version

Summary of OsREG515 (All List)

OrganismOryza sativa  
IDOsREG515  
SequenceCATCCACC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1780  

Entry Sequences (1780 entries)

LocusGene modelSequenceDescription
Os01g0143100AK072025GGTGGATGMitochondrial substrate carrier family protein. 
AK107219GGTGGATGNONE 
J100068M05GGTGGATGNONE 
Os01g0150200006-072-A05CCCATCCACCNONE 
AK060935CCCATCCACCNONE 
AK099465CCCATCCACCProtein tyrosine phosphatase-like protein, PTPLA family protein. 
J013023K19CCCATCCACCNONE 
J065009G18CCCATCCACCNONE 
J065054L02CCCATCCACCNONE 
J065139N21CCCATCCACCNONE 
J065191G16CCCATCCACCNONE 
J075157K23CCCATCCACCNONE 
J100025C13CCCATCCACCNONE 
J100032B09CCCATCCACCNONE 
J100053I22CCCATCCACCNONE 
J100072P11CCCATCCACCNONE 
Os01g0232400AK101990CATCCACCSimilar to VHS1 protein (Fragment). 
AK106519CATCCACCNONE 
Os01g0262500AK071545CATCCACCTRAM, LAG1 and CLN8 homology domain containing protein. 
Os01g0348800009-070-A09CATCCACCNONE 
AK062553CATCCACCSimilar to Salt-stress induced protein (Salt protein). 
Os01g0357200AK099419GGTGGATGSterol-binding domain containing protein. 
Os01g0514700AK069218CATCCACCProtein kinase domain containing protein. 
Os01g0520800AK102454CATCCACCConserved hypothetical protein. 
J033094A13CATCCACCNONE 
Os01g0549300AK107646CATCCACCHomeodomain-like containing protein. 
J075054N10CATCCACCNONE 
J075167C07CATCCACCNONE 
J075194O08CATCCACCNONE 
Os01g0554100012-026-D02CATCCACCNONE 
AK060977CATCCACCNONE 
AK063461CATCCACCNONE 
J075096C09CATCCACCNONE 
J075154I16CATCCACCNONE 
Os01g0575200015-047-A07CATCCACCNONE 
AK106333CATCCACCConserved hypothetical protein. 
J065140I24CATCCACCNONE 
J080013D19CATCCACCNONE 
J080034P11CATCCACCNONE 
J080043J20CATCCACCNONE 
J080068H05CATCCACCNONE 
J080070I24CATCCACCNONE 
J080076D13CATCCACCNONE 
J080086M10CATCCACCNONE 
J080086M20CATCCACCNONE 
J080096B02CATCCACCNONE 
J080097C23CATCCACCNONE 
J100050L16CATCCACCNONE 
Os01g0600000014-098-H06CCCATCCACCNONE 
AK121212CCCATCCACCSimilar to Copia-like retroelement pol polyprotein. 
J023089H03CCCATCCACCNONE 
J033140E12CCCATCCACCNONE 
J033142E12CCCATCCACCNONE 
J043040N09CCCATCCACCNONE 
J065014M23CCCATCCACCNONE 
J065017B07CCCATCCACCNONE 
J065019E11CCCATCCACCNONE 
J065049F16CCCATCCACCNONE 
J065053P17CCCATCCACCNONE 
J065083C04CCCATCCACCNONE 
J065093P06CCCATCCACCNONE 
J065146L22CCCATCCACCNONE 
J065203F18CCCATCCACCNONE 
J065217E22CCCATCCACCNONE 
J075003E06CCCATCCACCNONE 
J075005I23CCCATCCACCNONE 
J075020P07CCCATCCACCNONE 
J075049I18CCCATCCACCNONE 
J075086G02CCCATCCACCNONE 
J075101C05CCCATCCACCNONE 
J075110G23CCCATCCACCNONE 
J075144E01CCCATCCACCNONE 
J090061N03CCCATCCACCNONE 
J090068M03CCCATCCACCNONE 
J100084N22CCCATCCACCNONE 
Os01g0607800AK058392GGTGGATGNONE 
Os01g0626100AK066892CATCCACCAdaptin, N-terminal domain containing protein. 
J013050G23CATCCACCNONE 
J013060F03CATCCACCNONE 
J013088A19CATCCACCNONE 
J013105M18CATCCACCNONE 
J013108D15CATCCACCNONE 
J013118M09CATCCACCNONE 
J023009J17CATCCACCNONE 
J023078I22CATCCACCNONE 
J023103F15CATCCACCNONE 
J023105B22CATCCACCNONE 
J033024C18CATCCACCNONE 
J033032N02CATCCACCNONE 
J033041E20CATCCACCNONE 
J033068L19CATCCACCNONE 
J033076E16CATCCACCNONE 
J033084J03CATCCACCNONE 
J033090A13CATCCACCNONE 
J033106C19CATCCACCNONE 
J033116N13CATCCACCNONE 
J033127C24CATCCACCNONE 
J033129M02CATCCACCNONE 
J033145J02CATCCACCNONE 
J043005F08CATCCACCNONE 
J043007L22CATCCACCNONE 
J043031E03CATCCACCNONE 
J043035J19CATCCACCNONE 
J053027K20CATCCACCNONE 
J065058I24CATCCACCNONE 
J065078A06CATCCACCNONE 
J065085E09CATCCACCNONE 
J065093L04CATCCACCNONE 
J065099H07CATCCACCNONE 
J065102D09CATCCACCNONE 
J065136J19CATCCACCNONE 
J065182P21CATCCACCNONE 
J065200F03CATCCACCNONE 
J090004E22CATCCACCNONE 
J090013K22CATCCACCNONE 
J090019A03CATCCACCNONE 
J090057B09CATCCACCNONE 
J090066F19CATCCACCNONE 
J090071M22CATCCACCNONE 
J090075E16CATCCACCNONE 
J090086D23CATCCACCNONE 
Os01g0662600009-056-E10CATCCACCNONE 
009-056-E10CATCCACCNONE 
AK062234CATCCACCNONE 
AK062234CATCCACCNONE 
AK098887CATCCACCNONE 
AK098887CATCCACCNONE 
AK099656CATCCACCNONE 
AK099656CATCCACCNONE 
AK119723CATCCACCSimilar to NifU-like protein. 
AK119723CATCCACCSimilar to NifU-like protein. 
J013001K01CATCCACCNONE 
J013001K01CATCCACCNONE 
J013090F20CATCCACCNONE 
J013090F20CATCCACCNONE 
J013119A14CATCCACCNONE 
J013119A14CATCCACCNONE 
J013121P12CATCCACCNONE 
J013121P12CATCCACCNONE 
J033132I15CATCCACCNONE 
J033132I15CATCCACCNONE 
J075023F22CATCCACCNONE 
J075023F22CATCCACCNONE 
J075023M13CATCCACCNONE 
J075023M13CATCCACCNONE 
J100024D10CATCCACCNONE 
J100024D10CATCCACCNONE 
J100024N01CATCCACCNONE 
J100024N01CATCCACCNONE 
J100026H09CATCCACCNONE 
J100026H09CATCCACCNONE 
J100027H07CATCCACCNONE 
J100027H07CATCCACCNONE 
J100045K07CATCCACCNONE 
J100045K07CATCCACCNONE 
J100057K18CATCCACCNONE 
J100057K18CATCCACCNONE 
J100085C22CATCCACCNONE 
J100085C22CATCCACCNONE 
Os01g0668700AK067957GGTGGATGConserved hypothetical protein. 
Os01g0675700003-128-A07CATCCACCNONE 
006-037-C05CATCCACCNONE 
AJ627256CATCCACCNONE 
AK061495CATCCACCNONE 
AK102396CATCCACCNONE 
AK106121CATCCACCSimilar to Auxin-responsive protein IAA14 (Indoleacetic acid-induced protein 14) (SOLITARY-ROOT protein). 
J065168F03CATCCACCNONE 
J075198K21CATCCACCNONE 
J100027E13CATCCACCNONE 
J100074L18CATCCACCNONE 
Os01g0716800AK101741CATCCACCEndonuclease/exonuclease/phosphatase domain containing protein. 
AK101771CATCCACCNONE 
Os01g0723600AK109735CATCCACCRibose-phosphate pyrophosphokinase 3 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 3). 
Os01g0769700014-082-A10GGTGGATGNONE 
014-082-A10GGTGGATGNONE 
AK105465GGTGGATGNONE 
AK105465GGTGGATGNONE 
J090037F10GGTGGATGNONE 
J090037F10GGTGGATGNONE 
Os01g0772500AK109736CATCCACCGlycosyl transferase, family 14 protein. 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0806300AK111352GGTGGATGConserved hypothetical protein. 
Os01g0813400006-025-B06CATCCACCAGCCCAAANONE 
006-030-C07CATCCACCAGCCCAAANONE 
006-068-F06CATCCACCAGCCCAAANONE 
006-096-E09CATCCACCAGCCCAAANONE 
006-097-B11CATCCACCAGCCCAAANONE 
006-104-H02CATCCACCAGCCCAAANONE 
AK062251CATCCACCAGCCCAAANONE 
AK065370CATCCACCAGCCCAAASimilar to ADP-ribosylation factor 1. 
J013022G24CATCCACCAGCCCAAANONE 
J013104C07CATCCACCAGCCCAAANONE 
J023074M17CATCCACCAGCCCAAANONE 
J043027C07CATCCACCAGCCCAAANONE 
J065026K05CATCCACCAGCCCAAANONE 
J065103I01CATCCACCAGCCCAAANONE 
J090025M17CATCCACCAGCCCAAANONE 
J100027L03CATCCACCAGCCCAAANONE 
J100054I20CATCCACCAGCCCAAANONE 
Os01g0827500AK111814CATCCACCExo70 exocyst complex subunit family protein. 
AK111814CCCATCCACCExo70 exocyst complex subunit family protein. 
Os01g0844900AK066659CATCCACCHomeodomain-like containing protein. 
Os01g0852900J033066K09GCCCATCCACCNONE 
Os01g0863300014-030-D08CATCCACCNONE 
AK111571CATCCACCSimilar to MCB2 protein. 
J013071A13CATCCACCNONE 
J075060E09CATCCACCNONE 
J075138C14CATCCACCNONE 
J075150M17CATCCACCNONE 
Os01g0872300J065128I03GGTGGATGConserved hypothetical protein. 
J100063A13GGTGGATGNONE 
Os01g0872900AK106574CATCCACCProtein of unknown function DUF635 family protein. 
Os01g0889400012-011-B10CATCCACCNONE 
AB200237CATCCACCNONE 
AK071407CATCCACCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2). 
AK119575CATCCACCNONE 
J023089G14CATCCACCNONE 
J075028N06CATCCACCNONE 
J075121D21CATCCACCNONE 
J075122K20CATCCACCNONE 
J075176J05CATCCACCNONE 
J080025B12CATCCACCNONE 
J080040M21CATCCACCNONE 
J080041I06CATCCACCNONE 
J080047F15CATCCACCNONE 
J080067B19CATCCACCNONE 
J080068J04CATCCACCNONE 
J080068M01CATCCACCNONE 
J080077C15CATCCACCNONE 
J080079M04CATCCACCNONE 
J080306O05CATCCACCNONE 
J090004J23CATCCACCNONE 
Os02g0115700AK065094GGGGCCCACATCCACCCatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231GGGGCCCACATCCACCNONE 
AK099923GGGGCCCACATCCACCNONE 
X61626GGGGCCCACATCCACCNONE 
Os02g0131100AK060381GGTGGATGConserved hypothetical protein. 
Os02g0141300AK067279CATCCACCACCAACGalactokinase family protein. 
AK074020CATCCACCACCAACNONE 
Os02g0177900AK060768GGTGGATGNONE 
AK066421GGTGGATGCarbohydrate kinase, FGGY family protein. 
J013033L10GGTGGATGNONE 
J013059J24GGTGGATGNONE 
J013107O09GGTGGATGNONE 
J023139D02GGTGGATGNONE 
J033032I10GGTGGATGNONE 
J033080M06GGTGGATGNONE 
J033094M16GGTGGATGNONE 
J033123P17GGTGGATGNONE 
J033138I01GGTGGATGNONE 
J033141M24GGTGGATGNONE 
J065015P22GGTGGATGNONE 
J065048H08GGTGGATGNONE 
J065057N23GGTGGATGNONE 
J065101K06GGTGGATGNONE 
J065188A09GGTGGATGNONE 
J075089I09GGTGGATGNONE 
J075112K04GGTGGATGNONE 
J090022A10GGTGGATGNONE 
J100061C08GGTGGATGNONE 
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0216500AK103179GGTGGATGHypothetical protein. 
Os02g0308400006-022-B03CCCATCCACCNONE 
006-023-H07CCCATCCACCNONE 
006-026-F01CCCATCCACCNONE 
006-026-G09CCCATCCACCNONE 
006-031-A06CCCATCCACCNONE 
006-033-B03CCCATCCACCNONE 
006-035-F03CCCATCCACCNONE 
006-046-D08CCCATCCACCNONE 
006-048-E07CCCATCCACCNONE 
006-048-F12CCCATCCACCNONE 
006-049-F11CCCATCCACCNONE 
006-051-A12CCCATCCACCNONE 
006-055-H04CCCATCCACCNONE 
006-061-B09CCCATCCACCNONE 
006-066-E12CCCATCCACCNONE 
006-068-D11CCCATCCACCNONE 
006-072-H02CCCATCCACCNONE 
006-079-D02CCCATCCACCNONE 
006-083-B08CCCATCCACCNONE 
006-083-F10CCCATCCACCNONE 
006-093-D11CCCATCCACCNONE 
006-097-C09CCCATCCACCNONE 
006-100-C09CCCATCCACCNONE 
006-107-A04CCCATCCACCNONE 
006-110-D02CCCATCCACCNONE 
006-116-E06CCCATCCACCNONE 
006-117-H10CCCATCCACCNONE 
006-120-H10CCCATCCACCNONE 
009-033-D01CCCATCCACCNONE 
009-106-A02CCCATCCACCNONE 
009-111-B04CCCATCCACCNONE 
009-129-G10CCCATCCACCNONE 
013-036-E08CCCATCCACCNONE 
013-039-G02CCCATCCACCNONE 
014-023-A11CCCATCCACCNONE 
014-100-A04CCCATCCACCNONE 
AK061195CCCATCCACCNONE 
AK061421CCCATCCACCNONE 
AK104181CCCATCCACCNONE 
AK104630CCCATCCACCNONE 
AK104655CCCATCCACCBeta-Ig-H3/fasciclin domain containing protein. 
Os02g0556700AK073875CATCCACCT-complex 11 family protein. 
Os02g0581200009-046-F03CATCCACCNONE 
AK062477CATCCACCConserved hypothetical protein. 
J100073E13CATCCACCNONE 
Os02g0606800AK073760CATCCACCIsochorismatase hydrolase family protein. 
J100033B19CATCCACCNONE 
J100047E15CATCCACCNONE 
J100058A18CATCCACCNONE 
J100068L14CATCCACCNONE 
J100089I02CATCCACCNONE 
Os02g0619600AK072178CATCCACCZinc finger, RING-type domain containing protein. 
Os02g0721700AK061514CATCCACCConserved hypothetical protein. 
AK104061CATCCACCNONE 
J065050F11CATCCACCNONE 
J065078C10CATCCACCNONE 
J065082O15CATCCACCNONE 
J065103F16CATCCACCNONE 
J075017D04CATCCACCNONE 
J075033O03CATCCACCNONE 
J075045I05CATCCACCNONE 
J075167O19CATCCACCNONE 
Os02g0733300AK101108CATCCACCSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446CATCCACCNONE 
Os02g0748300009-089-D04GGTGGATGNONE 
AK100919GGTGGATGNONE 
J023133K05GGTGGATGNONE 
Os02g0764500006-061-H01CATCCACCNONE 
009-179-B01CATCCACCNONE 
AK066291CATCCACCSimilar to Lhca5 protein. 
J053091A05CATCCACCNONE 
J065012B02CATCCACCNONE 
J065034D22CATCCACCNONE 
J065055H23CATCCACCNONE 
J065087E07CATCCACCNONE 
J065104B19CATCCACCNONE 
J065163L17CATCCACCNONE 
Os02g0771200011-006-B07GGTGGATGNONE 
AK066823GGTGGATGConserved hypothetical protein. 
AK071059GGTGGATGNONE 
J013075K03GGTGGATGNONE 
Os02g0773800006-058-D05CATCCACCNONE 
AK103063CATCCACCHypothetical protein. 
J033117N07CATCCACCNONE 
J065083B19CATCCACCNONE 
Os02g0797500AK072426CATCCACCSimilar to Plastidic aspartate aminotransferase. 
AK105059CATCCACCNONE 
AY157306CATCCACCNONE 
J090089N21CATCCACCNONE 
Os02g0806000AK072745CATCCACCGCN5-related N-acetyltransferase domain containing protein. 
J013130C06CATCCACCNONE 
J013154L12CATCCACCNONE 
J023135J07CATCCACCNONE 
J065038E23CATCCACCNONE 
J065042C10CATCCACCNONE 
J090075B11CATCCACCNONE 
J100033J17CATCCACCNONE 
Os02g0822100AK099610CATCCACCNONE 
Os02g0826500AK061860GGTGGATGNONE 
Os02g0829500016-020-D10GGTGGATGNONE 
AK064830GGTGGATGNONE 
AK065244GGTGGATGNONE 
AK104364GGTGGATGNONE 
AK104532GGTGGATGNONE 
AK122029GGTGGATGBeta-lactamase-like domain containing protein. 
J013000F10GGTGGATGNONE 
J013002I14GGTGGATGNONE 
J013104C08GGTGGATGNONE 
J013129D17GGTGGATGNONE 
J023001C18GGTGGATGNONE 
J033073L12GGTGGATGNONE 
J033112F11GGTGGATGNONE 
J043017J09GGTGGATGNONE 
J053080K12GGTGGATGNONE 
J053094B07GGTGGATGNONE 
J065195N12GGTGGATGNONE 
Os03g0111600AK101020GGTGGATGGGProtein of unknown function DUF1618 domain containing protein. 
J023149K08GGTGGATGGGNONE 
J033042K17GGTGGATGGGNONE 
J033073E05GGTGGATGGGNONE 
J043032K02GGTGGATGGGNONE 
J090009D04GGTGGATGGGNONE 
J090037M16GGTGGATGGGNONE 
Os03g0115400003-126-D04CATCCACCNONE 
AK103356CATCCACCWD40-like domain containing protein. 
AK103522CATCCACCNONE 
J033126K20CATCCACCNONE 
J033131K03CATCCACCNONE 
J033131K05CATCCACCNONE 
J033136B16CATCCACCNONE 
J033147E04CATCCACCNONE 
J043027H03CATCCACCNONE 
J065173H02CATCCACCNONE 
J075032C10CATCCACCNONE 
J075040D19CATCCACCNONE 
J075060L18CATCCACCNONE 
J075084N07CATCCACCNONE 
J075112M18CATCCACCNONE 
J075132I01CATCCACCNONE 
J075195E06CATCCACCNONE 
J090016B20CATCCACCNONE 
J090063F20CATCCACCNONE 
J100061H04CATCCACCNONE 
J100089D15CATCCACCNONE 
Os03g0131200AB020502CCCATCCACCNONE 
AK062174CCCATCCACCNONE 
AK066378CCCATCCACCSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372CCCATCCACCNONE 
J013060B21CCCATCCACCNONE 
J013149P20CCCATCCACCNONE 
J023060E16CCCATCCACCNONE 
J043004A19CCCATCCACCNONE 
J053029N09CCCATCCACCNONE 
J053072I10CCCATCCACCNONE 
J065016G02CCCATCCACCNONE 
J065022E22CCCATCCACCNONE 
J065024K17CCCATCCACCNONE 
J065035E10CCCATCCACCNONE 
J065036D13CCCATCCACCNONE 
J065041E06CCCATCCACCNONE 
J065064H14CCCATCCACCNONE 
J065067I06CCCATCCACCNONE 
J065080C01CCCATCCACCNONE 
J065086K23CCCATCCACCNONE 
J065087L12CCCATCCACCNONE 
J065090I05CCCATCCACCNONE 
J065117E23CCCATCCACCNONE 
J065120A10CCCATCCACCNONE 
J065120L22CCCATCCACCNONE 
J065123F02CCCATCCACCNONE 
J065128G02CCCATCCACCNONE 
J065142B04CCCATCCACCNONE 
J065143K12CCCATCCACCNONE 
J065148B18CCCATCCACCNONE 
J065153C16CCCATCCACCNONE 
J065163J11CCCATCCACCNONE 
J065168L24CCCATCCACCNONE 
J065181J11CCCATCCACCNONE 
J065190F19CCCATCCACCNONE 
J065209E24CCCATCCACCNONE 
J065210G04CCCATCCACCNONE 
J065217H17CCCATCCACCNONE 
J065219I20CCCATCCACCNONE 
J075001M13CCCATCCACCNONE 
J075007B08CCCATCCACCNONE 
J075009I01CCCATCCACCNONE 
J075014C11CCCATCCACCNONE 
J075014L02CCCATCCACCNONE 
J075016E07CCCATCCACCNONE 
J075017J02CCCATCCACCNONE 
J075018F07CCCATCCACCNONE 
J075018N07CCCATCCACCNONE 
J075019B06CCCATCCACCNONE 
J075024F21CCCATCCACCNONE 
J075026B18CCCATCCACCNONE 
J075026M12CCCATCCACCNONE 
J075032B13CCCATCCACCNONE 
J075033O09CCCATCCACCNONE 
J075041A09CCCATCCACCNONE 
J075045L13CCCATCCACCNONE 
J075048N11CCCATCCACCNONE 
J075052A14CCCATCCACCNONE 
J075061B17CCCATCCACCNONE 
J075061I05CCCATCCACCNONE 
J075066I11CCCATCCACCNONE 
J075066P09CCCATCCACCNONE 
J075068F03CCCATCCACCNONE 
J075068P22CCCATCCACCNONE 
J075080I15CCCATCCACCNONE 
J075081I07CCCATCCACCNONE 
J075082K01CCCATCCACCNONE 
J075083A18CCCATCCACCNONE 
J075086O11CCCATCCACCNONE 
J075087E02CCCATCCACCNONE 
J075087M19CCCATCCACCNONE 
J075088G23CCCATCCACCNONE 
J075092K18CCCATCCACCNONE 
J075095H15CCCATCCACCNONE 
J075095K12CCCATCCACCNONE 
J075096L06CCCATCCACCNONE 
J075100H23CCCATCCACCNONE 
J075100K01CCCATCCACCNONE 
J075102K21CCCATCCACCNONE 
J075104F24CCCATCCACCNONE 
J075106C17CCCATCCACCNONE 
J075106E06CCCATCCACCNONE 
J075106M19CCCATCCACCNONE 
J075106O12CCCATCCACCNONE 
J075108I09CCCATCCACCNONE 
J075111M06CCCATCCACCNONE 
J075112E12CCCATCCACCNONE 
J075114C04CCCATCCACCNONE 
J075120A06CCCATCCACCNONE 
J075120D14CCCATCCACCNONE 
J075122P15CCCATCCACCNONE 
J075123A11CCCATCCACCNONE 
J075123L12CCCATCCACCNONE 
J075127G14CCCATCCACCNONE 
J075127H09CCCATCCACCNONE 
J075128M04CCCATCCACCNONE 
J075129J04CCCATCCACCNONE 
J075130J01CCCATCCACCNONE 
J075137N02CCCATCCACCNONE 
J075137O14CCCATCCACCNONE 
J075138H22CCCATCCACCNONE 
J075139P16CCCATCCACCNONE 
J075141G08CCCATCCACCNONE 
J075142C17CCCATCCACCNONE 
J075143B09CCCATCCACCNONE 
J075156I11CCCATCCACCNONE 
J075158M03CCCATCCACCNONE 
J075166I21CCCATCCACCNONE 
J075167C08CCCATCCACCNONE 
J075170C12CCCATCCACCNONE 
J075170F08CCCATCCACCNONE 
J075170G04CCCATCCACCNONE 
J075172N16CCCATCCACCNONE 
J075172P13CCCATCCACCNONE 
J075173G24CCCATCCACCNONE 
J075175D01CCCATCCACCNONE 
J075175K01CCCATCCACCNONE 
J075181O04CCCATCCACCNONE 
J075186A04CCCATCCACCNONE 
J075190B08CCCATCCACCNONE 
J075190M24CCCATCCACCNONE 
J075193D18CCCATCCACCNONE 
J075193H03CCCATCCACCNONE 
J075195N18CCCATCCACCNONE 
J080001N20CCCATCCACCNONE 
J080006K17CCCATCCACCNONE 
J080012I16CCCATCCACCNONE 
J080013K20CCCATCCACCNONE 
J080018N01CCCATCCACCNONE 
J080041G15CCCATCCACCNONE 
J080048L15CCCATCCACCNONE 
J080049A21CCCATCCACCNONE 
J080075G12CCCATCCACCNONE 
J080076O09CCCATCCACCNONE 
J080078P10CCCATCCACCNONE 
J080084D10CCCATCCACCNONE 
J090005N07CCCATCCACCNONE 
Os03g0142800015-062-B07GGTGGATGNONE 
AK064325GGTGGATGNONE 
Os03g0199500J065099N05CATCCACCNONE 
J065152P14CATCCACCConserved hypothetical protein. 
J080009C14CATCCACCNONE 
J080011K01CATCCACCNONE 
J080015H12CATCCACCNONE 
J080022K05CATCCACCNONE 
J080034G01CATCCACCNONE 
J080038I04CATCCACCNONE 
J080039F20CATCCACCNONE 
J080042J22CATCCACCNONE 
J080042N23CATCCACCNONE 
J080043E07CATCCACCNONE 
J080050A12CATCCACCNONE 
J080050C11CATCCACCNONE 
J080052B01CATCCACCNONE 
J080052H22CATCCACCNONE 
J080060E02CATCCACCNONE 
J080063K24CATCCACCNONE 
J080067I07CATCCACCNONE 
J080081H22CATCCACCNONE 
J080085J10CATCCACCNONE 
J080089E20CATCCACCNONE 
J080092N04CATCCACCNONE 
J080093B01CATCCACCNONE 
J080093N04CATCCACCNONE 
J080097B03CATCCACCNONE 
Os03g0226300AK111731GGTGGATGSimilar to Pto kinase interactor 1. 
Os03g0238300AK059494CATCCACCInositol polyphosphate related phosphatase domain containing protein. 
AK122075CATCCACCNONE 
J033118P13CATCCACCNONE 
Os03g0269300011-021-H03GGTGGATGNONE 
011-029-B01GGTGGATGNONE 
AK111855GGTGGATGNONE 
AK111884GGTGGATGAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0278500AK070850GGTGGATGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16GGTGGATGNONE 
Os03g0279200009-097-C06CATCCACCNONE 
013-007-B07CATCCACCNONE 
AK121750CATCCACCSimilar to Histone H2A. 
J033087I02CATCCACCNONE 
J065002G20CATCCACCNONE 
J065102M04CATCCACCNONE 
J065139A02CATCCACCNONE 
J075109D21CATCCACCNONE 
J075191L12CATCCACCNONE 
J090096C03CATCCACCNONE 
J100036C23CATCCACCNONE 
Os03g0286300AK058710CATCCACCSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
AK101724CATCCACCNONE 
Os03g0298600009-095-C02CATCCACCNONE 
AK066846CATCCACCTetratricopeptide-like helical domain containing protein. 
Os03g0302700006-099-F12CATCCACCAACNONE 
AK112010CATCCACCAACZinc finger, RING-type domain containing protein. 
AK121656CATCCACCAACNONE 
J075090A19CATCCACCAACNONE 
J075148M06CATCCACCAACNONE 
Os03g0306900AK073626CATCCACCTENA/THI-4 protein domain containing protein. 
J033050J24CATCCACCNONE 
J075180K24CATCCACCNONE 
Os03g0330300AK060756GGTGGATGViral attachment protein, fibre shaft repeat containing protein. 
AK072405GGTGGATGNONE 
J013043H13GGTGGATGNONE 
J013097M19GGTGGATGNONE 
J023080M15GGTGGATGNONE 
Os03g0355600AK069084GGTGGATGNONE 
J023007F10GGTGGATGNONE 
J065108D02GGTGGATGNONE 
J065109A09GGTGGATGNONE 
Os03g0399600AK068188CATCCACCConserved hypothetical protein. 
J013135E21CATCCACCNONE 
Os03g0431100009-024-H08CATCCACCNONE 
009-057-F10CATCCACCNONE 
009-089-F05CATCCACCNONE 
009-131-C05CATCCACCNONE 
009-133-D11CATCCACCNONE 
009-191-G08CATCCACCNONE 
013-024-A03CATCCACCNONE 
013-053-F10CATCCACCNONE 
013-057-D04CATCCACCNONE 
013-096-F08CATCCACCNONE 
AK058643CATCCACCXYPPX repeat containing protein. 
J013170C12CATCCACCNONE 
J065013E12CATCCACCNONE 
J065056D10CATCCACCNONE 
J065116F03CATCCACCNONE 
J065127J02CATCCACCNONE 
J065210J02CATCCACCNONE 
J075064D13CATCCACCNONE 
J075145C05CATCCACCNONE 
J075173H04CATCCACCNONE 
J075197D19CATCCACCNONE 
J075199E21CATCCACCNONE 
J100025E11CATCCACCNONE 
J100036J23CATCCACCNONE 
J100042A07CATCCACCNONE 
J100045J24CATCCACCNONE 
J100046E08CATCCACCNONE 
J100050E22CATCCACCNONE 
J100070G12CATCCACCNONE 
Os03g0577200006-030-H11CCCATCCACCNONE 
AK061735CCCATCCACCSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953CCCATCCACCNONE 
AK099558CCCATCCACCNONE 
AK104547CCCATCCACCNONE 
J013034B14CCCATCCACCNONE 
J013066J17CCCATCCACCNONE 
J090033N14CCCATCCACCNONE 
Os03g0654700AK107417CATCCACCProtein of unknown function DUF1637 family protein. 
Os03g0704200AK071176GGTGGATGZinc finger, MYND-type domain containing protein. 
J023083O08GGTGGATGNONE 
Os03g0762300006-060-F02GGTGGATGNONE 
006-075-B03GGTGGATGNONE 
006-083-C04GGTGGATGNONE 
006-083-E06GGTGGATGNONE 
006-090-A06GGTGGATGNONE 
006-104-A05GGTGGATGNONE 
006-107-C12GGTGGATGNONE 
006-111-D05GGTGGATGNONE 
Os03g0762400AK071181CATCCACCGCACCGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20CATCCACCGCACCGCNONE 
J033039C18CATCCACCGCACCGCNONE 
J033108N03CATCCACCGCACCGCNONE 
J043017N16CATCCACCGCACCGCNONE 
J065026C13CATCCACCGCACCGCNONE 
J065045C01CATCCACCGCACCGCNONE 
J065045D11CATCCACCGCACCGCNONE 
J065050N09CATCCACCGCACCGCNONE 
J065058P21CATCCACCGCACCGCNONE 
J065075I20CATCCACCGCACCGCNONE 
J065077I17CATCCACCGCACCGCNONE 
J065081I20CATCCACCGCACCGCNONE 
J065085B14CATCCACCGCACCGCNONE 
J065101K21CATCCACCGCACCGCNONE 
J065112A17CATCCACCGCACCGCNONE 
J065112N13CATCCACCGCACCGCNONE 
J065118J02CATCCACCGCACCGCNONE 
J065123E01CATCCACCGCACCGCNONE 
J065134N12CATCCACCGCACCGCNONE 
J065139L04CATCCACCGCACCGCNONE 
J065141I11CATCCACCGCACCGCNONE 
J065161J24CATCCACCGCACCGCNONE 
J065164I10CATCCACCGCACCGCNONE 
J065171L01CATCCACCGCACCGCNONE 
J065178P21CATCCACCGCACCGCNONE 
J065185L24CATCCACCGCACCGCNONE 
J065219C04CATCCACCGCACCGCNONE 
J075029B07CATCCACCGCACCGCNONE 
J075033G20CATCCACCGCACCGCNONE 
J075054N01CATCCACCGCACCGCNONE 
J075068B22CATCCACCGCACCGCNONE 
J075096N11CATCCACCGCACCGCNONE 
J075098C11CATCCACCGCACCGCNONE 
J075115J22CATCCACCGCACCGCNONE 
J075127D11CATCCACCGCACCGCNONE 
J075156J21CATCCACCGCACCGCNONE 
J075166G08CATCCACCGCACCGCNONE 
J075166P17CATCCACCGCACCGCNONE 
J075170O18CATCCACCGCACCGCNONE 
J075181A16CATCCACCGCACCGCNONE 
J075195J11CATCCACCGCACCGCNONE 
Os03g0764900011-075-A04CATCCACCNONE 
AK063380CATCCACCSimilar to Zn finger protein (Fragment). 
J065161C07CATCCACCNONE 
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE 
Os03g0796600003-113-D10CATCCACCNONE 
011-076-B12CATCCACCNONE 
AK105257CATCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03CATCCACCNONE 
J080036O17CATCCACCNONE 
J080064E16CATCCACCNONE 
J080069E03CATCCACCNONE 
J080079E23CATCCACCNONE 
J090036H20CATCCACCNONE 
J100029L10CATCCACCNONE 
J100055G09CATCCACCNONE 
Os03g0800000015-017-H02CATCCACCNONE 
AK064790CATCCACCNONE 
AK068267CATCCACCSimilar to Nitrate and chloride transporter. 
J013000C06CATCCACCNONE 
J013149D11CATCCACCNONE 
J023081E05CATCCACCNONE 
J023113D05CATCCACCNONE 
J023114B05CATCCACCNONE 
J023114B13CATCCACCNONE 
J023120G11CATCCACCNONE 
J043027F09CATCCACCNONE 
J065124K12CATCCACCNONE 
J100048B15CATCCACCNONE 
Os03g0823200AK072964GGTGGATGNONE 
Os03g0855600006-029-G09GGTGGATGGGNONE 
006-033-E02GGTGGATGGGNONE 
006-069-G07GGTGGATGGGNONE 
006-083-A02GGTGGATGGGNONE 
006-098-H04GGTGGATGGGNONE 
009-054-C04GGTGGATGGGNONE 
AK060030GGTGGATGGGNONE 
AK061467GGTGGATGGGConserved hypothetical protein. 
AK067858GGTGGATGGGNONE 
AK106030GGTGGATGGGNONE 
J013123A10GGTGGATGGGNONE 
J065001I24GGTGGATGGGNONE 
J065015N21GGTGGATGGGNONE 
J065016H07GGTGGATGGGNONE 
J065040A05GGTGGATGGGNONE 
J065040F01GGTGGATGGGNONE 
J065066G17GGTGGATGGGNONE 
J065077I09GGTGGATGGGNONE 
J065099M22GGTGGATGGGNONE 
J065135B13GGTGGATGGGNONE 
J065144H19GGTGGATGGGNONE 
J065146I03GGTGGATGGGNONE 
J065169E02GGTGGATGGGNONE 
J065177D21GGTGGATGGGNONE 
J065189L20GGTGGATGGGNONE 
J065207H13GGTGGATGGGNONE 
J065210D24GGTGGATGGGNONE 
J065212I03GGTGGATGGGNONE 
J075007E21GGTGGATGGGNONE 
J075013H07GGTGGATGGGNONE 
J075023K06GGTGGATGGGNONE 
J075031D23GGTGGATGGGNONE 
J075038K09GGTGGATGGGNONE 
J075084C08GGTGGATGGGNONE 
J075098K20GGTGGATGGGNONE 
J090028E04GGTGGATGGGNONE 
J090031E20GGTGGATGGGNONE 
J090042F06GGTGGATGGGNONE 
J090049L05GGTGGATGGGNONE 
J090086G03GGTGGATGGGNONE 
J090096J04GGTGGATGGGNONE 
J100035O03GGTGGATGGGNONE 
J100053H24GGTGGATGGGNONE 
J100056L17GGTGGATGGGNONE 
J100058K06GGTGGATGGGNONE 
J100059G09GGTGGATGGGNONE 
J100081C15GGTGGATGGGNONE 
Os03g0857500AK072880GGTGGATGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0175900006-100-F11GGTGGATGNONE 
AK061551GGTGGATGWinged helix repressor DNA-binding domain containing protein. 
AK104764GGTGGATGNONE 
J075039D12GGTGGATGNONE 
Os04g0231200J075131N11CATCCACCNONE 
J075169M11CATCCACCNONE 
Os04g0244800009-066-G06GGTGGATGNONE 
011-024-D02GGTGGATGNONE 
AK121488GGTGGATGHeavy metal transport/detoxification protein domain containing protein. 
J023095P14GGTGGATGNONE 
J023150J09GGTGGATGNONE 
J053097G24GGTGGATGNONE 
J065001K24GGTGGATGNONE 
J065009O13GGTGGATGNONE 
J065076M12GGTGGATGNONE 
J065081I15GGTGGATGNONE 
J065105E10GGTGGATGNONE 
J065106G04GGTGGATGNONE 
J065123I12GGTGGATGNONE 
J065137H16GGTGGATGNONE 
J065151I11GGTGGATGNONE 
J065164H06GGTGGATGNONE 
J065173J07GGTGGATGNONE 
J065196F02GGTGGATGNONE 
J065198I17GGTGGATGNONE 
J065206I11GGTGGATGNONE 
J065216J02GGTGGATGNONE 
J075076D10GGTGGATGNONE 
J075098F06GGTGGATGNONE 
J075115A20GGTGGATGNONE 
J075184H05GGTGGATGNONE 
J075193E17GGTGGATGNONE 
J090014L09GGTGGATGNONE 
J090015H16GGTGGATGNONE 
J090024M04GGTGGATGNONE 
J090062K08GGTGGATGNONE 
J090082I08GGTGGATGNONE 
Os04g0271200AK060035CCCATCCATCCACCSilent information regulator protein Sir2 family protein. 
J053065P14CCCATCCATCCACCNONE 
J065030K14CCCATCCATCCACCNONE 
J090008K24CCCATCCATCCACCNONE 
J090047J16CCCATCCATCCACCNONE 
Os04g0459200AK107705CATCCACCConserved hypothetical protein. 
J065167E17CATCCACCNONE 
J080302I04CATCCACCNONE 
Os04g0464200AK103582CATCCACCBetaine-aldehyde dehydrogenase (EC 1.2.1.8) (BADH). 
J033133A13CATCCACCNONE 
J090026I06CATCCACCNONE 
J090096B12CATCCACCNONE 
Os04g0504800006-049-B07CATCCACCNONE 
006-049-C07CATCCACCNONE 
016-073-C01CATCCACCNONE 
AK104208CATCCACCNONE 
AK105555CATCCACCNONE 
Os04g0528800009-025-E06CATCCACCNONE 
009-025-E06CATCCACCNONE 
AK062397CATCCACCNONE 
AK062397CATCCACCNONE 
Os04g0531100013-046-D02CATCCACCNONE 
AF090698CATCCACCNONE 
AK063584CATCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CATCCACCNONE 
J065028L15CATCCACCNONE 
J065048O03CATCCACCNONE 
J065053K10CATCCACCNONE 
J065072H10CATCCACCNONE 
J065081H10CATCCACCNONE 
J065082N17CATCCACCNONE 
J065104K08CATCCACCNONE 
J065106M03CATCCACCNONE 
J065119I05CATCCACCNONE 
J065122F04CATCCACCNONE 
J065140N24CATCCACCNONE 
J065153G09CATCCACCNONE 
J065171H07CATCCACCNONE 
J065172M23CATCCACCNONE 
J065173K13CATCCACCNONE 
J065177D22CATCCACCNONE 
J065189H10CATCCACCNONE 
J065198H24CATCCACCNONE 
J065204D19CATCCACCNONE 
J075006C08CATCCACCNONE 
J075029I08CATCCACCNONE 
J075039A16CATCCACCNONE 
J075107I24CATCCACCNONE 
J075135M22CATCCACCNONE 
J075181P06CATCCACCNONE 
J075190O11CATCCACCNONE 
J075193F04CATCCACCNONE 
Os04g0540600AF464932GGTGGATGNONE 
AK071169GGTGGATGAldehyde dehydrogenase NAD(P)-dependent family protein. 
J023022A08GGTGGATGNONE 
J023127F17GGTGGATGNONE 
J033127K14GGTGGATGNONE 
J075060H15GGTGGATGNONE 
J080063F04GGTGGATGNONE 
J090030C21GGTGGATGNONE 
J090049I06GGTGGATGNONE 
Os04g0545100AK071451GGTGGATGEngulfment and cell motility, ELM domain containing protein. 
Os04g0555700AK069329GGTGGATGGGSimilar to Actin-depolymerizing factor (ADF). 
Os04g0556900015-052-H08CATCCACCNONE 
AK064112CATCCACCConserved hypothetical protein. 
Os04g0588700AK099941CATCCACCABC transporter, transmembrane region domain containing protein. 
Os04g0603800013-090-H10CATCCACCNONE 
AK063616CATCCACCChromo domain containing protein. 
Os04g0623100006-042-D10CATCCACCNONE 
AK067276CATCCACCBromodomain containing protein. 
J013097L22CATCCACCNONE 
J013099L18CATCCACCNONE 
J023009D13CATCCACCNONE 
J023041M21CATCCACCNONE 
J090088H12CATCCACCNONE 
Os04g0649001J065183D15GGTGGATGHypothetical protein. 
Os04g0682300AK061384CATCCACCSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004CATCCACCNONE 
J033102P12CATCCACCNONE 
J100038F01CATCCACCNONE 
Os04g0686000AK108418CATCCACCU box domain containing protein. 
J100024L16CATCCACCNONE 
J100048I03CATCCACCNONE 
J100078H21CATCCACCNONE 
J100085O03CATCCACCNONE 
Os05g0116000AK058320CATCCACCNONE 
AK121775CATCCACC11-S plant seed storage protein family protein. 
J023003L12CATCCACCNONE 
J023025C18CATCCACCNONE 
J023074E20CATCCACCNONE 
J023128H09CATCCACCNONE 
J033092N18CATCCACCNONE 
J065009J09CATCCACCNONE 
J090073L21CATCCACCNONE 
Os05g0156300005-020-F11GGTGGATGNONE 
015-057-E12GGTGGATGNONE 
AK062024GGTGGATGSimilar to Protein disulfide isomerase. 
AK098931GGTGGATGNONE 
AK099341GGTGGATGNONE 
AK103944GGTGGATGNONE 
J013023F18GGTGGATGNONE 
J013119E18GGTGGATGNONE 
J013126C01GGTGGATGNONE 
J023038D10GGTGGATGNONE 
J023050G13GGTGGATGNONE 
J023127B09GGTGGATGNONE 
J033024A21GGTGGATGNONE 
J033028P21GGTGGATGNONE 
J033069P15GGTGGATGNONE 
J033071G02GGTGGATGNONE 
J033131K18GGTGGATGNONE 
J043003O08GGTGGATGNONE 
J043022B22GGTGGATGNONE 
J043040I07GGTGGATGNONE 
J065138D03GGTGGATGNONE 
J080001J11GGTGGATGNONE 
J080024C03GGTGGATGNONE 
J080034N06GGTGGATGNONE 
J090002C19GGTGGATGNONE 
J090044G14GGTGGATGNONE 
J090071H19GGTGGATGNONE 
J090077M11GGTGGATGNONE 
J090085I16GGTGGATGNONE 
J100042O18GGTGGATGNONE 
Os05g0181700J065042G21CATCCACCNONE 
J065051L21CATCCACCNONE 
J065051L22CATCCACCNONE 
Os05g0226300AK067770CATCCACCConserved hypothetical protein. 
J013120H22CATCCACCNONE 
J013146E15CATCCACCNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0267100009-106-H07CATCCACCNONE 
009-177-H02CATCCACCNONE 
AK062790CATCCACCNONE 
AK065811CATCCACCNONE 
J013026N17CATCCACCNONE 
J013039F07CATCCACCNONE 
Os05g0335800AK108393GGTGGATGTGF-beta receptor, type I/II extracellular region family protein. 
Os05g0344200006-022-E04CATCCCCCCATCCACCNONE 
006-080-D01CATCCCCCCATCCACCNONE 
009-021-D03CATCCCCCCATCCACCNONE 
009-026-A10CATCCCCCCATCCACCNONE 
009-054-B12CATCCCCCCATCCACCNONE 
009-059-H03CATCCCCCCATCCACCNONE 
009-077-C02CATCCCCCCATCCACCNONE 
009-095-H12CATCCCCCCATCCACCNONE 
009-106-B08CATCCCCCCATCCACCNONE 
009-138-D10CATCCCCCCATCCACCNONE 
009-140-G06CATCCCCCCATCCACCNONE 
009-146-E09CATCCCCCCATCCACCNONE 
009-161-F04CATCCCCCCATCCACCNONE 
009-176-F05CATCCCCCCATCCACCNONE 
013-047-C03CATCCCCCCATCCACCNONE 
013-052-E07CATCCCCCCATCCACCNONE 
013-054-G04CATCCCCCCATCCACCNONE 
013-095-D10CATCCCCCCATCCACCNONE 
014-003-D06CATCCCCCCATCCACCNONE 
014-020-C09CATCCCCCCATCCACCNONE 
014-043-E01CATCCCCCCATCCACCNONE 
014-080-G09CATCCCCCCATCCACCNONE 
014-081-H05CATCCCCCCATCCACCNONE 
AK060058CATCCCCCCATCCACCConserved hypothetical protein. 
AK098850CATCCCCCCATCCACCNONE 
AK104716CATCCCCCCATCCACCNONE 
AK119727CATCCCCCCATCCACCNONE 
J013000G04CATCCCCCCATCCACCNONE 
J013155L11CATCCCCCCATCCACCNONE 
J033138J22CATCCCCCCATCCACCNONE 
J065112E22CATCCCCCCATCCACCNONE 
J065124M06CATCCCCCCATCCACCNONE 
J065130M01CATCCCCCCATCCACCNONE 
J065137I03CATCCCCCCATCCACCNONE 
J065157O12CATCCCCCCATCCACCNONE 
J065171B12CATCCCCCCATCCACCNONE 
J075003O16CATCCCCCCATCCACCNONE 
J075026G12CATCCCCCCATCCACCNONE 
J075032K07CATCCCCCCATCCACCNONE 
J075070I11CATCCCCCCATCCACCNONE 
J075093K06CATCCCCCCATCCACCNONE 
J075148C12CATCCCCCCATCCACCNONE 
J075148L08CATCCCCCCATCCACCNONE 
J075152G13CATCCCCCCATCCACCNONE 
J075177G07CATCCCCCCATCCACCNONE 
J100026I09CATCCCCCCATCCACCNONE 
J100083L11CATCCCCCCATCCACCNONE 
J100086F04CATCCCCCCATCCACCNONE 
Os05g0363100AK073358CATCCACCAlpha/beta hydrolase family protein. 
AK073379CATCCACCNONE 
J100047H18CATCCACCNONE 
J100059D03CATCCACCNONE 
Os05g0381400014-036-H12CCCATCCACCCACACGTGTCNONE 
014-085-H12CCCATCCACCCACACGTGTCNONE 
AK102039CCCATCCACCCACACGTGTCSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CCCATCCACCCACACGTGTCNONE 
J075057P04CCCATCCACCCACACGTGTCNONE 
J075066K19CCCATCCACCCACACGTGTCNONE 
J075068L13CCCATCCACCCACACGTGTCNONE 
J075074J21CCCATCCACCCACACGTGTCNONE 
J075076N10CCCATCCACCCACACGTGTCNONE 
J075078L14CCCATCCACCCACACGTGTCNONE 
J075099O16CCCATCCACCCACACGTGTCNONE 
J075120C05CCCATCCACCCACACGTGTCNONE 
J075140I24CCCATCCACCCACACGTGTCNONE 
J075148F21CCCATCCACCCACACGTGTCNONE 
J075151F01CCCATCCACCCACACGTGTCNONE 
J075151I10CCCATCCACCCACACGTGTCNONE 
J075156M15CCCATCCACCCACACGTGTCNONE 
J075191F07CCCATCCACCCACACGTGTCNONE 
J075192K20CCCATCCACCCACACGTGTCNONE 
J075195M22CCCATCCACCCACACGTGTCNONE 
Os05g0399700AB012855CATCCACCNONE 
AB018248CATCCACCNONE 
AB096139CATCCACCNONE 
AK071196CATCCACCChitinase (EC 3.2.1.14). 
J023012C04CATCCACCNONE 
J023086B11CATCCACCNONE 
J023143A20CATCCACCNONE 
J080040G15CATCCACCNONE 
J080306P19CATCCACCNONE 
J080307K24CATCCACCNONE 
J090040G17CATCCACCNONE 
J090047J17CATCCACCNONE 
J090075E21CATCCACCNONE 
J090088L05CATCCACCNONE 
Os05g0401100009-037-F05CCCATCCACCNONE 
009-147-G03CCCATCCACCNONE 
AK058790CCCATCCACCNONE 
AK067179CCCATCCACCProtein of unknown function DUF477 family protein. 
Os05g0422900AK073629CATCCACCConserved hypothetical protein. 
J023126I07CATCCACCNONE 
J023143K12CATCCACCNONE 
J033051N08CATCCACCNONE 
J033128I04CATCCACCNONE 
J065067M02CATCCACCNONE 
J080312N05CATCCACCNONE 
J100032G23CATCCACCNONE 
Os05g0502800016-060-H05CCCATCCACCGGCCCGCANONE 
AK064242CCCATCCACCGGCCCGCANONE 
AK065486CCCATCCACCGGCCCGCANAF1 domain containing protein. 
Os05g0541200AK068633GGTGGATGConserved hypothetical protein 730 family protein. 
J013157L23GGTGGATGNONE 
Os05g0573900J080085J19CATCCACCConserved hypothetical protein. 
Os05g0581700AK108181CATCCACCConserved hypothetical protein. 
Os05g0594100006-034-F04GGTGGATGNONE 
006-061-A02GGTGGATGNONE 
009-081-E02GGTGGATGNONE 
AK060122GGTGGATGNONE 
AK106130GGTGGATGSimilar to GDA2 protein. 
J023010C07GGTGGATGNONE 
J023098J20GGTGGATGNONE 
J023117G22GGTGGATGNONE 
J023127J08GGTGGATGNONE 
J033117G03GGTGGATGNONE 
J033124I03GGTGGATGNONE 
J043015K15GGTGGATGNONE 
Os06g0128300AK064342GGTGGATGNONE 
AK072699GGTGGATGSimilar to Mitochondrial half-ABC transporter. 
Os06g0134800014-049-H04CATCCACCNONE 
AK063692CATCCACCGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0149700AF073698CATCCACCCysteine synthase (EC 4.2.99.8). 
J100022K21CATCCACCNONE 
J100046J06CATCCACCNONE 
Os06g0192500AK059545GGTGGATGNONE 
Os06g0219600AK060429CATCCACCATCCAACGSimilar to Poly(A)-binding protein II-like. 
AK099019CATCCACCATCCAACGNONE 
J013118A14CATCCACCATCCAACGNONE 
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein. 
Os06g0258000AK107483CATCCACCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0286228AK069113CATCCACCCupredoxin domain containing protein. 
Os06g0299300AK060501CATCCACCGlucose/ribitol dehydrogenase family protein. 
AK067625CATCCACCNONE 
Os06g0304600006-119-E03GGTGGATGNONE 
AK060352GGTGGATGPeptidase A1, pepsin family protein. 
AK102614GGTGGATGNONE 
AK120604GGTGGATGNONE 
Os06g0502900AK103578CATCCACCConserved hypothetical protein. 
AK120599CATCCACCNONE 
J033132P14CATCCACCNONE 
Os06g0515400AK071571CATCCACCConserved hypothetical protein. 
Os06g0683400009-047-C07CATCCACCNONE 
009-060-B06CATCCACCNONE 
013-057-F12CATCCACCNONE 
AK111852CATCCACCNONE 
AK111897CATCCACCNONE 
AK112082CATCCACCSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CATCCACCNONE 
J065187J11CATCCACCNONE 
J065197L08CATCCACCNONE 
J100045K14CATCCACCNONE 
J100074M08CATCCACCNONE 
J100088H21CATCCACCNONE 
Os06g0683900011-042-B09GGTGGATGNONE 
011-042-F07GGTGGATGNONE 
015-047-H05GGTGGATGNONE 
016-011-D06GGTGGATGNONE 
AK063941GGTGGATGConserved hypothetical protein. 
AK102096GGTGGATGNONE 
J090059F01GGTGGATGNONE 
Os06g0684000AK102878CATCCACCAACSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os07g0106000015-044-D09GGTGGATGNONE 
AK064319GGTGGATGNONE 
Os07g0155200006-036-E03CATCCACCNONE 
006-036-E04CATCCACCNONE 
AK061006CATCCACCProtein of unknown function DUF150 family protein. 
AK104606CATCCACCNONE 
Os07g0181500AK072431CATCCACCProtein of unknown function DUF506, plant family protein. 
Os07g0224000009-060-E01CATCCACCNONE 
J065042D20CATCCACCNONE 
J065127D14CATCCACCNONE 
J065176C24CATCCACCNONE 
J065188M12CATCCACCNONE 
J065194L14CATCCACCNONE 
J075060P09CATCCACCNONE 
J075134C14CATCCACCRibosomal protein L24E family protein. 
J075192M12CATCCACCNONE 
J100032N01CATCCACCNONE 
Os07g0243200AK121036GGTGGATGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272GGTGGATGNONE 
Os07g0262200AK071615AGCCGTCCATCCACCATCCAACGSimilar to Prohibitin. 
AK104133AGCCGTCCATCCACCATCCAACGNONE 
Os07g0432800012-025-C05CATCCACCNONE 
AK063456CATCCACCMyb, DNA-binding domain containing protein. 
J053025J09CATCCACCNONE 
J053052K16CATCCACCNONE 
J053060G01CATCCACCNONE 
J053096H11CATCCACCNONE 
J075033O13CATCCACCNONE 
Os07g0474300AK108961CATCCACCConserved hypothetical protein. 
Os07g0486500AK063998CATCCACCRho GTPase activation protein domain containing protein. 
AK068175CATCCACCNONE 
J013130L24CATCCACCNONE 
J013156J03CATCCACCNONE 
J033031L21CATCCACCNONE 
J043001A20CATCCACCNONE 
J043007B17CATCCACCNONE 
J043017M19CATCCACCNONE 
J043024H09CATCCACCNONE 
J043030B12CATCCACCNONE 
J065177C18CATCCACCNONE 
J075004K10CATCCACCNONE 
J075004K12CATCCACCNONE 
J075088G07CATCCACCNONE 
J075107M02CATCCACCNONE 
J075126G01CATCCACCNONE 
J075185J08CATCCACCNONE 
J100034E04CATCCACCNONE 
J100038G12CATCCACCNONE 
Os07g0558400003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0575600AK101924CATCCACCSimilar to Lectin-like receptor kinase 7;2. 
AK110940CATCCACCNONE 
J033071P06CATCCACCNONE 
J075026A14CATCCACCNONE 
J075126D06CATCCACCNONE 
Os07g0606500AK068811CATCCACCNONE 
AK121873CATCCACCNONE 
J013159C05CATCCACCNONE 
J075158B14CATCCACCNONE 
Os07g0622200AB122058CCCATCCACCAACNONE 
AK069968CCCATCCACCAACNONE 
AK105687CCCATCCACCAACSimilar to M-160-u1_1 (Fragment). 
J075095A10CCCATCCACCAACNONE 
Os07g0658400AK120896CATCCACCNONE 
Os07g0661400006-083-E05CATCCACCNONE 
006-084-B12CATCCACCNONE 
006-096-B03CATCCACCNONE 
009-013-C12CATCCACCNONE 
009-017-C10CATCCACCNONE 
009-027-A02CATCCACCNONE 
009-035-A06CATCCACCNONE 
009-047-H11CATCCACCNONE 
009-050-B11CATCCACCNONE 
009-051-C02CATCCACCNONE 
009-089-G06CATCCACCNONE 
009-091-C05CATCCACCNONE 
009-095-B11CATCCACCNONE 
009-151-C01CATCCACCNONE 
009-154-F06CATCCACCNONE 
009-169-F02CATCCACCNONE 
009-171-G01CATCCACCNONE 
009-179-F07CATCCACCNONE 
013-018-H06CATCCACCNONE 
013-024-E05CATCCACCNONE 
013-038-F09CATCCACCNONE 
013-099-F06CATCCACCNONE 
014-042-E09CATCCACCNONE 
014-086-C02CATCCACCNONE 
014-093-B08CATCCACCNONE 
015-039-G11CATCCACCNONE 
016-036-E05CATCCACCNONE 
AK068814CATCCACCNONE 
AK102682CATCCACCNONE 
AK105973CATCCACCNONE 
AK107202CATCCACCConserved hypothetical protein. 
J053035N21CATCCACCNONE 
J053099D11CATCCACCNONE 
J065023B18CATCCACCNONE 
J065031M15CATCCACCNONE 
J065035G23CATCCACCNONE 
J065060M18CATCCACCNONE 
J065073J18CATCCACCNONE 
J065103E20CATCCACCNONE 
J065105N19CATCCACCNONE 
J065137A08CATCCACCNONE 
J065152K09CATCCACCNONE 
J065156M12CATCCACCNONE 
J065162G23CATCCACCNONE 
J065162L13CATCCACCNONE 
J065163H16CATCCACCNONE 
J065165E06CATCCACCNONE 
J065171J04CATCCACCNONE 
J065180L23CATCCACCNONE 
J065183K23CATCCACCNONE 
J065186H13CATCCACCNONE 
J065195D10CATCCACCNONE 
J065209G11CATCCACCNONE 
J075006J08CATCCACCNONE 
J075112O07CATCCACCNONE 
J080301H14CATCCACCNONE 
J100058C17CATCCACCNONE 
J100077I23CATCCACCNONE 
J100080I24CATCCACCNONE 
Os07g0679700AK101356CATCCACCTranscriptional factor B3 family protein. 
Os07g0685800AK064532CATCCACCGlucose/ribitol dehydrogenase family protein. 
Os08g0138500AK102951GGTGGGCCCCACCTGTCATCCACCSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GGTGGGCCCCACCTGTCATCCACCNONE 
J033115D14GGTGGGCCCCACCTGTCATCCACCNONE 
J065013F04GGTGGGCCCCACCTGTCATCCACCNONE 
J065050P11GGTGGGCCCCACCTGTCATCCACCNONE 
J065063K18GGTGGGCCCCACCTGTCATCCACCNONE 
J090054H10GGTGGGCCCCACCTGTCATCCACCNONE 
J100083F11GGTGGGCCCCACCTGTCATCCACCNONE 
Os08g0157600AK104073CATCCACCNONE 
AK121547CATCCACCNONE 
J033032F11CATCCACCNONE 
Os08g0175200AK072367GGACCCACCCCATCCACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16GGACCCACCCCATCCACCNONE 
J023075K04GGACCCACCCCATCCACCNONE 
J023082L15GGACCCACCCCATCCACCNONE 
J043015G07GGACCCACCCCATCCACCNONE 
J065052L17GGACCCACCCCATCCACCNONE 
J065202P07GGACCCACCCCATCCACCNONE 
J075061D17GGACCCACCCCATCCACCNONE 
J100088P13GGACCCACCCCATCCACCNONE 
Os08g0200300005-007-C01CCCATCCACCNONE 
009-041-H05CCCATCCACCNONE 
009-055-G10CCCATCCACCNONE 
009-101-E05CCCATCCACCNONE 
009-110-H11CCCATCCACCNONE 
009-114-D06CCCATCCACCNONE 
009-116-B08CCCATCCACCNONE 
009-117-G06CCCATCCACCNONE 
009-125-H04CCCATCCACCNONE 
009-131-H10CCCATCCACCNONE 
009-136-F02CCCATCCACCNONE 
009-144-C04CCCATCCACCNONE 
009-149-E10CCCATCCACCNONE 
009-166-E04CCCATCCACCNONE 
009-189-G08CCCATCCACCNONE 
AK105055CCCATCCACCNONE 
AK121083CCCATCCACCSimilar to Photosystem II 10 kDa polypeptide (Fragment). 
J013051F20CCCATCCACCNONE 
J013060E15CCCATCCACCNONE 
J013070F24CCCATCCACCNONE 
J013071K15CCCATCCACCNONE 
J013091E11CCCATCCACCNONE 
J013134L03CCCATCCACCNONE 
J023063I15CCCATCCACCNONE 
J023084E22CCCATCCACCNONE 
J023084J06CCCATCCACCNONE 
J033090D12CCCATCCACCNONE 
J065001D08CCCATCCACCNONE 
J065007K04CCCATCCACCNONE 
J065040H06CCCATCCACCNONE 
J065078N14CCCATCCACCNONE 
J065093B19CCCATCCACCNONE 
J065103D10CCCATCCACCNONE 
J065107E16CCCATCCACCNONE 
J065116E01CCCATCCACCNONE 
J065129B10CCCATCCACCNONE 
J065132F08CCCATCCACCNONE 
J065135M15CCCATCCACCNONE 
J065149C13CCCATCCACCNONE 
J065155H23CCCATCCACCNONE 
J065162P16CCCATCCACCNONE 
J065169P09CCCATCCACCNONE 
J065176B09CCCATCCACCNONE 
J065187F07CCCATCCACCNONE 
J065194H08CCCATCCACCNONE 
J065197G22CCCATCCACCNONE 
J065208D12CCCATCCACCNONE 
J065210B17CCCATCCACCNONE 
J065219D24CCCATCCACCNONE 
J075009C14CCCATCCACCNONE 
J075009O22CCCATCCACCNONE 
J075012J06CCCATCCACCNONE 
J075014G03CCCATCCACCNONE 
J075015A03CCCATCCACCNONE 
J075022B09CCCATCCACCNONE 
J075023H11CCCATCCACCNONE 
J075025J07CCCATCCACCNONE 
J075026K15CCCATCCACCNONE 
J075029D06CCCATCCACCNONE 
J075038G19CCCATCCACCNONE 
J075041N03CCCATCCACCNONE 
J075048P22CCCATCCACCNONE 
J075051J23CCCATCCACCNONE 
J075051L15CCCATCCACCNONE 
J075052P04CCCATCCACCNONE 
J075058O21CCCATCCACCNONE 
J075062E03CCCATCCACCNONE 
J075063K18CCCATCCACCNONE 
J075064K01CCCATCCACCNONE 
J075067B03CCCATCCACCNONE 
J075070I20CCCATCCACCNONE 
J075071J04CCCATCCACCNONE 
J075074F17CCCATCCACCNONE 
J075076H02CCCATCCACCNONE 
J075080E17CCCATCCACCNONE 
J075081F04CCCATCCACCNONE 
J075086K17CCCATCCACCNONE 
J075090I07CCCATCCACCNONE 
J075092F21CCCATCCACCNONE 
J075096P11CCCATCCACCNONE 
J075099K15CCCATCCACCNONE 
J075102M12CCCATCCACCNONE 
J075105B03CCCATCCACCNONE 
J075110I07CCCATCCACCNONE 
J075111C15CCCATCCACCNONE 
J075111M09CCCATCCACCNONE 
J075114I06CCCATCCACCNONE 
J075115E15CCCATCCACCNONE 
J075123K17CCCATCCACCNONE 
J075125B03CCCATCCACCNONE 
J075126A12CCCATCCACCNONE 
J075129L20CCCATCCACCNONE 
J075130B11CCCATCCACCNONE 
J075137J12CCCATCCACCNONE 
J075141G10CCCATCCACCNONE 
J075141I06CCCATCCACCNONE 
J075143A22CCCATCCACCNONE 
J075148E07CCCATCCACCNONE 
J075158D09CCCATCCACCNONE 
J075168G18CCCATCCACCNONE 
J075169K08CCCATCCACCNONE 
J075170A10CCCATCCACCNONE 
J075170E18CCCATCCACCNONE 
J075179C15CCCATCCACCNONE 
J075180L24CCCATCCACCNONE 
J075181A22CCCATCCACCNONE 
J075185C20CCCATCCACCNONE 
J075191B07CCCATCCACCNONE 
J075192D03CCCATCCACCNONE 
J075192L04CCCATCCACCNONE 
J075193G10CCCATCCACCNONE 
J075193M18CCCATCCACCNONE 
J075198F05CCCATCCACCNONE 
J080001F14CCCATCCACCNONE 
J080001J20CCCATCCACCNONE 
J080002N10CCCATCCACCNONE 
J080003I15CCCATCCACCNONE 
J080004H05CCCATCCACCNONE 
J080006J08CCCATCCACCNONE 
J080007D08CCCATCCACCNONE 
J080008B21CCCATCCACCNONE 
J080009P16CCCATCCACCNONE 
J080010F24CCCATCCACCNONE 
J080011F18CCCATCCACCNONE 
J080012J03CCCATCCACCNONE 
J080013B21CCCATCCACCNONE 
J080013N24CCCATCCACCNONE 
J080017D22CCCATCCACCNONE 
J080017E04CCCATCCACCNONE 
J080018G06CCCATCCACCNONE 
J080020M24CCCATCCACCNONE 
J080021C22CCCATCCACCNONE 
J080021E21CCCATCCACCNONE 
J080021G12CCCATCCACCNONE 
J080021N20CCCATCCACCNONE 
J080022B02CCCATCCACCNONE 
J080022D19CCCATCCACCNONE 
J080024J07CCCATCCACCNONE 
J080026M20CCCATCCACCNONE 
J080028D11CCCATCCACCNONE 
J080029E08CCCATCCACCNONE 
J080030F06CCCATCCACCNONE 
J080030J09CCCATCCACCNONE 
J080032F19CCCATCCACCNONE 
J080032L09CCCATCCACCNONE 
J080032O15CCCATCCACCNONE 
J080034J07CCCATCCACCNONE 
J080035A04CCCATCCACCNONE 
J080035A12CCCATCCACCNONE 
J080037P21CCCATCCACCNONE 
J080040F18CCCATCCACCNONE 
J080040N13CCCATCCACCNONE 
J080040P12CCCATCCACCNONE 
J080041E09CCCATCCACCNONE 
J080044A04CCCATCCACCNONE 
J080044F21CCCATCCACCNONE 
J080044P20CCCATCCACCNONE 
J080045N06CCCATCCACCNONE 
J080046H12CCCATCCACCNONE 
J080047A12CCCATCCACCNONE 
J080047O03CCCATCCACCNONE 
J080047O20CCCATCCACCNONE 
J080048G24CCCATCCACCNONE 
J080049H08CCCATCCACCNONE 
J080050G23CCCATCCACCNONE 
J080050P05CCCATCCACCNONE 
J080052J24CCCATCCACCNONE 
J080056N20CCCATCCACCNONE 
J080056O04CCCATCCACCNONE 
J080058D10CCCATCCACCNONE 
J080058G13CCCATCCACCNONE 
J080059H10CCCATCCACCNONE 
J080062G11CCCATCCACCNONE 
J080064A12CCCATCCACCNONE 
J080064E18CCCATCCACCNONE 
J080064O19CCCATCCACCNONE 
J080065F09CCCATCCACCNONE 
J080065P22CCCATCCACCNONE 
J080067A17CCCATCCACCNONE 
J080067E09CCCATCCACCNONE 
J080069M22CCCATCCACCNONE 
J080070E21CCCATCCACCNONE 
J080070K18CCCATCCACCNONE 
J080071L21CCCATCCACCNONE 
J080071P04CCCATCCACCNONE 
J080072M02CCCATCCACCNONE 
J080075K15CCCATCCACCNONE 
J080075K19CCCATCCACCNONE 
J080076L03CCCATCCACCNONE 
J080079L23CCCATCCACCNONE 
J080080O08CCCATCCACCNONE 
J080081H06CCCATCCACCNONE 
J080082L22CCCATCCACCNONE 
J080083N23CCCATCCACCNONE 
J080084J09CCCATCCACCNONE 
J080085B01CCCATCCACCNONE 
J080087M23CCCATCCACCNONE 
J080088P08CCCATCCACCNONE 
J080090A20CCCATCCACCNONE 
J080092J18CCCATCCACCNONE 
J080095G03CCCATCCACCNONE 
J080097C14CCCATCCACCNONE 
J080097P20CCCATCCACCNONE 
J080301E13CCCATCCACCNONE 
J080301G11CCCATCCACCNONE 
J080301I11CCCATCCACCNONE 
J080301O21CCCATCCACCNONE 
J080302L09CCCATCCACCNONE 
J080303E17CCCATCCACCNONE 
J080304C05CCCATCCACCNONE 
J080305E22CCCATCCACCNONE 
J080305F22CCCATCCACCNONE 
J080307B14CCCATCCACCNONE 
J080310B22CCCATCCACCNONE 
J080310J02CCCATCCACCNONE 
J080312N01CCCATCCACCNONE 
J080313I10CCCATCCACCNONE 
J080315K16CCCATCCACCNONE 
J080317B08CCCATCCACCNONE 
J080317H10CCCATCCACCNONE 
J080317M14CCCATCCACCNONE 
J080317P17CCCATCCACCNONE 
J080319M22CCCATCCACCNONE 
J090052E23CCCATCCACCNONE 
J090071I04CCCATCCACCNONE 
J100045L08CCCATCCACCNONE 
J100068N19CCCATCCACCNONE 
U86018CCCATCCACCNONE 
Os08g0202300J065042E23CATCCACCNONE 
J065111M06CATCCACCNONE 
Os08g0243500AK068915CCCATCCACCSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CCCATCCACCNONE 
Os08g0327501J065211N12CATCCACCConserved hypothetical protein. 
Os08g0420700Os08g0420700CATCCACCConserved hypothetical protein. 
Os08g0484200J075096L14CATCCACCZinc finger, RING-type domain containing protein. 
Os08g0497300AK068384CATCCACCNONE 
AK070235CATCCACCCellular retinaldehyde binding/alpha-tocopherol transport family protein. 
Os08g0502400AK106964CATCCACCBeta-Ig-H3/fasciclin domain containing protein. 
Os08g0556900AK072235CATCCACCSimilar to Cysteine proteinase (EC 3.4.22.-). 
AK099308CATCCACCNONE 
AK105612CATCCACCNONE 
J100051D13CATCCACCNONE 
Os08g0560900AK120366CATCCACCNONE 
Os08g0562500AK109443CATCCACCTransferase family protein. 
Os09g0115400AK067816CATCCACCNONE 
AK101706CATCCACCSimilar to Poly(A)-binding protein. 
Os09g0122500J065067B01CATCCACCNONE 
J065113L16CATCCACCHypothetical protein. 
Os09g0243200AK107718CATCCACCZinc finger, RING-type domain containing protein. 
Os09g0244200AK065536CATCCACCConserved hypothetical protein. 
Os09g0269900AK064489CATCCACCConserved hypothetical protein. 
Os09g0418000006-022-F01CATCCACCNONE 
006-038-G10CATCCACCNONE 
006-089-G04CATCCACCNONE 
006-098-F07CATCCACCNONE 
AK061220CATCCACCNONE 
AK061493CATCCACCNONE 
AK100881CATCCACCNONE 
AK119760CATCCACCProtein kinase-like domain containing protein. 
J023127H10CATCCACCNONE 
J033122J01CATCCACCNONE 
J065162D08CATCCACCNONE 
J065214P03CATCCACCNONE 
J090009B17CATCCACCNONE 
J090093C21CATCCACCNONE 
J100067C01CATCCACCNONE 
J100067P06CATCCACCNONE 
Os09g0421500AK059873CATCCACCConserved hypothetical protein. 
AK070023CATCCACCNONE 
J043016F04CATCCACCNONE 
J065007A11CATCCACCNONE 
J065017L24CATCCACCNONE 
J065028D23CATCCACCNONE 
J065092B17CATCCACCNONE 
J065134M11CATCCACCNONE 
J080001P16CATCCACCNONE 
J080081O05CATCCACCNONE 
Os09g0493800011-053-H02CATCCACCNONE 
015-024-E10CATCCACCNONE 
AK103057CATCCACCSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
AK105408CATCCACCNONE 
J033117K03CATCCACCNONE 
J065135F16CATCCACCNONE 
J065140A21CATCCACCNONE 
J075018O14CATCCACCNONE 
J075033C15CATCCACCNONE 
Os09g0526700011-075-B12CATCCACCNONE 
AB097460CATCCACCNONE 
AK073610CATCCACCSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977CATCCACCNONE 
Os09g0542600006-033-D09CATCCACCNONE 
AK060109CATCCACCSimilar to RING-H2 finger protein ATL1I. 
Os11g0112100J075033D01GGTGGATGNONE 
J075074L17GGTGGATGHypothetical protein. 
J075120E08GGTGGATGNONE 
Os11g0148500005-005-G04CATCCACCNONE 
AK061668CATCCACCPyruvate kinase family protein. 
AK099650CATCCACCNONE 
J013035J10CATCCACCNONE 
J013059F21CATCCACCNONE 
J013099E15CATCCACCNONE 
J013118D18CATCCACCNONE 
J013124P19CATCCACCNONE 
J013151I15CATCCACCNONE 
J023048B15CATCCACCNONE 
J023061L08CATCCACCNONE 
J023065D18CATCCACCNONE 
J023085D10CATCCACCNONE 
J023105B08CATCCACCNONE 
J023109A06CATCCACCNONE 
J023111F01CATCCACCNONE 
J023113P06CATCCACCNONE 
J023127I11CATCCACCNONE 
J023147E17CATCCACCNONE 
J033027C14CATCCACCNONE 
J033028A04CATCCACCNONE 
J033029O22CATCCACCNONE 
J033030C12CATCCACCNONE 
J033031C08CATCCACCNONE 
J033035C23CATCCACCNONE 
J033035M20CATCCACCNONE 
J033038A07CATCCACCNONE 
J033044M24CATCCACCNONE 
J033058H23CATCCACCNONE 
J033061K10CATCCACCNONE 
J033065L04CATCCACCNONE 
J033068L22CATCCACCNONE 
J033075L04CATCCACCNONE 
J033079H06CATCCACCNONE 
J033091F08CATCCACCNONE 
J033092P07CATCCACCNONE 
J033095F02CATCCACCNONE 
J033095M11CATCCACCNONE 
J033096H17CATCCACCNONE 
J033105M05CATCCACCNONE 
J033106F19CATCCACCNONE 
J033112P11CATCCACCNONE 
J033125M09CATCCACCNONE 
J033128J07CATCCACCNONE 
J033136F08CATCCACCNONE 
J043001M03CATCCACCNONE 
J043020H18CATCCACCNONE 
J043020N20CATCCACCNONE 
J053029O10CATCCACCNONE 
J053037C05CATCCACCNONE 
J053039P08CATCCACCNONE 
J053043K16CATCCACCNONE 
J053053I05CATCCACCNONE 
J053069P20CATCCACCNONE 
J053079K22CATCCACCNONE 
J053089D01CATCCACCNONE 
J053094B15CATCCACCNONE 
J053094E04CATCCACCNONE 
J090014L04CATCCACCNONE 
J090029H02CATCCACCNONE 
J090036O22CATCCACCNONE 
J090048B20CATCCACCNONE 
J090054C04CATCCACCNONE 
J090090O18CATCCACCNONE 
J090091H14CATCCACCNONE 
J100034D15CATCCACCNONE 
J100060E03CATCCACCNONE 
J100083K16CATCCACCNONE 
Os11g0157400AK066482CATCCACCExo70 exocyst complex subunit family protein. 
Os11g0189600AK068026GGTGGATGSimilar to Cycloartenol synthase. 
Os11g0210500AK070886CATCCACCNONE 
J023069O03CATCCACCNONE 
J100038M22CATCCACCNONE 
J100066M06CATCCACCNONE 
Os11g0285000AK070534GGTGGATGSimilar to Beta-amyrin synthase. 
Os11g0306400006-029-H06CATCCACCNONE 
006-032-A12CATCCACCNONE 
006-118-E06CATCCACCNONE 
AK059770CATCCACCNONE 
AK106179CATCCACCSimilar to Herbicide safener binding protein. 
J043020J23CATCCACCNONE 
Os11g0429000AK067370CCCATCCACCConserved hypothetical protein. 
Os11g0572100AB109200CATCCACCNONE 
AK070564CATCCACCSimilar to DNA ligase (EC 6.5.1.2). 
AK101875CATCCACCNONE 
Os11g0606200AK109636GGTGGATGNONE 
Os12g0141100AK100364CATCCACCNONE 
AK102875CATCCACCPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os12g0145700AK071391CATCCACCPyruvate kinase family protein. 
J023013N02CATCCACCNONE 
J033085D15CATCCACCNONE 
J043021I09CATCCACCNONE 
J100055L05CATCCACCNONE 
Os12g0151500AK058389CATCCACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CATCCACCNONE 
Os12g0180100AK058227GGTGGATGGGCNONE 
Os12g0264800006-098-D10CATCCACCCACTCTNONE 
AK061213CATCCACCCACTCTConserved hypothetical protein. 
Os12g0267200AK069115GGTGGATGCyclopropane-fatty-acyl-phospholipid synthase domain containing protein. 
Os12g0278800003-004-E01CATCCACCNONE 
AK111498CATCCACCNONE 
AK111962CATCCACCNONE 
AK121774CATCCACCSimilar to Zinc finger CCCH type domain containing protein ZFN-like 1. Splice isoform 3. 
J013000H23CATCCACCNONE 
J033034P15CATCCACCNONE 
J033064D07CATCCACCNONE 
J033089C02CATCCACCNONE 
J033092M18CATCCACCNONE 
J033097M16CATCCACCNONE 
J043001K06CATCCACCNONE 
J090083L17CATCCACCNONE 
J100090M02CATCCACCNONE 
Os12g0285600AK069104CATCCACCOxysterol-binding protein family protein. 
AK069104CATCCACCOxysterol-binding protein family protein. 
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein. 
J013158L10ACCGGCCCATCCACCCACTTGNONE 
J065083J02ACCGGCCCATCCACCCACTTGNONE 
J075079D02ACCGGCCCATCCACCCACTTGNONE 
J100037H16ACCGGCCCATCCACCCACTTGNONE 
J100075P13ACCGGCCCATCCACCCACTTGNONE 
Os12g0573200AK111522CATCCACCNONE 
AK121943CATCCACCGRAS transcription factor domain containing protein. 
J013002M11CATCCACCNONE 
J013151M11CATCCACCNONE 
J013159J22CATCCACCNONE 
J023087F18CATCCACCNONE 
J033107F03CATCCACCNONE 
J033125L09CATCCACCNONE 
J033126E12CATCCACCNONE 
J043022I15CATCCACCNONE 
J065176F05CATCCACCNONE 
J090034D17CATCCACCNONE 
J090075J06CATCCACCNONE 
J100058D22CATCCACCNONE 
J100058P04CATCCACCNONE 
Os12g0613500009-028-C05CATCCACCCATCCACCNONE 
011-081-E10CATCCACCCATCCACCNONE 
AB118018CATCCACCCATCCACCNONE 
AK058205CATCCACCCATCCACCNONE 
AK101273CATCCACCCATCCACCLissencephaly type-1-like homology motif domain containing protein. 
J033033A11CATCCACCCATCCACCNONE 
Os12g0633301AK100870GGTGGATGConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.