version

Summary of OsREG517 (All List)

OrganismOryza sativa  
IDOsREG517  
SequenceCATGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCATGG  function unknown  
PLACE Motif 
Total Entry Count4024  

Entry Sequences (4024 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
J065164N24TCATGGGCCTTNONE 
J065167H04TCATGGGCCTTNONE 
J065187N12TCATGGGCCTTNONE 
Os01g0148700006-099-B04CATGGGCCGTTTNONE 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
AK109379CATGGGCCGTTTNONE 
J023101J18CATGGGCCGTTTNONE 
J033036D19CATGGGCCGTTTNONE 
J033051P05CATGGGCCGTTTNONE 
J033061D21CATGGGCCGTTTNONE 
J033071M06CATGGGCCGTTTNONE 
J033072D18CATGGGCCGTTTNONE 
J033073M13CATGGGCCGTTTNONE 
J033084N02CATGGGCCGTTTNONE 
J065092C13CATGGGCCGTTTNONE 
J080017H24CATGGGCCGTTTNONE 
J080032E16CATGGGCCGTTTNONE 
J080077J07CATGGGCCGTTTNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0160200AK073444ATGGCCCATGNONE 
AK102533ATGGCCCATGLeucine rich repeat, N-terminal domain containing protein. 
J033044L19ATGGCCCATGNONE 
J033096F04ATGGCCCATGNONE 
Os01g0172000012-070-G06GGGCCGGAGGCCCATGANONE 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
J013149A07GGGCCGGAGGCCCATGANONE 
J053047H05GGGCCGGAGGCCCATGANONE 
J065075N03GGGCCGGAGGCCCATGANONE 
J065093G22GGGCCGGAGGCCCATGANONE 
J065130N21GGGCCGGAGGCCCATGANONE 
J065143P05GGGCCGGAGGCCCATGANONE 
J065216H07GGGCCGGAGGCCCATGANONE 
J075013B06GGGCCGGAGGCCCATGANONE 
J075196M05GGGCCGGAGGCCCATGANONE 
J100039G24GGGCCGGAGGCCCATGANONE 
J100041B11GGGCCGGAGGCCCATGANONE 
J100069A16GGGCCGGAGGCCCATGANONE 
J100069L12GGGCCGGAGGCCCATGANONE 
J100074P16GGGCCGGAGGCCCATGANONE 
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE 
009-028-D05GCCCATGGGCCTGGNONE 
009-058-B11GCCCATGGGCCTGGNONE 
009-151-D09GCCCATGGGCCTGGNONE 
013-026-G03GCCCATGGGCCTGGNONE 
013-063-F04GCCCATGGGCCTGGNONE 
013-069-B05GCCCATGGGCCTGGNONE 
014-029-E04GCCCATGGGCCTGGNONE 
014-072-H04GCCCATGGGCCTGGNONE 
014-089-E09GCCCATGGGCCTGGNONE 
015-047-G05GCCCATGGGCCTGGNONE 
016-033-G06GCCCATGGGCCTGGNONE 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08GCCCATGGGCCTGGNONE 
J023077K21GCCCATGGGCCTGGNONE 
J023081F19GCCCATGGGCCTGGNONE 
J033052N11GCCCATGGGCCTGGNONE 
J033058N11GCCCATGGGCCTGGNONE 
J033114G05GCCCATGGGCCTGGNONE 
J033114O17GCCCATGGGCCTGGNONE 
J033129L14GCCCATGGGCCTGGNONE 
J053029I12GCCCATGGGCCTGGNONE 
J065067N19GCCCATGGGCCTGGNONE 
J065084I19GCCCATGGGCCTGGNONE 
J065099O03GCCCATGGGCCTGGNONE 
J065201I08GCCCATGGGCCTGGNONE 
J075035B08GCCCATGGGCCTGGNONE 
J075037B22GCCCATGGGCCTGGNONE 
J075054L16GCCCATGGGCCTGGNONE 
J075059D15GCCCATGGGCCTGGNONE 
J075164I08GCCCATGGGCCTGGNONE 
J075185J01GCCCATGGGCCTGGNONE 
J090042O06GCCCATGGGCCTGGNONE 
J090044F12GCCCATGGGCCTGGNONE 
J090063L02GCCCATGGGCCTGGNONE 
J090073I10GCCCATGGGCCTGGNONE 
J090078E18GCCCATGGGCCTGGNONE 
J100072K16GCCCATGGGCCTGGNONE 
Os01g0191800AK061360GTGGCCCATGNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023121K24CCATGGGCCACNONE 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
J065002A07TCATGGGCCTGNONE 
J065079J08TCATGGGCCTGNONE 
J065167M18TCATGGGCCTGNONE 
Os01g0508300AK101435GCGGCCCATGANONE 
AK111287GCGGCCCATGAConserved hypothetical protein. 
J065096N08GCGGCCCATGANONE 
J075003F13GCGGCCCATGANONE 
J075014I16GCGGCCCATGANONE 
J075022D23GCGGCCCATGANONE 
J075040N19GCGGCCCATGANONE 
J075121O06GCGGCCCATGANONE 
J075131E17GCGGCCCATGANONE 
J075136N22GCGGCCCATGANONE 
J075147D01GCGGCCCATGANONE 
J075173C07GCGGCCCATGANONE 
J075196L22GCGGCCCATGANONE 
Os01g0513700AK058445ACATGGGCCGCNONE 
AK058445ACCGGCCCATGGNONE 
AK068877ACATGGGCCGCSybindin-like protein family protein. 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
J023001F01ACATGGGCCGCNONE 
J023001F01ACCGGCCCATGGNONE 
J065065I18ACATGGGCCGCNONE 
J065065I18ACCGGCCCATGGNONE 
J065165A09ACATGGGCCGCNONE 
J065165A09ACCGGCCCATGGNONE 
J065184N12ACATGGGCCGCNONE 
J065184N12ACCGGCCCATGGNONE 
J065205M05ACATGGGCCGCNONE 
J065205M05ACCGGCCCATGGNONE 
J075172I17ACATGGGCCGCNONE 
J075172I17ACCGGCCCATGGNONE 
J090025O09ACATGGGCCGCNONE 
J090025O09ACCGGCCCATGGNONE 
J100087H03ACATGGGCCGCNONE 
J100087H03ACCGGCCCATGGNONE 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01TCATGGGCCCAAATNONE 
Os01g0596300016-083-D09TCATGGGCCTTNONE 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
J023007D17TCATGGGCCTTNONE 
J065141M02TCATGGGCCTTNONE 
Os01g0613900014-018-D04GCGGCCCATGANONE 
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GCGGCCCATGANONE 
J065019A15GCGGCCCATGANONE 
J075090J10GCGGCCCATGANONE 
J075195H12GCGGCCCATGANONE 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08ACCGGCCCATGANONE 
J033064N24ACCGGCCCATGANONE 
J043022M20ACCGGCCCATGANONE 
J065075K20ACCGGCCCATGANONE 
J065081K04ACCGGCCCATGANONE 
J065128K13ACCGGCCCATGANONE 
J065131K12ACCGGCCCATGANONE 
J065137H20ACCGGCCCATGANONE 
J065205A09ACCGGCCCATGANONE 
J090030C13ACCGGCCCATGANONE 
J090053I08ACCGGCCCATGANONE 
J090054O22ACCGGCCCATGANONE 
J090082C15ACCGGCCCATGANONE 
J090097P12ACCGGCCCATGANONE 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AAGGCCCATGGNONE 
J065007E03AAGGCCCATGGNONE 
J065015A13AAGGCCCATGGNONE 
J065093J17AAGGCCCATGGNONE 
J065116C09AAGGCCCATGGNONE 
J065120E04AAGGCCCATGGNONE 
J065197I17AAGGCCCATGGNONE 
J065208L13AAGGCCCATGGNONE 
J065213P07AAGGCCCATGGNONE 
J075056K07AAGGCCCATGGNONE 
J090036L08AAGGCCCATGGNONE 
Os01g0709500AK065353AAGGCCCATGGNONE 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
J033080F19AAGGCCCATGANONE 
Os01g0738600AK073479TTGGCCCATGGENTH/VHS domain containing protein. 
AK120616TTGGCCCATGGNONE 
J013046M12TTGGCCCATGGNONE 
J013152B11TTGGCCCATGGNONE 
J023007A09TTGGCCCATGGNONE 
J023007N03TTGGCCCATGGNONE 
J023042A01TTGGCCCATGGNONE 
J023059P06TTGGCCCATGGNONE 
J023113A05TTGGCCCATGGNONE 
J033044K11TTGGCCCATGGNONE 
J033082E04TTGGCCCATGGNONE 
J090033B13TTGGCCCATGGNONE 
J090062H08TTGGCCCATGGNONE 
J100086G23TTGGCCCATGGNONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
J013091F09TCATGGGCCTANONE 
J013134K14TCATGGGCCTANONE 
J013158J15TCATGGGCCTANONE 
J033060O20TCATGGGCCTANONE 
J033074C16TCATGGGCCTANONE 
J075086F05TCATGGGCCTANONE 
J075150H08TCATGGGCCTANONE 
J090006E02TCATGGGCCTANONE 
J090074E02TCATGGGCCTANONE 
J100030M05TCATGGGCCTANONE 
J100036M16TCATGGGCCTANONE 
J100063H18TCATGGGCCTANONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0805000009-045-H11AAGGCCCATGANONE 
009-196-H08AAGGCCCATGANONE 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
J013119F23AAGGCCCATGANONE 
J065128B11AAGGCCCATGANONE 
Os01g0831900011-058-G07CCATGGGCCAGANONE 
AK063959CCATGGGCCAGANONE 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
J033084D13CCATGGGCCAGANONE 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
J013098M23CAGGCCCATGANONE 
Os01g0834200AK069188CATGGGCCCACANONE 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0842500011-030-F11CATGGGCCCCNONE 
AK066513CATGGGCCCCSimilar to Laccase (EC 1.10.3.2). 
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH. 
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein. 
Os01g0857700006-045-F05GAGGCCCATGANONE 
AK066959GAGGCCCATGASimilar to G10. 
AK099794GAGGCCCATGANONE 
J013093N15GAGGCCCATGANONE 
J023105B19GAGGCCCATGANONE 
Os01g0863300014-030-D08ATGGCCCATGGNONE 
AK111571ATGGCCCATGGSimilar to MCB2 protein. 
J013071A13ATGGCCCATGGNONE 
J075060E09ATGGCCCATGGNONE 
J075138C14ATGGCCCATGGNONE 
J075150M17ATGGCCCATGGNONE 
Os01g0869800006-029-F03CACGCCACGCGGCCCATGNONE 
006-067-H02CACGCCACGCGGCCCATGNONE 
006-084-A06CACGCCACGCGGCCCATGNONE 
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS. 
AK071827CACGCCACGCGGCCCATGNONE 
AK104275CACGCCACGCGGCCCATGNONE 
J013049J07CACGCCACGCGGCCCATGNONE 
J033089F12CACGCCACGCGGCCCATGNONE 
J090094I11CACGCCACGCGGCCCATGNONE 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0904400AJ535210GCGGCCCATGGNONE 
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog. 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0937300AK062872CCATGGGCCACNONE 
J033136K12CCATGGGCCACNONE 
J053048E20CCATGGGCCACNONE 
J053088K08CCATGGGCCACNONE 
J065011G23CCATGGGCCACNONE 
J065202J09CCATGGGCCACNONE 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
J090089O16GAGGCCCATGANONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0962600009-104-A04GAGGCCCATGTNONE 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCATGTNONE 
J065079N18GAGGCCCATGTNONE 
J065122H12GAGGCCCATGTNONE 
J065197O14GAGGCCCATGTNONE 
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein. 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0103800006-046-H11GTGGCCCATGANONE 
006-060-B05GTGGCCCATGANONE 
006-097-A09GTGGCCCATGANONE 
006-102-A10GTGGCCCATGANONE 
006-104-E11GTGGCCCATGANONE 
006-112-D09GTGGCCCATGANONE 
AK061774GTGGCCCATGANONE 
AK065309GTGGCCCATGANONE 
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGCCCATGANONE 
J013026F06GTGGCCCATGANONE 
J013037O14GTGGCCCATGANONE 
J013066N06GTGGCCCATGANONE 
J013108G22GTGGCCCATGANONE 
J023050M15GTGGCCCATGANONE 
J023054B21GTGGCCCATGANONE 
J023073C23GTGGCCCATGANONE 
J023086H17GTGGCCCATGANONE 
J023105A20GTGGCCCATGANONE 
J065019E16GTGGCCCATGANONE 
J065064G10GTGGCCCATGANONE 
J065071C18GTGGCCCATGANONE 
J065103B02GTGGCCCATGANONE 
J065153G06GTGGCCCATGANONE 
J075152G24GTGGCCCATGANONE 
J075166P04GTGGCCCATGANONE 
J080001F02GTGGCCCATGANONE 
J080001M07GTGGCCCATGANONE 
J080001O05GTGGCCCATGANONE 
J080003I19GTGGCCCATGANONE 
J080004C12GTGGCCCATGANONE 
J080008E17GTGGCCCATGANONE 
J080008M08GTGGCCCATGANONE 
J080010H21GTGGCCCATGANONE 
J080011F22GTGGCCCATGANONE 
J080012C16GTGGCCCATGANONE 
J080013D20GTGGCCCATGANONE 
J080018K15GTGGCCCATGANONE 
J080020O14GTGGCCCATGANONE 
J080020P21GTGGCCCATGANONE 
J080021A07GTGGCCCATGANONE 
J080021B06GTGGCCCATGANONE 
J080022G21GTGGCCCATGANONE 
J080022P14GTGGCCCATGANONE 
J080023H24GTGGCCCATGANONE 
J080023M08GTGGCCCATGANONE 
J080027E08GTGGCCCATGANONE 
J080027E18GTGGCCCATGANONE 
J080027O16GTGGCCCATGANONE 
J080029M22GTGGCCCATGANONE 
J080034A17GTGGCCCATGANONE 
J080038G04GTGGCCCATGANONE 
J080040F13GTGGCCCATGANONE 
J080040F22GTGGCCCATGANONE 
J080041L15GTGGCCCATGANONE 
J080042L04GTGGCCCATGANONE 
J080042M14GTGGCCCATGANONE 
J080043C22GTGGCCCATGANONE 
J080043O09GTGGCCCATGANONE 
J080045N17GTGGCCCATGANONE 
J080046N08GTGGCCCATGANONE 
J080047K11GTGGCCCATGANONE 
J080047O06GTGGCCCATGANONE 
J080048H10GTGGCCCATGANONE 
J080048N03GTGGCCCATGANONE 
J080050N02GTGGCCCATGANONE 
J080051A05GTGGCCCATGANONE 
J080052I20GTGGCCCATGANONE 
J080053E08GTGGCCCATGANONE 
J080055P05GTGGCCCATGANONE 
J080056F15GTGGCCCATGANONE 
J080056H07GTGGCCCATGANONE 
J080057M20GTGGCCCATGANONE 
J080059K09GTGGCCCATGANONE 
J080059M10GTGGCCCATGANONE 
J080060B12GTGGCCCATGANONE 
J080061N09GTGGCCCATGANONE 
J080062H11GTGGCCCATGANONE 
J080062M13GTGGCCCATGANONE 
J080063D14GTGGCCCATGANONE 
J080063G10GTGGCCCATGANONE 
J080063H18GTGGCCCATGANONE 
J080066J23GTGGCCCATGANONE 
J080067J06GTGGCCCATGANONE 
J080069I11GTGGCCCATGANONE 
J080069O22GTGGCCCATGANONE 
J080070P11GTGGCCCATGANONE 
J080072D06GTGGCCCATGANONE 
J080072J22GTGGCCCATGANONE 
J080075A20GTGGCCCATGANONE 
J080076F11GTGGCCCATGANONE 
J080076J24GTGGCCCATGANONE 
J080076K05GTGGCCCATGANONE 
J080077O10GTGGCCCATGANONE 
J080078L19GTGGCCCATGANONE 
J080080I08GTGGCCCATGANONE 
J080081J23GTGGCCCATGANONE 
J080083A17GTGGCCCATGANONE 
J080085C05GTGGCCCATGANONE 
J080086G24GTGGCCCATGANONE 
J080087H02GTGGCCCATGANONE 
J080089A13GTGGCCCATGANONE 
J080090K08GTGGCCCATGANONE 
J080092M01GTGGCCCATGANONE 
J080095A19GTGGCCCATGANONE 
J080095B20GTGGCCCATGANONE 
J100028F13GTGGCCCATGANONE 
J100040G22GTGGCCCATGANONE 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0121200AK070123GAGGCCCATGTNONE 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
Os02g0130300011-005-D07CATGGGCCCACCTNONE 
011-041-B06CATGGGCCCACCTNONE 
015-099-D11CATGGGCCCACCTNONE 
016-049-D06CATGGGCCCACCTNONE 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0148400AK070451TCCGGCCCATGANONE 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TCCGGCCCATGANONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0180100005-013-B11TCATGGGCCCGNONE 
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700TCATGGGCCCGNONE 
J013090O22TCATGGGCCCGNONE 
J013099P19TCATGGGCCCGNONE 
J090041M21TCATGGGCCCGNONE 
J090049C14TCATGGGCCCGNONE 
Os02g0192500AK059580TTGGCCCATGNONE 
Os02g0198000AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0205300006-050-H03ACATGGGCCGGCNONE 
011-057-B04ACATGGGCCGGCNONE 
AB033537ACATGGGCCGGCNONE 
AB052887ACATGGGCCGGCNONE 
AK061762ACATGGGCCGGCNONE 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
AK106217ACATGGGCCGGCNONE 
J013000E18ACATGGGCCGGCNONE 
J023030F11ACATGGGCCGGCNONE 
J033030E16ACATGGGCCGGCNONE 
J033061B21ACATGGGCCGGCNONE 
J033086D09ACATGGGCCGGCNONE 
J033089I16ACATGGGCCGGCNONE 
J033132G01ACATGGGCCGGCNONE 
J090003O15ACATGGGCCGGCNONE 
J090004A19ACATGGGCCGGCNONE 
J090054P05ACATGGGCCGGCNONE 
J090083M17ACATGGGCCGGCNONE 
J100039E08ACATGGGCCGGCNONE 
J100058D24ACATGGGCCGGCNONE 
J100066P09ACATGGGCCGGCNONE 
J100086K12ACATGGGCCGGCNONE 
J100088J15ACATGGGCCGGCNONE 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0274000006-082-B11TCATGGGCCATNONE 
009-149-B01TCATGGGCCATNONE 
013-005-D02TCATGGGCCATNONE 
AK061802TCATGGGCCATNONE 
AK099750TCATGGGCCATConserved hypothetical protein. 
J013092A18TCATGGGCCATNONE 
J065205D02TCATGGGCCATNONE 
J080305A06TCATGGGCCATNONE 
J080306D13TCATGGGCCATNONE 
J090043E14TCATGGGCCATNONE 
J100023E14TCATGGGCCATNONE 
J100041A16TCATGGGCCATNONE 
J100078K21TCATGGGCCATNONE 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18GAGGCCCATGTNONE 
J080035D09GAGGCCCATGTNONE 
J080039E21GAGGCCCATGTNONE 
J080054N01GAGGCCCATGTNONE 
J080071C12GAGGCCCATGTNONE 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075129I09GTGTGGGCCCATGANONE 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0605600016-017-B02TCATGGGCCGCNONE 
AK066104TCATGGGCCGCLUC7 related family protein. 
J013052G16TCATGGGCCGCNONE 
J043022E03TCATGGGCCGCNONE 
J065105P10TCATGGGCCGCNONE 
Os02g0621700011-079-F10TAGGCCCATGANONE 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TAGGCCCATGANONE 
J013026C02TAGGCCCATGANONE 
J013104M10TAGGCCCATGANONE 
J023003D01TAGGCCCATGANONE 
J023007H13TAGGCCCATGANONE 
J023019G09TAGGCCCATGANONE 
J023020L19TAGGCCCATGANONE 
J023022L12TAGGCCCATGANONE 
J023022O14TAGGCCCATGANONE 
J023036F16TAGGCCCATGANONE 
J023047D16TAGGCCCATGANONE 
J023052P08TAGGCCCATGANONE 
J023077C01TAGGCCCATGANONE 
J023083M06TAGGCCCATGANONE 
J023105A11TAGGCCCATGANONE 
J023117F21TAGGCCCATGANONE 
J023119D20TAGGCCCATGANONE 
J023148E03TAGGCCCATGANONE 
J023149B13TAGGCCCATGANONE 
J033029A10TAGGCCCATGANONE 
J033046L17TAGGCCCATGANONE 
J033052M04TAGGCCCATGANONE 
J033057M14TAGGCCCATGANONE 
J033066K24TAGGCCCATGANONE 
J033069K02TAGGCCCATGANONE 
J033079G14TAGGCCCATGANONE 
J033101E06TAGGCCCATGANONE 
J033116E06TAGGCCCATGANONE 
J033118L18TAGGCCCATGANONE 
J033135B13TAGGCCCATGANONE 
J033136C10TAGGCCCATGANONE 
J033136P08TAGGCCCATGANONE 
J043027B13TAGGCCCATGANONE 
J065039I03TAGGCCCATGANONE 
J065185N21TAGGCCCATGANONE 
J090008D14TAGGCCCATGANONE 
J090029K17TAGGCCCATGANONE 
J090047H20TAGGCCCATGANONE 
J090048N17TAGGCCCATGANONE 
J090085G08TAGGCCCATGANONE 
J090089F07TAGGCCCATGANONE 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0643500AK068423TCATGGGCCAAPentapeptide repeat containing protein. 
Os02g0646200009-031-C03AACGGCCCATGNONE 
AK071507AACGGCCCATGZinc finger, B-box domain containing protein. 
J023090D24AACGGCCCATGNONE 
Os02g0655300006-024-H05CCATGGGCCACNONE 
006-032-G04CCATGGGCCACNONE 
006-045-F03CCATGGGCCACNONE 
006-076-D04CCATGGGCCACNONE 
006-086-C09CCATGGGCCACNONE 
006-104-C07CCATGGGCCACNONE 
AK061544CCATGGGCCACNONE 
AK103778CCATGGGCCACNONE 
AK106107CCATGGGCCACNONE 
AK120006CCATGGGCCACNONE 
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21CCATGGGCCACNONE 
J065021C16CCATGGGCCACNONE 
J065182F01CCATGGGCCACNONE 
J075063I18CCATGGGCCACNONE 
J075151E01CCATGGGCCACNONE 
J075198K18CCATGGGCCACNONE 
J090026M06CCATGGGCCACNONE 
J090081H02CCATGGGCCACNONE 
J100061E20CCATGGGCCACNONE 
Os02g0665400AK073914TCATGGGCCACNONE 
AK109787TCATGGGCCACNONE 
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TCATGGGCCACNONE 
J075165B08TCATGGGCCACNONE 
J075177B03TCATGGGCCACNONE 
J075191K02TCATGGGCCACNONE 
J090051I12TCATGGGCCACNONE 
J090057E21TCATGGGCCACNONE 
J090058E01TCATGGGCCACNONE 
J090087C06TCATGGGCCACNONE 
J100025K07TCATGGGCCACNONE 
J100026I21TCATGGGCCACNONE 
J100041E12TCATGGGCCACNONE 
J100083B01TCATGGGCCACNONE 
Os02g0670900003-115-B09TGTGGGCCCATGANONE 
005-004-F12TGTGGGCCCATGANONE 
006-037-B11TGTGGGCCCATGANONE 
006-094-B07TGTGGGCCCATGANONE 
011-020-A12TGTGGGCCCATGANONE 
AK061649TGTGGGCCCATGANONE 
AK061743TGTGGGCCCATGANONE 
AK064827TGTGGGCCCATGANONE 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
AK119517TGTGGGCCCATGANONE 
J013000F07TGTGGGCCCATGANONE 
J013027M02TGTGGGCCCATGANONE 
J013027M22TGTGGGCCCATGANONE 
J013031G16TGTGGGCCCATGANONE 
J013044H17TGTGGGCCCATGANONE 
J013045G22TGTGGGCCCATGANONE 
J013059N20TGTGGGCCCATGANONE 
J013063G15TGTGGGCCCATGANONE 
J013064J09TGTGGGCCCATGANONE 
J013089F14TGTGGGCCCATGANONE 
J013099L15TGTGGGCCCATGANONE 
J013119A08TGTGGGCCCATGANONE 
J013119B13TGTGGGCCCATGANONE 
J013126K07TGTGGGCCCATGANONE 
J023019J06TGTGGGCCCATGANONE 
J023019K19TGTGGGCCCATGANONE 
J023038I17TGTGGGCCCATGANONE 
J023042O17TGTGGGCCCATGANONE 
J023060G23TGTGGGCCCATGANONE 
J023064A12TGTGGGCCCATGANONE 
J023072G01TGTGGGCCCATGANONE 
J023108K16TGTGGGCCCATGANONE 
J023111D04TGTGGGCCCATGANONE 
J023134O14TGTGGGCCCATGANONE 
J023142P09TGTGGGCCCATGANONE 
J033039F01TGTGGGCCCATGANONE 
J033068J18TGTGGGCCCATGANONE 
J033117B05TGTGGGCCCATGANONE 
J033118I01TGTGGGCCCATGANONE 
J033136E10TGTGGGCCCATGANONE 
J033140C15TGTGGGCCCATGANONE 
J043024E09TGTGGGCCCATGANONE 
J043038B21TGTGGGCCCATGANONE 
J090005F19TGTGGGCCCATGANONE 
J090022N04TGTGGGCCCATGANONE 
J090023F15TGTGGGCCCATGANONE 
J090038O19TGTGGGCCCATGANONE 
J090042N22TGTGGGCCCATGANONE 
J090051C06TGTGGGCCCATGANONE 
J090063O09TGTGGGCCCATGANONE 
J090079N05TGTGGGCCCATGANONE 
J090096L17TGTGGGCCCATGANONE 
J100038G08TGTGGGCCCATGANONE 
J100041F17TGTGGGCCCATGANONE 
J100042G15TGTGGGCCCATGANONE 
J100042N11TGTGGGCCCATGANONE 
J100048B10TGTGGGCCCATGANONE 
J100056C24TGTGGGCCCATGANONE 
J100059K07TGTGGGCCCATGANONE 
J100069A06TGTGGGCCCATGANONE 
J100077B01TGTGGGCCCATGANONE 
J100089D17TGTGGGCCCATGANONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein. 
J075148E09AACGGCCCATGNONE 
J080024A08AACGGCCCATGNONE 
J080063C14AACGGCCCATGNONE 
J080072L04AACGGCCCATGNONE 
J080074H15AACGGCCCATGNONE 
J080080E22AACGGCCCATGNONE 
J080086H10AACGGCCCATGNONE 
J080093B21AACGGCCCATGNONE 
J080094G01AACGGCCCATGNONE 
J080306H24AACGGCCCATGNONE 
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0753300012-010-H04ATGGCCCATGGNONE 
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein. 
AK104930ATGGCCCATGGNONE 
J013038J04ATGGCCCATGGNONE 
J065041B21ATGGCCCATGGNONE 
J065162K13ATGGCCCATGGNONE 
J065187G18ATGGCCCATGGNONE 
J075051J11ATGGCCCATGGNONE 
J100027H02ATGGCCCATGGNONE 
Os02g0756200AK063454CGGGCCCATGGNONE 
AK101655CGGGCCCATGGSimilar to Phi-1 protein. 
J065104L21CGGGCCCATGGNONE 
J065141A07CGGGCCCATGGNONE 
Os02g0767100011-054-E05ACATGGGCCTCNONE 
AK063351ACATGGGCCTCNONE 
AK103640ACATGGGCCTCConserved hypothetical protein. 
J090022G11ACATGGGCCTCNONE 
J090072L18ACATGGGCCTCNONE 
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein. 
AK111328CATGGGCCATProtein kinase-like domain containing protein. 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os02g0782200AK070439AAGGCCCATGANONE 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein. 
Os02g0804300006-046-D12GAGGCCCATGANONE 
AK060165GAGGCCCATGANONE 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GAGGCCCATGANONE 
J023098C22GAGGCCCATGANONE 
J033123P06GAGGCCCATGANONE 
J065060N24GAGGCCCATGANONE 
J065069H22GAGGCCCATGANONE 
J065155N20GAGGCCCATGANONE 
J065170K07GAGGCCCATGANONE 
J090033D12GAGGCCCATGANONE 
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
J065055C02CAGGCCCATGANONE 
J065098A17CAGGCCCATGANONE 
J065119B13CAGGCCCATGANONE 
J065146F10CAGGCCCATGANONE 
J065209G06CAGGCCCATGANONE 
J080001K12CAGGCCCATGANONE 
J080004O17CAGGCCCATGANONE 
J080005P21CAGGCCCATGANONE 
J080009M18CAGGCCCATGANONE 
J080013O18CAGGCCCATGANONE 
J080014B04CAGGCCCATGANONE 
J080014O21CAGGCCCATGANONE 
J080015B04CAGGCCCATGANONE 
J080016B17CAGGCCCATGANONE 
J080017G09CAGGCCCATGANONE 
J080022A17CAGGCCCATGANONE 
J080024M10CAGGCCCATGANONE 
J080025F17CAGGCCCATGANONE 
J080025O16CAGGCCCATGANONE 
J080029H09CAGGCCCATGANONE 
J080030G24CAGGCCCATGANONE 
J080031E02CAGGCCCATGANONE 
J080032A18CAGGCCCATGANONE 
J080032G24CAGGCCCATGANONE 
J080033C05CAGGCCCATGANONE 
J080033N19CAGGCCCATGANONE 
J080035H10CAGGCCCATGANONE 
J080035L05CAGGCCCATGANONE 
J080042N09CAGGCCCATGANONE 
J080044C14CAGGCCCATGANONE 
J080048K16CAGGCCCATGANONE 
J080050L07CAGGCCCATGANONE 
J080051L06CAGGCCCATGANONE 
J080051P22CAGGCCCATGANONE 
J080053D09CAGGCCCATGANONE 
J080053J15CAGGCCCATGANONE 
J080053O12CAGGCCCATGANONE 
J080057L01CAGGCCCATGANONE 
J080062E08CAGGCCCATGANONE 
J080062I09CAGGCCCATGANONE 
J080063A21CAGGCCCATGANONE 
J080063E04CAGGCCCATGANONE 
J080063E08CAGGCCCATGANONE 
J080064D15CAGGCCCATGANONE 
J080064N15CAGGCCCATGANONE 
J080068F13CAGGCCCATGANONE 
J080070L16CAGGCCCATGANONE 
J080072O17CAGGCCCATGANONE 
J080075A07CAGGCCCATGANONE 
J080076H10CAGGCCCATGANONE 
J080077K19CAGGCCCATGANONE 
J080078E19CAGGCCCATGANONE 
J080082A02CAGGCCCATGANONE 
J080083O05CAGGCCCATGANONE 
J080091I07CAGGCCCATGANONE 
J080094K10CAGGCCCATGANONE 
J080094N03CAGGCCCATGANONE 
J080096F09CAGGCCCATGANONE 
J080097O04CAGGCCCATGANONE 
J090037B19CAGGCCCATGANONE 
J100017A13CAGGCCCATGANONE 
J100068N22CAGGCCCATGANONE 
J100072C06CAGGCCCATGANONE 
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein. 
Os02g0830100J013032G02TTGGCCCATGANONE 
J013052O21TTGGCCCATGANONE 
J023078A05TTGGCCCATGANONE 
J033114C07TTGGCCCATGANONE 
J033125M07TTGGCCCATGANONE 
J053045C11TTGGCCCATGANONE 
J100055G05TTGGCCCATGANONE 
J100080J22TTGGCCCATGANONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0115200009-112-E09TCGGACGGCCCATGNONE 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TCGGACGGCCCATGNONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK104882ACATGGGCCGTGNONE 
J013075C10ACATGGGCCGTGNONE 
J090012B18ACATGGGCCGTGNONE 
J090087J08ACATGGGCCGTGNONE 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0131200AB020502TGCGGCCCATGTNONE 
AK062174TGCGGCCCATGTNONE 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372TGCGGCCCATGTNONE 
J013060B21TGCGGCCCATGTNONE 
J013149P20TGCGGCCCATGTNONE 
J023060E16TGCGGCCCATGTNONE 
J043004A19TGCGGCCCATGTNONE 
J053029N09TGCGGCCCATGTNONE 
J053072I10TGCGGCCCATGTNONE 
J065016G02TGCGGCCCATGTNONE 
J065022E22TGCGGCCCATGTNONE 
J065024K17TGCGGCCCATGTNONE 
J065035E10TGCGGCCCATGTNONE 
J065036D13TGCGGCCCATGTNONE 
J065041E06TGCGGCCCATGTNONE 
J065064H14TGCGGCCCATGTNONE 
J065067I06TGCGGCCCATGTNONE 
J065080C01TGCGGCCCATGTNONE 
J065086K23TGCGGCCCATGTNONE 
J065087L12TGCGGCCCATGTNONE 
J065090I05TGCGGCCCATGTNONE 
J065117E23TGCGGCCCATGTNONE 
J065120A10TGCGGCCCATGTNONE 
J065120L22TGCGGCCCATGTNONE 
J065123F02TGCGGCCCATGTNONE 
J065128G02TGCGGCCCATGTNONE 
J065142B04TGCGGCCCATGTNONE 
J065143K12TGCGGCCCATGTNONE 
J065148B18TGCGGCCCATGTNONE 
J065153C16TGCGGCCCATGTNONE 
J065163J11TGCGGCCCATGTNONE 
J065168L24TGCGGCCCATGTNONE 
J065181J11TGCGGCCCATGTNONE 
J065190F19TGCGGCCCATGTNONE 
J065209E24TGCGGCCCATGTNONE 
J065210G04TGCGGCCCATGTNONE 
J065217H17TGCGGCCCATGTNONE 
J065219I20TGCGGCCCATGTNONE 
J075001M13TGCGGCCCATGTNONE 
J075007B08TGCGGCCCATGTNONE 
J075009I01TGCGGCCCATGTNONE 
J075014C11TGCGGCCCATGTNONE 
J075014L02TGCGGCCCATGTNONE 
J075016E07TGCGGCCCATGTNONE 
J075017J02TGCGGCCCATGTNONE 
J075018F07TGCGGCCCATGTNONE 
J075018N07TGCGGCCCATGTNONE 
J075019B06TGCGGCCCATGTNONE 
J075024F21TGCGGCCCATGTNONE 
J075026B18TGCGGCCCATGTNONE 
J075026M12TGCGGCCCATGTNONE 
J075032B13TGCGGCCCATGTNONE 
J075033O09TGCGGCCCATGTNONE 
J075041A09TGCGGCCCATGTNONE 
J075045L13TGCGGCCCATGTNONE 
J075048N11TGCGGCCCATGTNONE 
J075052A14TGCGGCCCATGTNONE 
J075061B17TGCGGCCCATGTNONE 
J075061I05TGCGGCCCATGTNONE 
J075066I11TGCGGCCCATGTNONE 
J075066P09TGCGGCCCATGTNONE 
J075068F03TGCGGCCCATGTNONE 
J075068P22TGCGGCCCATGTNONE 
J075080I15TGCGGCCCATGTNONE 
J075081I07TGCGGCCCATGTNONE 
J075082K01TGCGGCCCATGTNONE 
J075083A18TGCGGCCCATGTNONE 
J075086O11TGCGGCCCATGTNONE 
J075087E02TGCGGCCCATGTNONE 
J075087M19TGCGGCCCATGTNONE 
J075088G23TGCGGCCCATGTNONE 
J075092K18TGCGGCCCATGTNONE 
J075095H15TGCGGCCCATGTNONE 
J075095K12TGCGGCCCATGTNONE 
J075096L06TGCGGCCCATGTNONE 
J075100H23TGCGGCCCATGTNONE 
J075100K01TGCGGCCCATGTNONE 
J075102K21TGCGGCCCATGTNONE 
J075104F24TGCGGCCCATGTNONE 
J075106C17TGCGGCCCATGTNONE 
J075106E06TGCGGCCCATGTNONE 
J075106M19TGCGGCCCATGTNONE 
J075106O12TGCGGCCCATGTNONE 
J075108I09TGCGGCCCATGTNONE 
J075111M06TGCGGCCCATGTNONE 
J075112E12TGCGGCCCATGTNONE 
J075114C04TGCGGCCCATGTNONE 
J075120A06TGCGGCCCATGTNONE 
J075120D14TGCGGCCCATGTNONE 
J075122P15TGCGGCCCATGTNONE 
J075123A11TGCGGCCCATGTNONE 
J075123L12TGCGGCCCATGTNONE 
J075127G14TGCGGCCCATGTNONE 
J075127H09TGCGGCCCATGTNONE 
J075128M04TGCGGCCCATGTNONE 
J075129J04TGCGGCCCATGTNONE 
J075130J01TGCGGCCCATGTNONE 
J075137N02TGCGGCCCATGTNONE 
J075137O14TGCGGCCCATGTNONE 
J075138H22TGCGGCCCATGTNONE 
J075139P16TGCGGCCCATGTNONE 
J075141G08TGCGGCCCATGTNONE 
J075142C17TGCGGCCCATGTNONE 
J075143B09TGCGGCCCATGTNONE 
J075156I11TGCGGCCCATGTNONE 
J075158M03TGCGGCCCATGTNONE 
J075166I21TGCGGCCCATGTNONE 
J075167C08TGCGGCCCATGTNONE 
J075170C12TGCGGCCCATGTNONE 
J075170F08TGCGGCCCATGTNONE 
J075170G04TGCGGCCCATGTNONE 
J075172N16TGCGGCCCATGTNONE 
J075172P13TGCGGCCCATGTNONE 
J075173G24TGCGGCCCATGTNONE 
J075175D01TGCGGCCCATGTNONE 
J075175K01TGCGGCCCATGTNONE 
J075181O04TGCGGCCCATGTNONE 
J075186A04TGCGGCCCATGTNONE 
J075190B08TGCGGCCCATGTNONE 
J075190M24TGCGGCCCATGTNONE 
J075193D18TGCGGCCCATGTNONE 
J075193H03TGCGGCCCATGTNONE 
J075195N18TGCGGCCCATGTNONE 
J080001N20TGCGGCCCATGTNONE 
J080006K17TGCGGCCCATGTNONE 
J080012I16TGCGGCCCATGTNONE 
J080013K20TGCGGCCCATGTNONE 
J080018N01TGCGGCCCATGTNONE 
J080041G15TGCGGCCCATGTNONE 
J080048L15TGCGGCCCATGTNONE 
J080049A21TGCGGCCCATGTNONE 
J080075G12TGCGGCCCATGTNONE 
J080076O09TGCGGCCCATGTNONE 
J080078P10TGCGGCCCATGTNONE 
J080084D10TGCGGCCCATGTNONE 
J090005N07TGCGGCCCATGTNONE 
Os03g0131400015-012-D11TCTGGGCCCATGANONE 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21ACATGGGCCGCANONE 
J023025G21CAGGCCCATGANONE 
J033073C08ACATGGGCCGCANONE 
J033073C08CAGGCCCATGANONE 
J033094C19ACATGGGCCGCANONE 
J033094C19CAGGCCCATGANONE 
J065017L10ACATGGGCCGCANONE 
J065017L10CAGGCCCATGANONE 
J065070H22ACATGGGCCGCANONE 
J065070H22CAGGCCCATGANONE 
J065079M09ACATGGGCCGCANONE 
J065079M09CAGGCCCATGANONE 
J065091N18ACATGGGCCGCANONE 
J065091N18CAGGCCCATGANONE 
J065109N03ACATGGGCCGCANONE 
J065109N03CAGGCCCATGANONE 
J065113F05ACATGGGCCGCANONE 
J065113F05CAGGCCCATGANONE 
J065135D23ACATGGGCCGCANONE 
J065135D23CAGGCCCATGANONE 
J065156L16ACATGGGCCGCANONE 
J065156L16CAGGCCCATGANONE 
J065207O04ACATGGGCCGCANONE 
J065207O04CAGGCCCATGANONE 
J065208F03ACATGGGCCGCANONE 
J065208F03CAGGCCCATGANONE 
J090010M15ACATGGGCCGCANONE 
J090010M15CAGGCCCATGANONE 
J090056J18ACATGGGCCGCANONE 
J090056J18CAGGCCCATGANONE 
Os03g0145700AK065716AGGGCCCATGNONE 
J013039F14AGGGCCCATGNONE 
J013091M20AGGGCCCATGNONE 
J065059P20AGGGCCCATGNONE 
J065128M07AGGGCCCATGNONE 
J065136N23AGGGCCCATGNONE 
J065163H21AGGGCCCATGNONE 
J065176B18AGGGCCCATGNONE 
J065177A17AGGGCCCATGNONE 
J065201F24AGGGCCCATGNONE 
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein. 
AK100518CATGGGCCTCNONE 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein. 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0195900J065063O15GAGGCCCATGANONE 
Os03g0200500005-016-A06CATGGGCCTANONE 
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein). 
AK104243CATGGGCCTANONE 
AK104699CATGGGCCTANONE 
D26060CATGGGCCTANONE 
J013024H20CATGGGCCTANONE 
J013029C14CATGGGCCTANONE 
J013035O17CATGGGCCTANONE 
J013066B11CATGGGCCTANONE 
J013066B12CATGGGCCTANONE 
J013066B13CATGGGCCTANONE 
J013152M04CATGGGCCTANONE 
J023001A03CATGGGCCTANONE 
J023013H23CATGGGCCTANONE 
J023042L07CATGGGCCTANONE 
J023081L11CATGGGCCTANONE 
J023088I23CATGGGCCTANONE 
J023092N22CATGGGCCTANONE 
J023126A20CATGGGCCTANONE 
J023139A17CATGGGCCTANONE 
J023150G12CATGGGCCTANONE 
J033026M10CATGGGCCTANONE 
J033031H24CATGGGCCTANONE 
J033036C22CATGGGCCTANONE 
J033037P08CATGGGCCTANONE 
J033045G14CATGGGCCTANONE 
J033048A13CATGGGCCTANONE 
J033048B13CATGGGCCTANONE 
J033048K11CATGGGCCTANONE 
J033066A06CATGGGCCTANONE 
J033072H01CATGGGCCTANONE 
J033082K07CATGGGCCTANONE 
J033091G20CATGGGCCTANONE 
J033095C14CATGGGCCTANONE 
J033101N24CATGGGCCTANONE 
J033105L15CATGGGCCTANONE 
J033107J18CATGGGCCTANONE 
J033112L02CATGGGCCTANONE 
J033117I17CATGGGCCTANONE 
J043003K06CATGGGCCTANONE 
J043016I20CATGGGCCTANONE 
J043021A10CATGGGCCTANONE 
J043034F14CATGGGCCTANONE 
J065002O17CATGGGCCTANONE 
J065014B14CATGGGCCTANONE 
J065054N19CATGGGCCTANONE 
J065112P18CATGGGCCTANONE 
J065121B20CATGGGCCTANONE 
J065170M08CATGGGCCTANONE 
J065194B05CATGGGCCTANONE 
J090040F01CATGGGCCTANONE 
J090078O20CATGGGCCTANONE 
J090078P21CATGGGCCTANONE 
J090084E11CATGGGCCTANONE 
J100080B11CATGGGCCTANONE 
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein. 
AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGCNONE 
AK121985ACATGGGCCGTCNONE 
J023114O06ACATGGGCCGCNONE 
J023114O06ACATGGGCCGTCNONE 
J100043M20ACATGGGCCGCNONE 
J100043M20ACATGGGCCGTCNONE 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
J023112P05TCATGGGCCTANONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein. 
Os03g0324800AK059868ACATGGGCCATNONE 
AK071431ACATGGGCCATHypothetical protein. 
Os03g0324900014-018-F11GTGGCCCATGANONE 
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein. 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
AK102274ACATGGGCCAGANONE 
J033089C06ACATGGGCCAGANONE 
J090089A17ACATGGGCCAGANONE 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
J100033H02CCATGGGCCCACCNONE 
Os03g0352800009-030-G08ACATGGGCCGTANONE 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17ACATGGGCCGTANONE 
J075050N19ACATGGGCCGTANONE 
J075104J18ACATGGGCCGTANONE 
J075142K05ACATGGGCCGTANONE 
J100050I19ACATGGGCCGTANONE 
J100057N04ACATGGGCCGTANONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0364000J065042L07TCATGGGCCTGNONE 
J065061O16TCATGGGCCTGNONE 
J065075L02TCATGGGCCTGNONE 
J065138N02TCATGGGCCTGNONE 
J065209H20TCATGGGCCTGNONE 
J075019G03TCATGGGCCTGNONE 
J075086E23TCATGGGCCTGNONE 
J075094M12TCATGGGCCTGNONE 
J075139L07TCATGGGCCTGNONE 
J075162I16TCATGGGCCTGNONE 
J075199G20TCATGGGCCTGNONE 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0383100AK107106CTGGCCCATGAConserved hypothetical protein. 
Os03g0389700AK061085CCATGGGCCNONE 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0410700J065102A22GCGGCCCATGANONE 
J065102A22GCGGCCCATGGNONE 
Os03g0410900J065067F10CCATGGGCCGCNONE 
J065067F10TCATGGGCCGCNONE 
J065073D08CCATGGGCCGCNONE 
J065073D08TCATGGGCCGCNONE 
J065176C06CCATGGGCCGCNONE 
J065176C06TCATGGGCCGCNONE 
J065189O13CCATGGGCCGCNONE 
J065189O13TCATGGGCCGCNONE 
J065214E05CCATGGGCCGCNONE 
J065214E05TCATGGGCCGCNONE 
J080007H09CCATGGGCCGCNONE 
J080007H09TCATGGGCCGCNONE 
J080012B19CCATGGGCCGCNONE 
J080012B19TCATGGGCCGCNONE 
J080020J16CCATGGGCCGCNONE 
J080020J16TCATGGGCCGCNONE 
J080038J22CCATGGGCCGCNONE 
J080038J22TCATGGGCCGCNONE 
J080045I09CCATGGGCCGCNONE 
J080045I09TCATGGGCCGCNONE 
J080059M16CCATGGGCCGCNONE 
J080059M16TCATGGGCCGCNONE 
J080060C19CCATGGGCCGCNONE 
J080060C19TCATGGGCCGCNONE 
J080080P22CCATGGGCCGCNONE 
J080080P22TCATGGGCCGCNONE 
J080083C03CCATGGGCCGCNONE 
J080083C03TCATGGGCCGCNONE 
J080093M17CCATGGGCCGCNONE 
J080093M17TCATGGGCCGCNONE 
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
Os03g0411500AK058696TAGGCCCATGANONE 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein. 
Os03g0566600011-071-A08ACATGGGCCATNONE 
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein. 
Os03g0566800AK103270CATGGGCCATSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CATGGGCCATNONE 
J023136P06CATGGGCCATNONE 
J033081A22CATGGGCCATNONE 
J033109N12CATGGGCCATNONE 
J033124H10CATGGGCCATNONE 
J033141B09CATGGGCCATNONE 
J090026G23CATGGGCCATNONE 
J090077J20CATGGGCCATNONE 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0581600J065037H09TCATGGGCCTGNONE 
J065183O12TCATGGGCCTGNONE 
Os03g0586800003-114-H11TCATGGGCCAGGCCCNONE 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TCATGGGCCAGGCCCNONE 
J090004H06TCATGGGCCAGGCCCNONE 
J090022N15TCATGGGCCAGGCCCNONE 
J100035E05TCATGGGCCAGGCCCNONE 
J100041L05TCATGGGCCAGGCCCNONE 
J100041M18TCATGGGCCAGGCCCNONE 
J100057P04TCATGGGCCAGGCCCNONE 
J100089H06TCATGGGCCAGGCCCNONE 
J100090C23TCATGGGCCAGGCCCNONE 
Os03g0606200009-030-E09CCCGGCCCATGTNONE 
009-076-H10CCCGGCCCATGTNONE 
009-122-H12CCCGGCCCATGTNONE 
009-153-F09CCCGGCCCATGTNONE 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCCGGCCCATGTNONE 
AK107928CCCGGCCCATGTNONE 
J023078E13CCCGGCCCATGTNONE 
J053031N01CCCGGCCCATGTNONE 
J053046K19CCCGGCCCATGTNONE 
J053062P07CCCGGCCCATGTNONE 
J053091C23CCCGGCCCATGTNONE 
J053099N19CCCGGCCCATGTNONE 
J065005E06CCCGGCCCATGTNONE 
J065030N03CCCGGCCCATGTNONE 
J065138O21CCCGGCCCATGTNONE 
J065159K03CCCGGCCCATGTNONE 
J075030M08CCCGGCCCATGTNONE 
J080006E23CCCGGCCCATGTNONE 
J080010D10CCCGGCCCATGTNONE 
J080016N17CCCGGCCCATGTNONE 
J080024N09CCCGGCCCATGTNONE 
J080028E23CCCGGCCCATGTNONE 
J080035I11CCCGGCCCATGTNONE 
J080038D15CCCGGCCCATGTNONE 
J080040H08CCCGGCCCATGTNONE 
J080043L04CCCGGCCCATGTNONE 
J080047C06CCCGGCCCATGTNONE 
J080061G04CCCGGCCCATGTNONE 
J080066E10CCCGGCCCATGTNONE 
J080067P03CCCGGCCCATGTNONE 
J080082D07CCCGGCCCATGTNONE 
J080089M13CCCGGCCCATGTNONE 
J080094O09CCCGGCCCATGTNONE 
J080095C24CCCGGCCCATGTNONE 
J080309E21CCCGGCCCATGTNONE 
J090016G15CCCGGCCCATGTNONE 
J090031C20CCCGGCCCATGTNONE 
J090033A15CCCGGCCCATGTNONE 
J090037L07CCCGGCCCATGTNONE 
J090038I10CCCGGCCCATGTNONE 
J090072P19CCCGGCCCATGTNONE 
J100040J02CCCGGCCCATGTNONE 
J100047N05CCCGGCCCATGTNONE 
J100048M10CCCGGCCCATGTNONE 
J100076C02CCCGGCCCATGTNONE 
J100077G23CCCGGCCCATGTNONE 
J100080O08CCCGGCCCATGTNONE 
J100085C06CCCGGCCCATGTNONE 
J100085F16CCCGGCCCATGTNONE 
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39. 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23TTTCGGCCCATGANONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0670700009-028-B03GCGGCCCATGTNONE 
009-036-H12GCGGCCCATGTNONE 
009-053-H05GCGGCCCATGTNONE 
009-126-B02GCGGCCCATGTNONE 
009-135-D07GCGGCCCATGTNONE 
009-148-A03GCGGCCCATGTNONE 
009-148-A12GCGGCCCATGTNONE 
009-152-B02GCGGCCCATGTNONE 
009-153-B06GCGGCCCATGTNONE 
009-166-G05GCGGCCCATGTNONE 
009-181-A09GCGGCCCATGTNONE 
011-061-D07GCGGCCCATGTNONE 
012-043-C04GCGGCCCATGTNONE 
013-001-A02GCGGCCCATGTNONE 
013-004-F05GCGGCCCATGTNONE 
013-008-C08GCGGCCCATGTNONE 
013-015-B09GCGGCCCATGTNONE 
013-016-G05GCGGCCCATGTNONE 
013-023-A06GCGGCCCATGTNONE 
013-023-B06GCGGCCCATGTNONE 
013-032-F09GCGGCCCATGTNONE 
013-059-C07GCGGCCCATGTNONE 
013-071-E09GCGGCCCATGTNONE 
013-073-D06GCGGCCCATGTNONE 
013-077-C02GCGGCCCATGTNONE 
013-078-B12GCGGCCCATGTNONE 
013-093-A01GCGGCCCATGTNONE 
014-002-B12GCGGCCCATGTNONE 
014-003-E08GCGGCCCATGTNONE 
014-004-D06GCGGCCCATGTNONE 
014-007-C11GCGGCCCATGTNONE 
014-007-G10GCGGCCCATGTNONE 
014-019-C04GCGGCCCATGTNONE 
014-021-F05GCGGCCCATGTNONE 
014-024-G06GCGGCCCATGTNONE 
014-027-C07GCGGCCCATGTNONE 
014-027-D03GCGGCCCATGTNONE 
014-029-E07GCGGCCCATGTNONE 
014-031-B04GCGGCCCATGTNONE 
014-033-B05GCGGCCCATGTNONE 
014-033-C03GCGGCCCATGTNONE 
014-033-C12GCGGCCCATGTNONE 
014-036-F01GCGGCCCATGTNONE 
014-037-C04GCGGCCCATGTNONE 
014-040-H02GCGGCCCATGTNONE 
014-045-H04GCGGCCCATGTNONE 
014-045-H06GCGGCCCATGTNONE 
014-052-A08GCGGCCCATGTNONE 
014-076-G01GCGGCCCATGTNONE 
014-083-F04GCGGCCCATGTNONE 
014-086-E01GCGGCCCATGTNONE 
014-091-D02GCGGCCCATGTNONE 
014-091-F05GCGGCCCATGTNONE 
014-093-E10GCGGCCCATGTNONE 
014-100-C10GCGGCCCATGTNONE 
015-011-H02GCGGCCCATGTNONE 
015-073-B03GCGGCCCATGTNONE 
AF010579GCGGCCCATGTNONE 
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATGTNONE 
AK119238GCGGCCCATGTNONE 
AK119242GCGGCCCATGTNONE 
J023037K17GCGGCCCATGTNONE 
J033136F11GCGGCCCATGTNONE 
J065008C13GCGGCCCATGTNONE 
J065032K18GCGGCCCATGTNONE 
J065043N10GCGGCCCATGTNONE 
J065045E06GCGGCCCATGTNONE 
J065046P21GCGGCCCATGTNONE 
J065048J17GCGGCCCATGTNONE 
J065053I23GCGGCCCATGTNONE 
J065053P03GCGGCCCATGTNONE 
J065054C13GCGGCCCATGTNONE 
J065058I17GCGGCCCATGTNONE 
J065061I12GCGGCCCATGTNONE 
J065062E09GCGGCCCATGTNONE 
J065063P04GCGGCCCATGTNONE 
J065068J07GCGGCCCATGTNONE 
J065076D02GCGGCCCATGTNONE 
J065083O07GCGGCCCATGTNONE 
J065090J02GCGGCCCATGTNONE 
J065093N08GCGGCCCATGTNONE 
J065097F02GCGGCCCATGTNONE 
J065112H17GCGGCCCATGTNONE 
J065121B01GCGGCCCATGTNONE 
J065124F12GCGGCCCATGTNONE 
J065130L03GCGGCCCATGTNONE 
J065131K05GCGGCCCATGTNONE 
J065132C06GCGGCCCATGTNONE 
J065135J18GCGGCCCATGTNONE 
J065138J22GCGGCCCATGTNONE 
J065140G21GCGGCCCATGTNONE 
J065161B19GCGGCCCATGTNONE 
J065162F22GCGGCCCATGTNONE 
J065162M09GCGGCCCATGTNONE 
J065163D03GCGGCCCATGTNONE 
J065163O21GCGGCCCATGTNONE 
J065165H11GCGGCCCATGTNONE 
J065165O16GCGGCCCATGTNONE 
J065167N06GCGGCCCATGTNONE 
J065168I08GCGGCCCATGTNONE 
J065170A14GCGGCCCATGTNONE 
J065170L03GCGGCCCATGTNONE 
J065171C08GCGGCCCATGTNONE 
J065173G11GCGGCCCATGTNONE 
J065173M09GCGGCCCATGTNONE 
J065176P07GCGGCCCATGTNONE 
J065178K24GCGGCCCATGTNONE 
J065185O12GCGGCCCATGTNONE 
J065191E02GCGGCCCATGTNONE 
J065204H10GCGGCCCATGTNONE 
J075033C23GCGGCCCATGTNONE 
J075041M21GCGGCCCATGTNONE 
J075043F13GCGGCCCATGTNONE 
J075044D02GCGGCCCATGTNONE 
J075044J15GCGGCCCATGTNONE 
J075048L07GCGGCCCATGTNONE 
J075054G12GCGGCCCATGTNONE 
J075055J10GCGGCCCATGTNONE 
J075059F09GCGGCCCATGTNONE 
J075066M23GCGGCCCATGTNONE 
J075071O09GCGGCCCATGTNONE 
J075085G23GCGGCCCATGTNONE 
J075086B21GCGGCCCATGTNONE 
J075087L18GCGGCCCATGTNONE 
J075087L21GCGGCCCATGTNONE 
J075087N14GCGGCCCATGTNONE 
J075088O13GCGGCCCATGTNONE 
J075089B06GCGGCCCATGTNONE 
J075089E20GCGGCCCATGTNONE 
J075090J01GCGGCCCATGTNONE 
J075090L05GCGGCCCATGTNONE 
J075091G05GCGGCCCATGTNONE 
J075091N06GCGGCCCATGTNONE 
J075093G08GCGGCCCATGTNONE 
J075094C13GCGGCCCATGTNONE 
J075095K01GCGGCCCATGTNONE 
J075096C02GCGGCCCATGTNONE 
J075097L16GCGGCCCATGTNONE 
J075097O10GCGGCCCATGTNONE 
J075098H24GCGGCCCATGTNONE 
J075099H02GCGGCCCATGTNONE 
J075099J11GCGGCCCATGTNONE 
J075099L08GCGGCCCATGTNONE 
J075109I11GCGGCCCATGTNONE 
J075114F03GCGGCCCATGTNONE 
J075121G07GCGGCCCATGTNONE 
J075122D23GCGGCCCATGTNONE 
J075132O07GCGGCCCATGTNONE 
J075141L21GCGGCCCATGTNONE 
J075142I08GCGGCCCATGTNONE 
J075145A06GCGGCCCATGTNONE 
J075147J15GCGGCCCATGTNONE 
J075150B09GCGGCCCATGTNONE 
J075151E07GCGGCCCATGTNONE 
J075161M16GCGGCCCATGTNONE 
J075190I16GCGGCCCATGTNONE 
J075192L05GCGGCCCATGTNONE 
J075192O03GCGGCCCATGTNONE 
J075192O08GCGGCCCATGTNONE 
J075193L12GCGGCCCATGTNONE 
J080001M24GCGGCCCATGTNONE 
J080004E20GCGGCCCATGTNONE 
J080005K15GCGGCCCATGTNONE 
J080005L05GCGGCCCATGTNONE 
J080014P20GCGGCCCATGTNONE 
J080029D12GCGGCCCATGTNONE 
J080030H09GCGGCCCATGTNONE 
J080039G05GCGGCCCATGTNONE 
J080040E18GCGGCCCATGTNONE 
J080041B02GCGGCCCATGTNONE 
J080041E06GCGGCCCATGTNONE 
J080041G05GCGGCCCATGTNONE 
J080041G24GCGGCCCATGTNONE 
J080041H07GCGGCCCATGTNONE 
J080041K03GCGGCCCATGTNONE 
J080047G01GCGGCCCATGTNONE 
J080052E07GCGGCCCATGTNONE 
J080053B15GCGGCCCATGTNONE 
J080053N01GCGGCCCATGTNONE 
J080054I01GCGGCCCATGTNONE 
J080054N02GCGGCCCATGTNONE 
J080063P03GCGGCCCATGTNONE 
J080064E13GCGGCCCATGTNONE 
J080064G13GCGGCCCATGTNONE 
J080065F02GCGGCCCATGTNONE 
J080065G03GCGGCCCATGTNONE 
J080065K17GCGGCCCATGTNONE 
J080067D06GCGGCCCATGTNONE 
J080067H23GCGGCCCATGTNONE 
J080067M15GCGGCCCATGTNONE 
J080068B20GCGGCCCATGTNONE 
J080068G24GCGGCCCATGTNONE 
J080072K19GCGGCCCATGTNONE 
J080076I24GCGGCCCATGTNONE 
J080092F05GCGGCCCATGTNONE 
J080092K14GCGGCCCATGTNONE 
J080092N22GCGGCCCATGTNONE 
J080093K02GCGGCCCATGTNONE 
J080094C08GCGGCCCATGTNONE 
J080094E09GCGGCCCATGTNONE 
J080094E20GCGGCCCATGTNONE 
J080094G08GCGGCCCATGTNONE 
J080094H18GCGGCCCATGTNONE 
J080094P22GCGGCCCATGTNONE 
J080095J23GCGGCCCATGTNONE 
J080096F14GCGGCCCATGTNONE 
J080097A21GCGGCCCATGTNONE 
J080097I07GCGGCCCATGTNONE 
J080097J02GCGGCCCATGTNONE 
J080097K01GCGGCCCATGTNONE 
J080097K03GCGGCCCATGTNONE 
J080305H18GCGGCCCATGTNONE 
J080306G01GCGGCCCATGTNONE 
J080306O08GCGGCCCATGTNONE 
J080311I01GCGGCCCATGTNONE 
J080315N24GCGGCCCATGTNONE 
J090003K21GCGGCCCATGTNONE 
J090008C20GCGGCCCATGTNONE 
J090008K19GCGGCCCATGTNONE 
J090008P13GCGGCCCATGTNONE 
J090015H22GCGGCCCATGTNONE 
J090016M01GCGGCCCATGTNONE 
J090018E13GCGGCCCATGTNONE 
J090018G03GCGGCCCATGTNONE 
J090018L17GCGGCCCATGTNONE 
J090019H11GCGGCCCATGTNONE 
J090021B19GCGGCCCATGTNONE 
J090021K02GCGGCCCATGTNONE 
J090023H15GCGGCCCATGTNONE 
J090034E03GCGGCCCATGTNONE 
J090045D16GCGGCCCATGTNONE 
J090045I06GCGGCCCATGTNONE 
J090047L09GCGGCCCATGTNONE 
J090048B05GCGGCCCATGTNONE 
J090048D11GCGGCCCATGTNONE 
J090048N11GCGGCCCATGTNONE 
J090050F20GCGGCCCATGTNONE 
J090052M20GCGGCCCATGTNONE 
J090083H03GCGGCCCATGTNONE 
J090084C12GCGGCCCATGTNONE 
J090095B05GCGGCCCATGTNONE 
J090095M18GCGGCCCATGTNONE 
J100024I22GCGGCCCATGTNONE 
J100024J12GCGGCCCATGTNONE 
J100024J22GCGGCCCATGTNONE 
J100025F07GCGGCCCATGTNONE 
J100026B13GCGGCCCATGTNONE 
J100027N03GCGGCCCATGTNONE 
J100029F14GCGGCCCATGTNONE 
J100029L20GCGGCCCATGTNONE 
J100032C22GCGGCCCATGTNONE 
J100032I08GCGGCCCATGTNONE 
J100032O05GCGGCCCATGTNONE 
J100033J24GCGGCCCATGTNONE 
J100033L12GCGGCCCATGTNONE 
J100034K06GCGGCCCATGTNONE 
J100037D09GCGGCCCATGTNONE 
J100038H02GCGGCCCATGTNONE 
J100039A12GCGGCCCATGTNONE 
J100039N12GCGGCCCATGTNONE 
J100039O21GCGGCCCATGTNONE 
J100040K05GCGGCCCATGTNONE 
J100042A02GCGGCCCATGTNONE 
J100042A17GCGGCCCATGTNONE 
J100043C15GCGGCCCATGTNONE 
J100044A17GCGGCCCATGTNONE 
J100044E18GCGGCCCATGTNONE 
J100044I11GCGGCCCATGTNONE 
J100044J15GCGGCCCATGTNONE 
J100045E23GCGGCCCATGTNONE 
J100049B18GCGGCCCATGTNONE 
J100050G04GCGGCCCATGTNONE 
J100051D06GCGGCCCATGTNONE 
J100051H20GCGGCCCATGTNONE 
J100052J01GCGGCCCATGTNONE 
J100052K07GCGGCCCATGTNONE 
J100055I01GCGGCCCATGTNONE 
J100057D02GCGGCCCATGTNONE 
J100059G14GCGGCCCATGTNONE 
J100059G21GCGGCCCATGTNONE 
J100059H03GCGGCCCATGTNONE 
J100059H15GCGGCCCATGTNONE 
J100063E13GCGGCCCATGTNONE 
J100063M02GCGGCCCATGTNONE 
J100064B17GCGGCCCATGTNONE 
J100064F11GCGGCCCATGTNONE 
J100066G12GCGGCCCATGTNONE 
J100066H09GCGGCCCATGTNONE 
J100068B12GCGGCCCATGTNONE 
J100068L16GCGGCCCATGTNONE 
J100068M23GCGGCCCATGTNONE 
J100069A02GCGGCCCATGTNONE 
J100069D07GCGGCCCATGTNONE 
J100069M13GCGGCCCATGTNONE 
J100070C07GCGGCCCATGTNONE 
J100070J11GCGGCCCATGTNONE 
J100070L20GCGGCCCATGTNONE 
J100071H10GCGGCCCATGTNONE 
J100072L14GCGGCCCATGTNONE 
J100072N12GCGGCCCATGTNONE 
J100073A21GCGGCCCATGTNONE 
J100074K17GCGGCCCATGTNONE 
J100074M04GCGGCCCATGTNONE 
J100075F11GCGGCCCATGTNONE 
J100076E23GCGGCCCATGTNONE 
J100076G03GCGGCCCATGTNONE 
J100077K01GCGGCCCATGTNONE 
J100077N23GCGGCCCATGTNONE 
J100079H17GCGGCCCATGTNONE 
J100081N01GCGGCCCATGTNONE 
J100082E04GCGGCCCATGTNONE 
J100082K11GCGGCCCATGTNONE 
J100085H23GCGGCCCATGTNONE 
J100086O18GCGGCCCATGTNONE 
J100087F21GCGGCCCATGTNONE 
J100088E02GCGGCCCATGTNONE 
J100088F08GCGGCCCATGTNONE 
J100088G24GCGGCCCATGTNONE 
J100088K20GCGGCCCATGTNONE 
J100089B19GCGGCCCATGTNONE 
J100089K22GCGGCCCATGTNONE 
J100089N22GCGGCCCATGTNONE 
J100089O17GCGGCCCATGTNONE 
J100090N05GCGGCCCATGTNONE 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
J065094N08TCATGGGCCTGNONE 
J065108H06TCATGGGCCTGNONE 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein. 
AK120533GCGGCCCATGANONE 
J043026E20GCGGCCCATGANONE 
Os03g0736700006-022-F08ATGGCCCATGGNONE 
006-042-H09ATGGCCCATGGNONE 
006-053-H02ATGGCCCATGGNONE 
009-127-A06ATGGCCCATGGNONE 
013-089-C06ATGGCCCATGGNONE 
AK060947ATGGCCCATGGGRAM domain containing protein. 
AK073026ATGGCCCATGGNONE 
AK104415ATGGCCCATGGNONE 
AK104642ATGGCCCATGGNONE 
J065027H19ATGGCCCATGGNONE 
J065059K06ATGGCCCATGGNONE 
J065065I02ATGGCCCATGGNONE 
J065085E10ATGGCCCATGGNONE 
J065140M09ATGGCCCATGGNONE 
J075115M21ATGGCCCATGGNONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
J080305A09ACATGGGCCGGANONE 
J080310E24ACATGGGCCGGANONE 
J080310O12ACATGGGCCGGANONE 
J080311N04ACATGGGCCGGANONE 
J080313N20ACATGGGCCGGANONE 
J080317H24ACATGGGCCGGANONE 
Os03g0757900011-060-H04GTGGCCCATGGNONE 
011-082-B10GTGGCCCATGGNONE 
012-053-F12GTGGCCCATGGNONE 
013-029-C07GTGGCCCATGGNONE 
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
J023009B02GTGGCCCATGGNONE 
J023085H11GTGGCCCATGGNONE 
J023135M18GTGGCCCATGGNONE 
J023147P04GTGGCCCATGGNONE 
J033072J22GTGGCCCATGGNONE 
J033128J06GTGGCCCATGGNONE 
Os03g0769600AK100054CCATGGGCCACResB-like family protein. 
AK100054TCATGGGCCCTResB-like family protein. 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0787100006-022-G04CAAGGCCCATGANONE 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
J065197C24CAAGGCCCATGANONE 
J075147E03CAAGGCCCATGANONE 
J100065K06CAAGGCCCATGANONE 
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0807800AK064984ATGGCCCATGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14ATGGCCCATGNONE 
J065015J20ATGGCCCATGNONE 
J065122L11ATGGCCCATGNONE 
J065217E10ATGGCCCATGNONE 
J075023C02ATGGCCCATGNONE 
J075102O04ATGGCCCATGNONE 
J080024G24ATGGCCCATGNONE 
J080033F02ATGGCCCATGNONE 
J080047M13ATGGCCCATGNONE 
J080048A22ATGGCCCATGNONE 
J080056E06ATGGCCCATGNONE 
J080064O11ATGGCCCATGNONE 
Os03g0824400AK070153CACGGCCCATGGNONE 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCCATTTNONE 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCCATTTNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCCATTTNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCCATTTNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCCATTTNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCCATTTNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCCATTTNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCCATTTNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
J033086B08ACATGGGCCGAANONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os03g0854000009-186-C03GAGGCCCATGNONE 
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein. 
J065138B11GAGGCCCATGNONE 
Os03g0855600006-029-G09GTGGCCCATGGNONE 
006-033-E02GTGGCCCATGGNONE 
006-069-G07GTGGCCCATGGNONE 
006-083-A02GTGGCCCATGGNONE 
006-098-H04GTGGCCCATGGNONE 
009-054-C04GTGGCCCATGGNONE 
AK060030GTGGCCCATGGNONE 
AK061467GTGGCCCATGGConserved hypothetical protein. 
AK067858GTGGCCCATGGNONE 
AK106030GTGGCCCATGGNONE 
J013123A10GTGGCCCATGGNONE 
J065001I24GTGGCCCATGGNONE 
J065015N21GTGGCCCATGGNONE 
J065016H07GTGGCCCATGGNONE 
J065040A05GTGGCCCATGGNONE 
J065040F01GTGGCCCATGGNONE 
J065066G17GTGGCCCATGGNONE 
J065077I09GTGGCCCATGGNONE 
J065099M22GTGGCCCATGGNONE 
J065135B13GTGGCCCATGGNONE 
J065144H19GTGGCCCATGGNONE 
J065146I03GTGGCCCATGGNONE 
J065169E02GTGGCCCATGGNONE 
J065177D21GTGGCCCATGGNONE 
J065189L20GTGGCCCATGGNONE 
J065207H13GTGGCCCATGGNONE 
J065210D24GTGGCCCATGGNONE 
J065212I03GTGGCCCATGGNONE 
J075007E21GTGGCCCATGGNONE 
J075013H07GTGGCCCATGGNONE 
J075023K06GTGGCCCATGGNONE 
J075031D23GTGGCCCATGGNONE 
J075038K09GTGGCCCATGGNONE 
J075084C08GTGGCCCATGGNONE 
J075098K20GTGGCCCATGGNONE 
J090028E04GTGGCCCATGGNONE 
J090031E20GTGGCCCATGGNONE 
J090042F06GTGGCCCATGGNONE 
J090049L05GTGGCCCATGGNONE 
J090086G03GTGGCCCATGGNONE 
J090096J04GTGGCCCATGGNONE 
J100035O03GTGGCCCATGGNONE 
J100053H24GTGGCCCATGGNONE 
J100056L17GTGGCCCATGGNONE 
J100058K06GTGGCCCATGGNONE 
J100059G09GTGGCCCATGGNONE 
J100081C15GTGGCCCATGGNONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein. 
Os04g0476400J033082D17CCATGGGCCGANONE 
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0481800AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24TCGGCCCATGGNONE 
Os04g0502300009-116-F02TGCGGCCCATGTNONE 
009-130-H06TGCGGCCCATGTNONE 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
J013124K01TGCGGCCCATGTNONE 
J023102F03TGCGGCCCATGTNONE 
J033094F17TGCGGCCCATGTNONE 
J053054C22TGCGGCCCATGTNONE 
J065024N13TGCGGCCCATGTNONE 
J065083J18TGCGGCCCATGTNONE 
J065132O14TGCGGCCCATGTNONE 
J065156M09TGCGGCCCATGTNONE 
J065176N15TGCGGCCCATGTNONE 
J065208H08TGCGGCCCATGTNONE 
J075054B03TGCGGCCCATGTNONE 
J090053E20TGCGGCCCATGTNONE 
J100075B09TGCGGCCCATGTNONE 
J100089H12TGCGGCCCATGTNONE 
Os04g0504600J065162K24TCTGGGCCCATGANONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0528100009-090-G06CCATGGGCCTCNONE 
009-168-C11CCATGGGCCTCNONE 
AK065957CCATGGGCCTCConserved hypothetical protein. 
J013039G20CCATGGGCCTCNONE 
J013044D08CCATGGGCCTCNONE 
J065013L14CCATGGGCCTCNONE 
J065143H08CCATGGGCCTCNONE 
J065146C14CCATGGGCCTCNONE 
J065149K22CCATGGGCCTCNONE 
J065156B18CCATGGGCCTCNONE 
J065201A04CCATGGGCCTCNONE 
J065209A04CCATGGGCCTCNONE 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0595000AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
Os04g0617050J065197A20TGTGGGGCCCATGNONE 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0635700009-079-G03AAGGCCCATGTNONE 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK098916AAGGCCCATGTNONE 
J013002J07AAGGCCCATGTNONE 
J013109L20AAGGCCCATGTNONE 
J023055C07AAGGCCCATGTNONE 
J065036K04AAGGCCCATGTNONE 
J065164G12AAGGCCCATGTNONE 
Os04g0636900011-028-G03CCATGGGCCTTNONE 
012-040-G03CCATGGGCCTTNONE 
AK058405CCATGGGCCTTNONE 
AK065789CCATGGGCCTTNONE 
AK101408CCATGGGCCTTNONE 
AK119286CCATGGGCCTTNONE 
J013042J24CCATGGGCCTTNONE 
J033037I12CCATGGGCCTTNONE 
J043031B12CCATGGGCCTTNONE 
J065152N10CCATGGGCCTTNONE 
J090060K17CCATGGGCCTTNONE 
J090083K14CCATGGGCCTTNONE 
J100046O13CCATGGGCCTTNONE 
J100066G22CCATGGGCCTTNONE 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK104273ACATGGGCCGGTNONE 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065211M10ACATGGGCCCACTTGNONE 
J075175E21ACATGGGCCCACTTGNONE 
J090021C06ACATGGGCCCACTTGNONE 
J090032P15ACATGGGCCCACTTGNONE 
J090082E05ACATGGGCCCACTTGNONE 
J100090O11ACATGGGCCCACTTGNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGCGGCCCATGANONE 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGCGGCCCATGANONE 
J065020P20TGCGGCCCATGANONE 
J065057I21TGCGGCCCATGANONE 
J065059P11TGCGGCCCATGANONE 
J065083A22TGCGGCCCATGANONE 
J065093K10TGCGGCCCATGANONE 
J065097D03TGCGGCCCATGANONE 
J065103P05TGCGGCCCATGANONE 
J065113K09TGCGGCCCATGANONE 
J065118F23TGCGGCCCATGANONE 
J065119M06TGCGGCCCATGANONE 
J065146K17TGCGGCCCATGANONE 
J065161N12TGCGGCCCATGANONE 
J065169L02TGCGGCCCATGANONE 
J065189H12TGCGGCCCATGANONE 
J065192E24TGCGGCCCATGANONE 
J065193K17TGCGGCCCATGANONE 
J065197O21TGCGGCCCATGANONE 
J065214D09TGCGGCCCATGANONE 
J065217B11TGCGGCCCATGANONE 
J075132K07TGCGGCCCATGANONE 
J100059D14TGCGGCCCATGANONE 
Os04g0674350J065104O14TCTCGGCCCATGGNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04ACATGGGCCAGANONE 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
J033125H15GGGGCCCATGTNONE 
J065021L01GGGGCCCATGTNONE 
J065029M01GGGGCCCATGTNONE 
J065089F17GGGGCCCATGTNONE 
J065112N04GGGGCCCATGTNONE 
J065163L03GGGGCCCATGTNONE 
J065175B04GGGGCCCATGTNONE 
J065192E02GGGGCCCATGTNONE 
J075046C20GGGGCCCATGTNONE 
J075192A01GGGGCCCATGTNONE 
J100018H13GGGGCCCATGTNONE 
J100067K20GGGGCCCATGTNONE 
J100080N03GGGGCCCATGTNONE 
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein. 
J065163K08CAGGCCCATGNONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0120300AK109108CATGGGCCGAHypothetical protein. 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
Os05g0176600009-151-A09ACATGGGCCGCNONE 
AK071760ACATGGGCCGCConserved hypothetical protein. 
J023110C14ACATGGGCCGCNONE 
J065116G18ACATGGGCCGCNONE 
J065131I04ACATGGGCCGCNONE 
J065163H12ACATGGGCCGCNONE 
J075088L08ACATGGGCCGCNONE 
J075165F17ACATGGGCCGCNONE 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
Os05g0182700003-102-E07CCCGGCCCATGANONE 
011-019-D04CCCGGCCCATGANONE 
013-068-D09CCCGGCCCATGANONE 
014-032-G03CCCGGCCCATGANONE 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK104343CCCGGCCCATGANONE 
J013045E01CCCGGCCCATGANONE 
J013156L15CCCGGCCCATGANONE 
J023029P17CCCGGCCCATGANONE 
J023134I24CCCGGCCCATGANONE 
J033099A10CCCGGCCCATGANONE 
J033115L16CCCGGCCCATGANONE 
J090007M24CCCGGCCCATGANONE 
J090019F02CCCGGCCCATGANONE 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0193800AK058865TCATGGGCCTCNONE 
AK067940TCATGGGCCTCConserved hypothetical protein. 
J065043K19TCATGGGCCTCNONE 
J065095O10TCATGGGCCTCNONE 
J065095O12TCATGGGCCTCNONE 
J080002K02TCATGGGCCTCNONE 
J080012L17TCATGGGCCTCNONE 
J080013J02TCATGGGCCTCNONE 
J080013O11TCATGGGCCTCNONE 
J080020A17TCATGGGCCTCNONE 
J080028E18TCATGGGCCTCNONE 
J080036P11TCATGGGCCTCNONE 
J080042E10TCATGGGCCTCNONE 
J080042L10TCATGGGCCTCNONE 
J080047B11TCATGGGCCTCNONE 
J080048N05TCATGGGCCTCNONE 
J080057E20TCATGGGCCTCNONE 
J080057K13TCATGGGCCTCNONE 
J080058L03TCATGGGCCTCNONE 
J080063H07TCATGGGCCTCNONE 
J080066L23TCATGGGCCTCNONE 
J080069G22TCATGGGCCTCNONE 
J080072E12TCATGGGCCTCNONE 
J080076D06TCATGGGCCTCNONE 
J080077A22TCATGGGCCTCNONE 
J080081A01TCATGGGCCTCNONE 
J080090M13TCATGGGCCTCNONE 
J080093G07TCATGGGCCTCNONE 
J080094O20TCATGGGCCTCNONE 
J080097F13TCATGGGCCTCNONE 
Os05g0327000014-005-A12CATGGGCCGANONE 
AK064059CATGGGCCGACyclin-like domain containing protein. 
AK101588CATGGGCCGANONE 
J033051A05CATGGGCCGANONE 
J065106E02CATGGGCCGANONE 
J065183D01CATGGGCCGANONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0383100AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0456300006-096-G05GTGGCCCATGGNONE 
006-108-F09GTGGCCCATGGNONE 
AK061843GTGGCCCATGGNONE 
AK068616GTGGCCCATGGSimilar to Aldose reductase. 
J013156J23GTGGCCCATGGNONE 
J023080O21GTGGCCCATGGNONE 
J043031L21GTGGCCCATGGNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033143O14GAGGCCCATGGGCCATNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0488900AK071883CTGGCCCATGSimilar to Cytochrome b5 reductase. 
AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699CTGGCCCATGNONE 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459CTGGCCCATGNONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06CTGGCCCATGNONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09CTGGCCCATGNONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24CTGGCCCATGNONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15CTGGCCCATGNONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06CTGGCCCATGNONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16CTGGCCCATGNONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK104049TCATGGGCCGAAANONE 
J013149D04TCATGGGCCGAAANONE 
J075085A06TCATGGGCCGAAANONE 
Os05g0526800016-054-G05ACATGGGCCATNONE 
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ACATGGGCCATNONE 
J013095M02ACATGGGCCATNONE 
J065195O21ACATGGGCCATNONE 
Os05g0528200009-146-C01ATGGCCCATGNONE 
009-146-C01TTGGCCCATGANONE 
AK062985ATGGCCCATGSimilar to 50S ribosomal protein L20. 
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20. 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK101531CCATGGGCCTTNONE 
J033030F10CCATGGGCCTTNONE 
Os05g0541900009-130-F05ACATGGGCCAANONE 
009-200-E07ACATGGGCCAANONE 
013-057-G09ACATGGGCCAANONE 
Os05g0558900AK101679TCATGGGCCATSimilar to Frsb-prov protein. 
J013028M08TCATGGGCCATNONE 
J013074E16TCATGGGCCATNONE 
J013096L01TCATGGGCCATNONE 
J023085M19TCATGGGCCATNONE 
J033058I10TCATGGGCCATNONE 
J033091D18TCATGGGCCATNONE 
J033111H13TCATGGGCCATNONE 
J033114C18TCATGGGCCATNONE 
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein. 
J013074C15ACATGGGCCGTCNONE 
J013098O16ACATGGGCCGTCNONE 
J033030M01ACATGGGCCGTCNONE 
J090058H12ACATGGGCCGTCNONE 
J090075M06ACATGGGCCGTCNONE 
Os05g0568600009-024-B09TCATGGGCCCACGCNONE 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
J080049H14TCATGGGCCCACGCNONE 
J080062M08TCATGGGCCCACGCNONE 
J080064I07TCATGGGCCCACGCNONE 
J080068A12TCATGGGCCCACGCNONE 
J080086J10TCATGGGCCCACGCNONE 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0580500AK102000TTGGCCCATGANONE 
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein. 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK107350CCATGGGCCTTNONE 
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE 
012-009-E07GCGTGGGCCCATGGNONE 
012-096-B01GCGTGGGCCCATGGNONE 
AK059614GCGTGGGCCCATGGNONE 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
J033040P21GCGTGGGCCCATGGNONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0124900009-128-B12GGGGCCCATGNONE 
009-186-H09GGGGCCCATGNONE 
AK062901GGGGCCCATGConserved hypothetical protein. 
J013056D13GGGGCCCATGNONE 
J013056D17GGGGCCCATGNONE 
J013066A13GGGGCCCATGNONE 
J013066C03GGGGCCCATGNONE 
J013066F01GGGGCCCATGNONE 
J023078D03GGGGCCCATGNONE 
J033113N02GGGGCCCATGNONE 
J065019F09GGGGCCCATGNONE 
J065048C21GGGGCCCATGNONE 
J065077L13GGGGCCCATGNONE 
J065082J09GGGGCCCATGNONE 
J065113H16GGGGCCCATGNONE 
J065147A20GGGGCCCATGNONE 
J065180A13GGGGCCCATGNONE 
J065198M18GGGGCCCATGNONE 
J065207K19GGGGCCCATGNONE 
J075109H13GGGGCCCATGNONE 
Os06g0134000AK102796CCATGGGCCAGNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0157800AK121504TCATGGGCCGGASimilar to CG7224 (Fragment). 
J033022L20TCATGGGCCGGANONE 
J075033D09TCATGGGCCGGANONE 
Os06g0178900011-082-D06GAGGCCCATGTNONE 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2). 
D45384GAGGCCCATGTNONE 
J013025O19GAGGCCCATGTNONE 
J013067J23GAGGCCCATGTNONE 
J013119G12GAGGCCCATGTNONE 
J013119I17GAGGCCCATGTNONE 
J013132B18GAGGCCCATGTNONE 
J023108D14GAGGCCCATGTNONE 
J033034C17GAGGCCCATGTNONE 
J033088E10GAGGCCCATGTNONE 
J065013C19GAGGCCCATGTNONE 
J065047E17GAGGCCCATGTNONE 
J090004E24GAGGCCCATGTNONE 
J090008I11GAGGCCCATGTNONE 
J090011F12GAGGCCCATGTNONE 
J090014D19GAGGCCCATGTNONE 
J090030B11GAGGCCCATGTNONE 
J090038J24GAGGCCCATGTNONE 
J090045I05GAGGCCCATGTNONE 
J090046C11GAGGCCCATGTNONE 
J090046F19GAGGCCCATGTNONE 
J090048G03GAGGCCCATGTNONE 
J090050A14GAGGCCCATGTNONE 
J090051B15GAGGCCCATGTNONE 
J090052E04GAGGCCCATGTNONE 
J090052L10GAGGCCCATGTNONE 
J090071O13GAGGCCCATGTNONE 
J090075F03GAGGCCCATGTNONE 
J090080I15GAGGCCCATGTNONE 
J090088B04GAGGCCCATGTNONE 
J100029D12GAGGCCCATGTNONE 
J100032D14GAGGCCCATGTNONE 
J100037J15GAGGCCCATGTNONE 
J100045D01GAGGCCCATGTNONE 
J100045K04GAGGCCCATGTNONE 
J100053M07GAGGCCCATGTNONE 
J100056F04GAGGCCCATGTNONE 
J100056L21GAGGCCCATGTNONE 
J100073N11GAGGCCCATGTNONE 
J100076O13GAGGCCCATGTNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AK059876CCATGGGCCCCNONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J075093C09CCATGGGCCCCNONE 
J100026J18AATTGGGCCCATGANONE 
J100026J18CCATGGGCCCCNONE 
J100041O16AATTGGGCCCATGANONE 
J100041O16CCATGGGCCCCNONE 
J100089K16AATTGGGCCCATGANONE 
J100089K16CCATGGGCCCCNONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J075006K03AATTGGGCCCATGGNONE 
J075067F07AATTGGGCCCATGGNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068H14AATTGGGCCCATGGNONE 
J075098N06AATTGGGCCCATGGNONE 
J075099F08AATTGGGCCCATGGNONE 
J075154G24AATTGGGCCCATGGNONE 
J075195H09AATTGGGCCCATGGNONE 
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17AGGGCCCATGTNONE 
J065038I02AGGGCCCATGTNONE 
J065214J02AGGGCCCATGTNONE 
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein. 
J075143M24CATGGGCCTANONE 
J075194D03CATGGGCCTANONE 
Os06g0306600006-117-A07ACATGGGCCGTANONE 
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein. 
AK099262ACATGGGCCGTANONE 
AK106075ACATGGGCCGTANONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
011-089-C01TTGGCCCATGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-030-D11TTGGCCCATGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
015-044-H10TTGGCCCATGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK105260TTGGCCCATGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
AK119646TTGGCCCATGNONE 
Os06g0320000009-030-C04CATGGGCCGAANONE 
009-135-F08CATGGGCCGAANONE 
J075103B05CATGGGCCGAAProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CATGGGCCGAANONE 
Os06g0338900016-067-B02TCTGGACCATGGGCCGANONE 
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein. 
J013058L01TCTGGACCATGGGCCGANONE 
J013135N01TCTGGACCATGGGCCGANONE 
J023123E15TCTGGACCATGGGCCGANONE 
J033051J01TCTGGACCATGGGCCGANONE 
J090002O21TCTGGACCATGGGCCGANONE 
J090013F06TCTGGACCATGGGCCGANONE 
J090056F16TCTGGACCATGGGCCGANONE 
J090081G13TCTGGACCATGGGCCGANONE 
J090090P21TCTGGACCATGGGCCGANONE 
J100039F05TCTGGACCATGGGCCGANONE 
J100059J03TCTGGACCATGGGCCGANONE 
Os06g0545800J023014L13CATGGGCCACNONE 
J023019D15CATGGGCCACNONE 
J023031O10CATGGGCCACNONE 
J023041K05CATGGGCCACNONE 
J023044D07CATGGGCCACNONE 
J023054D06CATGGGCCACNONE 
J023088I12CATGGGCCACNONE 
J023093O06CATGGGCCACNONE 
J023105M09CATGGGCCACNONE 
J023109C07CATGGGCCACSimilar to Exopolygalacturonase precursor (EC 3.2.1.67) (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase). 
J023135P03CATGGGCCACNONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter. 
AK071175AACGGCCCATGANONE 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0667600AK058606ACATGGGCCTANONE 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03ACATGGGCCTANONE 
J033095E17ACATGGGCCTANONE 
J065020B16ACATGGGCCTANONE 
Os06g0673500J100018J12CCATGGGCCTTNONE 
J100018J12GACGGCCCATGTNONE 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
J100072F13GACGGCCCATGTSimilar to Ubiquitin. 
Os06g0682800011-092-E01ACATGGGCCTGANONE 
011-092-E01GCCGGGCCACATGGGCCGGANONE 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
J013000E13ACATGGGCCTGANONE 
J013000E13GCCGGGCCACATGGGCCGGANONE 
J013035J22ACATGGGCCTGANONE 
J013035J22GCCGGGCCACATGGGCCGGANONE 
J013045M06ACATGGGCCTGANONE 
J013045M06GCCGGGCCACATGGGCCGGANONE 
J013120A07ACATGGGCCTGANONE 
J013120A07GCCGGGCCACATGGGCCGGANONE 
J033144H15ACATGGGCCTGANONE 
J033144H15GCCGGGCCACATGGGCCGGANONE 
J033145H15ACATGGGCCTGANONE 
J033145H15GCCGGGCCACATGGGCCGGANONE 
J033145N16ACATGGGCCTGANONE 
J033145N16GCCGGGCCACATGGGCCGGANONE 
J090019J02ACATGGGCCTGANONE 
J090019J02GCCGGGCCACATGGGCCGGANONE 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0702800009-039-E05ACATGGGCCAGNONE 
009-039-E05ACATGGGCCAGGCCCAAATNONE 
009-039-E05GGACGGCCCATGANONE 
AK073948ACATGGGCCAGHypothetical protein. 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
AK073948GGACGGCCCATGAHypothetical protein. 
J023108K23ACATGGGCCAGNONE 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J023108K23GGACGGCCCATGANONE 
J033072H04ACATGGGCCAGNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J033072H04GGACGGCCCATGANONE 
J065008G05ACATGGGCCAGNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065008G05GGACGGCCCATGANONE 
J065128J12ACATGGGCCAGNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065128J12GGACGGCCCATGANONE 
J065131A01ACATGGGCCAGNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065131A01GGACGGCCCATGANONE 
J065173B12ACATGGGCCAGNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
J065173B12GGACGGCCCATGANONE 
Os06g0709100006-057-D06TTCGGCCCATGANONE 
011-040-A08TTCGGCCCATGANONE 
016-044-A01TTCGGCCCATGANONE 
AK059732TTCGGCCCATGANONE 
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein. 
AK103683TTCGGCCCATGANONE 
J065026P10TTCGGCCCATGANONE 
J090017L13TTCGGCCCATGANONE 
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein. 
Os06g0711600016-047-G09CATGGGCCTTGNONE 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
AK102831CATGGGCCTTGNONE 
J013072P18CATGGGCCTTGNONE 
J023049G01CATGGGCCTTGNONE 
J023088I01CATGGGCCTTGNONE 
J033023I22CATGGGCCTTGNONE 
J033106I12CATGGGCCTTGNONE 
J033109G07CATGGGCCTTGNONE 
J065030F22CATGGGCCTTGNONE 
J065132H19CATGGGCCTTGNONE 
J080301D07CATGGGCCTTGNONE 
J080305C09CATGGGCCTTGNONE 
J080312C03CATGGGCCTTGNONE 
J080313I15CATGGGCCTTGNONE 
J080315B09CATGGGCCTTGNONE 
J090056N21CATGGGCCTTGNONE 
J100027B07CATGGGCCTTGNONE 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein. 
AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19ACATGGGCCGGANONE 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03ACATGGGCCGGANONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE 
AK065121GACACGTGAAGGCCCATGGNONE 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GACACGTGAAGGCCCATGGNONE 
AY302112GACACGTGAAGGCCCATGGNONE 
D10752GACACGTGAAGGCCCATGGNONE 
D11082GACACGTGAAGGCCCATGGNONE 
J013031L12GACACGTGAAGGCCCATGGNONE 
J013042M09GACACGTGAAGGCCCATGGNONE 
J013058E01GACACGTGAAGGCCCATGGNONE 
J013058O09GACACGTGAAGGCCCATGGNONE 
J013063J17GACACGTGAAGGCCCATGGNONE 
J013066I24GACACGTGAAGGCCCATGGNONE 
J013069F17GACACGTGAAGGCCCATGGNONE 
J013106E01GACACGTGAAGGCCCATGGNONE 
J013118D19GACACGTGAAGGCCCATGGNONE 
J013162M11GACACGTGAAGGCCCATGGNONE 
J023028B19GACACGTGAAGGCCCATGGNONE 
J023031A13GACACGTGAAGGCCCATGGNONE 
J023047H18GACACGTGAAGGCCCATGGNONE 
J023059N10GACACGTGAAGGCCCATGGNONE 
J023104N22GACACGTGAAGGCCCATGGNONE 
J033025J03GACACGTGAAGGCCCATGGNONE 
J033045B05GACACGTGAAGGCCCATGGNONE 
J033067M08GACACGTGAAGGCCCATGGNONE 
J033113D04GACACGTGAAGGCCCATGGNONE 
J043003D11GACACGTGAAGGCCCATGGNONE 
J043009O20GACACGTGAAGGCCCATGGNONE 
J043016P06GACACGTGAAGGCCCATGGNONE 
J043017C21GACACGTGAAGGCCCATGGNONE 
J043017J20GACACGTGAAGGCCCATGGNONE 
J043021P15GACACGTGAAGGCCCATGGNONE 
J043026I22GACACGTGAAGGCCCATGGNONE 
J043032L15GACACGTGAAGGCCCATGGNONE 
J043034G14GACACGTGAAGGCCCATGGNONE 
J043039L16GACACGTGAAGGCCCATGGNONE 
J075003D02GACACGTGAAGGCCCATGGNONE 
J075003O22GACACGTGAAGGCCCATGGNONE 
J075005I24GACACGTGAAGGCCCATGGNONE 
J075006N09GACACGTGAAGGCCCATGGNONE 
J075011A22GACACGTGAAGGCCCATGGNONE 
J075012K24GACACGTGAAGGCCCATGGNONE 
J075017D01GACACGTGAAGGCCCATGGNONE 
J075017I23GACACGTGAAGGCCCATGGNONE 
J075023D17GACACGTGAAGGCCCATGGNONE 
J075024B03GACACGTGAAGGCCCATGGNONE 
J075025H05GACACGTGAAGGCCCATGGNONE 
J075031D19GACACGTGAAGGCCCATGGNONE 
J075034B02GACACGTGAAGGCCCATGGNONE 
J075035C02GACACGTGAAGGCCCATGGNONE 
J075037J12GACACGTGAAGGCCCATGGNONE 
J075038M11GACACGTGAAGGCCCATGGNONE 
J075039J17GACACGTGAAGGCCCATGGNONE 
J075042P10GACACGTGAAGGCCCATGGNONE 
J075046J20GACACGTGAAGGCCCATGGNONE 
J075047F21GACACGTGAAGGCCCATGGNONE 
J075053E05GACACGTGAAGGCCCATGGNONE 
J075054D11GACACGTGAAGGCCCATGGNONE 
J075054K06GACACGTGAAGGCCCATGGNONE 
J075059E15GACACGTGAAGGCCCATGGNONE 
J075061O04GACACGTGAAGGCCCATGGNONE 
J075062I20GACACGTGAAGGCCCATGGNONE 
J075066I12GACACGTGAAGGCCCATGGNONE 
J075066L06GACACGTGAAGGCCCATGGNONE 
J075071H12GACACGTGAAGGCCCATGGNONE 
J075071N19GACACGTGAAGGCCCATGGNONE 
J075074K01GACACGTGAAGGCCCATGGNONE 
J075077H22GACACGTGAAGGCCCATGGNONE 
J075083H18GACACGTGAAGGCCCATGGNONE 
J075085F04GACACGTGAAGGCCCATGGNONE 
J075085K09GACACGTGAAGGCCCATGGNONE 
J075086C06GACACGTGAAGGCCCATGGNONE 
J075086E06GACACGTGAAGGCCCATGGNONE 
J075087A15GACACGTGAAGGCCCATGGNONE 
J075090N02GACACGTGAAGGCCCATGGNONE 
J075090N22GACACGTGAAGGCCCATGGNONE 
J075091C04GACACGTGAAGGCCCATGGNONE 
J075091G16GACACGTGAAGGCCCATGGNONE 
J075097E04GACACGTGAAGGCCCATGGNONE 
J075099E04GACACGTGAAGGCCCATGGNONE 
J075102P22GACACGTGAAGGCCCATGGNONE 
J075109B08GACACGTGAAGGCCCATGGNONE 
J075109J02GACACGTGAAGGCCCATGGNONE 
J075115I12GACACGTGAAGGCCCATGGNONE 
J075117E17GACACGTGAAGGCCCATGGNONE 
J075123C07GACACGTGAAGGCCCATGGNONE 
J075124N05GACACGTGAAGGCCCATGGNONE 
J075125E12GACACGTGAAGGCCCATGGNONE 
J075126B11GACACGTGAAGGCCCATGGNONE 
J075129E14GACACGTGAAGGCCCATGGNONE 
J075130N15GACACGTGAAGGCCCATGGNONE 
J075131I07GACACGTGAAGGCCCATGGNONE 
J075141B13GACACGTGAAGGCCCATGGNONE 
J075141B20GACACGTGAAGGCCCATGGNONE 
J075144D23GACACGTGAAGGCCCATGGNONE 
J075144N01GACACGTGAAGGCCCATGGNONE 
J075147M24GACACGTGAAGGCCCATGGNONE 
J075148L16GACACGTGAAGGCCCATGGNONE 
J075151A22GACACGTGAAGGCCCATGGNONE 
J075151D03GACACGTGAAGGCCCATGGNONE 
J075151D04GACACGTGAAGGCCCATGGNONE 
J075153E23GACACGTGAAGGCCCATGGNONE 
J075156D02GACACGTGAAGGCCCATGGNONE 
J075156P05GACACGTGAAGGCCCATGGNONE 
J075162E23GACACGTGAAGGCCCATGGNONE 
J075165J22GACACGTGAAGGCCCATGGNONE 
J075166A06GACACGTGAAGGCCCATGGNONE 
J075168H13GACACGTGAAGGCCCATGGNONE 
J075170D04GACACGTGAAGGCCCATGGNONE 
J075171C19GACACGTGAAGGCCCATGGNONE 
J075173B12GACACGTGAAGGCCCATGGNONE 
J075173M23GACACGTGAAGGCCCATGGNONE 
J075174C03GACACGTGAAGGCCCATGGNONE 
J075185O11GACACGTGAAGGCCCATGGNONE 
J075186G21GACACGTGAAGGCCCATGGNONE 
J075187D06GACACGTGAAGGCCCATGGNONE 
J075195G21GACACGTGAAGGCCCATGGNONE 
J090003D18GACACGTGAAGGCCCATGGNONE 
J090005I12GACACGTGAAGGCCCATGGNONE 
J090007D15GACACGTGAAGGCCCATGGNONE 
J090007G20GACACGTGAAGGCCCATGGNONE 
J090014G13GACACGTGAAGGCCCATGGNONE 
J090014L08GACACGTGAAGGCCCATGGNONE 
J090016J03GACACGTGAAGGCCCATGGNONE 
J090023P22GACACGTGAAGGCCCATGGNONE 
J090025C19GACACGTGAAGGCCCATGGNONE 
J090028F11GACACGTGAAGGCCCATGGNONE 
J090028G01GACACGTGAAGGCCCATGGNONE 
J090028H02GACACGTGAAGGCCCATGGNONE 
J090037I11GACACGTGAAGGCCCATGGNONE 
J090040F21GACACGTGAAGGCCCATGGNONE 
J090040N24GACACGTGAAGGCCCATGGNONE 
J090044M12GACACGTGAAGGCCCATGGNONE 
J090045B13GACACGTGAAGGCCCATGGNONE 
J090045M22GACACGTGAAGGCCCATGGNONE 
J090048C10GACACGTGAAGGCCCATGGNONE 
J090051J02GACACGTGAAGGCCCATGGNONE 
J090058O15GACACGTGAAGGCCCATGGNONE 
J090062F11GACACGTGAAGGCCCATGGNONE 
J090067D23GACACGTGAAGGCCCATGGNONE 
J090069G15GACACGTGAAGGCCCATGGNONE 
J090072I06GACACGTGAAGGCCCATGGNONE 
J090073H18GACACGTGAAGGCCCATGGNONE 
J090073L01GACACGTGAAGGCCCATGGNONE 
J090075O21GACACGTGAAGGCCCATGGNONE 
J090084K24GACACGTGAAGGCCCATGGNONE 
J090087P11GACACGTGAAGGCCCATGGNONE 
J090092B17GACACGTGAAGGCCCATGGNONE 
J100042H08GACACGTGAAGGCCCATGGNONE 
Os06g0730900AK062118GTGGCCCATGGNONE 
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
AK065172GTGGCCCATGGNONE 
AK099361GTGGCCCATGGNONE 
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein. 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE 
AK058680AGATGGGCCGGCCCATGTNONE 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
J033051C16AGATGGGCCGGCCCATGTNONE 
J033123H15AGATGGGCCGGCCCATGTNONE 
J065093I01AGATGGGCCGGCCCATGTNONE 
J065197C05AGATGGGCCGGCCCATGTNONE 
J075037B11AGATGGGCCGGCCCATGTNONE 
J075114B08AGATGGGCCGGCCCATGTNONE 
J075123N01AGATGGGCCGGCCCATGTNONE 
J075129O04AGATGGGCCGGCCCATGTNONE 
J075160H17AGATGGGCCGGCCCATGTNONE 
J075166H17AGATGGGCCGGCCCATGTNONE 
J080310F11AGATGGGCCGGCCCATGTNONE 
J080315P11AGATGGGCCGGCCCATGTNONE 
J090025A22AGATGGGCCGGCCCATGTNONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E04AATTGGGCCCATGTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0245100J023048C16CCATGGGCCCACTTGNONE 
J023110L14CCATGGGCCCACTTGNONE 
J053023B18CCATGGGCCCACTTGNONE 
J053031L17CCATGGGCCCACTTGNONE 
J065035I22CCATGGGCCCACTTGNONE 
J065043D21CCATGGGCCCACTTGNONE 
J065072L16CCATGGGCCCACTTGNONE 
J065214I23CCATGGGCCCACTTGNONE 
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein. 
Os07g0408100AK108466GCCGGCCCATGGNONE 
AK111780GCCGGCCCATGGWD40-like domain containing protein. 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0531600015-098-E11ACATGGGCCGANONE 
015-098-E11CCGAGCCGGCCCATGTNONE 
AK067845ACATGGGCCGAPhospholipid/glycerol acyltransferase domain containing protein. 
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01ACATGGGCCGANONE 
J013124G01CCGAGCCGGCCCATGTNONE 
J065008E15ACATGGGCCGANONE 
J065008E15CCGAGCCGGCCCATGTNONE 
J065052K14ACATGGGCCGANONE 
J065052K14CCGAGCCGGCCCATGTNONE 
J065052L13ACATGGGCCGANONE 
J065052L13CCGAGCCGGCCCATGTNONE 
J065058M02ACATGGGCCGANONE 
J065058M02CCGAGCCGGCCCATGTNONE 
J065069M10ACATGGGCCGANONE 
J065069M10CCGAGCCGGCCCATGTNONE 
J065135A14ACATGGGCCGANONE 
J065135A14CCGAGCCGGCCCATGTNONE 
J065168O18ACATGGGCCGANONE 
J065168O18CCGAGCCGGCCCATGTNONE 
J075070D14ACATGGGCCGANONE 
J075070D14CCGAGCCGGCCCATGTNONE 
J075169B16ACATGGGCCGANONE 
J075169B16CCGAGCCGGCCCATGTNONE 
Os07g0546700009-110-H10TCATGGGCCGGCNONE 
AK058262TCATGGGCCGGCNONE 
J065154I05TCATGGGCCGGCNONE 
J065175P09TCATGGGCCGGCNONE 
J065187F11TCATGGGCCGGCNONE 
J075114K16TCATGGGCCGGCNONE 
J090031L21TCATGGGCCGGCNONE 
U86017TCATGGGCCGGCSimilar to 60S ribosomal protein L38. 
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0603100AK101352GCGGCCCATGGNuclear transport factor 2 domain containing protein. 
AK101352TCATGGGCCGGANuclear transport factor 2 domain containing protein. 
AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
J023077E09GCGGCCCATGGNONE 
J023077E09TCATGGGCCGGANONE 
J023077E09TCATGGGCCTGGNONE 
J023081N15GCGGCCCATGGNONE 
J023081N15TCATGGGCCGGANONE 
J023081N15TCATGGGCCTGGNONE 
J033022N22GCGGCCCATGGNONE 
J033022N22TCATGGGCCGGANONE 
J033022N22TCATGGGCCTGGNONE 
J033024M18GCGGCCCATGGNONE 
J033024M18TCATGGGCCGGANONE 
J033024M18TCATGGGCCTGGNONE 
J033034P09GCGGCCCATGGNONE 
J033034P09TCATGGGCCGGANONE 
J033034P09TCATGGGCCTGGNONE 
J033046A06GCGGCCCATGGNONE 
J033046A06TCATGGGCCGGANONE 
J033046A06TCATGGGCCTGGNONE 
J033051K01GCGGCCCATGGNONE 
J033051K01TCATGGGCCGGANONE 
J033051K01TCATGGGCCTGGNONE 
J033081P09GCGGCCCATGGNONE 
J033081P09TCATGGGCCGGANONE 
J033081P09TCATGGGCCTGGNONE 
J033091B17GCGGCCCATGGNONE 
J033091B17TCATGGGCCGGANONE 
J033091B17TCATGGGCCTGGNONE 
J033092K23GCGGCCCATGGNONE 
J033092K23TCATGGGCCGGANONE 
J033092K23TCATGGGCCTGGNONE 
J033132J09GCGGCCCATGGNONE 
J033132J09TCATGGGCCGGANONE 
J033132J09TCATGGGCCTGGNONE 
J033144A14GCGGCCCATGGNONE 
J033144A14TCATGGGCCGGANONE 
J033144A14TCATGGGCCTGGNONE 
J033145A14GCGGCCCATGGNONE 
J033145A14TCATGGGCCGGANONE 
J033145A14TCATGGGCCTGGNONE 
J043021B20GCGGCCCATGGNONE 
J043021B20TCATGGGCCGGANONE 
J043021B20TCATGGGCCTGGNONE 
J053024D23GCGGCCCATGGNONE 
J053024D23TCATGGGCCGGANONE 
J053024D23TCATGGGCCTGGNONE 
J065212J10GCGGCCCATGGNONE 
J065212J10TCATGGGCCGGANONE 
J065212J10TCATGGGCCTGGNONE 
J090055M05GCGGCCCATGGNONE 
J090055M05TCATGGGCCGGANONE 
J090055M05TCATGGGCCTGGNONE 
J090065E14GCGGCCCATGGNONE 
J090065E14TCATGGGCCGGANONE 
J090065E14TCATGGGCCTGGNONE 
J090092J06GCGGCCCATGGNONE 
J090092J06TCATGGGCCGGANONE 
J090092J06TCATGGGCCTGGNONE 
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800CGCGTGCGCACGGCCCATGNONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0635500011-089-H07ATGGCCCATGGNONE 
016-030-A09ATGGCCCATGGNONE 
AK106081ATGGCCCATGGNONE 
AK121733ATGGCCCATGGSimilar to Cytochrome P450. 
J043036I03ATGGCCCATGGNONE 
J065001N22ATGGCCCATGGNONE 
J065035I03ATGGCCCATGGNONE 
J065167G12ATGGCCCATGGNONE 
J075041E07ATGGCCCATGGNONE 
J090007D08ATGGCCCATGGNONE 
J090089I24ATGGCCCATGGNONE 
J100026I23ATGGCCCATGGNONE 
J100027H19ATGGCCCATGGNONE 
J100044G07ATGGCCCATGGNONE 
J100089H22ATGGCCCATGGNONE 
J100090D03ATGGCCCATGGNONE 
J100090D22ATGGCCCATGGNONE 
Os07g0638300AK101401ACATGGGCCGCNONE 
AK102982ACATGGGCCGCSimilar to 1-Cys peroxiredoxin. 
AY336994ACATGGGCCGCNONE 
D63917ACATGGGCCGCNONE 
J033044N01ACATGGGCCGCNONE 
J033055M23ACATGGGCCGCNONE 
J033057E19ACATGGGCCGCNONE 
J033114I23ACATGGGCCGCNONE 
J033115O22ACATGGGCCGCNONE 
J033120C03ACATGGGCCGCNONE 
J033121H24ACATGGGCCGCNONE 
J043034H13ACATGGGCCGCNONE 
J065029D17ACATGGGCCGCNONE 
J065058P20ACATGGGCCGCNONE 
J065062L08ACATGGGCCGCNONE 
J065082B12ACATGGGCCGCNONE 
J065131K01ACATGGGCCGCNONE 
J065181F09ACATGGGCCGCNONE 
J065200F11ACATGGGCCGCNONE 
J075003I12ACATGGGCCGCNONE 
J075006B18ACATGGGCCGCNONE 
J075013E13ACATGGGCCGCNONE 
J075013I03ACATGGGCCGCNONE 
J075017J08ACATGGGCCGCNONE 
J075019J19ACATGGGCCGCNONE 
J075030G22ACATGGGCCGCNONE 
J075037E04ACATGGGCCGCNONE 
J075048L18ACATGGGCCGCNONE 
J075056A08ACATGGGCCGCNONE 
J075059G05ACATGGGCCGCNONE 
J075062J04ACATGGGCCGCNONE 
J075070F14ACATGGGCCGCNONE 
J075072N23ACATGGGCCGCNONE 
J075085J23ACATGGGCCGCNONE 
J075091L01ACATGGGCCGCNONE 
J075094B10ACATGGGCCGCNONE 
J075098M05ACATGGGCCGCNONE 
J075106B18ACATGGGCCGCNONE 
J075116K24ACATGGGCCGCNONE 
J075136C06ACATGGGCCGCNONE 
J075137I15ACATGGGCCGCNONE 
J075140K14ACATGGGCCGCNONE 
J075147H07ACATGGGCCGCNONE 
J075167I19ACATGGGCCGCNONE 
J075182O03ACATGGGCCGCNONE 
J075188G23ACATGGGCCGCNONE 
J075194C06ACATGGGCCGCNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0653100J065130E21TCATGGGCCGGAConserved hypothetical protein. 
J065186P07TCATGGGCCGGANONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0686600AK108527TGGGTCCCATGGGCCATVQ domain containing protein. 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0110200AK068841ACATGGGCCATSimilar to Fertility restorer. 
J090071I18ACATGGGCCATNONE 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0118900AK109749TCGGCCCATGTAdenylate kinase family protein. 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0154200AK103192CAGGCCCATGGConserved hypothetical protein. 
J033121O14CAGGCCCATGGNONE 
Os08g0158900AK067062ACATGGGCCGGAGTP1/OBG domain containing protein. 
J013089F04ACATGGGCCGGANONE 
J013092D16ACATGGGCCGGANONE 
J033120K14ACATGGGCCGGANONE 
J033133F24ACATGGGCCGGANONE 
J033145A10ACATGGGCCGGANONE 
J033145A11ACATGGGCCGGANONE 
J053048H24ACATGGGCCGGANONE 
J053075H10ACATGGGCCGGANONE 
Os08g0159000AK073617TCCGGCCCATGTNONE 
AK103973TCCGGCCCATGTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCCGGCCCATGTNONE 
J033051J11TCCGGCCCATGTNONE 
J065101C10TCCGGCCCATGTNONE 
J065168B04TCCGGCCCATGTNONE 
J065184E22TCCGGCCCATGTNONE 
J080021D11TCCGGCCCATGTNONE 
J080025H10TCCGGCCCATGTNONE 
J080026N19TCCGGCCCATGTNONE 
J080034A12TCCGGCCCATGTNONE 
J080040L02TCCGGCCCATGTNONE 
J080042H19TCCGGCCCATGTNONE 
J080047B05TCCGGCCCATGTNONE 
J080047E09TCCGGCCCATGTNONE 
J080047I01TCCGGCCCATGTNONE 
J080052H19TCCGGCCCATGTNONE 
J080062K13TCCGGCCCATGTNONE 
J080063A22TCCGGCCCATGTNONE 
J080068G18TCCGGCCCATGTNONE 
J080068N19TCCGGCCCATGTNONE 
J080076G08TCCGGCCCATGTNONE 
J080077H13TCCGGCCCATGTNONE 
J080077K06TCCGGCCCATGTNONE 
J080093D15TCCGGCCCATGTNONE 
J080094D21TCCGGCCCATGTNONE 
J080097A20TCCGGCCCATGTNONE 
J080097E21TCCGGCCCATGTNONE 
J080097N17TCCGGCCCATGTNONE 
J100071K18TCCGGCCCATGTNONE 
J100072F09TCCGGCCCATGTNONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0227100AK071657TCATGGGCCGCTRAF-like domain containing protein. 
AK103481TCATGGGCCGCNONE 
J065183O06TCATGGGCCGCNONE 
J090013C07TCATGGGCCGCNONE 
J090081F11TCATGGGCCGCNONE 
Os08g0270800AK061845CATGGGCCTTNONE 
AK066874CATGGGCCTTConserved hypothetical protein. 
J013075I05CATGGGCCTTNONE 
J013146E07CATGGGCCTTNONE 
Os08g0386300AK059323TGGTGGGCCCATGNONE 
AK070379TGGTGGGCCCATGCytochrome b5 domain containing protein. 
J023054P20TGGTGGGCCCATGNONE 
J033089H01TGGTGGGCCCATGNONE 
J065013I01TGGTGGGCCCATGNONE 
J065212E17TGGTGGGCCCATGNONE 
J080317O15TGGTGGGCCCATGNONE 
J090018O07TGGTGGGCCCATGNONE 
Os08g0433200013-023-E07CATGGGCCTANONE 
013-023-E07CATGGGCCTANONE 
AK099471CATGGGCCTAConserved hypothetical protein. 
AK099471CATGGGCCTAConserved hypothetical protein. 
J013024A05CATGGGCCTANONE 
J013024A05CATGGGCCTANONE 
J013065N03CATGGGCCTANONE 
J013065N03CATGGGCCTANONE 
J023111A21CATGGGCCTANONE 
J023111A21CATGGGCCTANONE 
J065035F10CATGGGCCTANONE 
J065035F10CATGGGCCTANONE 
J065083H01CATGGGCCTANONE 
J065083H01CATGGGCCTANONE 
J065159E03CATGGGCCTANONE 
J065159E03CATGGGCCTANONE 
J065186A03CATGGGCCTANONE 
J065186A03CATGGGCCTANONE 
J075032B02CATGGGCCTANONE 
J075032B02CATGGGCCTANONE 
J075038L14CATGGGCCTANONE 
J075038L14CATGGGCCTANONE 
J075047N21CATGGGCCTANONE 
J075047N21CATGGGCCTANONE 
J075076H05CATGGGCCTANONE 
J075076H05CATGGGCCTANONE 
J075110C08CATGGGCCTANONE 
J075110C08CATGGGCCTANONE 
J090096K17CATGGGCCTANONE 
J090096K17CATGGGCCTANONE 
Os08g0433400AJ495796TCATGGGCCATSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
AK059468TCATGGGCCATNONE 
Os08g0435800AK121712TCCGGCCCATGGSimilar to Lipoate protein ligase-like protein. 
J065121P15TCCGGCCCATGGNONE 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0450800AK102479GAGGCCCATGTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0461300AK065651GTGGCCCATGTCyclin-like F-box domain containing protein. 
Os08g0465000J065121H01CTGGCCCATGHomeobox domain containing protein. 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
014-015-C10TCATGGGCCGAANONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK069190TCATGGGCCGAASimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
AK072089TCATGGGCCGAANONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J023006O19TCATGGGCCGAANONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
J033041C11TCATGGGCCGAANONE 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0535400004-001-H10GCGGCCCATGANONE 
AK071527GCGGCCCATGAZinc finger, DHHC-type domain containing protein. 
J023107B02GCGGCCCATGANONE 
Os08g0548900006-043-D07CCATGGGCCCATGGNONE 
006-043-D07TCCGGCCCATGGGCCAANONE 
006-043-H11CCATGGGCCCATGGNONE 
006-043-H11TCCGGCCCATGGGCCAANONE 
006-081-G06CCATGGGCCCATGGNONE 
006-081-G06TCCGGCCCATGGGCCAANONE 
006-109-E04CCATGGGCCCATGGNONE 
006-109-E04TCCGGCCCATGGGCCAANONE 
011-033-E04CCATGGGCCCATGGNONE 
011-033-E04TCCGGCCCATGGGCCAANONE 
AK061808CCATGGGCCCATGGSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCCCATGGNONE 
AK098875TCCGGCCCATGGGCCAANONE 
J013001D12CCATGGGCCCATGGNONE 
J013001D12TCCGGCCCATGGGCCAANONE 
J033126N14CCATGGGCCCATGGNONE 
J033126N14TCCGGCCCATGGGCCAANONE 
J053069M09CCATGGGCCCATGGNONE 
J053069M09TCCGGCCCATGGGCCAANONE 
J053098E10CCATGGGCCCATGGNONE 
J053098E10TCCGGCCCATGGGCCAANONE 
J053101C24CCATGGGCCCATGGNONE 
J053101C24TCCGGCCCATGGGCCAANONE 
J065002F21CCATGGGCCCATGGNONE 
J065002F21TCCGGCCCATGGGCCAANONE 
J065006C22CCATGGGCCCATGGNONE 
J065006C22TCCGGCCCATGGGCCAANONE 
J065076J02CCATGGGCCCATGGNONE 
J065076J02TCCGGCCCATGGGCCAANONE 
J065134M22CCATGGGCCCATGGNONE 
J065134M22TCCGGCCCATGGGCCAANONE 
J075007M19CCATGGGCCCATGGNONE 
J075007M19TCCGGCCCATGGGCCAANONE 
J075040I11CCATGGGCCCATGGNONE 
J075040I11TCCGGCCCATGGGCCAANONE 
J075047E20CCATGGGCCCATGGNONE 
J075047E20TCCGGCCCATGGGCCAANONE 
J075052D22CCATGGGCCCATGGNONE 
J075052D22TCCGGCCCATGGGCCAANONE 
J075076L13CCATGGGCCCATGGNONE 
J075076L13TCCGGCCCATGGGCCAANONE 
J075157P22CCATGGGCCCATGGNONE 
J075157P22TCCGGCCCATGGGCCAANONE 
J075161M18CCATGGGCCCATGGNONE 
J075161M18TCCGGCCCATGGGCCAANONE 
J075168P22CCATGGGCCCATGGNONE 
J075168P22TCCGGCCCATGGGCCAANONE 
J075181E04CCATGGGCCCATGGNONE 
J075181E04TCCGGCCCATGGGCCAANONE 
U92540CCATGGGCCCATGGNONE 
U92540TCCGGCCCATGGGCCAANONE 
Os08g0549300009-008-F01CATGGGCCGGANONE 
009-033-G10CATGGGCCGGANONE 
AK120938CATGGGCCGGASimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CATGGGCCGGANONE 
J023037A21CATGGGCCGGANONE 
J023066D20CATGGGCCGGANONE 
J033099K13CATGGGCCGGANONE 
J065116C14CATGGGCCGGANONE 
J075009K15CATGGGCCGGANONE 
J075071P13CATGGGCCGGANONE 
J075080D18CATGGGCCGGANONE 
J075124F24CATGGGCCGGANONE 
J075198F23CATGGGCCGGANONE 
J080006B15CATGGGCCGGANONE 
J090078H13CATGGGCCGGANONE 
J090089J09CATGGGCCGGANONE 
J100017A03CATGGGCCGGANONE 
J100023G03CATGGGCCGGANONE 
Os08g0553450Os08g0553450TCATGGGCCAAHypothetical protein. 
Os08g0554000AK111661CATGGGCCGCAWD-40 repeat containing protein. 
AK112044CATGGGCCGCANONE 
J013039N12CATGGGCCGCANONE 
J013134D02CATGGGCCGCANONE 
J013153B06CATGGGCCGCANONE 
J033044L16CATGGGCCGCANONE 
J033073P14CATGGGCCGCANONE 
Os08g0557000AK059917TCCGGCCCATGGNONE 
AK100496TCCGGCCCATGGSimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0558000J080005K14ACATGGGCCACNONE 
Os08g0564100AK063258GTGGCCCATGASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0115400AK067816GGACACGTGCACGGCCCATGTNONE 
AK101706GGACACGTGCACGGCCCATGTSimilar to Poly(A)-binding protein. 
Os09g0115500006-023-A12CGATGGGCCCATGTNONE 
006-042-G01CGATGGGCCCATGTNONE 
AK061717CGATGGGCCCATGTCBS domain containing protein. 
AK065986CGATGGGCCCATGTNONE 
J013043C13CGATGGGCCCATGTNONE 
J013111D13CGATGGGCCCATGTNONE 
J023114K12CGATGGGCCCATGTNONE 
J065102N18CGATGGGCCCATGTNONE 
Os09g0251800006-100-E12AGCCCATGGCCCATGGNONE 
AK061218AGCCCATGGCCCATGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010AGCCCATGGCCCATGGNONE 
J065048A02AGCCCATGGCCCATGGNONE 
J065073P10AGCCCATGGCCCATGGNONE 
J065075B09AGCCCATGGCCCATGGNONE 
J065112B05AGCCCATGGCCCATGGNONE