCTGNONE 
AK104659GGGTGGGCCCACCTGNONE 
J065043H04GGGTGGGCCCACCTGNONE 
J075034N21GGGTGGGCCCACCTGNONE 
J075145C18GGGTGGGCCCACCTGNONE 
J080016H01GGGTGGGCCCACCTGNONE 
J080040F01GGGTGGGCCCACCTGNONE 
J080047L23GGGTGGGCCCACCTGNONE 
J080049B22GGGTGGGCCCACCTGNONE 
J080062J16GGGTGGGCCCACCTGNONE 
J080064C23GGGTGGGCCCACCTGNONE 
J080064L22GGGTGGGCCCACCTGNONE 
J080077N01GGGTGGGCCCACCTGNONE 
J080097G17GGGTGGGCCCACCTGNONE 
J100065L15GGGTGGGCCCACCTGNONE 
J100066K23GGGTGGGCCCACCTGNONE 
J100088C07GGGTGGGCCCACCTGNONE 
J100090H09GGGTGGGCCCACCTGNONE 
Os02g0769200J065031C02GGTCCCACCTGTCNONE 
J065206E04GGTCCCACCTGTCNONE 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CAGGTGGGCCCGNONE 
J033030H07CAGGTGGGCCCGNONE 
J033050M24CAGGTGGGCCCGNONE 
J033069B10CAGGTGGGCCCGNONE 
J033121A16CAGGTGGGCCCGNONE 
J053023M14CAGGTGGGCCCGNONE 
J053033A15CAGGTGGGCCCGNONE 
J053054H14CAGGTGGGCCCGNONE 
J053055H24CAGGTGGGCCCGNONE 
J053082B18CAGGTGGGCCCGNONE 
J065001N03CAGGTGGGCCCGNONE 
J065011O16CAGGTGGGCCCGNONE 
J065026K24CAGGTGGGCCCGNONE 
J065056C09CAGGTGGGCCCGNONE 
J065067H11CAGGTGGGCCCGNONE 
J065097E19CAGGTGGGCCCGNONE 
J065118O11CAGGTGGGCCCGNONE 
J065124N09CAGGTGGGCCCGNONE 
J065143A02CAGGTGGGCCCGNONE 
J065213P06CAGGTGGGCCCGNONE 
J065215E24CAGGTGGGCCCGNONE 
J075051B11CAGGTGGGCCCGNONE 
J075065K05CAGGTGGGCCCGNONE 
J080306E10CAGGTGGGCCCGNONE 
J090042I16CAGGTGGGCCCGNONE 
J090066J24CAGGTGGGCCCGNONE 
J090092K17CAGGTGGGCCCGNONE 
J100029A17CAGGTGGGCCCGNONE 
J100052N08CAGGTGGGCCCGNONE 
J100071I23CAGGTGGGCCCGNONE 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
AK104135GACAGGTGGGCCCCNONE 
U46758ATGGCCCACCTGTCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104802GACAGGTGGGGCCCAGGNONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os03g0107700014-091-A02CAGGTGGGNONE 
AK063743CAGGTGGGSimilar to EL2 protein. 
D64038CAGGTGGGNONE 
J065001A12CAGGTGGGNONE 
J065046K10CAGGTGGGNONE 
J065063C24CAGGTGGGNONE 
J065094D16CAGGTGGGNONE 
J065152A12CAGGTGGGNONE 
J065158D05CAGGTGGGNONE 
J065166L15CAGGTGGGNONE 
J065190D04CAGGTGGGNONE 
J075056F01CAGGTGGGNONE 
J075148A07CAGGTGGGNONE 
J080074L17CAGGTGGGNONE 
J080094A13CAGGTGGGNONE 
J090044B15CAGGTGGGNONE 
J090065N04CAGGTGGGNONE 
Os03g0114100AK108265GCCCACCTGConserved hypothetical protein. 
Os03g0125000006-032-D09AAAGCCCACCTGNONE 
006-033-B05AAAGCCCACCTGNONE 
006-048-G06AAAGCCCACCTGNONE 
006-048-G09AAAGCCCACCTGNONE 
006-052-D09AAAGCCCACCTGNONE 
006-072-A04AAAGCCCACCTGNONE 
006-076-F12AAAGCCCACCTGNONE 
006-080-B03AAAGCCCACCTGNONE 
006-092-H03AAAGCCCACCTGNONE 
006-103-G04AAAGCCCACCTGNONE 
009-079-E01AAAGCCCACCTGNONE 
009-150-F03AAAGCCCACCTGNONE 
AF095708AAAGCCCACCTGNONE 
AK059557AAAGCCCACCTGNONE 
AK070779AAAGCCCACCTGSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999AAAGCCCACCTGNONE 
AK104137AAAGCCCACCTGNONE 
J065002D07AAAGCCCACCTGNONE 
J065167E24AAAGCCCACCTGNONE 
J075199O14AAAGCCCACCTGNONE 
J100083L01AAAGCCCACCTGNONE 
Os03g0130400AK070255GACAGGTGGGACCAdenylate kinase, subfamily protein. 
Os03g0146500006-036-F10TTGGCCCACCTGNONE 
006-082-C03TTGGCCCACCTGNONE 
006-098-E04TTGGCCCACCTGNONE 
006-110-C03TTGGCCCACCTGNONE 
009-057-C11TTGGCCCACCTGNONE 
009-182-D02TTGGCCCACCTGNONE 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
AK071628TTGGCCCACCTGNONE 
AK104105TTGGCCCACCTGNONE 
AK104220TTGGCCCACCTGNONE 
J065168B02TTGGCCCACCTGNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
AK121425CTGACAGGTGGGNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CTGACAGGTGGGNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169500Os03g0169500CTGGGGCCCCACCTGTCSimilar to Cellulose synthase-like A4. 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0173700AK101161CCCACCTGTCAGNONE 
AK111195CCCACCTGTCAGConserved hypothetical protein. 
J090042G17CCCACCTGTCAGNONE 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0199500J065099N05CCCACCTGTCAGTGNONE 
J065152P14CCCACCTGTCAGTGConserved hypothetical protein. 
J080009C14CCCACCTGTCAGTGNONE 
J080011K01CCCACCTGTCAGTGNONE 
J080015H12CCCACCTGTCAGTGNONE 
J080022K05CCCACCTGTCAGTGNONE 
J080034G01CCCACCTGTCAGTGNONE 
J080038I04CCCACCTGTCAGTGNONE 
J080039F20CCCACCTGTCAGTGNONE 
J080042J22CCCACCTGTCAGTGNONE 
J080042N23CCCACCTGTCAGTGNONE 
J080043E07CCCACCTGTCAGTGNONE 
J080050A12CCCACCTGTCAGTGNONE 
J080050C11CCCACCTGTCAGTGNONE 
J080052B01CCCACCTGTCAGTGNONE 
J080052H22CCCACCTGTCAGTGNONE 
J080060E02CCCACCTGTCAGTGNONE 
J080063K24CCCACCTGTCAGTGNONE 
J080067I07CCCACCTGTCAGTGNONE 
J080081H22CCCACCTGTCAGTGNONE 
J080085J10CCCACCTGTCAGTGNONE 
J080089E20CCCACCTGTCAGTGNONE 
J080092N04CCCACCTGTCAGTGNONE 
J080093B01CCCACCTGTCAGTGNONE 
J080093N04CCCACCTGTCAGTGNONE 
J080097B03CCCACCTGTCAGTGNONE 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0240800006-092-D05GACAGGTGGGNONE 
AK059292GACAGGTGGGNONE 
AK061178GACAGGTGGGSimilar to AGL157Cp. 
AK121552GACAGGTGGGNONE 
J023131D06GACAGGTGGGNONE 
J033033E14GACAGGTGGGNONE 
J033105B01GACAGGTGGGNONE 
J033114L18GACAGGTGGGNONE 
J033132N24GACAGGTGGGNONE 
J065032H03GACAGGTGGGNONE 
J065115J20GACAGGTGGGNONE 
J065150C05GACAGGTGGGNONE 
J080302A11GACAGGTGGGNONE 
J080302H16GACAGGTGGGNONE 
J080305M12GACAGGTGGGNONE 
J080306F13GACAGGTGGGNONE 
J080312A06GACAGGTGGGNONE 
J090088P09GACAGGTGGGNONE 
Os03g0251500AK101151CAGGTGGGGGCCCACANONE 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0255200AK058212AGGGCCCACCTGNONE 
AK058212CAGGTGGGGCCCACTCCNONE 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0267500AK061753CCCACCTGProtein of unknown function DUF620 family protein. 
AK120179CCCACCTGNONE 
J013170O22CCCACCTGNONE 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0278500AK070850ACAGGTGGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16ACAGGTGGGNONE 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0281600AK070260CCCACCTGTSimilar to Ca2+-ATPase. 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0308800AK066789CCCACCTGTCAGNONE 
AK068534CCCACCTGTCAGProtein prenyltransferase domain containing protein. 
Os03g0370000AK100033CCCACCTGTCAGSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0383800009-149-G01CCCACCTGTCAGNONE 
AK062998CCCACCTGTCAGNONE 
AK065904CCCACCTGTCAGNONE 
Os03g0586300AK100442CAGGTGGGCCCCReticulon family protein. 
J023031G06CAGGTGGGCCCCNONE 
J023089N19CAGGTGGGCCCCNONE 
J023099N13CAGGTGGGCCCCNONE 
J065026N17CAGGTGGGCCCCNONE 
J065045N16CAGGTGGGCCCCNONE 
J065163L12CAGGTGGGCCCCNONE 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
Os03g0659700AK071550CAGGTGGGSimilar to LOB domain protein 12. 
J065188F12CAGGTGGGNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0687800AK106820GCCCCACCTGTCConserved hypothetical protein. 
Os03g0703300016-074-H01GCAGCCCACCTGNONE 
AK073831GCAGCCCACCTGCalponin-like actin-binding domain containing protein. 
Os03g0712200AK073205CAGGTGGGGGCZinc finger, RanBP2-type domain containing protein. 
AK098968CAGGTGGGGGCNONE 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0767800004-017-A08CCCACCTGTNONE 
006-025-G11CCCACCTGTNONE 
006-088-G04CCCACCTGTNONE 
009-055-C02CCCACCTGTNONE 
AF283006CCCACCTGTNONE 
AK060000CCCACCTGTNONE 
AK060906CCCACCTGTNONE 
AK066036CCCACCTGTCold acclimation WCOR413 family protein. 
J023026I12CCCACCTGTNONE 
J023049J16CCCACCTGTNONE 
J033037M10CCCACCTGTNONE 
J033057D13CCCACCTGTNONE 
J033105H16CCCACCTGTNONE 
J033119G10CCCACCTGTNONE 
J065023C15CCCACCTGTNONE 
J065080D13CCCACCTGTNONE 
J080003C23CCCACCTGTNONE 
J080003P09CCCACCTGTNONE 
J080004K04CCCACCTGTNONE 
J080010M14CCCACCTGTNONE 
J080011J21CCCACCTGTNONE 
J080013J01CCCACCTGTNONE 
J080015A16CCCACCTGTNONE 
J080021F07CCCACCTGTNONE 
J080023F18CCCACCTGTNONE 
J080034D18CCCACCTGTNONE 
J080034O19CCCACCTGTNONE 
J080038J08CCCACCTGTNONE 
J080039N10CCCACCTGTNONE 
J080042P09CCCACCTGTNONE 
J080043E10CCCACCTGTNONE 
J080051M02CCCACCTGTNONE 
J080051O17CCCACCTGTNONE 
J080053B01CCCACCTGTNONE 
J080056N01CCCACCTGTNONE 
J080058J20CCCACCTGTNONE 
J080061B11CCCACCTGTNONE 
J080064B15CCCACCTGTNONE 
J080064O18CCCACCTGTNONE 
J080071A15CCCACCTGTNONE 
J080071C13CCCACCTGTNONE 
J080071F14CCCACCTGTNONE 
J080071M21CCCACCTGTNONE 
J080072A10CCCACCTGTNONE 
J080075J05CCCACCTGTNONE 
J080076A05CCCACCTGTNONE 
J080078F05CCCACCTGTNONE 
J080078K01CCCACCTGTNONE 
J080081F11CCCACCTGTNONE 
J080081K15CCCACCTGTNONE 
J080084K03CCCACCTGTNONE 
J080089F18CCCACCTGTNONE 
J080095A21CCCACCTGTNONE 
J100022L11CCCACCTGTNONE 
J100029I01CCCACCTGTNONE 
J100032I15CCCACCTGTNONE 
J100062N24CCCACCTGTNONE 
J100067E13CCCACCTGTNONE 
J100075G02CCCACCTGTNONE 
J100080L14CCCACCTGTNONE 
Os03g0774600AK066871CAGGTGGGHypothetical protein. 
J053033J17CAGGTGGGNONE 
Os03g0780400011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0780600AK120180CAGGTGGGCCCCNONE 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CAGGTGGGCCCCNONE 
J033022G05CAGGTGGGCCCCNONE 
J033028A16CAGGTGGGCCCCNONE 
J033050M08CAGGTGGGCCCCNONE 
J090053F04CAGGTGGGCCCCNONE 
J090064E19CAGGTGGGCCCCNONE 
J090083J24CAGGTGGGCCCCNONE 
J100024I23CAGGTGGGCCCCNONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
J013090J22CAGGTGGGCCCCNONE 
J023050M06CAGGTGGGCCCCNONE 
J023073A12CAGGTGGGCCCCNONE 
J023075P21CAGGTGGGCCCCNONE 
J023106F04CAGGTGGGCCCCNONE 
J075181H19CAGGTGGGCCCCNONE 
J090009C24CAGGTGGGCCCCNONE 
J100027L24CAGGTGGGCCCCNONE 
J100055F06CAGGTGGGCCCCNONE 
J100081C22CAGGTGGGCCCCNONE 
J100084I21CAGGTGGGCCCCNONE 
Os03g0791800013-037-A12CAGGTGGGCCATNONE 
013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798CAGGTGGGCCATNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251CAGGTGGGCCATNONE 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10CAGGTGGGCCATNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18CAGGTGGGCCATNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23CAGGTGGGCCATNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21CAGGTGGGCCATNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11CAGGTGGGCCATNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05CAGGTGGGCCATNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15CAGGTGGGCCATNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07CAGGTGGGCCATNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21CAGGTGGGCCATNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01CAGGTGGGCCATNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02CAGGTGGGCCATNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22CAGGTGGGCCATNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17CAGGTGGGCCATNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12CAGGTGGGCCATNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0793500AK103407GGCCCCACCTGTCNONE 
AK121620GGCCCCACCTGTCSimilar to Casein kinase-like protein. 
Os03g0801900015-081-G06GACAGGTGGGCTCTCCCCCANONE 
AK106415GACAGGTGGGCTCTCCCCCAProtein of unknown function DUF569 family protein. 
J090099L17GACAGGTGGGCTCTCCCCCANONE 
J100024B03GACAGGTGGGCTCTCCCCCANONE 
J100088I08GACAGGTGGGCTCTCCCCCANONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0822300AK060050CCCACCTGTRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20CCCACCTGTNONE 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0844100AK067164CCCACCTGTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0259800AK111548GGACCCACCTGConserved hypothetical protein. 
Os04g0275966J065015F20GGACCCACCTGConserved hypothetical protein. 
J065118M18GGACCCACCTGNONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK066575CTGACAGGTGGGTCCNONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CTGACAGGTGGGTCCNONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CTGACAGGTGGGTCCNONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462900006-094-A02CCCACCTGNONE 
006-097-F05CCCACCTGNONE 
009-129-A10CCCACCTGNONE 
015-042-F07CCCACCTGNONE 
AK058481CCCACCTGNONE 
AK059483CCCACCTGNONE 
AK061324CCCACCTGNONE 
AK099100CCCACCTGNONE 
AK102579CCCACCTGNONE 
AK106322CCCACCTGSimilar to Prohibitin. 
J065059J20CCCACCTGNONE 
J065085I02CCCACCTGNONE 
J065118N23CCCACCTGNONE 
J065208K24CCCACCTGNONE 
J075053B14CCCACCTGNONE 
J075097M22CCCACCTGNONE 
J075184B07CCCACCTGNONE 
J075194A15CCCACCTGNONE 
J080315G03CCCACCTGNONE 
J090088H19CCCACCTGNONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0492900AK102780ACAGGTGGGCRS1/YhbY domain containing protein. 
AK120004ACAGGTGGGNONE 
AK120369ACAGGTGGGNONE 
Os04g0510900012-083-A10CCCACCTGTNONE 
014-002-F04CCCACCTGTNONE 
AK063625CCCACCTGTSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20CCCACCTGTNONE 
J065144F23CCCACCTGTNONE 
J065153D08CCCACCTGTNONE 
J065178A02CCCACCTGTNONE 
J065178B01CCCACCTGTNONE 
J065195M21CCCACCTGTNONE 
Os04g0558400AK061440CCCACCTGAcyl-CoA thioesterase family protein. 
AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein. 
AK102197CCCACCTGNONE 
AK102197GGTCCCACCTGACAGGNONE 
J013046K23CCCACCTGNONE 
J013046K23GGTCCCACCTGACAGGNONE 
J013090O17CCCACCTGNONE 
J013090O17GGTCCCACCTGACAGGNONE 
J033087D05CCCACCTGNONE 
J033087D05GGTCCCACCTGACAGGNONE 
J065029A16CCCACCTGNONE 
J065029A16GGTCCCACCTGACAGGNONE 
J065121A13CCCACCTGNONE 
J065121A13GGTCCCACCTGACAGGNONE 
J090063H18CCCACCTGNONE 
J090063H18GGTCCCACCTGACAGGNONE 
J100048C18CCCACCTGNONE 
J100048C18GGTCCCACCTGACAGGNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0617050J065197A20GTGGGACCCACCTGTNONE 
J090067K01GTGGGACCCACCTGTAuxin responsive SAUR protein family protein. 
Os04g0629500009-120-G06CCCACCTGNONE 
AK072821CCCACCTGSimilar to Thioredoxin h. 
AK103985CCCACCTGNONE 
AK121437CCCACCTGNONE 
J013111B13CCCACCTGNONE 
J013128N16CCCACCTGNONE 
J023098G05CCCACCTGNONE 
J023139A03CCCACCTGNONE 
J023140C07CCCACCTGNONE 
J065045N21CCCACCTGNONE 
J065054G17CCCACCTGNONE 
J065054L01CCCACCTGNONE 
J100044H07CCCACCTGNONE 
J100064L04CCCACCTGNONE 
Os04g0645100AK072140CCCACCTGTCTetratricopeptide-like helical domain containing protein. 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0678300AK102779GGGCCCCACCTGTCWD40-like domain containing protein. 
J033107J24GGGCCCCACCTGTCNONE 
J065165H03GGGCCCCACCTGTCNONE 
J065186I23GGGCCCCACCTGTCNONE 
J065194C13GGGCCCCACCTGTCNONE 
J090039O08GGGCCCCACCTGTCNONE 
J100029O21GGGCCCCACCTGTCNONE 
Os04g0679800AK060662CCCACCTGTCSimilar to RNA-binding protein-like protein. 
AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987CCCACCTGTCNONE 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11CCCACCTGTCNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17CCCACCTGTCNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12CCCACCTGTCNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12CCCACCTGTCNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07CCCACCTGTCNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0156900AK107275ACAGGTGGGSimilar to Inorganic pyrophosphatase (EC 3.6.1.1) (Fragment). 
J090095J16ACAGGTGGGNONE 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
J075027E19CCTGGGCCCACCTGNONE 
J075174L13CCTGGGCCCACCTGNONE 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0277500014-017-G01CCCACCTGTNONE 
AK105351CCCACCTGTSimilar to Germin-like protein subfamily 2 member 4 precursor. 
Os05g0299500AK073649CCCACCTGProtein of unknown function DUF914, eukaryotic family protein. 
J065086D14CCCACCTGNONE 
Os05g0320700AK100598CCCACCTGSimilar to Cytochrome P450. 
AK104994CCCACCTGNONE 
Os05g0322900006-057-H12GGTCCCACCTGNONE 
014-051-A08GGTCCCACCTGNONE 
AK063697GGTCCCACCTGNONE 
AK066255GGTCCCACCTGSimilar to WRKY transcription factor 45. 
AK103959GGTCCCACCTGNONE 
AY870611GGTCCCACCTGNONE 
J100068H13GGTCCCACCTGNONE 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0354400AK065144CAGGTGGGCCCACCCProtein of unknown function DUF231, plant domain containing protein. 
Os05g0358500AK060575CCCACCTGNONE 
AK060575GCTCAGCTCAGGTGGGNONE 
AK100777CCCACCTGProtein phosphatase 2C-like domain containing protein. 
AK100777GCTCAGCTCAGGTGGGProtein phosphatase 2C-like domain containing protein. 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0388600AK105904GGCCCCACCTGConserved hypothetical protein. 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
Os05g0424800AK121054CCCACCTGTSimilar to AER274Wp. 
J023055P22CCCACCTGTNONE 
J023102M21CCCACCTGTNONE 
J033088E13CCCACCTGTNONE 
J033123K17CCCACCTGTNONE 
J065176L18CCCACCTGTNONE 
J075002F14CCCACCTGTNONE 
J075005E10CCCACCTGTNONE 
J075005K21CCCACCTGTNONE 
J075007A18CCCACCTGTNONE 
J075021J16CCCACCTGTNONE 
J075040K11CCCACCTGTNONE 
J075061A14CCCACCTGTNONE 
J075106H07CCCACCTGTNONE 
J075109M22CCCACCTGTNONE 
J075121O13CCCACCTGTNONE 
J075132M08CCCACCTGTNONE 
J075153B19CCCACCTGTNONE 
J075158L15CCCACCTGTNONE 
J075187G20CCCACCTGTNONE 
J100079N17CCCACCTGTNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein. 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0473300AK102559TGGTGGGCCCACCTGNONE 
AK103822TGGTGGGCCCACCTGNONE 
AK109855TGGTGGGCCCACCTGSimilar to Ethylene response factor 1. 
Os05g0503000AK068335CCCACCTGTCSimilar to Secretory carrier membrane protein. 
AK104049CCCACCTGTCNONE 
J013149D04CCCACCTGTCNONE 
J075085A06CCCACCTGTCNONE 
Os05g0503300011-013-H12GCCCACCTGNONE 
011-013-H12GGCCCCACCTGTCNONE 
012-072-B03GCCCACCTGNONE 
012-072-B03GGCCCCACCTGTCNONE 
AK073969GCCCACCTGSimilar to Sulfite reductase (Fragment). 
AK073969GGCCCCACCTGTCSimilar to Sulfite reductase (Fragment). 
AK100773GCCCACCTGNONE 
AK100773GGCCCCACCTGTCNONE 
AK103289GCCCACCTGNONE 
AK103289GGCCCCACCTGTCNONE 
J013045K07GCCCACCTGNONE 
J013045K07GGCCCCACCTGTCNONE 
J033075F01GCCCACCTGNONE 
J033075F01GGCCCCACCTGTCNONE 
J033125N07GCCCACCTGNONE 
J033125N07GGCCCCACCTGTCNONE 
J033130G12GCCCACCTGNONE 
J033130G12GGCCCCACCTGTCNONE 
Os05g0542600AK060408GGCCCCACCTGNONE 
AK101373GGCCCCACCTGMov34/MPN/PAD-1 family protein. 
J023081F17GGCCCCACCTGNONE 
J033035N15GGCCCCACCTGNONE 
J033124K20GGCCCCACCTGNONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0584900012-044-B12GTCCCACCTGTCNONE 
012-082-A03GTCCCACCTGTCNONE 
AK105309GTCCCACCTGTCC4-dicarboxylate transporter/malic acid transport protein family protein. 
J053069A10GTCCCACCTGTCNONE 
J065070I05GTCCCACCTGTCNONE 
J075096O04GTCCCACCTGTCNONE 
J075136D21GTCCCACCTGTCNONE 
Os05g0585900AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK098854GACAGGTGGGCCCCNONE 
J013000H16GACAGGTGGGCCCCNONE 
J033118D07GACAGGTGGGCCCCNONE 
Os06g0114700AK061552CCCACCTGProtein of unknown function DUF1218 family protein. 
AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848CCCACCTGNONE 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142CCCACCTGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16CCCACCTGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
AK122132GACAGGTGGGCCCGNONE 
J033133F04GACAGGTGGGCCCGNONE 
J065094M24GACAGGTGGGCCCGNONE 
J065122J07GACAGGTGGGCCCGNONE 
J065137G10GACAGGTGGGCCCGNONE 
J065178L09GACAGGTGGGCCCGNONE 
J080011E11GACAGGTGGGCCCGNONE 
J080020G21GACAGGTGGGCCCGNONE 
J080039H03GACAGGTGGGCCCGNONE 
J080039J04GACAGGTGGGCCCGNONE 
Os06g0161800AK064664TGCGGCCCCACCTGProtein of unknown function DUF569 family protein. 
AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0163000AK069245CCCAGCCCACCTGNONE 
AK069675CCCAGCCCACCTGSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CCCAGCCCACCTGNONE 
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein. 
Os06g0233000009-177-C07CAGGTGGGCCCGCNONE 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
Os06g0244000AK062130CCCACCTGSAM dependent carboxyl methyltransferase family protein. 
AK098988CCCACCTGNONE 
J013096P21CCCACCTGNONE 
J033124M06CCCACCTGNONE 
J053056N22CCCACCTGNONE 
J053083N17CCCACCTGNONE 
J053099B22CCCACCTGNONE 
J065048H04CCCACCTGNONE 
J065118I04CCCACCTGNONE 
J065119I22CCCACCTGNONE 
J065206M14CCCACCTGNONE 
J065207M10CCCACCTGNONE 
J100038N07CCCACCTGNONE 
J100057M20CCCACCTGNONE 
Os06g0264300AK061556CAGGTGGGTCCNONE 
AK073271CAGGTGGGTCCSimilar to RAD23, isoform I. 
Os06g0353700J065177D24GGACCCACCTGConserved hypothetical protein. 
Os06g0550800J065058J22GGTCCCACCTGConserved hypothetical protein. 
Os06g0551400009-003-D11ACAGGTGGGACCNONE 
011-025-C09ACAGGTGGGACCNONE 
AK066548ACAGGTGGGACCRas-related protein RIC2. 
D13758ACAGGTGGGACCNONE 
J013069H14ACAGGTGGGACCNONE 
J053037J07ACAGGTGGGACCNONE 
J065011J03ACAGGTGGGACCNONE 
J065078L15ACAGGTGGGACCNONE 
J065103H24ACAGGTGGGACCNONE 
J065157A07ACAGGTGGGACCNONE 
J065213P12ACAGGTGGGACCNONE 
J090007P04ACAGGTGGGACCNONE 
J090052N23ACAGGTGGGACCNONE 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0603000AK068856TCCGGGCCCACCTGTCNONE 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
AK099872CCTGGGCCCCACCTGNONE 
BT014680CCTGGGCCCCACCTGNONE 
J023008M02CCTGGGCCCCACCTGNONE 
J023127M12CCTGGGCCCCACCTGNONE 
J065049L24CCTGGGCCCCACCTGNONE 
J065102K24CCTGGGCCCCACCTGNONE 
J065205O14CCTGGGCCCCACCTGNONE 
J075127F01CCTGGGCCCCACCTGNONE 
J080033F07CCTGGGCCCCACCTGNONE 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0704100AK103758CAGGTGGGProtein of unknown function DUF547 domain containing protein. 
J033143F04CAGGTGGGNONE 
J033144M16CAGGTGGGNONE 
J033145M16CAGGTGGGNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE 
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin. 
J013052B11AGGGCCCACCTGTCAGNONE 
J013052B13AGGGCCCACCTGTCAGNONE 
J065214H07AGGGCCCACCTGTCAGNONE 
J075192D20AGGGCCCACCTGTCAGNONE 
J090090C15AGGGCCCACCTGTCAGNONE 
J100051J18AGGGCCCACCTGTCAGNONE 
J100055A07AGGGCCCACCTGTCAGNONE 
J100060B10AGGGCCCACCTGTCAGNONE 
J100061D02AGGGCCCACCTGTCAGNONE 
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein. 
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein. 
J023020A02CCCACCTGTCAGTNONE 
J023020A02CCCACCTGTCAGTGNONE 
J023039H03CCCACCTGTCAGTNONE 
J023039H03CCCACCTGTCAGTGNONE 
J100042E23CCCACCTGTCAGTNONE 
J100042E23CCCACCTGTCAGTGNONE 
J100069N01CCCACCTGTCAGTNONE 
J100069N01CCCACCTGTCAGTGNONE 
J100089L13CCCACCTGTCAGTNONE 
J100089L13CCCACCTGTCAGTGNONE 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os06g0728700AK111637CAGGTGGGGCCHomeodomain-like containing protein. 
AK119632CAGGTGGGGCCNONE 
J075015J02CAGGTGGGGCCNONE 
J075016L14CAGGTGGGGCCNONE 
J075078O03CAGGTGGGGCCNONE 
J075098O14CAGGTGGGGCCNONE 
J075171L20CAGGTGGGGCCNONE 
Os07g0102100AK066544CAGGTGGGACNONE 
AK099800CAGGTGGGACSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2. 
Os07g0123300AK108490GGGGCCCACCTGConserved hypothetical protein. 
J065197L01GGGGCCCACCTGNONE 
J065206N07GGGGCCCACCTGNONE 
J080011N05GGGGCCCACCTGNONE 
J080021N11GGGGCCCACCTGNONE 
J080025M24GGGGCCCACCTGNONE 
J080031E13GGGGCCCACCTGNONE 
J080047B07GGGGCCCACCTGNONE 
J080061L03GGGGCCCACCTGNONE 
J080062C18GGGGCCCACCTGNONE 
J080063E20GGGGCCCACCTGNONE 
J080063O12GGGGCCCACCTGNONE 
J080070D20GGGGCCCACCTGNONE 
J080074J17GGGGCCCACCTGNONE 
J080076K17GGGGCCCACCTGNONE 
J080079K21GGGGCCCACCTGNONE 
J080080D02GGGGCCCACCTGNONE 
J080088E12GGGGCCCACCTGNONE 
J080092I18GGGGCCCACCTGNONE 
Os07g0124600AK073437GTGGGACCCACCTGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GTGGGACCCACCTGTCNONE 
J033136G07GTGGGACCCACCTGTCNONE 
J065092I12GTGGGACCCACCTGTCNONE 
J065132F04GTGGGACCCACCTGTCNONE 
J065143I11GTGGGACCCACCTGTCNONE 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0152800AK065458GGTGGGCCCCACCTGConserved hypothetical protein. 
J013022G05GGTGGGCCCCACCTGNONE 
J013023D18GGTGGGCCCCACCTGNONE 
J013048J16GGTGGGCCCCACCTGNONE 
J013055I03GGTGGGCCCCACCTGNONE 
J013057F12GGTGGGCCCCACCTGNONE 
J023109A22GGTGGGCCCCACCTGNONE 
J023148E09GGTGGGCCCCACCTGNONE 
J033069G17GGTGGGCCCCACCTGNONE 
J033092I18GGTGGGCCCCACCTGNONE 
J033093C02GGTGGGCCCCACCTGNONE 
J033141M17GGTGGGCCCCACCTGNONE 
J043016M18GGTGGGCCCCACCTGNONE 
J090016D12GGTGGGCCCCACCTGNONE 
J090071B10GGTGGGCCCCACCTGNONE 
J090098K07GGTGGGCCCCACCTGNONE 
J100035K14GGTGGGCCCCACCTGNONE 
Os07g0160600011-014-G11CCCGGCCCCACCTGNONE 
015-033-C08CCCGGCCCCACCTGNONE 
AK065047CCCGGCCCCACCTGBeta-Ig-H3/fasciclin domain containing protein. 
AK098844CCCGGCCCCACCTGNONE 
J013000B24CCCGGCCCCACCTGNONE 
J013001I08CCCGGCCCCACCTGNONE 
J023150E13CCCGGCCCCACCTGNONE 
J033026K03CCCGGCCCCACCTGNONE 
J065093N10CCCGGCCCCACCTGNONE 
J075054B05CCCGGCCCCACCTGNONE 
J075131H23CCCGGCCCCACCTGNONE 
J090007M18CCCGGCCCCACCTGNONE 
J090029B19CCCGGCCCCACCTGNONE 
J100026A09CCCGGCCCCACCTGNONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0173200AK061624CCCACCTGTCFrigida-like family protein. 
AK061624CCCACCTGTCFrigida-like family protein. 
AK065275CCCACCTGTCNONE 
AK065275CCCACCTGTCNONE 
AK098856CCCACCTGTCNONE 
AK098856CCCACCTGTCNONE 
AK098899CCCACCTGTCNONE 
AK098899CCCACCTGTCNONE 
Os07g0179000AK100008CGGGCCCACCTGNONE 
AK119398CGGGCCCACCTGProtein prenyltransferase domain containing protein. 
AK119505CGGGCCCACCTGNONE 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0185000015-028-H12GACAGGTGGGACNONE 
AK072273GACAGGTGGGACNONE 
AK100930GACAGGTGGGACSimilar to MAP kinase (Ser/Thr kinase). 
J100026K08GACAGGTGGGACNONE 
J100062M04GACAGGTGGGACNONE 
J100073N07GACAGGTGGGACNONE 
J100088M04GACAGGTGGGACNONE 
Os07g0185200AK060743CAGGTGGGNONE 
AK066157CAGGTGGGCCCGCSimilar to Membrane related protein-like. 
AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0188700011-058-D09CAGGTGGGGCCCACCCNONE 
AK063957CAGGTGGGGCCCACCCNONE 
AK073755CAGGTGGGGCCCACCCSimilar to EXO. 
AK107609CAGGTGGGGCCCACCCNONE 
J033066N03CAGGTGGGGCCCACCCNONE 
Os07g0190800J065011L18GACAGGTGGGNONE 
J065143M23GACAGGTGGGNONE 
J065182M05GACAGGTGGGNONE 
J065200H08GACAGGTGGGSimilar to Thioredoxin h. 
Os07g0205900AK070209CCCACCTGArmadillo-like helical domain containing protein. 
Os07g0222800009-072-E05CCCACCTGNONE 
AK060442CCCACCTGNONE 
AK100823CCCACCTGAcyl carrier protein-like protein. 
AK103131CCCACCTGNONE 
AY224456CCCACCTGNONE 
J075026H13CCCACCTGNONE 
J075142G06CCCACCTGNONE 
J100033K08CCCACCTGNONE 
Os07g0240300AK072205GACGTGGCCCCACCTGConserved hypothetical protein. 
AK072205GGCCCCACCTGTCConserved hypothetical protein. 
AK098977GACGTGGCCCCACCTGNONE 
AK098977GGCCCCACCTGTCNONE 
Os07g0241500AK107239CCCACCTGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CCCACCTGNONE 
J065158P15CCCACCTGNONE 
J065167J16CCCACCTGNONE 
J065183I01CCCACCTGNONE 
J065187L18CCCACCTGNONE 
J065205J10CCCACCTGNONE 
Os07g0245100J023048C16GGGCCCCACCTGTCAGTNONE 
J023110L14GGGCCCCACCTGTCAGTNONE 
J053023B18GGGCCCCACCTGTCAGTNONE 
J053031L17GGGCCCCACCTGTCAGTNONE 
J065035I22GGGCCCCACCTGTCAGTNONE 
J065043D21GGGCCCCACCTGTCAGTNONE 
J065072L16GGGCCCCACCTGTCAGTNONE 
J065214I23GGGCCCCACCTGTCAGTNONE 
Os07g0438800AK060412CCCGGCCCCACCTGTCAGNONE 
AK100065CCCGGCCCCACCTGTCAGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCGGCCCCACCTGTCAGNONE 
AY224478CCCGGCCCCACCTGTCAGNONE 
J013160O05CCCGGCCCCACCTGTCAGNONE 
J023030C05CCCGGCCCCACCTGTCAGNONE 
J033025O04CCCGGCCCCACCTGTCAGNONE 
J033121P15CCCGGCCCCACCTGTCAGNONE 
J043034I23CCCGGCCCCACCTGTCAGNONE 
J065022N01CCCGGCCCCACCTGTCAGNONE 
J065022N02CCCGGCCCCACCTGTCAGNONE 
J065023M01CCCGGCCCCACCTGTCAGNONE 
J065101G13CCCGGCCCCACCTGTCAGNONE 
J075058P13CCCGGCCCCACCTGTCAGNONE 
J075186K10CCCGGCCCCACCTGTCAGNONE 
J075199F17CCCGGCCCCACCTGTCAGNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0495000015-070-F12CAGGTGGGCNONE 
AK060721CAGGTGGGCNONE 
AK073883CAGGTGGGCCupin, RmlC-type domain containing protein. 
AK119204CAGGTGGGCNONE 
J033071H20CAGGTGGGCNONE 
J090079B04CAGGTGGGCNONE 
Os07g0496700016-057-A12TGGGGCCCACCTGTCNONE 
AK064235TGGGGCCCACCTGTCPhosphate-induced protein 1 conserved region family protein. 
Os07g0501100AK110924CCCACCTGSimilar to Chalcone synthase 2 (EC 2.3.1.74) (Naringenin-chalcone synthase 2). 
Os07g0531600015-098-E11AGTGGGCCCACCTGTCNONE 
AK067845AGTGGGCCCACCTGTCPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01AGTGGGCCCACCTGTCNONE 
J065008E15AGTGGGCCCACCTGTCNONE 
J065052K14AGTGGGCCCACCTGTCNONE 
J065052L13AGTGGGCCCACCTGTCNONE 
J065058M02AGTGGGCCCACCTGTCNONE 
J065069M10AGTGGGCCCACCTGTCNONE 
J065135A14AGTGGGCCCACCTGTCNONE 
J065168O18AGTGGGCCCACCTGTCNONE 
J075070D14AGTGGGCCCACCTGTCNONE 
J075169B16AGTGGGCCCACCTGTCNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0540100AK101714CAGGTGGGCCCACCProtein of unknown function DUF26 domain containing protein. 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK099740GCCCCCACCTGTCAGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
AK110717GCCCCCACCTGTCAGNONE 
Os07g0597000009-013-A01GACAGGTGGGNONE 
009-077-A02GACAGGTGGGNONE 
009-195-H04GACAGGTGGGNONE 
AF094773GACAGGTGGGNONE 
AK062134GACAGGTGGGNONE 
AK103429GACAGGTGGGSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19GACAGGTGGGNONE 
J013152D01GACAGGTGGGNONE 
J023024K09GACAGGTGGGNONE 
J023058J15GACAGGTGGGNONE 
J023097I07GACAGGTGGGNONE 
J023132B05GACAGGTGGGNONE 
J033065L11GACAGGTGGGNONE 
J033086B12GACAGGTGGGNONE 
J033128M07GACAGGTGGGNONE 
J043010M23GACAGGTGGGNONE 
J043024A05GACAGGTGGGNONE 
J053057P08GACAGGTGGGNONE 
J065022G24GACAGGTGGGNONE 
J065028I10GACAGGTGGGNONE 
J065065D08GACAGGTGGGNONE 
J065103D22GACAGGTGGGNONE 
J065153K16GACAGGTGGGNONE 
J065210B16GACAGGTGGGNONE 
J075015H18GACAGGTGGGNONE 
J075102C14GACAGGTGGGNONE 
J080302G09GACAGGTGGGNONE 
J080302L20GACAGGTGGGNONE 
J080303K11GACAGGTGGGNONE 
J080312C18GACAGGTGGGNONE 
J080316F08GACAGGTGGGNONE 
J090023I05GACAGGTGGGNONE 
J090023I07GACAGGTGGGNONE 
J090053C21GACAGGTGGGNONE 
J090067J22GACAGGTGGGNONE 
J090070E24GACAGGTGGGNONE 
J090078H04GACAGGTGGGNONE 
J090089P06GACAGGTGGGNONE 
J090092E21GACAGGTGGGNONE 
J100014G01GACAGGTGGGNONE 
J100022L20GACAGGTGGGNONE 
J100024I05GACAGGTGGGNONE 
J100025L08GACAGGTGGGNONE 
J100030J03GACAGGTGGGNONE 
J100031K12GACAGGTGGGNONE 
J100036N01GACAGGTGGGNONE 
J100050C23GACAGGTGGGNONE 
J100062G12GACAGGTGGGNONE 
J100067L17GACAGGTGGGNONE 
J100074O09GACAGGTGGGNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0626100009-127-G03GACAGGTGGGCCACNONE 
AK062899GACAGGTGGGCCACSimilar to 50S ribosomal protein L7/L12. 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0669600AK066595GGACCCACCTGTConserved hypothetical protein. 
J065042J05GGACCCACCTGTNONE 
Os07g0679300AK065079CAGGTGGGTCCCANONE 
AK099229CAGGTGGGTCCCASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CAGGTGGGTCCCANONE 
J013049N18CAGGTGGGTCCCANONE 
J013071C14CAGGTGGGTCCCANONE 
J013088P15CAGGTGGGTCCCANONE 
J013092D24CAGGTGGGTCCCANONE 
J013093O14CAGGTGGGTCCCANONE 
J023095E17CAGGTGGGTCCCANONE 
J043005E21CAGGTGGGTCCCANONE 
J043015E06CAGGTGGGTCCCANONE 
J043027P22CAGGTGGGTCCCANONE 
J065038B15CAGGTGGGTCCCANONE 
J065073M21CAGGTGGGTCCCANONE 
J065165P06CAGGTGGGTCCCANONE 
J065198I06CAGGTGGGTCCCANONE 
J075007E08CAGGTGGGTCCCANONE 
J075038I07CAGGTGGGTCCCANONE 
J075130L20CAGGTGGGTCCCANONE 
J090057G17CAGGTGGGTCCCANONE 
J100029K23CAGGTGGGTCCCANONE 
J100086O16CAGGTGGGTCCCANONE 
J100087M02CAGGTGGGTCCCANONE 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os07g0690300012-048-A07CGGGCCCACCTGNONE 
AK099674CGGGCCCACCTGChromatin SPT2 family protein. 
J013028F12CGGGCCCACCTGNONE 
J013069F21CGGGCCCACCTGNONE 
J013104E17CGGGCCCACCTGNONE 
J013153M16CGGGCCCACCTGNONE 
J023012L09CGGGCCCACCTGNONE 
J023069A08CGGGCCCACCTGNONE 
J023132L23CGGGCCCACCTGNONE 
J033120P19CGGGCCCACCTGNONE 
J065173J03CGGGCCCACCTGNONE 
J075008H06CGGGCCCACCTGNONE 
J075043J15CGGGCCCACCTGNONE 
J075147I12CGGGCCCACCTGNONE 
J090041G07CGGGCCCACCTGNONE 
Os08g0113100003-102-G01CAGGTGGGCCCCACCNONE 
011-041-F02CAGGTGGGCCCCACCNONE 
011-063-A09CAGGTGGGCCCCACCNONE 
AB110164CAGGTGGGCCCCACCNONE 
AF429947CAGGTGGGCCCCACCNONE 
AK070120CAGGTGGGCCCCACCSimilar to Fructokinase (Fragment). 
AK099353CAGGTGGGCCCCACCNONE 
J013072L23CAGGTGGGCCCCACCNONE 
J023031J20CAGGTGGGCCCCACCNONE 
J023041C07CAGGTGGGCCCCACCNONE 
J023068B05CAGGTGGGCCCCACCNONE 
J023111H11CAGGTGGGCCCCACCNONE 
J023114G22CAGGTGGGCCCCACCNONE 
J023121E01CAGGTGGGCCCCACCNONE 
J023121G16CAGGTGGGCCCCACCNONE 
J023128D15CAGGTGGGCCCCACCNONE 
J023142I22CAGGTGGGCCCCACCNONE 
J033058M11CAGGTGGGCCCCACCNONE 
J033092F23CAGGTGGGCCCCACCNONE 
J033108M10CAGGTGGGCCCCACCNONE 
J065085D10CAGGTGGGCCCCACCNONE 
J065086I17CAGGTGGGCCCCACCNONE 
J065137I08CAGGTGGGCCCCACCNONE 
J065154L19CAGGTGGGCCCCACCNONE 
J065179C12CAGGTGGGCCCCACCNONE 
J065184K15CAGGTGGGCCCCACCNONE 
J065195G07CAGGTGGGCCCCACCNONE 
J075052K09CAGGTGGGCCCCACCNONE 
J075093D08CAGGTGGGCCCCACCNONE 
J075093L13CAGGTGGGCCCCACCNONE 
J090005F03CAGGTGGGCCCCACCNONE 
J090013F02CAGGTGGGCCCCACCNONE 
J090026L07CAGGTGGGCCCCACCNONE 
J090041P18CAGGTGGGCCCCACCNONE 
J090081E12CAGGTGGGCCCCACCNONE 
J090087F17CAGGTGGGCCCCACCNONE 
J090091C17CAGGTGGGCCCCACCNONE 
J090099P12CAGGTGGGCCCCACCNONE 
J100030P08CAGGTGGGCCCCACCNONE 
J100055E21CAGGTGGGCCCCACCNONE 
J100056N16CAGGTGGGCCCCACCNONE 
J100061I23CAGGTGGGCCCCACCNONE 
J100063L04CAGGTGGGCCCCACCNONE 
J100065A14CAGGTGGGCCCCACCNONE 
J100072A15CAGGTGGGCCCCACCNONE 
J100080A04CAGGTGGGCCCCACCNONE 
J100082K16CAGGTGGGCCCCACCNONE 
J100088C06CAGGTGGGCCCCACCNONE 
J100088L18CAGGTGGGCCCCACCNONE 
Os08g0119800AJ437536CAGGTGGGACCCACNONE 
AK060602CAGGTGGGACCCACSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)]. 
AK067636CAGGTGGGACCCACNONE 
AK068273CAGGTGGGACCCACNONE 
J100075K05CAGGTGGGACCCACNONE 
Os08g0121900AK101512CCCGTGGGACCCACCTGTCProtein of unknown function DUF23 family protein. 
Os08g0138500AK102951GGTGGGCCCCACCTGTCATCCACCSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GGTGGGCCCCACCTGTCATCCACCNONE 
J033115D14GGTGGGCCCCACCTGTCATCCACCNONE 
J065013F04GGTGGGCCCCACCTGTCATCCACCNONE 
J065050P11GGTGGGCCCCACCTGTCATCCACCNONE 
J065063K18GGTGGGCCCCACCTGTCATCCACCNONE 
J090054H10GGTGGGCCCCACCTGTCATCCACCNONE 
J100083F11GGTGGGCCCCACCTGTCATCCACCNONE 
Os08g0143400015-006-A10AGCCCACCTGNONE 
AK066792AGCCCACCTGNONE 
AK120532AGCCCACCTGSWIRM domain containing protein. 
J100083F02AGCCCACCTGNONE 
Os08g0143500006-072-G06CAGGTGGGCTNONE 
016-053-H02CAGGTGGGCTNONE 
AK061094CAGGTGGGCTNONE 
AK071122CAGGTGGGCTGlycosyl transferase, family 14 protein. 
J023081E17CAGGTGGGCTNONE 
J023106O18CAGGTGGGCTNONE 
J043001N22CAGGTGGGCTNONE 
J065062D05CAGGTGGGCTNONE 
J065099M15CAGGTGGGCTNONE 
J065180K12CAGGTGGGCTNONE 
J090045L23CAGGTGGGCTNONE 
J100088K05CAGGTGGGCTNONE 
Os08g0155100AK069865CCCACCTGMajor sperm protein domain containing protein. 
AK104886CCCACCTGNONE 
J013089M01CCCACCTGNONE 
J023037M15CCCACCTGNONE 
J033068E03CCCACCTGNONE 
J090021P19CCCACCTGNONE 
Os08g0160600AK106763CCCGGGCCCCACCTGTConserved hypothetical protein. 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
J033105E19GACGGCCCACCTGTNONE 
J080012K11GACGGCCCACCTGTNONE 
J080041I12GACGGCCCACCTGTNONE 
J080049G05GACGGCCCACCTGTNONE 
J080050P09GACGGCCCACCTGTNONE 
J080051A10GACGGCCCACCTGTNONE 
J080054G05GACGGCCCACCTGTNONE 
J080058M08GACGGCCCACCTGTNONE 
J080064N23GACGGCCCACCTGTNONE 
J080072L15GACGGCCCACCTGTNONE 
J080096H09GACGGCCCACCTGTNONE 
J100079I08GACGGCCCACCTGTNONE 
Os08g0191900AK067587CTGACAGGTGGGCCCCProtein prenyltransferase domain containing protein. 
AK099016CTGACAGGTGGGCCCCNONE 
J013032I08CTGACAGGTGGGCCCCNONE 
J013050I24CTGACAGGTGGGCCCCNONE 
J013128E05CTGACAGGTGGGCCCCNONE 
Os08g0326600AK065219TGGGTCCCACCTGTCAGSimilar to GMP synthetase. 
Os08g0366100AK061882AGGTGGGCCCCACCTGTCAGNONE 
AK120339AGGTGGGCCCCACCTGTCAGSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10AGGTGGGCCCCACCTGTCAGNONE 
J023135H23AGGTGGGCCCCACCTGTCAGNONE 
J033095L23AGGTGGGCCCCACCTGTCAGNONE 
J065010L09AGGTGGGCCCCACCTGTCAGNONE 
J065016A02AGGTGGGCCCCACCTGTCAGNONE 
J065041H14AGGTGGGCCCCACCTGTCAGNONE 
J065043F09AGGTGGGCCCCACCTGTCAGNONE 
J065045E03AGGTGGGCCCCACCTGTCAGNONE 
J065058F23AGGTGGGCCCCACCTGTCAGNONE 
J065075L19AGGTGGGCCCCACCTGTCAGNONE 
J065078N12AGGTGGGCCCCACCTGTCAGNONE 
J065105J19AGGTGGGCCCCACCTGTCAGNONE 
J065162I03AGGTGGGCCCCACCTGTCAGNONE 
J065164D10AGGTGGGCCCCACCTGTCAGNONE 
J065170B05AGGTGGGCCCCACCTGTCAGNONE 
J075039K19AGGTGGGCCCCACCTGTCAGNONE 
J075039M06AGGTGGGCCCCACCTGTCAGNONE 
J075057L17AGGTGGGCCCCACCTGTCAGNONE 
J075059F17AGGTGGGCCCCACCTGTCAGNONE 
J075109J04AGGTGGGCCCCACCTGTCAGNONE 
J075120B14AGGTGGGCCCCACCTGTCAGNONE 
J075153I11AGGTGGGCCCCACCTGTCAGNONE 
J075156C19AGGTGGGCCCCACCTGTCAGNONE 
J075166J20AGGTGGGCCCCACCTGTCAGNONE 
J090052H04AGGTGGGCCCCACCTGTCAGNONE 
J100051E13AGGTGGGCCCCACCTGTCAGNONE 
J100057L03AGGTGGGCCCCACCTGTCAGNONE 
J100059G23AGGTGGGCCCCACCTGTCAGNONE 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
Os08g0474000009-121-F01CCCACCTGTNONE 
009-124-B06CCCACCTGTNONE 
AK062882CCCACCTGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0511400AK069673CAGGTGGGTCCCACCConserved hypothetical protein. 
J065161H07CAGGTGGGTCCCACCNONE 
Os08g0525000AK103220AGTGGGCCCCACCTGTCAGRas GTPase family protein. 
J033122O18AGTGGGCCCCACCTGTCAGNONE 
J065026M15AGTGGGCCCCACCTGTCAGNONE 
J075007I01AGTGGGCCCCACCTGTCAGNONE 
J075031E01AGTGGGCCCCACCTGTCAGNONE 
J075043N14AGTGGGCCCCACCTGTCAGNONE 
J075074O16AGTGGGCCCCACCTGTCAGNONE 
J075092O04AGTGGGCCCCACCTGTCAGNONE 
J075141D16AGTGGGCCCCACCTGTCAGNONE 
J075172C22AGTGGGCCCCACCTGTCAGNONE 
J075173A05AGTGGGCCCCACCTGTCAGNONE 
Os08g0531000AK072408AGTGGGCCCCACCTGTCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os09g0122500J065067B01GGCCCCACCTGTCNONE 
J065113L16GGCCCCACCTGTCHypothetical protein. 
Os09g0306700J023045A19GGCCCCACCTGTCNONE 
Os09g0309500J100027L22CAGGTGGGConserved hypothetical protein. 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0363700AK103667CTGACAGGTGGGCCCCConserved hypothetical protein. 
AK103667GACAGGTGGGConserved hypothetical protein. 
J075001L14CTGACAGGTGGGCCCCNONE 
J075001L14GACAGGTGGGNONE 
J075049M23CTGACAGGTGGGCCCCNONE 
J075049M23GACAGGTGGGNONE 
J075051I04CTGACAGGTGGGCCCCNONE 
J075051I04GACAGGTGGGNONE 
J075073L04CTGACAGGTGGGCCCCNONE 
J075073L04GACAGGTGGGNONE 
J075077E03CTGACAGGTGGGCCCCNONE 
J075077E03GACAGGTGGGNONE 
J075083J11CTGACAGGTGGGCCCCNONE 
J075083J11GACAGGTGGGNONE 
J075094J22CTGACAGGTGGGCCCCNONE 
J075094J22GACAGGTGGGNONE 
J075112E08CTGACAGGTGGGCCCCNONE 
J075112E08GACAGGTGGGNONE 
J075137J23CTGACAGGTGGGCCCCNONE 
J075137J23GACAGGTGGGNONE 
J075192E02CTGACAGGTGGGCCCCNONE 
J075192E02GACAGGTGGGNONE 
J100039K04CTGACAGGTGGGCCCCNONE 
J100039K04GACAGGTGGGNONE 
Os09g0371200J100027I16CAGGTGGGCCCCACGTMajor facilitator superfamily MFS_1 protein. 
Os09g0376000AK119322CAGGTGGGCCCGConserved hypothetical protein. 
Os09g0380400009-200-D01GACAGGTGGGTCCCACTTGNONE 
AK063909GACAGGTGGGTCCCACTTGNONE 
AK072517GACAGGTGGGTCCCACTTGConserved hypothetical protein. 
AK073073GACAGGTGGGTCCCACTTGNONE 
J065205F20GACAGGTGGGTCCCACTTGNONE 
J100036D22GACAGGTGGGTCCCACTTGNONE 
J100047M01GACAGGTGGGTCCCACTTGNONE 
J100071G04GACAGGTGGGTCCCACTTGNONE 
Os09g0397200J065178K08GGTCCCACCTGTCConserved hypothetical protein. 
J065178L07GGTCCCACCTGTCNONE 
Os09g0402100009-119-F11GACAGGTGGGCCCCACTCCNONE 
009-166-C09GACAGGTGGGCCCCACTCCNONE 
AK068506GACAGGTGGGCCCCACTCCPF1 protein. 
J065130I01GACAGGTGGGCCCCACTCCNONE 
L24390GACAGGTGGGCCCCACTCCNONE 
Os09g0409000AK107676GGTCCCACCTGTCConserved hypothetical protein. 
Os09g0424600AK073882ACAGGTGGGCCCCACGTGGCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0441900009-109-C08GCCCCACCTGNONE 
013-033-G05GCCCCACCTGNONE 
AK062809GCCCCACCTGNONE 
AK064043GCCCCACCTGNONE 
J023131I10GCCCCACCTGNONE 
J033032C18GCCCCACCTGNONE 
J033113E20GCCCCACCTGNONE 
Os09g0445600AK107839CAGGTGGGGCCCACCACConserved hypothetical protein. 
Os09g0446200011-092-H04CCCACCTGSpc97/Spc98 family protein. 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0528000AK072633GACAGGTGGGCCCCGTGGGNONE 
AK100918GACAGGTGGGCCCCGTGGGKinesin, motor region domain containing protein. 
Os09g0535500AK108282CCCACCTGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os11g0159000AK065738CAGGTGGGCCCCACGTGConserved hypothetical protein. 
Os11g0187500012-002-D06CTGACAGGTGGGGCCNONE 
012-035-H04CTGACAGGTGGGGCCNONE 
012-065-F08CTGACAGGTGGGGCCNONE 
AK063977CTGACAGGTGGGGCCSimilar to Heat shock protein 70. 
AK103083CTGACAGGTGGGGCCNONE 
J033118G15CTGACAGGTGGGGCCNONE 
J065115E02CTGACAGGTGGGGCCNONE 
J065178K04CTGACAGGTGGGGCCNONE 
J065178L03CTGACAGGTGGGGCCNONE 
J090064A22CTGACAGGTGGGGCCNONE 
Os11g0209700012-068-H08GCCCCCACCTGNONE 
015-016-B07GCCCCCACCTGNONE 
AK068331GCCCCCACCTGNONE 
Os11g0216100AK059179CAGGTGGGCCCCACGSimilar to Chaperone protein dnaJ. 
Os11g0297900AK067692CAGGTGGGCTTASimilar to Txnl4b protein. 
J013118F01CAGGTGGGCTTANONE 
J023066E22CAGGTGGGCTTANONE 
J023066E24CAGGTGGGCTTANONE 
Os11g0453900AK109096GCCCACCTGDehydrin RAB 16D. 
Os11g0473000AK060156CAGGTGGGCCNONE 
AK065994CAGGTGGGCCSimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759CAGGTGGGCCNONE 
Os11g0525200011-005-B12CAGGTGGGGCCCNONE 
012-006-A10CAGGTGGGGCCCNONE 
012-093-G03CAGGTGGGGCCCNONE 
014-088-E05CAGGTGGGGCCCNONE 
015-100-F08CAGGTGGGGCCCNONE 
AB025047CAGGTGGGGCCCNONE 
AK060487CAGGTGGGGCCCNONE 
AK121491CAGGTGGGGCCCSimilar to Cytochrome P450 51 (EC 1.14.13.70) (CYPLI) (P450-LIA1) (Obtusifoliol 14-alpha demethylase) (Fragment). 
J013130H02CAGGTGGGGCCCNONE 
J013158G17CAGGTGGGGCCCNONE 
J023063C20CAGGTGGGGCCCNONE 
J023079N18CAGGTGGGGCCCNONE 
J023082P17CAGGTGGGGCCCNONE 
J023086I09CAGGTGGGGCCCNONE 
J023112D17CAGGTGGGGCCCNONE 
J023121B06CAGGTGGGGCCCNONE 
J023122G16CAGGTGGGGCCCNONE 
J023147J07CAGGTGGGGCCCNONE 
J023150P16CAGGTGGGGCCCNONE 
J033076I22CAGGTGGGGCCCNONE 
J033129I15CAGGTGGGGCCCNONE 
J075155F06CAGGTGGGGCCCNONE 
J075163E02CAGGTGGGGCCCNONE 
J075168H23CAGGTGGGGCCCNONE 
J100022M11CAGGTGGGGCCCNONE 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
AK098929GACAGGTGGGCCCCACCACNONE 
J013026M18GACAGGTGGGCCCCACCACNONE 
J013050K16GACAGGTGGGCCCCACCACNONE 
J013156L24GACAGGTGGGCCCCACCACNONE 
J023022H22GACAGGTGGGCCCCACCACNONE 
J023065I09GACAGGTGGGCCCCACCACNONE 
J023084F23GACAGGTGGGCCCCACCACNONE 
J033111G01GACAGGTGGGCCCCACCACNONE 
J053026C09GACAGGTGGGCCCCACCACNONE 
J053027J02GACAGGTGGGCCCCACCACNONE 
J053061N23GACAGGTGGGCCCCACCACNONE 
J053086A13GACAGGTGGGCCCCACCACNONE 
J053094C15GACAGGTGGGCCCCACCACNONE 
J075094C03GACAGGTGGGCCCCACCACNONE 
J075150B17GACAGGTGGGCCCCACCACNONE 
J090097L07GACAGGTGGGCCCCACCACNONE 
J100025O15GACAGGTGGGCCCCACCACNONE 
J100077N15GACAGGTGGGCCCCACCACNONE 
Os11g0527000J065137N17CATGGGCCCCACCTGTCConserved hypothetical protein. 
J065137N17GTGGGTCCCACCTGTCConserved hypothetical protein. 
Os11g0549615AK069660TCCGGGCCCACCTGAcid phosphatase, type 5 family protein. 
J023031L04TCCGGGCCCACCTGNONE 
Os11g0549620006-091-C11GTGTGGGGCCCACCTGNONE 
AK061321GTGTGGGGCCCACCTGSimilar to Purple acid phosphatase. 
AK106004GTGTGGGGCCCACCTGNONE 
Os11g0549690J065085G07ATTTGGGCCCACCTGTConserved hypothetical protein. 
J065218B08ATTTGGGCCCACCTGTNONE 
J090036H16ATTTGGGCCCACCTGTNONE 
Os11g0580000AK119421CTGACAGGTGGGCCCCAGArmadillo-like helical domain containing protein. 
AK121905CTGACAGGTGGGCCCCAGNONE 
J033105I06CTGACAGGTGGGCCCCAGNONE 
J090022C10CTGACAGGTGGGCCCCAGNONE 
J090024J23CTGACAGGTGGGCCCCAGNONE 
J090044F24CTGACAGGTGGGCCCCAGNONE 
Os11g0615700AB026561CAGGTGGGTCCCNONE 
AK059521CAGGTGGGTCCCNONE 
AK103487CAGGTGGGTCCCProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14CAGGTGGGTCCCNONE 
J065044A11CAGGTGGGTCCCNONE 
J065090I02CAGGTGGGTCCCNONE 
J065104I09CAGGTGGGTCCCNONE 
J065187J10CAGGTGGGTCCCNONE 
J075024E07CAGGTGGGTCCCNONE 
J075025O13CAGGTGGGTCCCNONE 
J090062N12CAGGTGGGTCCCNONE 
J090087G06CAGGTGGGTCCCNONE 
J090098K11CAGGTGGGTCCCNONE 
Os11g0629200AK065196CCCACCTGTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0655100014-094-A01CAGGTGGGNONE 
AK063746CAGGTGGGConserved hypothetical protein. 
Os11g0672900014-017-A02GGTCCCACCTGTCAGNONE 
AK105350GGTCCCACCTGTCAGProtein of unknown function DUF1645 family protein. 
Os12g0120000011-024-E09CCCACCTGTCNONE 
AK105399CCCACCTGTCProtein of unknown function DUF936, plant family protein. 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0197400J013068J02CTGGGGCCCACCTGTCAGNONE 
J013074K04CTGGGGCCCACCTGTCAGNONE 
J013089J21CTGGGGCCCACCTGTCAGNONE 
J013170B12CTGGGGCCCACCTGTCAGNONE 
J033029L11CTGGGGCCCACCTGTCAGNONE 
J033051A07CTGGGGCCCACCTGTCAGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18CTGGGGCCCACCTGTCAGNONE 
J065101D01CTGGGGCCCACCTGTCAGNONE 
J065144J23CTGGGGCCCACCTGTCAGNONE 
J065206D18CTGGGGCCCACCTGTCAGNONE 
Os12g0244000AK106408GGCCCCACCTGTCAGHypothetical protein. 
Os12g0405300AK070969GTGGGACCCACCTGTCConserved hypothetical protein. 
Os12g0472800AK063278AGGGCCCACCTGTCAGB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0500700AK073408CCCACCTGTCAGTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0566900AK109171CAGGTGGGNONE 
Os12g0597500AK101904CAGGTGGGCCTCNONE 
AK103799CAGGTGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CAGGTGGGCCTCNONE 
J100078O15CAGGTGGGCCTCNONE 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0625000006-117-H03TGCGGGCCCCACCTGNONE 
AF073695TGCGGGCCCCACCTGNONE 
AK061993TGCGGGCCCCACCTGNONE 
AK099598TGCGGGCCCCACCTGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.