version

Summary of OsREG518 (All List)

OrganismOryza sativa  
IDOsREG518  
SequenceCCAACGGC  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count1542  

Entry Sequences (1542 entries)

LocusGene modelSequenceDescription
Os01g0141100012-043-A12CCAACGGCNONE 
AK062139CCAACGGCNONE 
J013110M14CCAACGGCNONE 
J013114F09CCAACGGCNONE 
J033036J01CCAACGGCNONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0176500AK102552ATCCAACGGCConserved hypothetical protein. 
AK102552CCAACGGCTConserved hypothetical protein. 
Os01g0220200J100075D14TACGGCCCCCAACGGCCNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0238200009-027-B03AGCCGTTGGNONE 
009-027-B03AGCCGTTGGNONE 
009-031-A07AGCCGTTGGNONE 
009-031-A07AGCCGTTGGNONE 
009-119-A04AGCCGTTGGNONE 
009-119-A04AGCCGTTGGNONE 
009-175-C11AGCCGTTGGNONE 
009-175-C11AGCCGTTGGNONE 
AK062403AGCCGTTGGConserved hypothetical protein. 
AK062403AGCCGTTGGConserved hypothetical protein. 
AK063106AGCCGTTGGNONE 
AK063106AGCCGTTGGNONE 
J065058A15AGCCGTTGGNONE 
J065058A15AGCCGTTGGNONE 
J065116N10AGCCGTTGGNONE 
J065116N10AGCCGTTGGNONE 
J065141K18AGCCGTTGGNONE 
J065141K18AGCCGTTGGNONE 
Os01g0281200AK107209GCCGTTGGSimilar to Type B-like cyclin (Fragment). 
AY647458GCCGTTGGNONE 
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein. 
J075175N03ATCCAACGGCCGAGANONE 
Os01g0328400006-092-H09ATCCAACGGCNONE 
009-085-A02ATCCAACGGCNONE 
012-078-B03ATCCAACGGCNONE 
AK061988ATCCAACGGCUbiquitin. 
J013073B13ATCCAACGGCNONE 
J023135L09ATCCAACGGCNONE 
J023135O07ATCCAACGGCNONE 
J033027B12ATCCAACGGCNONE 
J033084P17ATCCAACGGCNONE 
J065010M05ATCCAACGGCNONE 
J065021N11ATCCAACGGCNONE 
J065021N12ATCCAACGGCNONE 
J065031K11ATCCAACGGCNONE 
J065072P04ATCCAACGGCNONE 
J065098D05ATCCAACGGCNONE 
J065122N23ATCCAACGGCNONE 
J065129L13ATCCAACGGCNONE 
J065135N13ATCCAACGGCNONE 
J065215N10ATCCAACGGCNONE 
J075120N22ATCCAACGGCNONE 
J090011G23ATCCAACGGCNONE 
J090014F06ATCCAACGGCNONE 
J090040G23ATCCAACGGCNONE 
J090075I20ATCCAACGGCNONE 
J090075N01ATCCAACGGCNONE 
J090089B04ATCCAACGGCNONE 
J090090F08ATCCAACGGCNONE 
J090091M17ATCCAACGGCNONE 
J090094L03ATCCAACGGCNONE 
J090099L06ATCCAACGGCNONE 
J100018A18ATCCAACGGCNONE 
J100027H13ATCCAACGGCNONE 
J100069C05ATCCAACGGCNONE 
J100086L10ATCCAACGGCNONE 
Os01g0348700009-125-H02CCAACGGCCNONE 
009-156-F08CCAACGGCCNONE 
009-177-A11CCAACGGCCNONE 
009-195-D02CCAACGGCCNONE 
013-040-B06CCAACGGCCNONE 
013-051-B09CCAACGGCCNONE 
AK120842CCAACGGCCSimilar to 60S ribosomal protein L23a (L25). 
J013071O22CCAACGGCCNONE 
J023022J07CCAACGGCCNONE 
J033028J08CCAACGGCCNONE 
J033109M11CCAACGGCCNONE 
J043022K15CCAACGGCCNONE 
J043031N11CCAACGGCCNONE 
J053023I10CCAACGGCCNONE 
J053045F16CCAACGGCCNONE 
J053054F22CCAACGGCCNONE 
J053094P15CCAACGGCCNONE 
J065048F01CCAACGGCCNONE 
J075012F16CCAACGGCCNONE 
J075089C09CCAACGGCCNONE 
J075179J20CCAACGGCCNONE 
J080305E19CCAACGGCCNONE 
J080309B21CCAACGGCCNONE 
J090017L05CCAACGGCCNONE 
J090058B11CCAACGGCCNONE 
Os01g0349400AK064941ATCCAACGGCCNONE 
AK100195ATCCAACGGCCNONE 
AK105047ATCCAACGGCCNONE 
AK122182ATCCAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment). 
Os01g0571300016-074-C10CCAACGGCNONE 
AK064271CCAACGGCSimilar to Heat shock transcription factor 31 (Fragment). 
Os01g0585400AK103584GGCCGTTGGConserved hypothetical protein. 
J033133B01GGCCGTTGGNONE 
Os01g0637600AK106980CGCACCGCCAACGGCCSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0639600005-018-A02CCAACGGCNONE 
AK067056CCAACGGCProtein of unknown function DUF1645 family protein. 
J013066M03CCAACGGCNONE 
J013066O05CCAACGGCNONE 
J013088M21CCAACGGCNONE 
J065045F04CCAACGGCNONE 
J080018F22CCAACGGCNONE 
J080037B10CCAACGGCNONE 
J080042G23CCAACGGCNONE 
J080052B21CCAACGGCNONE 
J080060H13CCAACGGCNONE 
J100024A05CCAACGGCNONE 
J100071A09CCAACGGCNONE 
J100080K14CCAACGGCNONE 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0658500AK058491GCCGTTGGAProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCCGTTGGANONE 
J043036P22GCCGTTGGANONE 
Os01g0663400016-054-B01GCCGTTGGNONE 
AK072283GCCGTTGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645GCCGTTGGNONE 
J065180A21GCCGTTGGNONE 
J075026E13GCCGTTGGNONE 
J075109M23GCCGTTGGNONE 
J075151A02GCCGTTGGNONE 
J090004B07GCCGTTGGNONE 
J090023O22GCCGTTGGNONE 
J090054G09GCCGTTGGNONE 
J090058H13GCCGTTGGNONE 
J090076G13GCCGTTGGNONE 
J100057F11GCCGTTGGNONE 
Os01g0678400006-114-H04CCAACGGCNONE 
AK106072CCAACGGCConserved hypothetical protein. 
Os01g0710800013-097-E05AGCCGTTGGATNONE 
AK069973AGCCGTTGGATNONE 
AK071099AGCCGTTGGATConserved hypothetical protein. 
J023081K01AGCCGTTGGATNONE 
J023123E16AGCCGTTGGATNONE 
J033066B11AGCCGTTGGATNONE 
J065144G11AGCCGTTGGATNONE 
Os01g0716200AK062106AGCCGTTGGAIQ calmodulin-binding region domain containing protein. 
AK098920AGCCGTTGGANONE 
J013002N06AGCCGTTGGANONE 
J013050O19AGCCGTTGGANONE 
J013074N19AGCCGTTGGANONE 
J013127F17AGCCGTTGGANONE 
J013155C17AGCCGTTGGANONE 
J013158K07AGCCGTTGGANONE 
J053086D01AGCCGTTGGANONE 
Os01g0765000AK101905AGCCCAACGGCCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0785700AK100774AGCCGTTGGGCCTGNONE 
AK102081AGCCGTTGGGCCTGProtein prenyltransferase domain containing protein. 
AY129829AGCCGTTGGGCCTGNONE 
J023120B17AGCCGTTGGGCCTGNONE 
J033082K10AGCCGTTGGGCCTGNONE 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0816700AK100654GGCCGTTGGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0856000016-095-F09CCAACGGCNONE 
AK107439CCAACGGCSimilar to CDC6 protein. 
AK107451CCAACGGCNONE 
Os01g0862200AK059299CCAACGGCCConserved hypothetical protein. 
AK100818CCAACGGCCNONE 
J023122F03CCAACGGCCNONE 
Os01g0870100AK103428CCAACGGCNONE 
Os01g0896400AK107067CCAACGGCCConserved hypothetical protein. 
AK107067CCAACGGCTConserved hypothetical protein. 
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE 
AK072409CATCCCCCATCCAACGGCNONE 
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CATCCCCCATCCAACGGCNONE 
AY288943CATCCCCCATCCAACGGCNONE 
AY318757CATCCCCCATCCAACGGCNONE 
J013021C23CATCCCCCATCCAACGGCNONE 
J013027H03CATCCCCCATCCAACGGCNONE 
J013032C02CATCCCCCATCCAACGGCNONE 
J013068G13CATCCCCCATCCAACGGCNONE 
J013070K16CATCCCCCATCCAACGGCNONE 
J013070L02CATCCCCCATCCAACGGCNONE 
J013091E15CATCCCCCATCCAACGGCNONE 
J013109D04CATCCCCCATCCAACGGCNONE 
J013118B04CATCCCCCATCCAACGGCNONE 
J013129E08CATCCCCCATCCAACGGCNONE 
J013134I15CATCCCCCATCCAACGGCNONE 
J013146N16CATCCCCCATCCAACGGCNONE 
J023083F05CATCCCCCATCCAACGGCNONE 
J023107E17CATCCCCCATCCAACGGCNONE 
J023113D21CATCCCCCATCCAACGGCNONE 
J023123A22CATCCCCCATCCAACGGCNONE 
J023133I24CATCCCCCATCCAACGGCNONE 
J023134L21CATCCCCCATCCAACGGCNONE 
J023142N24CATCCCCCATCCAACGGCNONE 
J033051B12CATCCCCCATCCAACGGCNONE 
J033058B04CATCCCCCATCCAACGGCNONE 
J033068E24CATCCCCCATCCAACGGCNONE 
J033076D01CATCCCCCATCCAACGGCNONE 
J033088O06CATCCCCCATCCAACGGCNONE 
J033093K15CATCCCCCATCCAACGGCNONE 
J033101G18CATCCCCCATCCAACGGCNONE 
J033130A01CATCCCCCATCCAACGGCNONE 
J043027I17CATCCCCCATCCAACGGCNONE 
J043027L17CATCCCCCATCCAACGGCNONE 
J090001N13CATCCCCCATCCAACGGCNONE 
J090004L10CATCCCCCATCCAACGGCNONE 
J090027D08CATCCCCCATCCAACGGCNONE 
J090027H18CATCCCCCATCCAACGGCNONE 
J090031F16CATCCCCCATCCAACGGCNONE 
J090048L18CATCCCCCATCCAACGGCNONE 
J090050N08CATCCCCCATCCAACGGCNONE 
J090051G05CATCCCCCATCCAACGGCNONE 
J090063G03CATCCCCCATCCAACGGCNONE 
J090068P21CATCCCCCATCCAACGGCNONE 
J090072P21CATCCCCCATCCAACGGCNONE 
J090079A14CATCCCCCATCCAACGGCNONE 
J090086I20CATCCCCCATCCAACGGCNONE 
J090087D19CATCCCCCATCCAACGGCNONE 
J090099B06CATCCCCCATCCAACGGCNONE 
J100047J19CATCCCCCATCCAACGGCNONE 
J100058I06CATCCCCCATCCAACGGCNONE 
Os01g0917100AK107234ATCCAACGGCTConserved hypothetical protein. 
Os01g0976600AK072971GGCCGTGGCCGTTGGSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GGCCGTGGCCGTTGGNONE 
J075095H03GGCCGTGGCCGTTGGNONE 
J090089M19GGCCGTGGCCGTTGGNONE 
Os02g0100200AK121311ATCCAACGGCTSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0103000AK110906GCCGTTGGConserved hypothetical protein. 
Os02g0135000AK069693AGCCGTTGGAConserved hypothetical protein. 
J023028F11AGCCGTTGGANONE 
Os02g0148600AK059287GGCCGTTGGATConserved hypothetical protein. 
Os02g0163500AK070929AGCCGTTGGAConserved hypothetical protein. 
J065065O20AGCCGTTGGANONE 
J065073E14AGCCGTTGGANONE 
J065134J06AGCCGTTGGANONE 
J075017I19AGCCGTTGGANONE 
J075074A02AGCCGTTGGANONE 
J075088N14AGCCGTTGGANONE 
J075108F01AGCCGTTGGANONE 
J075114M06AGCCGTTGGANONE 
J075153E15AGCCGTTGGANONE 
J075158D01AGCCGTTGGANONE 
J075177K13AGCCGTTGGANONE 
J075195G15AGCCGTTGGANONE 
J075198A19AGCCGTTGGANONE 
Os02g0188500AK102004CATCCCCCTCCAACGGCTNONE 
AK106917CATCCCCCTCCAACGGCTUbiquitin domain containing protein. 
J090039N13CATCCCCCTCCAACGGCTNONE 
Os02g0202400AK107368GCCGTTGGTGGSimilar to Plastidial ADP-glucose transporter. 
J075147G14GCCGTTGGTGGNONE 
J090009K03GCCGTTGGTGGNONE 
Os02g0205000AK060003TCCAACGGCNONE 
AK073514TCCAACGGCRibosomal protein L19 family protein. 
J065106I07TCCAACGGCNONE 
Os02g0205400AK101434ATCCAACGGCCWD40-like domain containing protein. 
J043024M20ATCCAACGGCCNONE 
Os02g0218400AK068947CCAACGGCCUspA domain containing protein. 
Os02g0299600AK069297CCAACGGCProtein of unknown function DUF1242 family protein. 
Os02g0302900AK110752CCAACGGCTReticulon family protein. 
Os02g0324700006-086-H07CCAACGGCTNONE 
006-106-G09CCAACGGCTNONE 
AK060405CCAACGGCTConserved hypothetical protein. 
AK104437CCAACGGCTNONE 
Os02g0327000006-110-H11GCCGTTGGNONE 
AK073631GCCGTTGGC2 domain containing protein. 
AK104165GCCGTTGGNONE 
J023004L22GCCGTTGGNONE 
J023091P07GCCGTTGGNONE 
J023115A09GCCGTTGGNONE 
J023139A19GCCGTTGGNONE 
J033043I10GCCGTTGGNONE 
J033052D22GCCGTTGGNONE 
J033066B05GCCGTTGGNONE 
J043003P17GCCGTTGGNONE 
J043030K22GCCGTTGGNONE 
J065109P18GCCGTTGGNONE 
J065130G19GCCGTTGGNONE 
J065150K12GCCGTTGGNONE 
J065202B18GCCGTTGGNONE 
J065203K23GCCGTTGGNONE 
J090012O12GCCGTTGGNONE 
J090076M23GCCGTTGGNONE 
J100019I12GCCGTTGGNONE 
J100028N06GCCGTTGGNONE 
J100030G13GCCGTTGGNONE 
J100031O22GCCGTTGGNONE 
J100042F17GCCGTTGGNONE 
J100059C04GCCGTTGGNONE 
J100067G16GCCGTTGGNONE 
J100075K20GCCGTTGGNONE 
J100078D05GCCGTTGGNONE 
Os02g0467400AK072333AGCCGTTGGATConserved hypothetical protein. 
AK073879AGCCGTTGGATNONE 
AK121931AGCCGTTGGATNONE 
J065085B12AGCCGTTGGATNONE 
Os02g0556700AK073875ATCCAACGGCCT-complex 11 family protein. 
Os02g0598400AK109577CCAACGGCNONE 
J013132M15CCAACGGCNONE 
J065057M19CCAACGGCNONE 
J065134L23CCAACGGCNONE 
J090026B21CCAACGGCNONE 
J090029B13CCAACGGCNONE 
Os02g0611400AK101310AGCCGTTGGATProtein prenyltransferase domain containing protein. 
J033024H21AGCCGTTGGATNONE 
J033033O21AGCCGTTGGATNONE 
J065134H24AGCCGTTGGATNONE 
J090087E02AGCCGTTGGATNONE 
Os02g0615500AK068010TCCAACGGCNONE 
AK100073TCCAACGGCProtein kinase-like domain containing protein. 
J013170D14TCCAACGGCNONE 
Os02g0634900006-032-G12AGCCGTTGGCCCGTGGGNONE 
006-033-E09AGCCGTTGGCCCGTGGGNONE 
006-117-F10AGCCGTTGGCCCGTGGGNONE 
006-118-E01AGCCGTTGGCCCGTGGGNONE 
013-056-G08AGCCGTTGGCCCGTGGGNONE 
AK059769AGCCGTTGGCCCGTGGGNONE 
AK068583AGCCGTTGGCCCGTGGGNONE 
AK072855AGCCGTTGGCCCGTGGGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGCCGTTGGCCCGTGGGNONE 
J023138P05AGCCGTTGGCCCGTGGGNONE 
J023143J07AGCCGTTGGCCCGTGGGNONE 
J033022O09AGCCGTTGGCCCGTGGGNONE 
J033111L02AGCCGTTGGCCCGTGGGNONE 
J033135O03AGCCGTTGGCCCGTGGGNONE 
J065005K19AGCCGTTGGCCCGTGGGNONE 
J065044C17AGCCGTTGGCCCGTGGGNONE 
J065116K09AGCCGTTGGCCCGTGGGNONE 
J065119O21AGCCGTTGGCCCGTGGGNONE 
J075014L05AGCCGTTGGCCCGTGGGNONE 
J075109H16AGCCGTTGGCCCGTGGGNONE 
J075117D04AGCCGTTGGCCCGTGGGNONE 
Os02g0667600AK073500CCAACGGCCHarpin-induced 1 domain containing protein. 
AK109748CCAACGGCCNONE 
AK109816CCAACGGCCNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0695600009-130-G03GGCCGTTGGNONE 
009-141-A10GGCCGTTGGNONE 
009-185-F07GGCCGTTGGNONE 
AK062960GGCCGTTGGConserved hypothetical protein. 
J100046B17GGCCGTTGGNONE 
Os02g0714600AK068469AGCCGTTGGRibose-phosphate pyrophosphokinase 4 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 4). 
AK103643AGCCGTTGGNONE 
AK104867AGCCGTTGGNONE 
J013000G18AGCCGTTGGNONE 
J013156D24AGCCGTTGGNONE 
J023002E01AGCCGTTGGNONE 
J023036G15AGCCGTTGGNONE 
J023057B17AGCCGTTGGNONE 
J023105D01AGCCGTTGGNONE 
J033039M17AGCCGTTGGNONE 
J033079M15AGCCGTTGGNONE 
J033117J21AGCCGTTGGNONE 
Os02g0728600AK063054GCCGTTGGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04GCCGTTGGNONE 
Os02g0733300AK101108TCCAACGGCCGAAASimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGCCGAAANONE 
Os02g0744900AK061968ATCCAACGGCTSimilar to Geranylgeranyl reductase (Fragment). 
AK098873ATCCAACGGCTNONE 
J013001C18ATCCAACGGCTNONE 
J080003D07ATCCAACGGCTNONE 
J080003H24ATCCAACGGCTNONE 
J080010C23ATCCAACGGCTNONE 
J080011I04ATCCAACGGCTNONE 
J080011O03ATCCAACGGCTNONE 
J080012F13ATCCAACGGCTNONE 
J080020E06ATCCAACGGCTNONE 
J080025H22ATCCAACGGCTNONE 
J080026D15ATCCAACGGCTNONE 
J080028D20ATCCAACGGCTNONE 
J080029P20ATCCAACGGCTNONE 
J080031K22ATCCAACGGCTNONE 
J080034I05ATCCAACGGCTNONE 
J080036E11ATCCAACGGCTNONE 
J080036H13ATCCAACGGCTNONE 
J080037E17ATCCAACGGCTNONE 
J080043N05ATCCAACGGCTNONE 
J080044L23ATCCAACGGCTNONE 
J080047N11ATCCAACGGCTNONE 
J080048O04ATCCAACGGCTNONE 
J080049M01ATCCAACGGCTNONE 
J080050F21ATCCAACGGCTNONE 
J080054F09ATCCAACGGCTNONE 
J080055N20ATCCAACGGCTNONE 
J080058C02ATCCAACGGCTNONE 
J080058K15ATCCAACGGCTNONE 
J080062G02ATCCAACGGCTNONE 
J080066H16ATCCAACGGCTNONE 
J080066O05ATCCAACGGCTNONE 
J080067O16ATCCAACGGCTNONE 
J080068E13ATCCAACGGCTNONE 
J080069P16ATCCAACGGCTNONE 
J080072M11ATCCAACGGCTNONE 
J080076H09ATCCAACGGCTNONE 
J080081G24ATCCAACGGCTNONE 
J080082J05ATCCAACGGCTNONE 
J080084I10ATCCAACGGCTNONE 
J080087L24ATCCAACGGCTNONE 
J080089H07ATCCAACGGCTNONE 
J080089M05ATCCAACGGCTNONE 
J080092G18ATCCAACGGCTNONE 
J080095N08ATCCAACGGCTNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein. 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065017L09TCCAACGGCTNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065036A05TCCAACGGCTNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065087C01TCCAACGGCTNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065105A14TCCAACGGCTNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065164J03TCCAACGGCTNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065175J19TCCAACGGCTNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J065201H07TCCAACGGCTProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075032O12TCCAACGGCTNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075085D24TCCAACGGCTNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J075197C17TCCAACGGCTNONE 
J100032C19ATATGGGCCAACGGCCNONE 
J100032C19TCCAACGGCTNONE 
Os02g0776800AB042415ATCCAACGGCTNONE 
AK072308ATCCAACGGCTReplication protein A 70kDa. 
AK101212ATCCAACGGCTNONE 
J033031B02ATCCAACGGCTNONE 
J090004E18ATCCAACGGCTNONE 
J090084C24ATCCAACGGCTNONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE 
AK101248ATCCAACGGCCGAAANONE 
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein. 
AK109354ATCCAACGGCCGAAANONE 
J033032D06ATCCAACGGCCGAAANONE 
J080308A01ATCCAACGGCCGAAANONE 
J090071H02ATCCAACGGCCGAAANONE 
J100048C10ATCCAACGGCCGAAANONE 
Os03g0127900009-144-F12GCCGTTGGANONE 
AK062977GCCGTTGGASodium/hydrogen exchanger family protein. 
Os03g0128300AK064718CCAACGGCTConserved hypothetical protein. 
Os03g0129100003-009-E09CCAACGGCCNONE 
AF384030CCAACGGCCNONE 
AK098993CCAACGGCCSeven transmembrane protein MLO2. 
AK111990CCAACGGCCNONE 
J013098A12CCAACGGCCNONE 
J023020M16CCAACGGCCNONE 
J043001L02CCAACGGCCNONE 
Os03g0146300011-078-E08ATCCAACGGCCNONE 
014-009-B07ATCCAACGGCCNONE 
AK121395ATCCAACGGCCSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319ATCCAACGGCCNONE 
J013104I06ATCCAACGGCCNONE 
J023130M16ATCCAACGGCCNONE 
J053037E13ATCCAACGGCCNONE 
J075104M08ATCCAACGGCCNONE 
J075144I22ATCCAACGGCCNONE 
J100057B09ATCCAACGGCCNONE 
Os03g0152900Os03g0152900GCCGTTGGATKinesin, motor region domain containing protein. 
Os03g0159600AK106743CCAACGGCGTCCGATSimilar to Rab28 protein. 
J075041K15CCAACGGCGTCCGATNONE 
J075051E03CCAACGGCGTCCGATNONE 
J075055P19CCAACGGCGTCCGATNONE 
J075096D01CCAACGGCGTCCGATNONE 
Os03g0160200AK064836GCCCAGATCCAACGGCTConserved hypothetical protein. 
AK071081GCCCAGATCCAACGGCTNONE 
AK100712GCCCAGATCCAACGGCTNONE 
AK104859GCCCAGATCCAACGGCTNONE 
J013000F21GCCCAGATCCAACGGCTNONE 
J013024G05GCCCAGATCCAACGGCTNONE 
J013035E12GCCCAGATCCAACGGCTNONE 
J013041A17GCCCAGATCCAACGGCTNONE 
J013045D10GCCCAGATCCAACGGCTNONE 
J013045F04GCCCAGATCCAACGGCTNONE 
J013046F04GCCCAGATCCAACGGCTNONE 
J013047F10GCCCAGATCCAACGGCTNONE 
J013051E10GCCCAGATCCAACGGCTNONE 
J013059J07GCCCAGATCCAACGGCTNONE 
J013059O17GCCCAGATCCAACGGCTNONE 
J013060A20GCCCAGATCCAACGGCTNONE 
J013063J23GCCCAGATCCAACGGCTNONE 
J013066D19GCCCAGATCCAACGGCTNONE 
J013069O08GCCCAGATCCAACGGCTNONE 
J013088K24GCCCAGATCCAACGGCTNONE 
J013098G04GCCCAGATCCAACGGCTNONE 
J013100I15GCCCAGATCCAACGGCTNONE 
J013102E18GCCCAGATCCAACGGCTNONE 
J013102O09GCCCAGATCCAACGGCTNONE 
J013119M18GCCCAGATCCAACGGCTNONE 
J013123I19GCCCAGATCCAACGGCTNONE 
J013146H15GCCCAGATCCAACGGCTNONE 
J013149A14GCCCAGATCCAACGGCTNONE 
J023003A05GCCCAGATCCAACGGCTNONE 
J023013O19GCCCAGATCCAACGGCTNONE 
J023044M05GCCCAGATCCAACGGCTNONE 
J023048O03GCCCAGATCCAACGGCTNONE 
J023049L17GCCCAGATCCAACGGCTNONE 
J023060D22GCCCAGATCCAACGGCTNONE 
J023060F20GCCCAGATCCAACGGCTNONE 
J023069G09GCCCAGATCCAACGGCTNONE 
J023086E11GCCCAGATCCAACGGCTNONE 
J023091I09GCCCAGATCCAACGGCTNONE 
J023091M19GCCCAGATCCAACGGCTNONE 
J023101D06GCCCAGATCCAACGGCTNONE 
J023109B03GCCCAGATCCAACGGCTNONE 
J023113B14GCCCAGATCCAACGGCTNONE 
J023114B19GCCCAGATCCAACGGCTNONE 
J023115H16GCCCAGATCCAACGGCTNONE 
J023134F22GCCCAGATCCAACGGCTNONE 
J023139I06GCCCAGATCCAACGGCTNONE 
J023150C02GCCCAGATCCAACGGCTNONE 
J033033A14GCCCAGATCCAACGGCTNONE 
J033058O11GCCCAGATCCAACGGCTNONE 
J033060H13GCCCAGATCCAACGGCTNONE 
J033075P14GCCCAGATCCAACGGCTNONE 
J033084O05GCCCAGATCCAACGGCTNONE 
J033087G04GCCCAGATCCAACGGCTNONE 
J033092E18GCCCAGATCCAACGGCTNONE 
J033101G23GCCCAGATCCAACGGCTNONE 
J033112I05GCCCAGATCCAACGGCTNONE 
J033118E14GCCCAGATCCAACGGCTNONE 
J033118P04GCCCAGATCCAACGGCTNONE 
J033123C07GCCCAGATCCAACGGCTNONE 
J043003C01GCCCAGATCCAACGGCTNONE 
J043024B21GCCCAGATCCAACGGCTNONE 
J043030N04GCCCAGATCCAACGGCTNONE 
J043039J02GCCCAGATCCAACGGCTNONE 
J043039N08GCCCAGATCCAACGGCTNONE 
J075006N21GCCCAGATCCAACGGCTNONE 
J075008A16GCCCAGATCCAACGGCTNONE 
J075018J16GCCCAGATCCAACGGCTNONE 
J075023G04GCCCAGATCCAACGGCTNONE 
J075134F18GCCCAGATCCAACGGCTNONE 
J075181B05GCCCAGATCCAACGGCTNONE 
J090014O14GCCCAGATCCAACGGCTNONE 
J090020H22GCCCAGATCCAACGGCTNONE 
J090022G17GCCCAGATCCAACGGCTNONE 
J090023J24GCCCAGATCCAACGGCTNONE 
J090033H01GCCCAGATCCAACGGCTNONE 
J090038A03GCCCAGATCCAACGGCTNONE 
J090041O22GCCCAGATCCAACGGCTNONE 
J090049E10GCCCAGATCCAACGGCTNONE 
J090063E24GCCCAGATCCAACGGCTNONE 
J090080N12GCCCAGATCCAACGGCTNONE 
J100021G23GCCCAGATCCAACGGCTNONE 
J100028P06GCCCAGATCCAACGGCTNONE 
J100060L21GCCCAGATCCAACGGCTNONE 
J100077D16GCCCAGATCCAACGGCTNONE 
J100088I09GCCCAGATCCAACGGCTNONE 
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0209400006-064-D01AGCCGTTGGATNONE 
AK059829AGCCGTTGGATGot1-like protein family protein. 
J075020J24AGCCGTTGGATNONE 
J075021D13AGCCGTTGGATNONE 
J075024F20AGCCGTTGGATNONE 
J075030B10AGCCGTTGGATNONE 
J075042D12AGCCGTTGGATNONE 
J075053D16AGCCGTTGGATNONE 
J075060J09AGCCGTTGGATNONE 
J075097J19AGCCGTTGGATNONE 
J075138D24AGCCGTTGGATNONE 
J100030P20AGCCGTTGGATNONE 
J100052N12AGCCGTTGGATNONE 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0245800013-094-D06CCAACGGCNONE 
AB020973CCAACGGCNONE 
AK063618CCAACGGCNONE 
AK120045CCAACGGCNONE 
AK120048CCAACGGCSimilar to Heat shock protein 26. 
J075104O17CCAACGGCNONE 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0278900006-049-H12AGCCGTTGGATNONE 
006-082-A07AGCCGTTGGATNONE 
009-169-C04AGCCGTTGGATNONE 
AK066019AGCCGTTGGATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925AGCCGTTGGATNONE 
AY224460AGCCGTTGGATNONE 
J065021K17AGCCGTTGGATNONE 
J065141H24AGCCGTTGGATNONE 
J065142J20AGCCGTTGGATNONE 
J065152J03AGCCGTTGGATNONE 
J065163A13AGCCGTTGGATNONE 
J065191I21AGCCGTTGGATNONE 
J065193K12AGCCGTTGGATNONE 
J075003D01AGCCGTTGGATNONE 
J075017D24AGCCGTTGGATNONE 
J075060F20AGCCGTTGGATNONE 
J075154C11AGCCGTTGGATNONE 
J075173F04AGCCGTTGGATNONE 
Os03g0288900AK100329CCAACGGCConserved hypothetical protein. 
J023080H15CCAACGGCNONE 
J033136I21CCAACGGCNONE 
J065036A16CCAACGGCNONE 
J065186A16CCAACGGCNONE 
J065187B08CCAACGGCNONE 
J065202E24CCAACGGCNONE 
Os03g0318500AK121967CCAACGGCSimilar to Glucose-6-phosphate 1-dehydrogenase, chloroplast precursor (EC 1.1.1.49) (G6PD). 
Os03g0386000AK072984CCAACGGCSimilar to WD domain protein-like. 
J065009K18CCAACGGCNONE 
J065165P09CCAACGGCNONE 
Os03g0393900AK069809AGCCGTTGGTTGGGCSimilar to S.tuberosum patatin (Fragment). 
J023030J03AGCCGTTGGTTGGGCNONE 
Os03g0426900AK069123ATCCAACGGCSimilar to Heat shock protein 101. 
Os03g0431500AK110714TCCAACGGCTConserved hypothetical protein. 
Os03g0576900AK064861ATCCAACGGCCNONE 
J013000I01ATCCAACGGCCNONE 
J013169P21ATCCAACGGCCNONE 
J023001P03ATCCAACGGCCNONE 
J023009M10ATCCAACGGCCNONE 
J023025G11ATCCAACGGCCNONE 
J033046B19ATCCAACGGCCNONE 
J033149I10ATCCAACGGCCNONE 
J090081C04ATCCAACGGCCNONE 
Os03g0672400AK061599TCCAACGGCCConserved hypothetical protein. 
Os03g0702000011-023-H12GCCGTTGGATNONE 
AK105398GCCGTTGGATNONE 
AK119905GCCGTTGGATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK121682GCCGTTGGATNONE 
J033070B15GCCGTTGGATNONE 
J033117B11GCCGTTGGATNONE 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0713100J013039M09ATCCAACGGCTNONE 
J023007K01ATCCAACGGCTNONE 
J023073H01ATCCAACGGCTNONE 
J023087M20ATCCAACGGCTNONE 
J023142E01ATCCAACGGCTNONE 
J033048E03ATCCAACGGCTNONE 
J033048F03ATCCAACGGCTSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11ATCCAACGGCTNONE 
J033074M20ATCCAACGGCTNONE 
J033084M11ATCCAACGGCTNONE 
J033091I23ATCCAACGGCTNONE 
J033100C08ATCCAACGGCTNONE 
J033123K19ATCCAACGGCTNONE 
J090006P21ATCCAACGGCTNONE 
J090045O16ATCCAACGGCTNONE 
J100087M13ATCCAACGGCTNONE 
Os03g0753600AK067449ATCCAACGGCChromo domain containing protein. 
J013107L13ATCCAACGGCNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0770900AK106660CCAACGGCTAATGGGCTConserved hypothetical protein. 
AK106660TCCAACGGCTConserved hypothetical protein. 
Os03g0780400011-100-D09AGCCGTTGGATNONE 
AK061347AGCCGTTGGATNONE 
AK073162AGCCGTTGGATSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGCCGTTGGATNONE 
J065045I07AGCCGTTGGATNONE 
J090036F17AGCCGTTGGATNONE 
J090077M14AGCCGTTGGATNONE 
J100055G20AGCCGTTGGATNONE 
Os03g0805100AB007501GCCGTTGGSimilar to Squalene synthase (EC 2.5.1.21). 
J065122P10GCCGTTGGNONE 
J090011P14GCCGTTGGNONE 
J100043D07GCCGTTGGNONE 
Os03g0808600AK066615TCCAACGGCSimilar to Calcium-dependent protein kinase. 
Os03g0830500J065024D01GCCGTTGGNONE 
J065078H14GCCGTTGGNONE 
J065099B04GCCGTTGGNONE 
J065129J08GCCGTTGGNONE 
J100037P21GCCGTTGGNONE 
Os03g0850600AK067191GGCCGTTGGATConserved hypothetical protein. 
J013095N12GGCCGTTGGATNONE 
J065214L06GGCCGTTGGATNONE 
J075093J10GGCCGTTGGATNONE 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0504200AK110863CCAACGGCTConserved hypothetical protein. 
Os04g0528600J065037M09CCAACGGCTConserved hypothetical protein. 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0558700AK110633ATCCAACGGCTConserved hypothetical protein. 
Os04g0560100006-090-B07CCAACGGCCCNONE 
AK071033CCAACGGCCCNONE 
AK106001CCAACGGCCCCytochrome P450 family protein. 
J023063N21CCAACGGCCCNONE 
J023078O09CCAACGGCCCNONE 
J090062K20CCAACGGCCCNONE 
Os04g0563700015-005-B06AGCCGTTGGNONE 
AB024987AGCCGTTGGNONE 
AK070211AGCCGTTGGCyclin. 
Os04g0578400AK060559AGCCGTTGGATSimilar to Beta-ring hydroxylase (Fragment). 
Os04g0598000013-056-C01AGCCGTTGGNONE 
AK121673AGCCGTTGGConserved hypothetical protein. 
J013055M22AGCCGTTGGNONE 
J023038C06AGCCGTTGGNONE 
J033068C09AGCCGTTGGNONE 
J075026L16AGCCGTTGGNONE 
J075099K14AGCCGTTGGNONE 
J075121B18AGCCGTTGGNONE 
J075156K08AGCCGTTGGNONE 
J075190I04AGCCGTTGGNONE 
J080315E20AGCCGTTGGNONE 
J090049E09AGCCGTTGGNONE 
J100024F09AGCCGTTGGNONE 
J100041H21AGCCGTTGGNONE 
J100073L07AGCCGTTGGNONE 
J100077K04AGCCGTTGGNONE 
J100080P09AGCCGTTGGNONE 
J100087E22AGCCGTTGGNONE 
Os04g0602100AK069838CCAACGGCHaem peroxidase family protein. 
AK121197CCAACGGCNONE 
J023087B01CCAACGGCNONE 
Os04g0604900AK059203GCCGTTGGSimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0631200013-003-B06CCAACGGCTNONE 
AK059277CCAACGGCTSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331CCAACGGCTNONE 
J033024P08CCAACGGCTNONE 
J033041G02CCAACGGCTNONE 
J053075H12CCAACGGCTNONE 
J065016B13CCAACGGCTNONE 
J090075B22CCAACGGCTNONE 
J100084K17CCAACGGCTNONE 
Os04g0636400006-064-G07CCAACGGCNONE 
006-097-D05CCAACGGCNONE 
AK061848CCAACGGCSimilar to Senescence-associated protein 6. 
AK099573CCAACGGCNONE 
J013035J20CCAACGGCNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os05g0297300AK067752CCACCAACGGCTProtein of unknown function DUF1618 domain containing protein. 
J013114A11CCACCAACGGCTNONE 
Os05g0350500013-071-D05GCCGTTGGATNONE 
AF020787GCCGTTGGATNONE 
AK061712GCCGTTGGATNONE 
AK102897GCCGTTGGATProliferation-associated protein 1 family protein. 
J033060G23GCCGTTGGATNONE 
J033112P14GCCGTTGGATNONE 
J033127J04GCCGTTGGATNONE 
J090015L18GCCGTTGGATNONE 
J090047K03GCCGTTGGATNONE 
J090097J17GCCGTTGGATNONE 
Os05g0381700AK068838CCAACGGCCalmodulin-binding, plant family protein. 
J013160I23CCAACGGCNONE 
Os05g0411300014-098-D05CCACCAACGGCNONE 
015-093-F04CCACCAACGGCNONE 
AK071931CCACCAACGGCConserved hypothetical protein. 
AK073142CCACCAACGGCNONE 
Os05g0413200006-067-C03CCCATCCAACGGCCNONE 
006-080-C03CCCATCCAACGGCCNONE 
006-095-G10CCCATCCAACGGCCNONE 
006-115-G11CCCATCCAACGGCCNONE 
013-040-E05CCCATCCAACGGCCNONE 
AB104732CCCATCCAACGGCCNONE 
AK122099CCCATCCAACGGCCBeta-tubulin. 
J033087H20CCCATCCAACGGCCNONE 
J033117C18CCCATCCAACGGCCNONE 
J033125G10CCCATCCAACGGCCNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0466600009-088-F09CTCCCCCATCCAACGGCNONE 
009-105-C11CTCCCCCATCCAACGGCNONE 
009-156-C06CTCCCCCATCCAACGGCNONE 
AK119240CTCCCCCATCCAACGGChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0485300AK102064AGCCGTTGGProtein of unknown function DUF887, TLC-like family protein. 
Os05g0491200AK068637ATCCAACGGCSimilar to SNF1 kinase complex anchoring protein (Fragment). 
AK071229ATCCAACGGCNONE 
Os05g0519800AK069435ATCCAACGGCTProtein of unknown function DUF28 family protein. 
J023024L22ATCCAACGGCTNONE 
Os05g0560300AK065592AGCCGTTGGProtein kinase-like domain containing protein. 
Os05g0560600011-097-B07ATCCAACGGCNONE 
AK067862ATCCAACGGCNONE 
AK122091ATCCAACGGCHomeodomain-like containing protein. 
J013124K11ATCCAACGGCNONE 
J033124C04ATCCAACGGCNONE 
J065013L06ATCCAACGGCNONE 
J065117J23ATCCAACGGCNONE 
Os05g0567100015-030-G11ATCCAACGGCTNONE 
AK066453ATCCAACGGCTNONE 
AK067742ATCCAACGGCTNONE 
AK098906ATCCAACGGCTNONE 
AK098911ATCCAACGGCTNONE 
AK103421ATCCAACGGCTNONE 
AK104838ATCCAACGGCTNONE 
D32144ATCCAACGGCTAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14ATCCAACGGCTNONE 
J013002H22ATCCAACGGCTNONE 
J013022G01ATCCAACGGCTNONE 
J013039N15ATCCAACGGCTNONE 
J023007F19ATCCAACGGCTNONE 
J023107B10ATCCAACGGCTNONE 
J033038D21ATCCAACGGCTNONE 
J033043E23ATCCAACGGCTNONE 
J033061A06ATCCAACGGCTNONE 
Os05g0571600Os05g0571600ATCCAACGGCConserved hypothetical protein. 
Os05g0571800009-157-G07ATCCAACGGCNONE 
AK063033ATCCAACGGCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCCAACGGCCNONE 
006-021-A08CCAACGGCNONE 
006-049-A11ATCCAACGGCCNONE 
006-049-A11CCAACGGCNONE 
006-086-F03ATCCAACGGCCNONE 
006-086-F03CCAACGGCNONE 
009-051-F06ATCCAACGGCCNONE 
009-051-F06CCAACGGCNONE 
AB015287ATCCAACGGCCNONE 
AB015287CCAACGGCNONE 
AB015972ATCCAACGGCCNONE 
AB015972CCAACGGCNONE 
AK061714ATCCAACGGCCNONE 
AK061714CCAACGGCNONE 
AK098889ATCCAACGGCCNONE 
AK098889CCAACGGCNONE 
AK121699ATCCAACGGCCSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
AK121699CCAACGGCSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCAACGGCCNONE 
J013001L15CCAACGGCNONE 
J013072D17ATCCAACGGCCNONE 
J013072D17CCAACGGCNONE 
J023028M04ATCCAACGGCCNONE 
J023028M04CCAACGGCNONE 
J023031F01ATCCAACGGCCNONE 
J023031F01CCAACGGCNONE 
J023114L22ATCCAACGGCCNONE 
J023114L22CCAACGGCNONE 
J033058L12ATCCAACGGCCNONE 
J033058L12CCAACGGCNONE 
J033073D17ATCCAACGGCCNONE 
J033073D17CCAACGGCNONE 
J043031D08ATCCAACGGCCNONE 
J043031D08CCAACGGCNONE 
J043036G01ATCCAACGGCCNONE 
J043036G01CCAACGGCNONE 
J065144O04ATCCAACGGCCNONE 
J065144O04CCAACGGCNONE 
J065181O08ATCCAACGGCCNONE 
J065181O08CCAACGGCNONE 
J080066B20ATCCAACGGCCNONE 
J080066B20CCAACGGCNONE 
Os05g0596200009-059-G06GACACGTGAGCCGTTGGATNONE 
AK062521GACACGTGAGCCGTTGGATNONE 
AK107887GACACGTGAGCCGTTGGATConserved hypothetical protein. 
AK108209GACACGTGAGCCGTTGGATNONE 
J065154B01GACACGTGAGCCGTTGGATNONE 
Os05g0597100011-044-C10CCAACGGCTNONE 
AF255711CCAACGGCTNONE 
AK072845CCAACGGCTSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16CCAACGGCTNONE 
J023135M22CCAACGGCTNONE 
J023141B21CCAACGGCTNONE 
J023142J09CCAACGGCTNONE 
J033025E09CCAACGGCTNONE 
J033111A20CCAACGGCTNONE 
J033126I01CCAACGGCTNONE 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0115300009-165-C05CCACCAACGGCCCNONE 
AK058833CCACCAACGGCCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09CCACCAACGGCCCNONE 
J075002E09CCACCAACGGCCCNONE 
J075015K23CCACCAACGGCCCNONE 
J075043B06CCACCAACGGCCCNONE 
J075057O21CCACCAACGGCCCNONE 
J075085L21CCACCAACGGCCCNONE 
J075134N20CCACCAACGGCCCNONE 
J075155O22CCACCAACGGCCCNONE 
J075198N22CCACCAACGGCCCNONE 
Os06g0128400AK064390ATCCAACGGCNONE 
AK121983ATCCAACGGCWD40-like domain containing protein. 
Os06g0131500012-073-H11CCAACGGCCNONE 
AK105303CCAACGGCCGlycoside hydrolase, family 17 protein. 
AK109675CCAACGGCCNONE 
J100041O13CCAACGGCCNONE 
Os06g0134000AJ417525ATCCAACGGCCNONE 
AJ417525ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK120319ATCCAACGGCCNONE 
AK120319ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
Os06g0152800003-125-D04TCCAACGGCTNONE 
AK099578TCCAACGGCTConserved hypothetical protein. 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0337100006-100-G05GGTCCACGCCGTTGGNONE 
AK061222GGTCCACGCCGTTGGConserved hypothetical protein. 
Os06g0367500013-096-F01CCAACGGCNONE 
AK063619CCAACGGCPrefoldin domain containing protein. 
Os06g0495800J100069N08CCAACGGCTProtein of unknown function DUF617, plant family protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0589500AK073322CCAACGGCConserved hypothetical protein. 
J033030G15CCAACGGCNONE 
J033148N18CCAACGGCNONE 
Os06g0598900AK100386ATCCAACGGCSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05ATCCAACGGCNONE 
J090043L20ATCCAACGGCNONE 
Os06g0652000AB096015ATCCAACGGCCNONE 
AB120430ATCCAACGGCCNONE 
AK069977ATCCAACGGCCSimilar to T3/T7-like RNA polymerase (Fragment). 
J023038J05ATCCAACGGCCNONE 
J033126K18ATCCAACGGCCNONE 
J043039G23ATCCAACGGCCNONE 
J090084C08ATCCAACGGCCNONE 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os07g0115300006-039-C05ATCCAACGGCCNONE 
AK061511ATCCAACGGCCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0167200003-103-H10ATCCAACGGCTNONE 
012-001-G01ATCCAACGGCTNONE 
AK120608ATCCAACGGCTSimilar to Zinc finger POZ domain protein (Fragment). 
J023093N23ATCCAACGGCTNONE 
J100059P15ATCCAACGGCTNONE 
Os07g0285200AK073171CCAACGGCCyclin-like F-box domain containing protein. 
J033022I08CCAACGGCNONE 
J065080B02CCAACGGCNONE 
J100059N11CCAACGGCNONE 
Os07g0408500AK103596AGCCGTTGGASimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0499800AK120716CCAACGGCZinc finger, RING-type domain containing protein. 
Os07g0516900009-108-C10ATCCAACGGCNONE 
AK062798ATCCAACGGCNONE 
Os07g0530600AK120747TCCAACGGCProtein of unknown function DUF299 family protein. 
Os07g0531500J065122B10TCCAACGGCCHarpin-induced 1 domain containing protein. 
Os07g0586700AK102792ATCCAACGGCCConserved hypothetical protein. 
Os07g0588800015-027-E02GGCCGTTGGNONE 
AK070635GGCCGTTGGNONE 
AK103183GGCCGTTGGConserved hypothetical protein. 
J023058H18GGCCGTTGGNONE 
Os07g0607800009-036-C11GGCCGTTGGNONE 
Os07g0657200AB042102CCAACGGCCGAGATNONE 
AK072927CCAACGGCCGAGATWD40-like domain containing protein. 
AK100911CCAACGGCCGAGATNONE 
Os07g0657600J065001N02AGCCGTTGGATNONE 
J065002E03AGCCGTTGGATDNA glycosylase family protein. 
Os08g0178800009-155-D05CCAACGGCNONE 
AK063025CCAACGGCHypothetical protein. 
Os08g0273000AK119305CCAACGGCRNA-directed DNA polymerase (Reverse transcriptase) domain containing protein. 
Os08g0459300AK060409TCCACGCCAACGGCConserved hypothetical protein. 
AK101386TCCACGCCAACGGCNONE 
J033034E20TCCACGCCAACGGCNONE 
J033036F14TCCACGCCAACGGCNONE 
J065047G22TCCACGCCAACGGCNONE 
J065173C14TCCACGCCAACGGCNONE 
J065188O22TCCACGCCAACGGCNONE 
J065189C17TCCACGCCAACGGCNONE 
J065197I16TCCACGCCAACGGCNONE 
J065202E05TCCACGCCAACGGCNONE 
J075022D03TCCACGCCAACGGCNONE 
J075023K21TCCACGCCAACGGCNONE 
J075096D12TCCACGCCAACGGCNONE 
J075129K24TCCACGCCAACGGCNONE 
Os08g0525500009-041-D07CCAACGGCNONE 
AK063792CCAACGGCNONE 
AK073336CCAACGGCProtein prenyltransferase domain containing protein. 
Os08g0558000J080005K14ATCCAACGGCTNONE 
Os08g0558400AK071334ATCCAACGGCCSimilar to Kinesin heavy chain (Fragment). 
Os08g0566700AK119354GCCGTTGGConserved hypothetical protein. 
Os09g0127800AK103786ATCCAACGGCSimilar to Coatomer alpha subunit. 
Os09g0272300AK102527CCAACGGCTSimilar to 3-glucanase. 
Os09g0358500Os09g0358500ATCCAACGGCCNONE 
Os09g0439400AK121407ATCCAACGGCTGCGGTGCGVirulence factor, pectin lyase fold family protein. 
Os09g0464000AK060777ATCCAACGGCCNONE 
AK069530ATCCAACGGCCSimilar to Carbonate dehydratase-like protein. 
Os09g0486500006-062-H11CCAACGGCCNONE 
009-049-A11CCAACGGCCNONE 
009-070-D06CCAACGGCCNONE 
009-089-A10CCAACGGCCNONE 
009-107-D06CCAACGGCCNONE 
009-133-F02CCAACGGCCNONE 
009-142-A05CCAACGGCCNONE 
009-175-G07CCAACGGCCNONE 
013-044-C05CCAACGGCCNONE 
014-044-D10CCAACGGCCNONE 
AF140722CCAACGGCCNONE 
AK061067CCAACGGCCNONE 
AK070140CCAACGGCCNONE 
AK106128CCAACGGCCMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793CCAACGGCCNONE 
J023042G11CCAACGGCCNONE 
J053043H07CCAACGGCCNONE 
J053046N13CCAACGGCCNONE 
J053091K15CCAACGGCCNONE 
J053094I21CCAACGGCCNONE 
J053094N04CCAACGGCCNONE 
J053100D12CCAACGGCCNONE 
J053101K11CCAACGGCCNONE 
J065079H06CCAACGGCCNONE 
J100028D11CCAACGGCCNONE 
J100033A20CCAACGGCCNONE 
J100033F15CCAACGGCCNONE 
Os09g0536000AK103074TCCAACGGCExodeoxyribonuclease III xth family protein. 
J033128L03TCCAACGGCNONE 
Os09g0538450J080302B10AGCCGTTGGAHypothetical protein. 
Os09g0547300AK102669GGCCGTTGCCAACGGCNONE 
Os09g0553900AK099586CCAACGGCCConserved hypothetical protein. 
AY224489CCAACGGCCNONE 
J075017C20CCAACGGCCNONE 
J075019K19CCAACGGCCNONE 
J075060C16CCAACGGCCNONE 
J075089B07CCAACGGCCNONE 
J075114D23CCAACGGCCNONE 
J075143J23CCAACGGCCNONE 
J075150K03CCAACGGCCNONE 
J075156M11CCAACGGCCNONE 
J075166B12CCAACGGCCNONE 
J075179F24CCAACGGCCNONE 
Os11g0130300AK059597CCAACGGCNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224CCAACGGCNONE 
J033031D09CCAACGGCNONE 
J033135B02CCAACGGCNONE 
J100021A17CCAACGGCNONE 
J100066G09CCAACGGCNONE 
Os11g0158400AK102797CCAACGGCCSimilar to Digalactosyldiacylglycerol synthase 1. 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0547000AK100677GCCGTTGGATSimilar to FKF1. 
Os11g0549620006-091-C11GCCGTTGGNONE 
AK061321GCCGTTGGSimilar to Purple acid phosphatase. 
AK106004GCCGTTGGNONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0610700012-090-B04GCCGTTGGATNONE 
AK099760GCCGTTGGATWD40-like domain containing protein. 
J065026G23GCCGTTGGATNONE 
J065062A01GCCGTTGGATNONE 
J065065J18GCCGTTGGATNONE 
J100026C05GCCGTTGGATNONE 
Os11g0621400009-043-B05AGCCCAACGGCTNONE 
009-043-B05CCAACGGCCNONE 
AK062468AGCCCAACGGCTConserved hypothetical protein. 
AK062468CCAACGGCCConserved hypothetical protein. 
Os11g0703900011-004-D05ATCCAACGGCTNONE 
011-014-C03ATCCAACGGCTNONE 
011-016-C01ATCCAACGGCTNONE 
011-017-B04ATCCAACGGCTNONE 
011-017-E09ATCCAACGGCTNONE 
011-019-E12ATCCAACGGCTNONE 
011-021-H12ATCCAACGGCTNONE 
011-025-H02ATCCAACGGCTNONE 
011-027-B09ATCCAACGGCTNONE 
011-039-G07ATCCAACGGCTNONE 
011-044-G07ATCCAACGGCTNONE 
011-046-F11ATCCAACGGCTNONE 
011-070-F02ATCCAACGGCTNONE 
011-071-A07ATCCAACGGCTNONE 
011-082-A03ATCCAACGGCTNONE 
011-086-B09ATCCAACGGCTNONE 
011-092-C04ATCCAACGGCTNONE 
012-006-F02ATCCAACGGCTNONE 
012-011-G08ATCCAACGGCTNONE 
012-026-C06ATCCAACGGCTNONE 
012-026-G06ATCCAACGGCTNONE 
012-028-E05ATCCAACGGCTNONE 
012-040-A05ATCCAACGGCTNONE 
012-045-C01ATCCAACGGCTNONE 
012-046-A10ATCCAACGGCTNONE 
012-047-H09ATCCAACGGCTNONE 
012-059-A12ATCCAACGGCTNONE 
012-072-D06ATCCAACGGCTNONE 
012-073-D05ATCCAACGGCTNONE 
012-076-D08ATCCAACGGCTNONE 
012-079-G05ATCCAACGGCTNONE 
012-080-A04ATCCAACGGCTNONE 
012-080-E01ATCCAACGGCTNONE 
012-083-C03ATCCAACGGCTNONE 
012-083-G06ATCCAACGGCTNONE 
012-086-G02ATCCAACGGCTNONE 
012-091-A07ATCCAACGGCTNONE 
012-094-G10ATCCAACGGCTNONE 
012-098-A07ATCCAACGGCTNONE 
012-100-G04ATCCAACGGCTNONE 
015-001-A11ATCCAACGGCTNONE 
015-033-E01ATCCAACGGCTNONE 
015-047-F12ATCCAACGGCTNONE 
015-054-E05ATCCAACGGCTNONE 
015-063-H02ATCCAACGGCTNONE 
015-075-E10ATCCAACGGCTNONE 
015-086-F05ATCCAACGGCTNONE 
016-031-A08ATCCAACGGCTNONE 
016-053-A03ATCCAACGGCTNONE 
016-054-C09ATCCAACGGCTNONE 
016-079-C08ATCCAACGGCTNONE 
AK065431ATCCAACGGCTHeat shock protein 70. 
AK119255ATCCAACGGCTNONE 
J013021C12ATCCAACGGCTNONE 
J013021C17ATCCAACGGCTNONE 
J023027B08ATCCAACGGCTNONE 
J023078A21ATCCAACGGCTNONE 
J023097M06ATCCAACGGCTNONE 
J023100O04ATCCAACGGCTNONE 
J023107B17ATCCAACGGCTNONE 
J023108L24ATCCAACGGCTNONE 
J023109L05ATCCAACGGCTNONE 
J033022M22ATCCAACGGCTNONE 
J033023K21ATCCAACGGCTNONE 
J033031L11ATCCAACGGCTNONE 
J033034H10ATCCAACGGCTNONE 
J033037B16ATCCAACGGCTNONE 
J033037F16ATCCAACGGCTNONE 
J033037H07ATCCAACGGCTNONE 
J033046E22ATCCAACGGCTNONE 
J033050N12ATCCAACGGCTNONE 
J033064F10ATCCAACGGCTNONE 
J033064N10ATCCAACGGCTNONE 
J033066O09ATCCAACGGCTNONE 
J033068H01ATCCAACGGCTNONE 
J033068J07ATCCAACGGCTNONE 
J033070B10ATCCAACGGCTNONE 
J033070G13ATCCAACGGCTNONE 
J033073O13ATCCAACGGCTNONE 
J033075B07ATCCAACGGCTNONE 
J033079L15ATCCAACGGCTNONE 
J033081J06ATCCAACGGCTNONE 
J033086G13ATCCAACGGCTNONE 
J033086N07ATCCAACGGCTNONE 
J033086O05ATCCAACGGCTNONE 
J033091A15ATCCAACGGCTNONE 
J033091D05ATCCAACGGCTNONE 
J033094C12ATCCAACGGCTNONE 
J033099P03ATCCAACGGCTNONE 
J033107L09ATCCAACGGCTNONE 
J033108D16ATCCAACGGCTNONE 
J033109E12ATCCAACGGCTNONE 
J033109K14ATCCAACGGCTNONE 
J033112P22ATCCAACGGCTNONE 
J033116F12ATCCAACGGCTNONE 
J033116K01ATCCAACGGCTNONE 
J033118F19ATCCAACGGCTNONE 
J033121J10ATCCAACGGCTNONE 
J033126H04ATCCAACGGCTNONE 
J033131G17ATCCAACGGCTNONE 
J033131L05ATCCAACGGCTNONE 
J033136A08ATCCAACGGCTNONE 
J033136H22ATCCAACGGCTNONE 
J033143F01ATCCAACGGCTNONE 
J065040M10ATCCAACGGCTNONE 
J065046F17ATCCAACGGCTNONE 
J065048G20ATCCAACGGCTNONE 
J065071N06ATCCAACGGCTNONE 
J065084I24ATCCAACGGCTNONE 
J065171B01ATCCAACGGCTNONE 
J065191J21ATCCAACGGCTNONE 
J065199I20ATCCAACGGCTNONE 
J075076C02ATCCAACGGCTNONE 
J090002P12ATCCAACGGCTNONE 
J090003A11ATCCAACGGCTNONE 
J090003H11ATCCAACGGCTNONE 
J090009M22ATCCAACGGCTNONE 
J090009O11ATCCAACGGCTNONE 
J090014N09ATCCAACGGCTNONE 
J090015A18ATCCAACGGCTNONE 
J090016E16ATCCAACGGCTNONE 
J090016I07ATCCAACGGCTNONE 
J090017O07ATCCAACGGCTNONE 
J090019E10ATCCAACGGCTNONE 
J090020D24ATCCAACGGCTNONE 
J090021M16ATCCAACGGCTNONE 
J090022F13ATCCAACGGCTNONE 
J090023H03ATCCAACGGCTNONE 
J090024E15ATCCAACGGCTNONE 
J090024G19ATCCAACGGCTNONE 
J090026J19ATCCAACGGCTNONE 
J090030E20ATCCAACGGCTNONE 
J090030I15ATCCAACGGCTNONE 
J090032F04ATCCAACGGCTNONE 
J090033N22ATCCAACGGCTNONE 
J090033O19ATCCAACGGCTNONE 
J090036F08ATCCAACGGCTNONE 
J090039A13ATCCAACGGCTNONE 
J090042N07ATCCAACGGCTNONE 
J090043C15ATCCAACGGCTNONE 
J090043N09ATCCAACGGCTNONE 
J090053J10ATCCAACGGCTNONE 
J090054F14ATCCAACGGCTNONE 
J090057N12ATCCAACGGCTNONE 
J090061P13ATCCAACGGCTNONE 
J090062F17ATCCAACGGCTNONE 
J090065H15ATCCAACGGCTNONE 
J090067P11ATCCAACGGCTNONE 
J090068M09ATCCAACGGCTNONE 
J090069E24ATCCAACGGCTNONE 
J090069K16ATCCAACGGCTNONE 
J090070N07ATCCAACGGCTNONE 
J090072M09ATCCAACGGCTNONE 
J090075I24ATCCAACGGCTNONE 
J090075M04ATCCAACGGCTNONE 
J090077D24ATCCAACGGCTNONE 
J090080M17ATCCAACGGCTNONE 
J090080O14ATCCAACGGCTNONE 
J090081C12ATCCAACGGCTNONE 
J090084N21ATCCAACGGCTNONE 
J090084O21ATCCAACGGCTNONE 
J090087J18ATCCAACGGCTNONE 
J090092L17ATCCAACGGCTNONE 
J090097A08ATCCAACGGCTNONE 
J100017E24ATCCAACGGCTNONE 
J100018K11ATCCAACGGCTNONE 
J100019A16ATCCAACGGCTNONE 
J100023I23ATCCAACGGCTNONE 
J100024D07ATCCAACGGCTNONE 
J100025H12ATCCAACGGCTNONE 
J100027K19ATCCAACGGCTNONE 
J100028C23ATCCAACGGCTNONE 
J100029A14ATCCAACGGCTNONE 
J100029O19ATCCAACGGCTNONE 
J100030I09ATCCAACGGCTNONE 
J100030J16ATCCAACGGCTNONE 
J100031C01ATCCAACGGCTNONE 
J100031N06ATCCAACGGCTNONE 
J100033H04ATCCAACGGCTNONE 
J100034L20ATCCAACGGCTNONE 
J100036K13ATCCAACGGCTNONE 
J100039M02ATCCAACGGCTNONE 
J100040J01ATCCAACGGCTNONE 
J100042O21ATCCAACGGCTNONE 
J100042P20ATCCAACGGCTNONE 
J100047K22ATCCAACGGCTNONE 
J100049B16ATCCAACGGCTNONE 
J100052M10ATCCAACGGCTNONE 
J100053B05ATCCAACGGCTNONE 
J100053B20ATCCAACGGCTNONE 
J100055I11ATCCAACGGCTNONE 
J100056A13ATCCAACGGCTNONE 
J100057C08ATCCAACGGCTNONE 
J100057N11ATCCAACGGCTNONE 
J100057P07ATCCAACGGCTNONE 
J100059E16ATCCAACGGCTNONE 
J100063N14ATCCAACGGCTNONE 
J100069H01ATCCAACGGCTNONE 
J100071C17ATCCAACGGCTNONE 
J100071K09ATCCAACGGCTNONE 
J100077D07ATCCAACGGCTNONE 
J100078P22ATCCAACGGCTNONE 
J100080F11ATCCAACGGCTNONE 
J100081L07ATCCAACGGCTNONE 
J100083B10ATCCAACGGCTNONE 
J100083K17ATCCAACGGCTNONE 
J100085B22ATCCAACGGCTNONE 
J100085L21ATCCAACGGCTNONE 
J100086B11ATCCAACGGCTNONE 
J100087E06ATCCAACGGCTNONE 
J100087P07ATCCAACGGCTNONE 
J100089H24ATCCAACGGCTNONE 
Os12g0137500011-018-C07GCCGTTGGATNONE 
AY224436GCCGTTGGATSimilar to Avr9/Cf-9 rapidly elicited protein 271 (Fragment). 
J013147P17GCCGTTGGATNONE 
J013153A04GCCGTTGGATNONE 
J023006N14GCCGTTGGATNONE 
J023045C20GCCGTTGGATNONE 
J033065M21GCCGTTGGATNONE 
J033070P21GCCGTTGGATNONE 
J090010P14GCCGTTGGATNONE 
J090024N03GCCGTTGGATNONE 
J090027L04GCCGTTGGATNONE 
J090068E18GCCGTTGGATNONE 
Os12g0149000AK108734ATCCAACGGCConserved hypothetical protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0235800AK058700GGCCGTTGGNONE 
Os12g0270300AK070311GGTCCCACCAACGGCDisease resistance protein family protein. 
AK103036GGTCCCACCAACGGCNONE 
Os12g0502100Os12g0502100GCCGTTGGATCTGGGCConserved hypothetical protein. 
Os12g0610950J075157D04AGCCGTTGGATHypothetical protein. 
Os12g0640700AK108649CCAACGGCTN/apple PAN domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.