version

Summary of OsREG516 (All List)

OrganismOryza sativa  
IDOsREG516  
SequenceCATCCCCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1063  

Entry Sequences (1063 entries)

LocusGene modelSequenceDescription
Os01g0272600015-046-G06CATCCCCCNONE 
AK067786CATCCCCCConserved hypothetical protein. 
Os01g0331900013-026-D04TGGGGGATGNONE 
AK064784TGGGGGATGNONE 
AK121761TGGGGGATGProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15TGGGGGATGNONE 
J033090D07TGGGGGATGNONE 
J090006L21TGGGGGATGNONE 
Os01g0363600014-029-H08CATCCCCCANONE 
AK063667CATCCCCCAConserved hypothetical protein. 
Os01g0369000AK064940CATCCCCCSimilar to Cullin-1. 
AK104340CATCCCCCNONE 
AY336990CATCCCCCNONE 
J013000P07CATCCCCCNONE 
J013056B18CATCCCCCNONE 
J013056B20CATCCCCCNONE 
J013098C09CATCCCCCNONE 
J013099E23CATCCCCCNONE 
J023007E10CATCCCCCNONE 
J023064L04CATCCCCCNONE 
J023119B15CATCCCCCNONE 
J023126O19CATCCCCCNONE 
J033120G16CATCCCCCNONE 
J043007K19CATCCCCCNONE 
J065037I22CATCCCCCNONE 
J065051D18CATCCCCCNONE 
J065073N09CATCCCCCNONE 
J065084K20CATCCCCCNONE 
J065115C15CATCCCCCNONE 
J065115M01CATCCCCCNONE 
J065121O10CATCCCCCNONE 
J065197H21CATCCCCCNONE 
J065211L23CATCCCCCNONE 
J065214M19CATCCCCCNONE 
J090006F13CATCCCCCNONE 
J090012M21CATCCCCCNONE 
J090029M05CATCCCCCNONE 
J090048P16CATCCCCCNONE 
J090051H13CATCCCCCNONE 
J090062C14CATCCCCCNONE 
J090072F21CATCCCCCNONE 
J090085D11CATCCCCCNONE 
J090090N24CATCCCCCNONE 
J090095K17CATCCCCCNONE 
J090099H12CATCCCCCNONE 
J100031B11CATCCCCCNONE 
J100053C15CATCCCCCNONE 
J100075F19CATCCCCCNONE 
J100087L22CATCCCCCNONE 
Os01g0388000AK069778CATCCCCCSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
Os01g0600000014-098-H06CATCCCCCNONE 
AK121212CATCCCCCSimilar to Copia-like retroelement pol polyprotein. 
J023089H03CATCCCCCNONE 
J033140E12CATCCCCCNONE 
J033142E12CATCCCCCNONE 
J043040N09CATCCCCCNONE 
J065014M23CATCCCCCNONE 
J065017B07CATCCCCCNONE 
J065019E11CATCCCCCNONE 
J065049F16CATCCCCCNONE 
J065053P17CATCCCCCNONE 
J065083C04CATCCCCCNONE 
J065093P06CATCCCCCNONE 
J065146L22CATCCCCCNONE 
J065203F18CATCCCCCNONE 
J065217E22CATCCCCCNONE 
J075003E06CATCCCCCNONE 
J075005I23CATCCCCCNONE 
J075020P07CATCCCCCNONE 
J075049I18CATCCCCCNONE 
J075086G02CATCCCCCNONE 
J075101C05CATCCCCCNONE 
J075110G23CATCCCCCNONE 
J075144E01CATCCCCCNONE 
J090061N03CATCCCCCNONE 
J090068M03CATCCCCCNONE 
J100084N22CATCCCCCNONE 
Os01g0748900AK071946CATCCCCCNONE 
AK072413CATCCCCCMembrane attack complex component/perforin/complement C9 family protein. 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0822900009-019-H05CATCCCCCANONE 
009-050-F07CATCCCCCANONE 
012-027-F05CATCCCCCANONE 
013-015-B03CATCCCCCANONE 
013-016-H08CATCCCCCANONE 
013-018-E09CATCCCCCANONE 
014-040-D05CATCCCCCANONE 
014-090-E10CATCCCCCANONE 
014-099-E02CATCCCCCANONE 
015-035-D03CATCCCCCANONE 
AK071598CATCCCCCANONE 
AK104079CATCCCCCANONE 
AK119174CATCCCCCANONE 
AK119258CATCCCCCANONE 
AK119732CATCCCCCANONE 
AK120044CATCCCCCASimilar to Lipid transfer protein. 
J023107C11CATCCCCCANONE 
J053091D24CATCCCCCANONE 
J065016C07CATCCCCCANONE 
J065046F09CATCCCCCANONE 
J065072L17CATCCCCCANONE 
J065079K03CATCCCCCANONE 
J065093P14CATCCCCCANONE 
J065104F05CATCCCCCANONE 
J065117G12CATCCCCCANONE 
J065144O12CATCCCCCANONE 
J065158L09CATCCCCCANONE 
J065162E07CATCCCCCANONE 
J065182I09CATCCCCCANONE 
J065213A18CATCCCCCANONE 
J075035F01CATCCCCCANONE 
J075041I11CATCCCCCANONE 
J075097N22CATCCCCCANONE 
J075099I07CATCCCCCANONE 
J075104F16CATCCCCCANONE 
J075110O07CATCCCCCANONE 
J075112B19CATCCCCCANONE 
J075156C13CATCCCCCANONE 
J075176H19CATCCCCCANONE 
J075187D15CATCCCCCANONE 
J075199L21CATCCCCCANONE 
J100048J24CATCCCCCANONE 
Os01g0837300009-126-A01GGGGGATGNONE 
011-049-F12GGGGGATGNONE 
011-052-H08GGGGGATGNONE 
015-056-D08GGGGGATGNONE 
015-099-B08GGGGGATGNONE 
AB079063GGGGGATGUDP-glucuronic acid decarboxylase. 
AK062894GGGGGATGNONE 
AK069181GGGGGATGNONE 
J023008F13GGGGGATGNONE 
J043024O14GGGGGATGNONE 
J065202P18GGGGGATGNONE 
J075002P09GGGGGATGNONE 
J075006M18GGGGGATGNONE 
J075007D11GGGGGATGNONE 
J075035I21GGGGGATGNONE 
J075041I06GGGGGATGNONE 
J075128L13GGGGGATGNONE 
J075158B04GGGGGATGNONE 
J075193E01GGGGGATGNONE 
Os01g0869000AK067351TGGGGGATGNONE 
AK121602TGGGGGATGProtein of unknown function DUF639 family protein. 
Os01g0881100AK109822CATCCCCCEpsin, N-terminal domain containing protein. 
Os01g0891300AK063674CATCCCCCCACGTSimilar to Allyl alcohol dehydrogenase. 
AK099151CATCCCCCCACGTNONE 
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE 
AK072409CATCCCCCATCCAACGGCNONE 
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CATCCCCCATCCAACGGCNONE 
AY288943CATCCCCCATCCAACGGCNONE 
AY318757CATCCCCCATCCAACGGCNONE 
J013021C23CATCCCCCATCCAACGGCNONE 
J013027H03CATCCCCCATCCAACGGCNONE 
J013032C02CATCCCCCATCCAACGGCNONE 
J013068G13CATCCCCCATCCAACGGCNONE 
J013070K16CATCCCCCATCCAACGGCNONE 
J013070L02CATCCCCCATCCAACGGCNONE 
J013091E15CATCCCCCATCCAACGGCNONE 
J013109D04CATCCCCCATCCAACGGCNONE 
J013118B04CATCCCCCATCCAACGGCNONE 
J013129E08CATCCCCCATCCAACGGCNONE 
J013134I15CATCCCCCATCCAACGGCNONE 
J013146N16CATCCCCCATCCAACGGCNONE 
J023083F05CATCCCCCATCCAACGGCNONE 
J023107E17CATCCCCCATCCAACGGCNONE 
J023113D21CATCCCCCATCCAACGGCNONE 
J023123A22CATCCCCCATCCAACGGCNONE 
J023133I24CATCCCCCATCCAACGGCNONE 
J023134L21CATCCCCCATCCAACGGCNONE 
J023142N24CATCCCCCATCCAACGGCNONE 
J033051B12CATCCCCCATCCAACGGCNONE 
J033058B04CATCCCCCATCCAACGGCNONE 
J033068E24CATCCCCCATCCAACGGCNONE 
J033076D01CATCCCCCATCCAACGGCNONE 
J033088O06CATCCCCCATCCAACGGCNONE 
J033093K15CATCCCCCATCCAACGGCNONE 
J033101G18CATCCCCCATCCAACGGCNONE 
J033130A01CATCCCCCATCCAACGGCNONE 
J043027I17CATCCCCCATCCAACGGCNONE 
J043027L17CATCCCCCATCCAACGGCNONE 
J090001N13CATCCCCCATCCAACGGCNONE 
J090004L10CATCCCCCATCCAACGGCNONE 
J090027D08CATCCCCCATCCAACGGCNONE 
J090027H18CATCCCCCATCCAACGGCNONE 
J090031F16CATCCCCCATCCAACGGCNONE 
J090048L18CATCCCCCATCCAACGGCNONE 
J090050N08CATCCCCCATCCAACGGCNONE 
J090051G05CATCCCCCATCCAACGGCNONE 
J090063G03CATCCCCCATCCAACGGCNONE 
J090068P21CATCCCCCATCCAACGGCNONE 
J090072P21CATCCCCCATCCAACGGCNONE 
J090079A14CATCCCCCATCCAACGGCNONE 
J090086I20CATCCCCCATCCAACGGCNONE 
J090087D19CATCCCCCATCCAACGGCNONE 
J090099B06CATCCCCCATCCAACGGCNONE 
J100047J19CATCCCCCATCCAACGGCNONE 
J100058I06CATCCCCCATCCAACGGCNONE 
Os02g0188500AK102004CATCCCCCTCCAACGGCTNONE 
AK106917CATCCCCCTCCAACGGCTUbiquitin domain containing protein. 
J090039N13CATCCCCCTCCAACGGCTNONE 
Os02g0510300AK067961TGGGGGATGConserved hypothetical protein. 
AK104001TGGGGGATGNONE 
J013123J20TGGGGGATGNONE 
J065169H15TGGGGGATGNONE 
Os02g0518000AK068281CATCCCCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
J013146J12CATCCCCCNONE 
J013155G12CATCCCCCNONE 
J065141K03CATCCCCCNONE 
J065162I12CATCCCCCNONE 
J065166C16CATCCCCCNONE 
J065171I12CATCCCCCNONE 
Os02g0526500006-107-D09CATCCCCCNONE 
Os02g0551400AJ428900GGGGGATGNONE 
AK068448GGGGGATGMyb, DNA-binding domain containing protein. 
J013034C01GGGGGATGNONE 
J013152C15GGGGGATGNONE 
J023062E13GGGGGATGNONE 
J023108B09GGGGGATGNONE 
J023128I24GGGGGATGNONE 
J033040B20GGGGGATGNONE 
J033150C09GGGGGATGNONE 
J065178H02GGGGGATGNONE 
J065179G01GGGGGATGNONE 
Os02g0640800AK061368CATCCCCCNONE 
Os02g0643500AK068423CATCCCCCGCGPentapeptide repeat containing protein. 
Os02g0665400AK073914CATCCCCCANONE 
AK109787CATCCCCCANONE 
AK120141CATCCCCCASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CATCCCCCANONE 
J075165B08CATCCCCCANONE 
J075177B03CATCCCCCANONE 
J075191K02CATCCCCCANONE 
J090051I12CATCCCCCANONE 
J090057E21CATCCCCCANONE 
J090058E01CATCCCCCANONE 
J090087C06CATCCCCCANONE 
J100025K07CATCCCCCANONE 
J100026I21CATCCCCCANONE 
J100041E12CATCCCCCANONE 
J100083B01CATCCCCCANONE 
Os02g0668500006-056-A05CATCCCCCNONE 
AK060958CATCCCCCNONE 
AK071867CATCCCCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CATCCCCCNONE 
J065013J03CATCCCCCNONE 
J065021P16CATCCCCCNONE 
J065044B07CATCCCCCNONE 
J065059E23CATCCCCCNONE 
J065087N20CATCCCCCNONE 
J065185I04CATCCCCCNONE 
J065190G19CATCCCCCNONE 
J065199C15CATCCCCCNONE 
J065213L12CATCCCCCNONE 
J080305C01CATCCCCCNONE 
J080308C07CATCCCCCNONE 
J080310F02CATCCCCCNONE 
Os02g0683800AK072580CATCCCCCConserved hypothetical protein. 
Os02g0686600AK102917CATCCCCCAMetal-dependent protein hydrolase family protein. 
Os02g0687200006-104-C02CATCCCCCNONE 
AK059947CATCCCCCProtein of unknown function DUF581 family protein. 
J065031L05CATCCCCCNONE 
J065093L07CATCCCCCNONE 
J065122G04CATCCCCCNONE 
J075091K22CATCCCCCNONE 
J075158D02CATCCCCCNONE 
Os02g0754900009-075-G04GGGGGATGNONE 
AK062624GGGGGATGNONE 
J075003F04GGGGGATGNONE 
Os02g0798700AK101070TGGGGGATGNeurochondrin family protein. 
AK103079TGGGGGATGNONE 
J090045L09TGGGGGATGNONE 
Os03g0160200AK064836CATCCCCCConserved hypothetical protein. 
AK064836CATCCCCCAConserved hypothetical protein. 
AK071081CATCCCCCNONE 
AK071081CATCCCCCANONE 
AK100712CATCCCCCNONE 
AK100712CATCCCCCANONE 
AK104859CATCCCCCNONE 
AK104859CATCCCCCANONE 
J013000F21CATCCCCCNONE 
J013000F21CATCCCCCANONE 
J013024G05CATCCCCCNONE 
J013024G05CATCCCCCANONE 
J013035E12CATCCCCCNONE 
J013035E12CATCCCCCANONE 
J013041A17CATCCCCCNONE 
J013041A17CATCCCCCANONE 
J013045D10CATCCCCCNONE 
J013045D10CATCCCCCANONE 
J013045F04CATCCCCCNONE 
J013045F04CATCCCCCANONE 
J013046F04CATCCCCCNONE 
J013046F04CATCCCCCANONE 
J013047F10CATCCCCCNONE 
J013047F10CATCCCCCANONE 
J013051E10CATCCCCCNONE 
J013051E10CATCCCCCANONE 
J013059J07CATCCCCCNONE 
J013059J07CATCCCCCANONE 
J013059O17CATCCCCCNONE 
J013059O17CATCCCCCANONE 
J013060A20CATCCCCCNONE 
J013060A20CATCCCCCANONE 
J013063J23CATCCCCCNONE 
J013063J23CATCCCCCANONE 
J013066D19CATCCCCCNONE 
J013066D19CATCCCCCANONE 
J013069O08CATCCCCCNONE 
J013069O08CATCCCCCANONE 
J013088K24CATCCCCCNONE 
J013088K24CATCCCCCANONE 
J013098G04CATCCCCCNONE 
J013098G04CATCCCCCANONE 
J013100I15CATCCCCCNONE 
J013100I15CATCCCCCANONE 
J013102E18CATCCCCCNONE 
J013102E18CATCCCCCANONE 
J013102O09CATCCCCCNONE 
J013102O09CATCCCCCANONE 
J013119M18CATCCCCCNONE 
J013119M18CATCCCCCANONE 
J013123I19CATCCCCCNONE 
J013123I19CATCCCCCANONE 
J013146H15CATCCCCCNONE 
J013146H15CATCCCCCANONE 
J013149A14CATCCCCCNONE 
J013149A14CATCCCCCANONE 
J023003A05CATCCCCCNONE 
J023003A05CATCCCCCANONE 
J023013O19CATCCCCCNONE 
J023013O19CATCCCCCANONE 
J023044M05CATCCCCCNONE 
J023044M05CATCCCCCANONE 
J023048O03CATCCCCCNONE 
J023048O03CATCCCCCANONE 
J023049L17CATCCCCCNONE 
J023049L17CATCCCCCANONE 
J023060D22CATCCCCCNONE 
J023060D22CATCCCCCANONE 
J023060F20CATCCCCCNONE 
J023060F20CATCCCCCANONE 
J023069G09CATCCCCCNONE 
J023069G09CATCCCCCANONE 
J023086E11CATCCCCCNONE 
J023086E11CATCCCCCANONE 
J023091I09CATCCCCCNONE 
J023091I09CATCCCCCANONE 
J023091M19CATCCCCCNONE 
J023091M19CATCCCCCANONE 
J023101D06CATCCCCCNONE 
J023101D06CATCCCCCANONE 
J023109B03CATCCCCCNONE 
J023109B03CATCCCCCANONE 
J023113B14CATCCCCCNONE 
J023113B14CATCCCCCANONE 
J023114B19CATCCCCCNONE 
J023114B19CATCCCCCANONE 
J023115H16CATCCCCCNONE 
J023115H16CATCCCCCANONE 
J023134F22CATCCCCCNONE 
J023134F22CATCCCCCANONE 
J023139I06CATCCCCCNONE 
J023139I06CATCCCCCANONE 
J023150C02CATCCCCCNONE 
J023150C02CATCCCCCANONE 
J033033A14CATCCCCCNONE 
J033033A14CATCCCCCANONE 
J033058O11CATCCCCCNONE 
J033058O11CATCCCCCANONE 
J033060H13CATCCCCCNONE 
J033060H13CATCCCCCANONE 
J033075P14CATCCCCCNONE 
J033075P14CATCCCCCANONE 
J033084O05CATCCCCCNONE 
J033084O05CATCCCCCANONE 
J033087G04CATCCCCCNONE 
J033087G04CATCCCCCANONE 
J033092E18CATCCCCCNONE 
J033092E18CATCCCCCANONE 
J033101G23CATCCCCCNONE 
J033101G23CATCCCCCANONE 
J033112I05CATCCCCCNONE 
J033112I05CATCCCCCANONE 
J033118E14CATCCCCCNONE 
J033118E14CATCCCCCANONE 
J033118P04CATCCCCCNONE 
J033118P04CATCCCCCANONE 
J033123C07CATCCCCCNONE 
J033123C07CATCCCCCANONE 
J043003C01CATCCCCCNONE 
J043003C01CATCCCCCANONE 
J043024B21CATCCCCCNONE 
J043024B21CATCCCCCANONE 
J043030N04CATCCCCCNONE 
J043030N04CATCCCCCANONE 
J043039J02CATCCCCCNONE 
J043039J02CATCCCCCANONE 
J043039N08CATCCCCCNONE 
J043039N08CATCCCCCANONE 
J075006N21CATCCCCCNONE 
J075006N21CATCCCCCANONE 
J075008A16CATCCCCCNONE 
J075008A16CATCCCCCANONE 
J075018J16CATCCCCCNONE 
J075018J16CATCCCCCANONE 
J075023G04CATCCCCCNONE 
J075023G04CATCCCCCANONE 
J075134F18CATCCCCCNONE 
J075134F18CATCCCCCANONE 
J075181B05CATCCCCCNONE 
J075181B05CATCCCCCANONE 
J090014O14CATCCCCCNONE 
J090014O14CATCCCCCANONE 
J090020H22CATCCCCCNONE 
J090020H22CATCCCCCANONE 
J090022G17CATCCCCCNONE 
J090022G17CATCCCCCANONE 
J090023J24CATCCCCCNONE 
J090023J24CATCCCCCANONE 
J090033H01CATCCCCCNONE 
J090033H01CATCCCCCANONE 
J090038A03CATCCCCCNONE 
J090038A03CATCCCCCANONE 
J090041O22CATCCCCCNONE 
J090041O22CATCCCCCANONE 
J090049E10CATCCCCCNONE 
J090049E10CATCCCCCANONE 
J090063E24CATCCCCCNONE 
J090063E24CATCCCCCANONE 
J090080N12CATCCCCCNONE 
J090080N12CATCCCCCANONE 
J100021G23CATCCCCCNONE 
J100021G23CATCCCCCANONE 
J100028P06CATCCCCCNONE 
J100028P06CATCCCCCANONE 
J100060L21CATCCCCCNONE 
J100060L21CATCCCCCANONE 
J100077D16CATCCCCCNONE 
J100077D16CATCCCCCANONE 
J100088I09CATCCCCCNONE 
J100088I09CATCCCCCANONE 
Os03g0174200AK060616CATCCCCCCAACGGTCNONE 
AK103762CATCCCCCCAACGGTCConserved hypothetical protein. 
J033143G15CATCCCCCCAACGGTCNONE 
J090025L02CATCCCCCCAACGGTCNONE 
Os03g0220300006-066-A07CATCCCCCANONE 
AK061070CATCCCCCANONE 
AK070005CATCCCCCANONE 
AK120487CATCCCCCAConserved hypothetical protein. 
J013114B13CATCCCCCANONE 
Os03g0259100AK107381CATCCCCCSimilar to Basic blue protein (Cusacyanin) (Plantacyanin) (CBP). 
J080043P09CATCCCCCNONE 
J080047O19CATCCCCCNONE 
J080048J10CATCCCCCNONE 
J080070O21CATCCCCCNONE 
J080087E09CATCCCCCNONE 
J080301D23CATCCCCCNONE 
J080304D23CATCCCCCNONE 
J080306E12CATCCCCCNONE 
J080309I04CATCCCCCNONE 
J080311C03CATCCCCCNONE 
J080311C05CATCCCCCNONE 
J080311K03CATCCCCCNONE 
J080313P13CATCCCCCNONE 
J100067J07CATCCCCCNONE 
Os03g0336200AK059473CATCCCCCAGCCCAGNONE 
AK070466CATCCCCCAGCCCAGTranscription factor RF2b. 
AY466471CATCCCCCAGCCCAGNONE 
Os03g0574300AK072541CATCCCCCAHypothetical protein. 
J023134M10CATCCCCCANONE 
Os03g0609500Os03g0609500CATCCCCCSimilar to LOB domain protein 39. 
Os03g0673800006-111-B06TGGGGGATGNONE 
015-080-E08TGGGGGATGNONE 
AK061864TGGGGGATGNONE 
J013043J09TGGGGGATGNONE 
J013044A17TGGGGGATGNONE 
J033136H09TGGGGGATGNONE 
J090064P21TGGGGGATGNONE 
Os03g0712800AK063913CATCCCCCASimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290CATCCCCCANONE 
J023127P21CATCCCCCANONE 
Os03g0719500AK106321CATCCCCCACTCCNONE 
Os03g0752100AK060467CATCCCCCNONE 
Os03g0753500005-012-D10GGGGGATGNONE 
016-012-D03GGGGGATGNONE 
016-078-D06GGGGGATGNONE 
016-079-A05GGGGGATGNONE 
AK070136GGGGGATGProtein of unknown function DUF1618 domain containing protein. 
AK100468GGGGGATGNONE 
AK103935GGGGGATGNONE 
J013089F06GGGGGATGNONE 
J013111N14GGGGGATGNONE 
J023004F15GGGGGATGNONE 
J023049P09GGGGGATGNONE 
J023084E09GGGGGATGNONE 
J023085A02GGGGGATGNONE 
J023092H12GGGGGATGNONE 
J023109O13GGGGGATGNONE 
J033045G16GGGGGATGNONE 
J033050A05GGGGGATGNONE 
J033060G05GGGGGATGNONE 
J033100F08GGGGGATGNONE 
J033103M12GGGGGATGNONE 
J033105K21GGGGGATGNONE 
J033125H09GGGGGATGNONE 
J033138H14GGGGGATGNONE 
J043012H09GGGGGATGNONE 
J090051L22GGGGGATGNONE 
J090066M07GGGGGATGNONE 
J090070J09GGGGGATGNONE 
J090077M02GGGGGATGNONE 
J100019P19GGGGGATGNONE 
J100024M18GGGGGATGNONE 
J100035E21GGGGGATGNONE 
J100050C07GGGGGATGNONE 
Os03g0793500AK103407CATCCCCCANONE 
AK121620CATCCCCCASimilar to Casein kinase-like protein. 
Os03g0815100006-022-A04CATCCCCCNONE 
006-032-F09CATCCCCCNONE 
012-044-F04CATCCCCCNONE 
012-051-A11CATCCCCCNONE 
014-094-A11CATCCCCCNONE 
016-048-F09CATCCCCCNONE 
AK067690CATCCCCCSimilar to OsNAC6 protein. 
AK099245CATCCCCCNONE 
AK104551CATCCCCCNONE 
AK104712CATCCCCCNONE 
AY596808CATCCCCCNONE 
J013023I21CATCCCCCNONE 
J013027O21CATCCCCCNONE 
J013027P22CATCCCCCNONE 
J013039E09CATCCCCCNONE 
J013070D18CATCCCCCNONE 
J013120D02CATCCCCCNONE 
J013124K09CATCCCCCNONE 
J023010G16CATCCCCCNONE 
J023012B04CATCCCCCNONE 
J023012O20CATCCCCCNONE 
J023019D19CATCCCCCNONE 
J023045H15CATCCCCCNONE 
J023049M06CATCCCCCNONE 
J023052G12CATCCCCCNONE 
J023052L12CATCCCCCNONE 
J023056N15CATCCCCCNONE 
J023082P03CATCCCCCNONE 
J023130J01CATCCCCCNONE 
J023136J03CATCCCCCNONE 
J033032A20CATCCCCCNONE 
J033048C16CATCCCCCNONE 
J033081C19CATCCCCCNONE 
J033086J21CATCCCCCNONE 
J033139O19CATCCCCCNONE 
J043013G20CATCCCCCNONE 
J043040J11CATCCCCCNONE 
J065010G15CATCCCCCNONE 
J065020E20CATCCCCCNONE 
J065039K24CATCCCCCNONE 
J065056M11CATCCCCCNONE 
J065065I09CATCCCCCNONE 
J065103L22CATCCCCCNONE 
J065117P20CATCCCCCNONE 
J065167C22CATCCCCCNONE 
J065168L06CATCCCCCNONE 
J065182A21CATCCCCCNONE 
J065191E11CATCCCCCNONE 
J065215E01CATCCCCCNONE 
J090015D12CATCCCCCNONE 
J090024E16CATCCCCCNONE 
J090077P07CATCCCCCNONE 
J100024A01CATCCCCCNONE 
J100029O14CATCCCCCNONE 
J100036E17CATCCCCCNONE 
J100059P22CATCCCCCNONE 
J100067K06CATCCCCCNONE 
J100080A22CATCCCCCNONE 
J100086A03CATCCCCCNONE 
Os03g0833300012-091-F09CATCCCCCNONE 
015-038-A05CATCCCCCNONE 
AK065741CATCCCCCNONE 
AK069847CATCCCCCSimilar to Squamosa-promoter binding-like protein 8. 
AK072164CATCCCCCNONE 
AK121030CATCCCCCNONE 
J013040K13CATCCCCCNONE 
J013122I04CATCCCCCNONE 
J013130O11CATCCCCCNONE 
J023003A13CATCCCCCNONE 
J023003A14CATCCCCCNONE 
J023034C10CATCCCCCNONE 
J033058F07CATCCCCCNONE 
J033065P18CATCCCCCNONE 
J033124B15CATCCCCCNONE 
J043001C15CATCCCCCNONE 
J043031N15CATCCCCCNONE 
J065090G07CATCCCCCNONE 
J090043M05CATCCCCCNONE 
J090053E11CATCCCCCNONE 
J090066P15CATCCCCCNONE 
J090067E22CATCCCCCNONE 
Os04g0165400AK100494TGGGGGATGHrf1 family protein. 
J023098P11TGGGGGATGNONE 
J033068L02TGGGGGATGNONE 
J053024H04TGGGGGATGNONE 
J053046G12TGGGGGATGNONE 
J053062A02TGGGGGATGNONE 
J053063H11TGGGGGATGNONE 
J053071A03TGGGGGATGNONE 
J053089P03TGGGGGATGNONE 
J053090C09TGGGGGATGNONE 
J053092K16TGGGGGATGNONE 
J053096H24TGGGGGATGNONE 
J065035M03TGGGGGATGNONE 
J065072G19TGGGGGATGNONE 
J065101E04TGGGGGATGNONE 
J065104A19TGGGGGATGNONE 
J065104K22TGGGGGATGNONE 
J065112E15TGGGGGATGNONE 
J065116K14TGGGGGATGNONE 
J065152N02TGGGGGATGNONE 
J065174H16TGGGGGATGNONE 
J075191A19TGGGGGATGNONE 
Os04g0234600006-040-F04CATCCCCCNONE 
006-045-E01CATCCCCCNONE 
006-089-E02CATCCCCCNONE 
006-102-H06CATCCCCCNONE 
009-131-A08CATCCCCCNONE 
013-029-A05CATCCCCCNONE 
AK062081CATCCCCCNONE 
AK065773CATCCCCCNONE 
AK119209CATCCCCCSimilar to Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptulose-bisphosphatase) (SBPASE) (SED(1,7)P2ASE). 
AY188797CATCCCCCNONE 
J013021A11CATCCCCCNONE 
J013039M24CATCCCCCNONE 
J013046A19CATCCCCCNONE 
J013052M13CATCCCCCNONE 
J023002M08CATCCCCCNONE 
J023102K16CATCCCCCNONE 
J023110O09CATCCCCCNONE 
J053060E14CATCCCCCNONE 
J065006F22CATCCCCCNONE 
J065039E14CATCCCCCNONE 
J065041B02CATCCCCCNONE 
J065061B21CATCCCCCNONE 
J065067N11CATCCCCCNONE 
J065080H19CATCCCCCNONE 
J065085H09CATCCCCCNONE 
J065104M02CATCCCCCNONE 
J065108F09CATCCCCCNONE 
J065124O12CATCCCCCNONE 
J065139O05CATCCCCCNONE 
J065144J21CATCCCCCNONE 
J065159D16CATCCCCCNONE 
J065163C14CATCCCCCNONE 
J065179B21CATCCCCCNONE 
J065206G05CATCCCCCNONE 
J075063K03CATCCCCCNONE 
J075134A08CATCCCCCNONE 
J075153E17CATCCCCCNONE 
Os04g0390100J033068G16CATCCCCCNONE 
J033071P09CATCCCCCNONE 
J043006E18CATCCCCCHeavy metal transport/detoxification protein domain containing protein. 
J100061I19CATCCCCCNONE 
Os04g0406600AK103609GGGGGATGPrephenate dehydratase domain containing protein. 
J033133I10GGGGGATGNONE 
J075092D11GGGGGATGNONE 
J100031M09GGGGGATGNONE 
Os04g0432000AB125308CCAGCCCATCCCCCSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087CCAGCCCATCCCCCNONE 
J065206O17CCAGCCCATCCCCCNONE 
Os04g0489600003-130-E01CATCCCCCACCCGCGCNONE 
AK062301CATCCCCCACCCGCGCNONE 
AK068039CATCCCCCACCCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0496600AK065058CATCCCCCConserved hypothetical protein. 
J013001J09CATCCCCCNONE 
J013037C18CATCCCCCNONE 
J013126H05CATCCCCCNONE 
J090062G17CATCCCCCNONE 
Os04g0503500AK099404CATCCCCCLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK099404GGGGGATGLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CATCCCCCNONE 
AK101695GGGGGATGNONE 
Os04g0579200AK100603CATCCCCCZinc finger, RING-type domain containing protein. 
Os04g0623800AK059270CATCCCCCNONE 
AK099234CATCCCCCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0658800AK111108CATCCCCCConserved hypothetical protein. 
Os04g0669300AK071148CATCCCCCDynamin family protein. 
Os05g0102500009-183-E08TGGGGGATGNONE 
AK063894TGGGGGATGNONE 
AK073341TGGGGGATGConserved hypothetical protein. 
J023022C11TGGGGGATGNONE 
J065095B14TGGGGGATGNONE 
J065130O12TGGGGGATGNONE 
J065142P07TGGGGGATGNONE 
J065155L18TGGGGGATGNONE 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
Os05g0230900J023149B21CATCCCCCNONE 
Os05g0291700AK073234CATCCCCCACGCGTNONE 
AK099865CATCCCCCACGCGTConserved hypothetical protein. 
AK108453CATCCCCCACGCGTNONE 
Os05g0299700AK072411CATCCCCCASimilar to Expressed protein (Zinc finger-like protein). 
J013155N07CATCCCCCANONE 
J023084O03CATCCCCCANONE 
J053039K15CATCCCCCANONE 
J053061F13CATCCCCCANONE 
J053090E09CATCCCCCANONE 
J053094L24CATCCCCCANONE 
J053099J16CATCCCCCANONE 
J065031F04CATCCCCCANONE 
J065054P09CATCCCCCANONE 
J065084C12CATCCCCCANONE 
J065092N14CATCCCCCANONE 
J065108I11CATCCCCCANONE 
J065117J08CATCCCCCANONE 
J065140E20CATCCCCCANONE 
J065141B14CATCCCCCANONE 
J065144E12CATCCCCCANONE 
J065153I16CATCCCCCANONE 
J065153J22CATCCCCCANONE 
J065164E10CATCCCCCANONE 
J065175J23CATCCCCCANONE 
J065178J18CATCCCCCANONE 
J065193H15CATCCCCCANONE 
J065209J01CATCCCCCANONE 
J075044H04CATCCCCCANONE 
J075053H12CATCCCCCANONE 
J075053K20CATCCCCCANONE 
J075076O11CATCCCCCANONE 
J075084L09CATCCCCCANONE 
J075092H07CATCCCCCANONE 
J075151B16CATCCCCCANONE 
J075151O20CATCCCCCANONE 
J075159L11CATCCCCCANONE 
J075174I09CATCCCCCANONE 
J075175H12CATCCCCCANONE 
J090071H06CATCCCCCANONE 
J100052G06CATCCCCCANONE 
J100078M21CATCCCCCANONE 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
AK104994TGTGGGCCCCACATCCCCCACACNONE 
Os05g0344200006-022-E04CATCCCCCCATCCACCNONE 
006-080-D01CATCCCCCCATCCACCNONE 
009-021-D03CATCCCCCCATCCACCNONE 
009-026-A10CATCCCCCCATCCACCNONE 
009-054-B12CATCCCCCCATCCACCNONE 
009-059-H03CATCCCCCCATCCACCNONE 
009-077-C02CATCCCCCCATCCACCNONE 
009-095-H12CATCCCCCCATCCACCNONE 
009-106-B08CATCCCCCCATCCACCNONE 
009-138-D10CATCCCCCCATCCACCNONE 
009-140-G06CATCCCCCCATCCACCNONE 
009-146-E09CATCCCCCCATCCACCNONE 
009-161-F04CATCCCCCCATCCACCNONE 
009-176-F05CATCCCCCCATCCACCNONE 
013-047-C03CATCCCCCCATCCACCNONE 
013-052-E07CATCCCCCCATCCACCNONE 
013-054-G04CATCCCCCCATCCACCNONE 
013-095-D10CATCCCCCCATCCACCNONE 
014-003-D06CATCCCCCCATCCACCNONE 
014-020-C09CATCCCCCCATCCACCNONE 
014-043-E01CATCCCCCCATCCACCNONE 
014-080-G09CATCCCCCCATCCACCNONE 
014-081-H05CATCCCCCCATCCACCNONE 
AK060058CATCCCCCCATCCACCConserved hypothetical protein. 
AK098850CATCCCCCCATCCACCNONE 
AK104716CATCCCCCCATCCACCNONE 
AK119727CATCCCCCCATCCACCNONE 
J013000G04CATCCCCCCATCCACCNONE 
J013155L11CATCCCCCCATCCACCNONE 
J033138J22CATCCCCCCATCCACCNONE 
J065112E22CATCCCCCCATCCACCNONE 
J065124M06CATCCCCCCATCCACCNONE 
J065130M01CATCCCCCCATCCACCNONE 
J065137I03CATCCCCCCATCCACCNONE 
J065157O12CATCCCCCCATCCACCNONE 
J065171B12CATCCCCCCATCCACCNONE 
J075003O16CATCCCCCCATCCACCNONE 
J075026G12CATCCCCCCATCCACCNONE 
J075032K07CATCCCCCCATCCACCNONE 
J075070I11CATCCCCCCATCCACCNONE 
J075093K06CATCCCCCCATCCACCNONE 
J075148C12CATCCCCCCATCCACCNONE 
J075148L08CATCCCCCCATCCACCNONE 
J075152G13CATCCCCCCATCCACCNONE 
J075177G07CATCCCCCCATCCACCNONE 
J100026I09CATCCCCCCATCCACCNONE 
J100083L11CATCCCCCCATCCACCNONE 
J100086F04CATCCCCCCATCCACCNONE 
Os05g0365500AK072352TGGGGGATGProtein prenyltransferase domain containing protein. 
J043027P13TGGGGGATGNONE 
Os05g0408200AK100057CATCCCCCSBP domain containing protein. 
AK100057CATCCCCCSBP domain containing protein. 
J065182F20CATCCCCCNONE 
J065182F20CATCCCCCNONE 
Os05g0412800AF402803GGGGGATGSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0423701J100057H19CATCCCCCAGlycoside hydrolase, family 9 protein. 
Os05g0553700006-100-D08TGGGGGATGNONE 
AK099747TGGGGGATGNONE 
AK101606TGGGGGATGNONE 
AK103396TGGGGGATGSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGGGGGATGNONE 
J090086G01TGGGGGATGNONE 
Os05g0565100011-013-H02CATCCCCCANONE 
AK063277CATCCCCCACytochrome b561 / ferric reductase transmembrane domain containing protein. 
Os05g0579300AK111350CATCCCCCACCACZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os06g0167600AK067977CATCCCCCASimilar to Proteasome subunit alpha-3 (Fragment). 
J013123K20CATCCCCCANONE 
J033125P19CATCCCCCANONE 
J065002M08CATCCCCCANONE 
J065045C13CATCCCCCANONE 
J065045J07CATCCCCCANONE 
J065098M04CATCCCCCANONE 
J065110M02CATCCCCCANONE 
J065113H12CATCCCCCANONE 
J065214E15CATCCCCCANONE 
Os06g0225800AB188835CATCCCCCShikimate kinase domain containing protein. 
AK109730CATCCCCCNONE 
J065176A08CATCCCCCNONE 
Os06g0274500AK066417CACGGCCCCATCCCCCCGGCCCSimilar to SERK1 (Fragment). 
Os06g0328800AK065974CATCCCCCNONE 
AK101557CATCCCCCProtein of unknown function DUF23 family protein. 
J013049H12CATCCCCCNONE 
J033050C11CATCCCCCNONE 
Os06g0498800AK107056CATCCCCCSimilar to MOTHER of FT and TF1 protein. 
J075147L06CATCCCCCNONE 
Os06g0538900009-018-A07CATCCCCCANONE 
009-022-B03CATCCCCCANONE 
009-059-E03CATCCCCCANONE 
009-064-C03CATCCCCCANONE 
009-069-H03CATCCCCCANONE 
009-072-G03CATCCCCCANONE 
009-093-E04CATCCCCCANONE 
009-097-C01CATCCCCCANONE 
009-097-H01CATCCCCCANONE 
009-098-D12CATCCCCCANONE 
009-100-B12CATCCCCCANONE 
009-110-H06CATCCCCCANONE 
009-149-C03CATCCCCCANONE 
009-162-C01CATCCCCCANONE 
009-163-E03CATCCCCCANONE 
009-178-D08CATCCCCCANONE 
009-179-F11CATCCCCCANONE 
009-191-G04CATCCCCCANONE 
009-196-F01CATCCCCCANONE 
AF466285CATCCCCCANONE 
AK063825CATCCCCCAProtein of unknown function DUF538 family protein. 
AK122046CATCCCCCANONE 
J023107A01CATCCCCCANONE 
J033060K20CATCCCCCANONE 
J033114A14CATCCCCCANONE 
J065213K05CATCCCCCANONE 
J075067G10CATCCCCCANONE 
J075075J01CATCCCCCANONE 
J075165E12CATCCCCCANONE 
J090004K02CATCCCCCANONE 
Os07g0124600AK073437CCGAGCCGTCCATCCCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24CCGAGCCGTCCATCCCCCNONE 
J033136G07CCGAGCCGTCCATCCCCCNONE 
J065092I12CCGAGCCGTCCATCCCCCNONE 
J065132F04CCGAGCCGTCCATCCCCCNONE 
J065143I11CCGAGCCGTCCATCCCCCNONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0200700AK063341CATCCCCCSimilar to Squalene synthase (EC 2.5.1.21). 
Os07g0501900AK067791GCCCATCCCCCNONE 
AK067791GGGGGATGNONE 
Os07g0568300AK067784TGGGGGATGNONE 
AK067895TGGGGGATGSimilar to ZF protein (Fragment). 
J013119M01TGGGGGATGNONE 
J013120B09TGGGGGATGNONE 
J013123G12TGGGGGATGNONE 
J023012C12TGGGGGATGNONE 
J023020G17TGGGGGATGNONE 
J023037E23TGGGGGATGNONE 
J033076I01TGGGGGATGNONE 
J033108A07TGGGGGATGNONE 
J033138J02TGGGGGATGNONE 
J075033L09TGGGGGATGNONE 
J075049E02TGGGGGATGNONE 
J075060N23TGGGGGATGNONE 
J075094H13TGGGGGATGNONE 
J075179L18TGGGGGATGNONE 
J080005P09TGGGGGATGNONE 
J080044J03TGGGGGATGNONE 
J080062G20TGGGGGATGNONE 
J080063L23TGGGGGATGNONE 
J080065B16TGGGGGATGNONE 
J080071K09TGGGGGATGNONE 
J080089C23TGGGGGATGNONE 
J090008P21TGGGGGATGNONE 
J090046B22TGGGGGATGNONE 
J090094C19TGGGGGATGNONE 
J090096B19TGGGGGATGNONE 
J100060G03TGGGGGATGNONE 
J100082D16TGGGGGATGNONE 
Os07g0578600AK067155TGGGGGATGSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TGGGGGATGNONE 
Os07g0634600AK060807CATCCCCCNONE 
J013001O22CATCCCCCNONE 
J013063O12CATCCCCCNONE 
J033046G10CATCCCCCNONE 
J033105G03CATCCCCCNONE 
J033132P16CATCCCCCNONE 
J033141A18CATCCCCCNONE 
J043021P12CATCCCCCNONE 
J043031E21CATCCCCCNONE 
J053054I19CATCCCCCNONE 
J053059C23CATCCCCCNONE 
J053071A18CATCCCCCNONE 
J053076B06CATCCCCCNONE 
J053094L08CATCCCCCNONE 
J053094M10CATCCCCCNONE 
J100051A01CATCCCCCNONE 
J100064F16CATCCCCCNONE 
J100081D10CATCCCCCNONE 
Os07g0688100AK101635CATCCCCCProtein prenyltransferase domain containing protein. 
J033055B02CATCCCCCNONE 
J090013O08CATCCCCCNONE 
J090074A17CATCCCCCNONE 
Os08g0305000AK102896TGGGGGATGNONE 
AK107492TGGGGGATGHypothetical protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0416400AK064144TGGGGGATGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0442300006-067-F05CATCCCCCACACNONE 
AK059843CATCCCCCACACNONE 
AK071719CATCCCCCACACSimilar to Calcineurin-like protein. 
AK102411CATCCCCCACACNONE 
J023108H11CATCCCCCACACNONE 
J033092P05CATCCCCCACACNONE 
J075109C09CATCCCCCACACNONE 
J090070B02CATCCCCCACACNONE 
J090076M14CATCCCCCACACNONE 
J100064B16CATCCCCCACACNONE 
Os08g0465400AK068332CATCCCCCAConserved hypothetical protein. 
Os08g0500200AK059046CATCCCCCNONE 
AK064018CATCCCCCConserved hypothetical protein. 
J075091E11CATCCCCCNONE 
J090039E22CATCCCCCNONE 
J100072K15CATCCCCCNONE 
Os08g0512400AK063161CATCCCCCNONE 
J090062E24CATCCCCCNONE 
Os08g0522500006-026-A04TGGGGGATGNONE 
006-037-B02TGGGGGATGNONE 
006-047-E11TGGGGGATGNONE 
015-049-E10TGGGGGATGNONE 
AK060080TGGGGGATGNONE 
AK102814TGGGGGATGNONE 
AK104718TGGGGGATGNONE 
AK106190TGGGGGATGGlycoside hydrolase, family 19 protein. 
J013068H02TGGGGGATGNONE 
J033108M05TGGGGGATGNONE 
J033116M13TGGGGGATGNONE 
J065211H04TGGGGGATGNONE 
J075195H03TGGGGGATGNONE 
J075195I24TGGGGGATGNONE 
Os08g0546700AK061056CATCCCCCRhomboid-like protein family protein. 
Os09g0119100AK102931CATCCCCCACGUBA-like domain containing protein. 
Os09g0122000J075038D18CATCCCCCNONE 
J075080K22CATCCCCCNONE 
J075153J04CATCCCCCNONE 
J075161K18CATCCCCCNONE 
J075163H20CATCCCCCNONE 
J075174C07CATCCCCCConserved hypothetical protein. 
Os09g0322300AK107151CATCCCCCAHypothetical protein. 
J075023P17CATCCCCCANONE 
J075143O05CATCCCCCANONE 
Os09g0466100011-041-C05CATCCCCCNONE 
AB080248CATCCCCCCyclin-like domain containing protein. 
AK063940CATCCCCCNONE 
AK102698CATCCCCCNONE 
J033060F17CATCCCCCNONE 
J033103I16CATCCCCCNONE 
J043024L16CATCCCCCNONE 
Os09g0491676AK062257CATCCCCCANONE 
AK064834CATCCCCCAConserved hypothetical protein. 
J013000F19CATCCCCCANONE 
J023069F02CATCCCCCANONE 
J023088G02CATCCCCCANONE 
J065158H21CATCCCCCANONE 
Os09g0521700014-005-C08GGGGGATGNONE 
AK063628GGGGGATGSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GGGGGATGNONE 
Os09g0522200009-034-A02CATCCCCCNONE 
009-121-B01CATCCCCCNONE 
AF300970CATCCCCCNONE 
AF494422CATCCCCCNONE 
AK071519CATCCCCCNONE 
AK105599CATCCCCCDRE-binding protein 1A. 
AY345233CATCCCCCNONE 
J065178N24CATCCCCCNONE 
J080092M16CATCCCCCNONE 
J080097F24CATCCCCCNONE 
J080097O15CATCCCCCNONE 
Os09g0527700AK111128CATCCCCCSimilar to Auxin-induced protein IAA4. 
J065124H12CATCCCCCNONE 
J065181I07CATCCCCCNONE 
J065207G14CATCCCCCNONE 
Os09g0528800AK070219GGGGGATGRabGAP/TBC domain containing protein. 
Os09g0567700AK065913GGGGGATGWD40-like domain containing protein. 
Os11g0130600AK066342GGGGGATGConserved hypothetical protein. 
J065192M10GGGGGATGNONE 
Os11g0183700006-030-G09TGGGGGATGNONE 
AK061734TGGGGGATGNONE 
Os11g0256200AK107906TGGGGGATGProtein of unknown function DUF842, eukaryotic family protein. 
J065007J01TGGGGGATGNONE 
J065167G22TGGGGGATGNONE 
J075001G14TGGGGGATGNONE 
J075121L13TGGGGGATGNONE 
Os12g0127500AK064595GGGGGATGConserved hypothetical protein. 
J065067F11GGGGGATGNONE 
J090007D02GGGGGATGNONE 
J100035G10GGGGGATGNONE 
J100077J10GGGGGATGNONE 
Os12g0193800AK111754GGGGGATGConserved hypothetical protein. 
Os12g0285600AK069104AGTGGGCCCATCCCCCCACCCGOxysterol-binding protein family protein. 
AK069104CATCCCCCOxysterol-binding protein family protein. 
Os12g0616900AK063753CATCCCCCSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464CATCCCCCNONE 
J033126J16CATCCCCCNONE 
J065140B05CATCCCCCNONE 
Os12g0617900AK065064CATCCCCCSimilar to Serine/threonine protein phosphatase BSL2 (EC 3.1.3.16) (BSU1-like protein 2). 
AK066418CATCCCCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.