
Summary of OsREG517 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCATGG  function unknown  
PLACE Motif 
Total Entry Count4024  

Entry Sequences (4024 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
AK102533ATGGCCCATGLeucine rich repeat, N-terminal domain containing protein. 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
AK111287GCGGCCCATGAConserved hypothetical protein. 
AK068877ACATGGGCCGCSybindin-like protein family protein. 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein. 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC (AvrPphB susceptible protein 1). 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
Os01g0738600AK073479TTGGCCCATGGENTH/VHS domain containing protein. 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
AK066513CATGGGCCCCSimilar to Laccase (EC 
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH. 
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein. 
AK066959GAGGCCCATGASimilar to G10. 
AK111571ATGGCCCATGGSimilar to MCB2 protein. 
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS. 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog. 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein. 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC (Fragment). 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
Os02g0198000AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein. 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
AK099750TCATGGGCCATConserved hypothetical protein. 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
AK066104TCATGGGCCGCLUC7 related family protein. 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0643500AK068423TCATGGGCCAAPentapeptide repeat containing protein. 
AK071507AACGGCCCATGZinc finger, B-box domain containing protein. 
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit. 
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC (IRAK-1). Splice isoform 2. 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein. 
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein. 
AK101655CGGGCCCATGGSimilar to Phi-1 protein. 
AK103640ACATGGGCCTCConserved hypothetical protein. 
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein. 
AK111328CATGGGCCATProtein kinase-like domain containing protein. 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein. 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein. 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein. 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein. 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein). 
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein. 
AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein. 
AK071431ACATGGGCCATHypothetical protein. 
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein. 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC (EC 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0383100AK107106CTGGCCCATGAConserved hypothetical protein. 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein. 
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein. 
Os03g0566800AK103270CATGGGCCATSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC (Lysine--tRNA ligase) (LysRS). 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39. 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein. 
AK060947ATGGCCCATGGGRAM domain containing protein. 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
Os03g0769600AK100054CCATGGGCCACResB-like family protein. 
AK100054TCATGGGCCCTResB-like family protein. 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
Os03g0807800AK064984ATGGCCCATGSimilar to 40S ribosomal protein S2 (Fragment). 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein. 
AK061467GTGGCCCATGGConserved hypothetical protein. 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein. 
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
Os04g0481800AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein. 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
AK065957CCATGGGCCTCConserved hypothetical protein. 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0595000AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein. 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
Os05g0120300AK109108CATGGGCCGAHypothetical protein. 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
AK071760ACATGGGCCGCConserved hypothetical protein. 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK067940TCATGGGCCTCConserved hypothetical protein. 
AK064059CATGGGCCGACyclin-like domain containing protein. 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
Os05g0383100AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein. 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
AK068616GTGGCCCATGGSimilar to Aldose reductase. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
Os05g0488900AK071883CTGGCCCATGSimilar to Cytochrome b5 reductase. 
AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK062985ATGGCCCATGSimilar to 50S ribosomal protein L20. 
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20. 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
Os05g0558900AK101679TCATGGGCCATSimilar to Frsb-prov protein. 
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein. 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein. 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
AK062901GGGGCCCATGConserved hypothetical protein. 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
Os06g0157800AK121504TCATGGGCCGGASimilar to CG7224 (Fragment). 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC (Ovp2). 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein. 
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein. 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK105260TTGGCCCATGConserved hypothetical protein. 
J075103B05CATGGGCCGAAProtein of unknown function DUF953, thioredoxin-like family protein. 
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein. 
J023109C07CATGGGCCACSimilar to Exopolygalacturonase precursor (EC (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase). 
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter. 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
J100072F13GACGGCCCATGTSimilar to Ubiquitin. 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
AK073948ACATGGGCCAGHypothetical protein. 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
AK073948GGACGGCCCATGAHypothetical protein. 
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein. 
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein. 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein. 
AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein. 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein. 
AK111780GCCGGCCCATGGWD40-like domain containing protein. 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
AK067845ACATGGGCCGAPhospholipid/glycerol acyltransferase domain containing protein. 
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein. 
U86017TCATGGGCCGGCSimilar to 60S ribosomal protein L38. 
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0603100AK101352GCGGCCCATGGNuclear transport factor 2 domain containing protein. 
AK101352TCATGGGCCGGANuclear transport factor 2 domain containing protein. 
AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein. 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
AK121733ATGGCCCATGGSimilar to Cytochrome P450. 
AK102982ACATGGGCCGCSimilar to 1-Cys peroxiredoxin. 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0653100J065130E21TCATGGGCCGGAConserved hypothetical protein. 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0686600AK108527TGGGTCCCATGGGCCATVQ domain containing protein. 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
Os08g0110200AK068841ACATGGGCCATSimilar to Fertility restorer. 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0118900AK109749TCGGCCCATGTAdenylate kinase family protein. 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC (Orange pericarp 1) (Fragment). 
Os08g0154200AK103192CAGGCCCATGGConserved hypothetical protein. 
Os08g0158900AK067062ACATGGGCCGGAGTP1/OBG domain containing protein. 
AK103973TCCGGCCCATGTSimilar to DnaJ homolog subfamily C member 1. 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
Os08g0227100AK071657TCATGGGCCGCTRAF-like domain containing protein. 
AK066874CATGGGCCTTConserved hypothetical protein. 
AK070379TGGTGGGCCCATGCytochrome b5 domain containing protein. 
AK099471CATGGGCCTAConserved hypothetical protein. 
AK099471CATGGGCCTAConserved hypothetical protein. 
Os08g0433400AJ495796TCATGGGCCATSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
Os08g0435800AK121712TCCGGCCCATGGSimilar to Lipoate protein ligase-like protein. 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
Os08g0450800AK102479GAGGCCCATGTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0461300AK065651GTGGCCCATGTCyclin-like F-box domain containing protein. 
Os08g0465000J065121H01CTGGCCCATGHomeobox domain containing protein. 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK069190TCATGGGCCGAASimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
AK071527GCGGCCCATGAZinc finger, DHHC-type domain containing protein. 
AK061808CCATGGGCCCATGGSimilar to Proteasome subunit alpha type 7 (EC (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK120938CATGGGCCGGASimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
Os08g0553450Os08g0553450TCATGGGCCAAHypothetical protein. 
Os08g0554000AK111661CATGGGCCGCAWD-40 repeat containing protein. 