version

Summary of OsREG520 (All List)

OrganismOryza sativa  
IDOsREG520  
SequenceCCACCAAC  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count2392  

Entry Sequences (2392 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09CCAGCCCACCAACNONE 
015-011-E06CCAGCCCACCAACNONE 
016-083-H11CCAGCCCACCAACNONE 
AK100002CCAGCCCACCAACConserved hypothetical protein. 
J065063K05CCAGCCCACCAACNONE 
J065191H24CCAGCCCACCAACNONE 
J100079N16CCAGCCCACCAACNONE 
Os01g0205900006-057-B04GTTGGTGGNONE 
AK060687GTTGGTGGNONE 
AK105932GTTGGTGGSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12GTTGGTGGNONE 
J075013J08GTTGGTGGNONE 
J075090B11GTTGGTGGNONE 
J075143C17GTTGGTGGNONE 
J075147O13GTTGGTGGNONE 
J075161L02GTTGGTGGNONE 
Os01g0231800009-133-C07CCACCAACNONE 
AK062918CCACCAACAppr>p cyclic nucleotide phosphodiesterase domain containing protein. 
Os01g0246400009-143-G05CCACCAACNONE 
AK062972CCACCAACSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0305900Os01g0305900CCACCAACSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0328400006-092-H09GTTGGTGGNONE 
009-085-A02GTTGGTGGNONE 
012-078-B03GTTGGTGGNONE 
AK061988GTTGGTGGUbiquitin. 
J013073B13GTTGGTGGNONE 
J023135L09GTTGGTGGNONE 
J023135O07GTTGGTGGNONE 
J033027B12GTTGGTGGNONE 
J033084P17GTTGGTGGNONE 
J065010M05GTTGGTGGNONE 
J065021N11GTTGGTGGNONE 
J065021N12GTTGGTGGNONE 
J065031K11GTTGGTGGNONE 
J065072P04GTTGGTGGNONE 
J065098D05GTTGGTGGNONE 
J065122N23GTTGGTGGNONE 
J065129L13GTTGGTGGNONE 
J065135N13GTTGGTGGNONE 
J065215N10GTTGGTGGNONE 
J075120N22GTTGGTGGNONE 
J090011G23GTTGGTGGNONE 
J090014F06GTTGGTGGNONE 
J090040G23GTTGGTGGNONE 
J090075I20GTTGGTGGNONE 
J090075N01GTTGGTGGNONE 
J090089B04GTTGGTGGNONE 
J090090F08GTTGGTGGNONE 
J090091M17GTTGGTGGNONE 
J090094L03GTTGGTGGNONE 
J090099L06GTTGGTGGNONE 
J100018A18GTTGGTGGNONE 
J100027H13GTTGGTGGNONE 
J100069C05GTTGGTGGNONE 
J100086L10GTTGGTGGNONE 
Os01g0329900009-063-H04CCACCAACNONE 
AK105168CCACCAACNONE 
AK120056CCACCAACSimilar to Lipase homolog (Fragment). 
J013000O15CCACCAACNONE 
J065026F09CCACCAACNONE 
Os01g0558600006-120-G12CCACCAACNONE 
J013100N20CCACCAACNONE 
J033043P09CCACCAACNONE 
J033125M18CCACCAACNONE 
J053043N11CCACCAACNONE 
J065008E07CCACCAACNONE 
J065080O16CCACCAACNONE 
J075002G24CCACCAACNONE 
J075123C09CCACCAACNONE 
S66160CCACCAACRas-related protein RIC1. 
Os01g0604700012-002-G04GTTGGTGGNONE 
AK063423GTTGGTGGNONE 
AK071681GTTGGTGGConserved hypothetical protein. 
Os01g0618200AK102319CCACCAACProtein phosphatase 2C family protein. 
Os01g0654500013-057-E05GCCCACCAACNONE 
AF155333GCCCACCAACNONE 
AK061752GCCCACCAACSimilar to NADP-isocitrate dehydrogenase. 
D21069GCCCACCAACNONE 
Os01g0665200012-014-E12CCACCAACNONE 
AK072082CCACCAACSimilar to Blast and wounding induced mitogen-activated protein kinase. 
J013000P12CCACCAACNONE 
J013074J01CCACCAACNONE 
J013147E15CCACCAACNONE 
J023003P12CCACCAACNONE 
J023126F21CCACCAACNONE 
J033028H14CCACCAACNONE 
J033034L22CCACCAACNONE 
Os01g0674150J065197O06GTTGGTGGNONE 
J065199N24GTTGGTGGNONE 
J090055L03GTTGGTGGConserved hypothetical protein. 
Os01g0708300AK060040CCACCAACNONE 
Os01g0709500016-042-H01CCACCAACNONE 
AK065353CCACCAACNONE 
AK105743CCACCAACNONE 
AK121129CCACCAACSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
J023075E10CCACCAACNONE 
J023106N12CCACCAACNONE 
J043016L01CCACCAACNONE 
J043026D20CCACCAACNONE 
J065086G18CCACCAACNONE 
J065137B07CCACCAACNONE 
J065202M22CCACCAACNONE 
J065207I15CCACCAACNONE 
J075038B04CCACCAACNONE 
J075044E14CCACCAACNONE 
J075120G21CCACCAACNONE 
J075149O14CCACCAACNONE 
J090003L12CCACCAACNONE 
J090006B04CCACCAACNONE 
J090009F02CCACCAACNONE 
J090014L16CCACCAACNONE 
J090017A05CCACCAACNONE 
J090018H23CCACCAACNONE 
J090039P04CCACCAACNONE 
J090058F13CCACCAACNONE 
J090077H07CCACCAACNONE 
J090084F06CCACCAACNONE 
J090091H18CCACCAACNONE 
J090097F01CCACCAACNONE 
Os01g0713200006-029-E05GTTGGTGGNONE 
006-033-F12GTTGGTGGNONE 
006-035-C06GTTGGTGGNONE 
006-035-G12GTTGGTGGNONE 
006-043-B10GTTGGTGGNONE 
006-051-D05GTTGGTGGNONE 
006-051-E10GTTGGTGGNONE 
006-054-E03GTTGGTGGNONE 
006-061-A11GTTGGTGGNONE 
006-062-A07GTTGGTGGNONE 
006-068-F08GTTGGTGGNONE 
006-073-B03GTTGGTGGNONE 
006-076-C11GTTGGTGGNONE 
006-083-D09GTTGGTGGNONE 
006-085-B02GTTGGTGGNONE 
006-086-H06GTTGGTGGNONE 
006-091-E02GTTGGTGGNONE 
006-097-A03GTTGGTGGNONE 
006-097-D10GTTGGTGGNONE 
006-104-A10GTTGGTGGNONE 
006-104-E10GTTGGTGGNONE 
006-106-C05GTTGGTGGNONE 
006-120-F10GTTGGTGGNONE 
009-048-C12GTTGGTGGNONE 
AB027429GTTGGTGGNONE 
AB027430GTTGGTGGNONE 
AF030167GTTGGTGGNONE 
AK060113GTTGGTGGNONE 
AK060862GTTGGTGGSimilar to Beta-glucanase. 
AK104472GTTGGTGGNONE 
J065057A22GTTGGTGGNONE 
J065102D04GTTGGTGGNONE 
J065104C05GTTGGTGGNONE 
J065199P19GTTGGTGGNONE 
J075072E03GTTGGTGGNONE 
J100017N05GTTGGTGGNONE 
J100021K10GTTGGTGGNONE 
J100024L11GTTGGTGGNONE 
J100040H13GTTGGTGGNONE 
J100070H04GTTGGTGGNONE 
J100071I09GTTGGTGGNONE 
J100074P15GTTGGTGGNONE 
J100086F19GTTGGTGGNONE 
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein. 
J023004P12GTTGGTGGCGTCGCGTCNONE 
J065006G23GTTGGTGGCGTCGCGTCNONE 
Os01g0744400AK067648CCACCAACConserved hypothetical protein. 
Os01g0748600AK104674GTTGGTGGNONE 
Os01g0756200AK108553CCACCAACSimilar to VirE2-interacting protein VIP1. 
Os01g0757400AB110177GCCGGCCCCACCAACNONE 
AB110177GCGGGCCCCACCAACNONE 
AK058626GCCGGCCCCACCAACNONE 
AK058626GCGGGCCCCACCAACNONE 
AK102585GCCGGCCCCACCAACNONE 
AK102585GCGGGCCCCACCAACNONE 
AK105474GCCGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCCGGCCCCACCAACNONE 
J033098E22GCGGGCCCCACCAACNONE 
J033105O19GCCGGCCCCACCAACNONE 
J033105O19GCGGGCCCCACCAACNONE 
J065019C21GCCGGCCCCACCAACNONE 
J065019C21GCGGGCCCCACCAACNONE 
J090082H11GCCGGCCCCACCAACNONE 
J090082H11GCGGGCCCCACCAACNONE 
J100050B19GCCGGCCCCACCAACNONE 
J100050B19GCGGGCCCCACCAACNONE 
J100078H19GCCGGCCCCACCAACNONE 
J100078H19GCGGGCCCCACCAACNONE 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0785900AK071014GTTGGTGGZinc finger, C2H2-type domain containing protein. 
AK104311GTTGGTGGNONE 
Os01g0793300J065140J12GTTGGTGGTyrosinase family protein. 
Os01g0806200011-003-A04CCACCAACNONE 
011-034-A08CCACCAACNONE 
AK105235CCACCAACCyclin-like F-box domain containing protein. 
J065053J03CCACCAACNONE 
Os01g0806400Os01g0806400CCACCAACProtein of unknown function DUF617, plant family protein. 
Os01g0810100AK071916GTTGGTGGRibonuclease III domain containing protein. 
AK099056GTTGGTGGNONE 
AK104320GTTGGTGGNONE 
Os01g0823200AK066097CCACCAACConserved hypothetical protein. 
J013056K15CCACCAACNONE 
Os01g0826400AK107199CCACCAACWRKY transcription factor 24 (WRKY24). 
AY341849CCACCAACNONE 
AY676925CCACCAACNONE 
AY870608CCACCAACNONE 
Os01g0831300AK109023CCACCAACSimilar to Ammonium transporter. 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0847300AK071164GCCCACCAACProtein of unknown function DUF588 family protein. 
AK104027GCCCACCAACNONE 
Os01g0852200AK063954CCACCAACNONE 
Os01g0880200AK105039GTTGGTGGNONE 
Os01g0916000015-035-A02GTTGGTGGNONE 
AK106300GTTGGTGGConserved hypothetical protein. 
J100028B12GTTGGTGGNONE 
J100035N14GTTGGTGGNONE 
J100042J01GTTGGTGGNONE 
J100045K22GTTGGTGGNONE 
J100054P19GTTGGTGGNONE 
J100063O03GTTGGTGGNONE 
J100066I09GTTGGTGGNONE 
J100066K05GTTGGTGGNONE 
J100072B04GTTGGTGGNONE 
J100073K11GTTGGTGGNONE 
J100078J18GTTGGTGGNONE 
J100079L10GTTGGTGGNONE 
J100080P17GTTGGTGGNONE 
J100081E17GTTGGTGGNONE 
J100085J05GTTGGTGGNONE 
J100087N20GTTGGTGGNONE 
Os01g0925100AK120911CCACCAACConserved hypothetical protein. 
J033022M17CCACCAACNONE 
J065050H13CCACCAACNONE 
J065137I09CCACCAACNONE 
Os01g0926300AK067632CCACCAACSimilar to Transaldolase (EC 2.2.1.2). 
AK072701CCACCAACNONE 
AK104087CCACCAACNONE 
AK105800CCACCAACNONE 
Os01g0952600AK067525GTTGGTGGGCTTANONE 
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment). 
Os01g0961200011-099-H06CTGGCCCACCAACNONE 
AK105424CTGGCCCACCAACCBS domain containing protein. 
J065169J18CTGGCCCACCAACNONE 
J075109H12CTGGCCCACCAACNONE 
Os01g0963300AK067544CCACCAACSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os02g0116600004-011-A08CCACCAACNONE 
009-035-C03CCACCAACNONE 
009-062-A03CCACCAACNONE 
AK060881CCACCAACNONE 
AK103434CCACCAACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK104188CCACCAACNONE 
J013058F02CCACCAACNONE 
J023042N21CCACCAACNONE 
J033129B02CCACCAACNONE 
J075030L17CCACCAACNONE 
J075048A07CCACCAACNONE 
J075084E21CCACCAACNONE 
J075138F20CCACCAACNONE 
J075147H12CCACCAACNONE 
J075149J07CCACCAACNONE 
J075168F01CCACCAACNONE 
J075196B10CCACCAACNONE 
Os02g0123100011-014-B01CCACCAACNONE 
012-013-G11CCACCAACNONE 
016-011-A12CCACCAACNONE 
AK063438CCACCAACNONE 
AK064363CCACCAACNONE 
AK101344CCACCAACSimilar to Cell division control protein 28 (EC 2.7.1.37). 
X60375CCACCAACNONE 
Os02g0141300AK067279CATCCACCACCAACGalactokinase family protein. 
AK074020CATCCACCACCAACNONE 
Os02g0176400009-099-H11CCACCAACNONE 
AK062746CCACCAACProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0186500AK068056CCACCAACSimilar to Protein kinase-like protein. 
AK099031CCACCAACNONE 
J013111A12CCACCAACNONE 
J013127K13CCACCAACNONE 
J013132O11CCACCAACNONE 
J023056A11CCACCAACNONE 
J023078M08CCACCAACNONE 
J033081F07CCACCAACNONE 
J090079E24CCACCAACNONE 
J090097I02CCACCAACNONE 
Os02g0192700004-020-H12CCACCAACNONE 
006-024-H06CCACCAACNONE 
006-042-F06CCACCAACNONE 
006-050-D04CCACCAACNONE 
006-059-E10CCACCAACNONE 
006-070-B02CCACCAACNONE 
006-084-A09CCACCAACNONE 
006-114-E11CCACCAACNONE 
006-117-E05CCACCAACNONE 
009-126-D11CCACCAACNONE 
AK061629CCACCAACSimilar to Thioredoxin peroxidase. 
AK065909CCACCAACNONE 
J013043E11CCACCAACNONE 
J065038I09CCACCAACNONE 
J065078C12CCACCAACNONE 
J065122O14CCACCAACNONE 
J065198H04CCACCAACNONE 
Os02g0202400AK107368GCCGTTGGTGGSimilar to Plastidial ADP-glucose transporter. 
J075147G14GCCGTTGGTGGNONE 
J090009K03GCCGTTGGTGGNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0308800004-016-D09CCACCAACNONE 
006-024-D08CCACCAACNONE 
006-048-E10CCACCAACNONE 
006-050-G03CCACCAACNONE 
006-059-E12CCACCAACNONE 
006-074-H06CCACCAACNONE 
006-084-B02CCACCAACNONE 
006-090-C05CCACCAACNONE 
006-107-H12CCACCAACNONE 
006-109-H08CCACCAACNONE 
009-085-G05CCACCAACNONE 
009-113-F09CCACCAACNONE 
009-144-E03CCACCAACNONE 
009-150-G05CCACCAACNONE 
AK060903CCACCAACNONE 
AK064819CCACCAACConserved hypothetical protein. 
AK104098CCACCAACNONE 
AK104533CCACCAACNONE 
J013000E21CCACCAACNONE 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0533900AB062681CCACCAACNONE 
AK061722CCACCAACNONE 
AK106147CCACCAACNONE 
AK121892CCACCAACSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0588700AK100801CCCACCACCAACConserved hypothetical protein. 
J100030D24CCCACCACCAACNONE 
J100031B19CCCACCACCAACNONE 
J100032M18CCCACCACCAACNONE 
J100035B04CCCACCACCAACNONE 
J100055G19CCCACCACCAACNONE 
Os02g0603800AK105762CCACCAACNONE 
AK120769CCACCAACSimilar to Isoprenoid biosynthesis-like protein (Fragment). 
Os02g0610700014-008-A03GTTGGTGGNONE 
AK059205GTTGGTGGConserved hypothetical protein. 
AK100281GTTGGTGGNONE 
J023074H03GTTGGTGGNONE 
J065002J16GTTGGTGGNONE 
J065032I20GTTGGTGGNONE 
J065076A07GTTGGTGGNONE 
J065142O21GTTGGTGGNONE 
J065203A03GTTGGTGGNONE 
J075017F24GTTGGTGGNONE 
J075017G24GTTGGTGGNONE 
Os02g0611500AK072083CCACCAACSimilar to Eukaryotic initiation factor-like protein. 
Os02g0625500011-025-C06GCCCACCAACCGCGGGGGNONE 
011-025-C06GTTGGTGGGCNONE 
AB050624GCCCACCAACCGCGGGGGNONE 
AB050624GTTGGTGGGCNONE 
AK059188GCCCACCAACCGCGGGGGNONE 
AK059188GTTGGTGGGCNONE 
AK059771GCCCACCAACCGCGGGGGNONE 
AK059771GTTGGTGGGCNONE 
AK101791GCCCACCAACCGCGGGGGSimilar to Adenosine kinase-like protein (Fragment). 
AK101791GTTGGTGGGCSimilar to Adenosine kinase-like protein (Fragment). 
AY224510GCCCACCAACCGCGGGGGNONE 
AY224510GTTGGTGGGCNONE 
J013152H02GCCCACCAACCGCGGGGGNONE 
J013152H02GTTGGTGGGCNONE 
J023012P09GCCCACCAACCGCGGGGGNONE 
J023012P09GTTGGTGGGCNONE 
J023127D16GCCCACCAACCGCGGGGGNONE 
J023127D16GTTGGTGGGCNONE 
J033024G01GCCCACCAACCGCGGGGGNONE 
J033024G01GTTGGTGGGCNONE 
J033025L19GCCCACCAACCGCGGGGGNONE 
J033025L19GTTGGTGGGCNONE 
J033080M04GCCCACCAACCGCGGGGGNONE 
J033080M04GTTGGTGGGCNONE 
J033101A08GCCCACCAACCGCGGGGGNONE 
J033101A08GTTGGTGGGCNONE 
J033121L12GCCCACCAACCGCGGGGGNONE 
J033121L12GTTGGTGGGCNONE 
J043017N15GCCCACCAACCGCGGGGGNONE 
J043017N15GTTGGTGGGCNONE 
J065207J01GCCCACCAACCGCGGGGGNONE 
J065207J01GTTGGTGGGCNONE 
J090049G12GCCCACCAACCGCGGGGGNONE 
J090049G12GTTGGTGGGCNONE 
J100036A07GCCCACCAACCGCGGGGGNONE 
J100036A07GTTGGTGGGCNONE 
J100076C04GCCCACCAACCGCGGGGGNONE 
J100076C04GTTGGTGGGCNONE 
J100080N22GCCCACCAACCGCGGGGGNONE 
J100080N22GTTGGTGGGCNONE 
Os02g0628600J100044L04CCACCAACTranscriptional factor B3 family protein. 
Os02g0663900AK068885GTTGGTGGSimilar to Phosphoribosyltransferase (Fragment). 
Os02g0686700AK111294CCACCAACProtein of unknown function DUF581 family protein. 
Os02g0703300006-087-E06CCACCAACNONE 
AK060227CCACCAACNONE 
AK071752CCACCAACNONE 
AK105992CCACCAACProtein of unknown function DUF1218 family protein. 
J023113K24CCACCAACNONE 
J065186E12CCACCAACNONE 
J100079N05CCACCAACNONE 
Os02g0703900AK102115AGCCCACCAACSimilar to Nodulin-like protein. 
AK121966AGCCCACCAACNONE 
J023109K03AGCCCACCAACNONE 
J033051G23AGCCCACCAACNONE 
J033084H22AGCCCACCAACNONE 
J090056B12AGCCCACCAACNONE 
J090059L13AGCCCACCAACNONE 
J090080M03AGCCCACCAACNONE 
Os02g0712500003-128-B04GTTGGTGGNONE 
AK100094GTTGGTGGProtein of unknown function DUF23 family protein. 
J023003P08GTTGGTGGNONE 
J033070I23GTTGGTGGNONE 
J065019B12GTTGGTGGNONE 
J065021D22GTTGGTGGNONE 
J065063H05GTTGGTGGNONE 
J065103B14GTTGGTGGNONE 
J065136I12GTTGGTGGNONE 
J065195F24GTTGGTGGNONE 
J090045N11GTTGGTGGNONE 
Os02g0725300AK120054CCACCAACNONE 
J013000L05CCACCAACNONE 
J065194M19CCACCAACNONE 
Os02g0734300006-027-C05CCACCAACNONE 
006-027-C11CCACCAACNONE 
006-039-E12CCACCAACNONE 
006-095-H04CCACCAACNONE 
009-112-G07CCACCAACNONE 
AK059780CCACCAACSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18). 
AK104571CCACCAACNONE 
J065079N09CCACCAACNONE 
J065188A17CCACCAACNONE 
J065209B17CCACCAACNONE 
Os02g0788400AK060351GTTGGTGGNONE 
AK103497GTTGGTGGSimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0803600AK064750CCACCAACLongin-like domain containing protein. 
Os02g0816800013-089-A09GGACGCGTCCACCAACNONE 
AK102271GGACGCGTCCACCAACNAD-dependent epimerase/dehydratase family protein. 
J013105O04GGACGCGTCCACCAACNONE 
J013124I08GGACGCGTCCACCAACNONE 
J023002E08GGACGCGTCCACCAACNONE 
J023025C01GGACGCGTCCACCAACNONE 
J023037O12GGACGCGTCCACCAACNONE 
J023049N06GGACGCGTCCACCAACNONE 
J023069G18GGACGCGTCCACCAACNONE 
J033029M02GGACGCGTCCACCAACNONE 
J033037L22GGACGCGTCCACCAACNONE 
J033089A08GGACGCGTCCACCAACNONE 
J033103L07GGACGCGTCCACCAACNONE 
J033125L19GGACGCGTCCACCAACNONE 
J090008N20GGACGCGTCCACCAACNONE 
J090041F23GGACGCGTCCACCAACNONE 
J090092H16GGACGCGTCCACCAACNONE 
Os02g0831800009-150-D09GTTGGTGGGCCATNONE 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03GTTGGTGGGCCATNONE 
J100077H12GTTGGTGGGCCATNONE 
Os03g0101600006-047-B09GTTGGTGGNONE 
006-082-H11GTTGGTGGNONE 
AK061143GTTGGTGGNONE 
AK069374GTTGGTGGSimilar to Quinone oxidoreductase. 
J023012O14GTTGGTGGNONE 
Os03g0120200AK102865CCACCAACNONE 
Os03g0126000AK121680GTTGGTGGSimilar to Phosphorybosyl anthranilate transferase 1. 
AY224452GTTGGTGGNONE 
Os03g0126800J075039C05CCACCAACNONE 
J075172P07CCACCAACNONE 
J075176L13CCACCAACNONE 
J075180L10CCACCAACNONE 
J090019H18CCACCAACNONE 
J090024P22CCACCAACNONE 
Os03g0137600006-057-G05CCACCAACNONE 
006-089-H04CCACCAACNONE 
006-105-G08CCACCAACNONE 
006-107-A12CCACCAACNONE 
AK058690CCACCAACNONE 
AK061189CCACCAACConserved hypothetical protein. 
AK099311CCACCAACNONE 
AK104115CCACCAACNONE 
J023149H01CCACCAACNONE 
J100054J06CCACCAACNONE 
Os03g0157900J043036K05GCCCACCAACNONE 
J043036K05GCCCCACCCACCAACNONE 
Os03g0169100006-030-B01CCACCAACNONE 
006-098-E09CCACCAACNONE 
AF047444CCACCAACNONE 
AK061772CCACCAACNONE 
AK066306CCACCAACRibulose-phosphate 3-epimerase, chloroplast precursor (EC 5.1.3.1) (Pentose-5-phosphate 3-epimerase) (PPE) (RPE) (R5P3E). 
AK099215CCACCAACNONE 
J013025E07CCACCAACNONE 
J013040K21CCACCAACNONE 
J013045P06CCACCAACNONE 
J013058K11CCACCAACNONE 
J013063E18CCACCAACNONE 
J013072B22CCACCAACNONE 
J013096J08CCACCAACNONE 
J075189H20CCACCAACNONE 
J080039H06CCACCAACNONE 
J080040H17CCACCAACNONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0191100AK066434CCACCAACNONE 
AK070661CCACCAACMitochondrial substrate carrier family protein. 
AK103991CCACCAACNONE 
Os03g0192500AK068957CCACCAACGGTCProtein phosphatase 2C-like domain containing protein. 
AY603974CCACCAACGGTCNONE 
Os03g0214400AK067931CCACCAACSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0219400AK100702CCACCAACGlycoside hydrolase, family 20 protein. 
AK121985CCACCAACNONE 
J023114O06CCACCAACNONE 
J100043M20CCACCAACNONE 
Os03g0220100006-023-B05GTTGGTGGNONE 
006-034-F08GTTGGTGGNONE 
006-093-A02GTTGGTGGNONE 
006-093-A06GTTGGTGGNONE 
011-078-E04GTTGGTGGNONE 
012-092-C04GTTGGTGGNONE 
AK066587GTTGGTGGSimilar to Very-long-chain fatty acid condensing enzyme CUT1. 
AK104714GTTGGTGGNONE 
AK106150GTTGGTGGNONE 
J013067C12GTTGGTGGNONE 
J013074H08GTTGGTGGNONE 
J013124K13GTTGGTGGNONE 
J065007A03GTTGGTGGNONE 
J065037H21GTTGGTGGNONE 
J065081F03GTTGGTGGNONE 
J090074C06GTTGGTGGNONE 
Os03g0231600AK105963CCACCAACSimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3). 
AK120579CCACCAACNONE 
Os03g0238800AY224467GTGGGGCCTGGCCACCAACConserved hypothetical protein. 
J013042E23GTGGGGCCTGGCCACCAACNONE 
Os03g0257900009-150-G06CCTCGCCCACCAACNONE 
009-181-H05CCTCGCCCACCAACNONE 
AK063892CCTCGCCCACCAACNONE 
AK100114CCTCGCCCACCAACSimilar to Lectin-like receptor kinase 7;2. 
AK103486CCTCGCCCACCAACNONE 
J023006K11CCTCGCCCACCAACNONE 
J075005E15CCTCGCCCACCAACNONE 
J075007K24CCTCGCCCACCAACNONE 
J075034G06CCTCGCCCACCAACNONE 
J075051I19CCTCGCCCACCAACNONE 
J075076A08CCTCGCCCACCAACNONE 
J075096H04CCTCGCCCACCAACNONE 
J075115I09CCTCGCCCACCAACNONE 
J075132K23CCTCGCCCACCAACNONE 
J075147C17CCTCGCCCACCAACNONE 
J090059O20CCTCGCCCACCAACNONE 
Os03g0265900009-004-C01CCACCAACNONE 
009-045-B03CCACCAACNONE 
AK099963CCACCAACNONE 
AK120374CCACCAACConserved hypothetical protein. 
J013036A19CCACCAACNONE 
J013070J20CCACCAACNONE 
J013071C06CCACCAACNONE 
J013088C01CCACCAACNONE 
J013112H21CCACCAACNONE 
J065114K10CCACCAACNONE 
J100028M20CCACCAACNONE 
Os03g0266000AK068775GTTGGTGGOvarian tumour, otubain domain containing protein. 
AK104949GTTGGTGGNONE 
J075149K24GTTGGTGGNONE 
J075184C19GTTGGTGGNONE 
Os03g0276600AK066437GTTGGTGGHypothetical protein. 
Os03g0298600009-095-C02TCCACGCCACCAACNONE 
AK066846TCCACGCCACCAACTetratricopeptide-like helical domain containing protein. 
Os03g0302700006-099-F12CATCCACCAACNONE 
AK112010CATCCACCAACZinc finger, RING-type domain containing protein. 
AK121656CATCCACCAACNONE 
J075090A19CATCCACCAACNONE 
J075148M06CATCCACCAACNONE 
Os03g0302900011-005-H01CCACCAACNONE 
AK069222CCACCAACConserved hypothetical protein. 
J023014L15CCACCAACNONE 
J033023G12CCACCAACNONE 
J090008H16CCACCAACNONE 
Os03g0310800009-126-C10AGCCCACCAACNONE 
009-156-D02AGCCCACCAACNONE 
AK058663AGCCCACCAACNONE 
AK099476AGCCCACCAACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15AGCCCACCAACNONE 
J075046C12AGCCCACCAACNONE 
J075058D24AGCCCACCAACNONE 
J075151M03AGCCCACCAACNONE 
J075151M04AGCCCACCAACNONE 
J075153I20AGCCCACCAACNONE 
J075167J05AGCCCACCAACNONE 
J075179G06AGCCCACCAACNONE 
J100025I19AGCCCACCAACNONE 
J100025L21AGCCCACCAACNONE 
J100029C06AGCCCACCAACNONE 
J100068E24AGCCCACCAACNONE 
J100070F10AGCCCACCAACNONE 
J100083H23AGCCCACCAACNONE 
J100089H10AGCCCACCAACNONE 
Os03g0376600004-014-C07GTTGGTGGNONE 
AK068720GTTGGTGGSimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK109412GTTGGTGGNONE 
Os03g0567600AK065135CCACCAACNONE 
AK098896CCACCAACNONE 
AK100305CCACCAACProtein of unknown function DUF563 family protein. 
Os03g0586600016-027-D02GTTGGTGGNONE 
AK070943GTTGGTGGSimilar to DNA-DIRECTED RNA POLYMERASES I, II, AND III 15 KD POLYPEPTIDE(RPABC6). 
J023067P18GTTGGTGGNONE 
J065083J09GTTGGTGGNONE 
Os03g0592500003-125-D02GTTGGTGGNONE 
006-021-F01GTTGGTGGNONE 
006-025-C12GTTGGTGGNONE 
006-027-A06GTTGGTGGNONE 
006-031-D08GTTGGTGGNONE 
006-031-H05GTTGGTGGNONE 
006-034-A10GTTGGTGGNONE 
006-034-H11GTTGGTGGNONE 
006-035-D10GTTGGTGGNONE 
006-037-H08GTTGGTGGNONE 
006-044-B09GTTGGTGGNONE 
006-044-F02GTTGGTGGNONE 
006-045-B11GTTGGTGGNONE 
006-045-E09GTTGGTGGNONE 
006-046-H12GTTGGTGGNONE 
006-047-D04GTTGGTGGNONE 
006-047-F02GTTGGTGGNONE 
006-050-C12GTTGGTGGNONE 
006-052-B07GTTGGTGGNONE 
006-053-A09GTTGGTGGNONE 
006-057-H02GTTGGTGGNONE 
006-061-G12GTTGGTGGNONE 
006-064-A04GTTGGTGGNONE 
006-067-G10GTTGGTGGNONE 
006-069-F06GTTGGTGGNONE 
006-070-D02GTTGGTGGNONE 
006-076-D11GTTGGTGGNONE 
006-078-B12GTTGGTGGNONE 
006-080-A10GTTGGTGGNONE 
006-082-B04GTTGGTGGNONE 
006-082-C05GTTGGTGGNONE 
006-082-C08GTTGGTGGNONE 
006-085-G08GTTGGTGGNONE 
006-086-E03GTTGGTGGNONE 
006-087-E03GTTGGTGGNONE 
006-088-A07GTTGGTGGNONE 
006-088-H06GTTGGTGGNONE 
006-089-G09GTTGGTGGNONE 
006-092-C03GTTGGTGGNONE 
006-092-C06GTTGGTGGNONE 
006-093-D09GTTGGTGGNONE 
006-097-B08GTTGGTGGNONE 
006-098-B09GTTGGTGGNONE 
006-102-D11GTTGGTGGNONE 
006-103-G02GTTGGTGGNONE 
006-104-A12GTTGGTGGNONE 
006-106-D10GTTGGTGGNONE 
006-108-A08GTTGGTGGNONE 
006-108-A12GTTGGTGGNONE 
006-108-B08GTTGGTGGNONE 
006-110-D07GTTGGTGGNONE 
006-110-D09GTTGGTGGNONE 
006-111-B04GTTGGTGGNONE 
006-111-G11GTTGGTGGNONE 
006-117-A08GTTGGTGGNONE 
006-119-A08GTTGGTGGNONE 
009-005-H11GTTGGTGGNONE 
009-013-A12GTTGGTGGNONE 
009-023-H09GTTGGTGGNONE 
009-056-D04GTTGGTGGNONE 
009-073-F11GTTGGTGGNONE 
009-127-B01GTTGGTGGNONE 
009-175-E01GTTGGTGGNONE 
AF022739GTTGGTGGNONE 
AF061577GTTGGTGGNONE 
AK058315GTTGGTGGNONE 
AK066762GTTGGTGGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment). 
D00642GTTGGTGGNONE 
J013075I09GTTGGTGGNONE 
J023115C07GTTGGTGGNONE 
J065024G17GTTGGTGGNONE 
J065051K08GTTGGTGGNONE 
J065137D16GTTGGTGGNONE 
J075057E17GTTGGTGGNONE 
J075096E24GTTGGTGGNONE 
J075105K04GTTGGTGGNONE 
J075125F06GTTGGTGGNONE 
J075132E10GTTGGTGGNONE 
J075149I20GTTGGTGGNONE 
J075151M21GTTGGTGGNONE 
J075160K21GTTGGTGGNONE 
J075187C08GTTGGTGGNONE 
J075187E15GTTGGTGGNONE 
J075194K02GTTGGTGGNONE 
J075194L07GTTGGTGGNONE 
J090008E24GTTGGTGGNONE 
Os03g0644400AB022783CCACCAACNONE 
AK067118CCACCAACAmino acid permease. 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0651700006-061-B11CCACCAACNONE 
AK059828CCACCAACConserved hypothetical protein. 
Os03g0669100014-007-F05GTTGGTGGNONE 
014-090-H05GTTGGTGGNONE 
AK063633GTTGGTGGSimilar to Deoxyuridine 5'-triphosphate nucleotidohydrolase (EC 3.6.1.23) (dUTPase) (dUTP pyrophosphatase) (P18). 
AK063742GTTGGTGGNONE 
J065030M17GTTGGTGGNONE 
J065132J05GTTGGTGGNONE 
J065176B11GTTGGTGGNONE 
J065201F08GTTGGTGGNONE 
Os03g0698900013-074-A08CGGGCCCCACCAACNONE 
AK073303CGGGCCCCACCAACAlkaline phytoceramidase family protein. 
AK103953CGGGCCCCACCAACNONE 
J033024P22CGGGCCCCACCAACNONE 
J065194N16CGGGCCCCACCAACNONE 
J065195O11CGGGCCCCACCAACNONE 
J075020F03CGGGCCCCACCAACNONE 
J075032P18CGGGCCCCACCAACNONE 
J075037H13CGGGCCCCACCAACNONE 
J075147I01CGGGCCCCACCAACNONE 
J075187B13CGGGCCCCACCAACNONE 
J100043G08CGGGCCCCACCAACNONE 
J100060L06CGGGCCCCACCAACNONE 
J100063O21CGGGCCCCACCAACNONE 
J100066O13CGGGCCCCACCAACNONE 
J100072K20CGGGCCCCACCAACNONE 
J100083G21CGGGCCCCACCAACNONE 
J100085D07CGGGCCCCACCAACNONE 
Os03g0721300AK072156CCACCAACProtein of unknown function DUF946, plant family protein. 
J013124E01CCACCAACNONE 
J013135K11CCACCAACNONE 
J090017L23CCACCAACNONE 
J090073M16CCACCAACNONE 
J090084G23CCACCAACNONE 
J100048L17CCACCAACNONE 
J100088L11CCACCAACNONE 
Os03g0726100003-107-C06GTTGGTGGNONE 
006-056-D03GTTGGTGGNONE 
006-058-D12GTTGGTGGNONE 
006-081-B08GTTGGTGGNONE 
AK119520GTTGGTGGNONE 
J090012J06GTTGGTGGNONE 
Os03g0736300AK070408CCACCAACSimilar to CEL6=CELLULASE 6 (Fragment). 
AK104929CCACCAACNONE 
Os03g0757900011-060-H04GTTGGTGGNONE 
011-082-B10GTTGGTGGNONE 
012-053-F12GTTGGTGGNONE 
013-029-C07GTTGGTGGNONE 
AK098880GTTGGTGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
J023009B02GTTGGTGGNONE 
J023085H11GTTGGTGGNONE 
J023135M18GTTGGTGGNONE 
J023147P04GTTGGTGGNONE 
J033072J22GTTGGTGGNONE 
J033128J06GTTGGTGGNONE 
Os03g0773600AK103310GTTGGTGGKinesin, motor region domain containing protein. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0788600AK069046GCCCCCACCAACBeta-Ig-H3/fasciclin domain containing protein. 
AK106114GCCCCCACCAACNONE 
J023009K09GCCCCCACCAACNONE 
J033022M06GCCCCCACCAACNONE 
J033033H18GCCCCCACCAACNONE 
J033098E16GCCCCCACCAACNONE 
J065138K19GCCCCCACCAACNONE 
J065163G19GCCCCCACCAACNONE 
J090029F21GCCCCCACCAACNONE 
J100031D24GCCCCCACCAACNONE 
J100047O10GCCCCCACCAACNONE 
J100052E07GCCCCCACCAACNONE 
J100055F20GCCCCCACCAACNONE 
J100055O09GCCCCCACCAACNONE 
J100065I23GCCCCCACCAACNONE 
Os03g0802400AK110996GTTGGTGGSimilar to Avr9/Cf-9 rapidly elicited protein 102 (Fragment). 
Os03g0823800AK058223GTTGGTGGGGCNONE 
Os03g0835600AK101677CCACCAACAcyl-coA-binding protein, ACBP family protein. 
Os03g0842700AK065755GACACGTGTTGGTGGNONE 
AK067436GACACGTGTTGGTGGNONE 
AK070821GACACGTGTTGGTGGVacuolar sorting protein 9 domain containing protein. 
J013036A18GACACGTGTTGGTGGNONE 
J013059F17GACACGTGTTGGTGGNONE 
J023043H05GACACGTGTTGGTGGNONE 
J023063L20GACACGTGTTGGTGGNONE 
J043020E01GACACGTGTTGGTGGNONE 
J065007C01GACACGTGTTGGTGGNONE 
J065023K08GACACGTGTTGGTGGNONE 
J065046H23GACACGTGTTGGTGGNONE 
J065080F24GACACGTGTTGGTGGNONE 
J065091L10GACACGTGTTGGTGGNONE 
J065102K05GACACGTGTTGGTGGNONE 
J065106E22GACACGTGTTGGTGGNONE 
J065128C20GACACGTGTTGGTGGNONE 
J065189O17GACACGTGTTGGTGGNONE 
J065219D10GACACGTGTTGGTGGNONE 
J075064C10GACACGTGTTGGTGGNONE 
J075098I17GACACGTGTTGGTGGNONE 
J075101I04GACACGTGTTGGTGGNONE 
J075153O11GACACGTGTTGGTGGNONE 
J075197E10GACACGTGTTGGTGGNONE 
J090011C21GACACGTGTTGGTGGNONE 
Os03g0851100AF303468GTTGGTGGNONE 
AK102069GTTGGTGGSimilar to Translational elongation factor EF-TuM. 
J033082G06GTTGGTGGNONE 
J043036M21GTTGGTGGNONE 
J065158H05GTTGGTGGNONE 
J065192A04GTTGGTGGNONE 
Os03g0855600006-029-G09GTTGGTGGNONE 
006-033-E02GTTGGTGGNONE 
006-069-G07GTTGGTGGNONE 
006-083-A02GTTGGTGGNONE 
006-098-H04GTTGGTGGNONE 
009-054-C04GTTGGTGGNONE 
AK060030GTTGGTGGNONE 
AK061467GTTGGTGGConserved hypothetical protein. 
AK067858GTTGGTGGNONE 
AK106030GTTGGTGGNONE 
J013123A10GTTGGTGGNONE 
J065001I24GTTGGTGGNONE 
J065015N21GTTGGTGGNONE 
J065016H07GTTGGTGGNONE 
J065040A05GTTGGTGGNONE 
J065040F01GTTGGTGGNONE 
J065066G17GTTGGTGGNONE 
J065077I09GTTGGTGGNONE 
J065099M22GTTGGTGGNONE 
J065135B13GTTGGTGGNONE 
J065144H19GTTGGTGGNONE 
J065146I03GTTGGTGGNONE 
J065169E02GTTGGTGGNONE 
J065177D21GTTGGTGGNONE 
J065189L20GTTGGTGGNONE 
J065207H13GTTGGTGGNONE 
J065210D24GTTGGTGGNONE 
J065212I03GTTGGTGGNONE 
J075007E21GTTGGTGGNONE 
J075013H07GTTGGTGGNONE 
J075023K06GTTGGTGGNONE 
J075031D23GTTGGTGGNONE 
J075038K09GTTGGTGGNONE 
J075084C08GTTGGTGGNONE 
J075098K20GTTGGTGGNONE 
J090028E04GTTGGTGGNONE 
J090031E20GTTGGTGGNONE 
J090042F06GTTGGTGGNONE 
J090049L05GTTGGTGGNONE 
J090086G03GTTGGTGGNONE 
J090096J04GTTGGTGGNONE 
J100035O03GTTGGTGGNONE 
J100053H24GTTGGTGGNONE 
J100056L17GTTGGTGGNONE 
J100058K06GTTGGTGGNONE 
J100059G09GTTGGTGGNONE 
J100081C15GTTGGTGGNONE 
Os03g0858400AK102968GTTGGTGGGGCCGGGWD40-like domain containing protein. 
Os04g0343900AK107841CCACCAACConserved hypothetical protein. 
Os04g0406600AK103609CCACCAACPrephenate dehydratase domain containing protein. 
J033133I10CCACCAACNONE 
J075092D11CCACCAACNONE 
J100031M09CCACCAACNONE 
Os04g0412700AK108347CCACCAACCarbonic anhydrase, eukaryotic family protein. 
J090084I06CCACCAACNONE 
Os04g0445200009-034-A06GTTGGTGGGGGCNONE 
AK062427GTTGGTGGGGGCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720GTTGGTGGGGGCNONE 
J065022E20GTTGGTGGGGGCNONE 
J065062D16GTTGGTGGGGGCNONE 
J065081I02GTTGGTGGGGGCNONE 
J065087C10GTTGGTGGGGGCNONE 
J065116N16GTTGGTGGGGGCNONE 
J065132F10GTTGGTGGGGGCNONE 
J065140F18GTTGGTGGGGGCNONE 
J065143M22GTTGGTGGGGGCNONE 
J065158K17GTTGGTGGGGGCNONE 
J065162D07GTTGGTGGGGGCNONE 
J065207H19GTTGGTGGGGGCNONE 
J075155B20GTTGGTGGGGGCNONE 
J075167E24GTTGGTGGGGGCNONE 
J075178B19GTTGGTGGGGGCNONE 
J080301D22GTTGGTGGGGGCNONE 
J080301J15GTTGGTGGGGGCNONE 
J080308J02GTTGGTGGGGGCNONE 
Os04g0457700J075145N15CCACCAACConserved hypothetical protein. 
Os04g0462600AK111125CCACCAACDynein light chain, type 1 family protein. 
Os04g0500700AK072528CCACCAACSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCACCAACNONE 
AK119237CCACCAACNONE 
Os04g0503500AK099404CCACCAACLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CCACCAACNONE 
Os04g0518200003-130-F03CCACCAACNONE 
AK100346CCACCAACPhenylalanine ammonia-lyase. 
AY224546CCACCAACNONE 
J023082J11CCACCAACNONE 
J090059F08CCACCAACNONE 
J090081G04CCACCAACNONE 
Os04g0548000011-097-D07CCACCAACNONE 
AK073099CCACCAACNONE 
AK104979CCACCAACProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18CCACCAACNONE 
J075076A16CCACCAACNONE 
J075082L09CCACCAACNONE 
J075092L18CCACCAACNONE 
J075092N01CCACCAACNONE 
J075122P14CCACCAACNONE 
J075148L06CCACCAACNONE 
Os04g0548300009-038-B02GTTGGTGGNONE 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0569900AK059100GTTGGTGGNONE 
Os04g0570600AK106747CCACCAACCytochrome P450 family protein. 
J080319G08CCACCAACNONE 
Os04g0570700AK063032GTTGGTGGHypothetical protein. 
Os04g0613200AK109490CCCACCACCAACVirulence factor, pectin lyase fold family protein. 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0670400012-048-A10GTTGGTGGNONE 
AK103099GTTGGTGGOvarian tumour, otubain domain containing protein. 
J033118N06GTTGGTGGNONE 
J100019K03GTTGGTGGNONE 
Os04g0682000AK069012CCACCAACSimilar to Autophagy 4a. 
Os04g0691900AK068257GCAGCCCAGCCACCAACChaperonin Cpn60/TCP-1 family protein. 
Os05g0100700006-039-H12CCACCAACNONE 
AK061517CCACCAACNONE 
Os05g0115200AK106709GTTGGTGGGCCConserved hypothetical protein. 
Os05g0124800J065050I11GTTGGTGGHypothetical protein. 
Os05g0132800AK108629GTTGGTGGGCTGAConserved hypothetical protein. 
Os05g0143300AK072841CCACCAACCCCACCACNONE 
AK099030CCACCAACCCCACCACConserved hypothetical protein. 
Os05g0153400AK108071TCAGCCCACCAACProtein prenyltransferase domain containing protein. 
Os05g0162600012-069-E09CCACCAACNONE 
AK063518CCACCAACSimilar to Splicing factor RSZ33. 
AK121854CCACCAACNONE 
J065178M11CCACCAACNONE 
J090016J24CCACCAACNONE 
J090023E07CCACCAACNONE 
Os05g0176100AF030052CCACCAACNONE 
AK067850CCACCAACNONE 
AK067967CCACCAACNONE 
AK098978CCACCAACNONE 
AK099228CCACCAACNONE 
AK099281CCACCAACNONE 
AK100188CCACCAACSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCACCAACNONE 
Os05g0209600014-029-G01CCACCAACNONE 
AK059511CCACCAACLipolytic enzyme, G-D-S-L family protein. 
AK100289CCACCAACNONE 
AY580163CCACCAACNONE 
J065164H12CCACCAACNONE 
J065178F10CCACCAACNONE 
Os05g0223300AK069616CCCACCACCAACSimilar to RNA-binding protein. 
J080093O15CCCACCACCAACNONE 
J090061N02CCCACCACCAACNONE 
Os05g0297300AK067752CCACCAACGGCTProtein of unknown function DUF1618 domain containing protein. 
J013114A11CCACCAACGGCTNONE 
Os05g0306000AK071384GCCCACCAACemp24/gp25L/p24 family protein. 
Os05g0358000006-083-G07CCACCAACNONE 
006-083-G07CTCGGCCCCACCAACNONE 
AK061141CCACCAACNONE 
AK061141CTCGGCCCCACCAACNONE 
AK070900CCACCAACNONE 
AK070900CTCGGCCCCACCAACNONE 
AK101263CCACCAACDrought induced 19 family protein. 
AK101263CTCGGCCCCACCAACDrought induced 19 family protein. 
J023098C13CCACCAACNONE 
J023098C13CTCGGCCCCACCAACNONE 
J033032J06CCACCAACNONE 
J033032J06CTCGGCCCCACCAACNONE 
J065014A09CCACCAACNONE 
J065014A09CTCGGCCCCACCAACNONE 
J065121L01CCACCAACNONE 
J065121L01CTCGGCCCCACCAACNONE 
J065130K19CCACCAACNONE 
J065130K19CTCGGCCCCACCAACNONE 
J065208B21CCACCAACNONE 
J065208B21CTCGGCCCCACCAACNONE 
J075080G14CCACCAACNONE 
J075080G14CTCGGCCCCACCAACNONE 
J075135L01CCACCAACNONE 
J075135L01CTCGGCCCCACCAACNONE 
J075180J15CCACCAACNONE 
J075180J15CTCGGCCCCACCAACNONE 
Os05g0408200AK100057CCACGGCCACCAACSBP domain containing protein. 
J065182F20CCACGGCCACCAACNONE 
Os05g0411300014-098-D05CCACCAACGGCNONE 
015-093-F04CCACCAACGGCNONE 
AK071931CCACCAACGGCConserved hypothetical protein. 
AK073142CCACCAACGGCNONE 
Os05g0419800013-088-G02CCACCAACNONE 
AK100958CCACCAACLipolytic enzyme, G-D-S-L family protein. 
Os05g0420200AK067880GCCCACCCACCAACProtein of unknown function DUF179 family protein. 
Os05g0438500006-102-F01CCCACCACCACCAACNONE 
AK059951CCCACCACCACCAACSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0455200AK063788CCACCAACNONE 
Os05g0460000011-074-F09GGGGCCCACCAACGCGTCCNONE 
J023002L01GGGGCCCACCAACGCGTCCNONE 
J023060I12GGGGCCCACCAACGCGTCCNONE 
J023060O12GGGGCCCACCAACGCGTCCNONE 
J023106P08GGGGCCCACCAACGCGTCCNONE 
J023141D17GGGGCCCACCAACGCGTCCNONE 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GGGGCCCACCAACGCGTCCNONE 
J033039H14GGGGCCCACCAACGCGTCCNONE 
J033101B11GGGGCCCACCAACGCGTCCNONE 
J033101B12GGGGCCCACCAACGCGTCCNONE 
J033114A09GGGGCCCACCAACGCGTCCNONE 
J090037G06GGGGCCCACCAACGCGTCCNONE 
J090048G13GGGGCCCACCAACGCGTCCNONE 
J090090F15GGGGCCCACCAACGCGTCCNONE 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK111946CTGGCCCACCAACNONE 
AK111972CTGGCCCACCAACNONE 
AK112021CTGGCCCACCAACNONE 
J033135H16CTGGCCCACCAACNONE 
J043036O11CTGGCCCACCAACNONE 
Os05g0486100AK119823GTTGGTGGProtein kinase-like domain containing protein. 
Os05g0514600AK107211GCCCACCAAC2OG-Fe(II) oxygenase domain containing protein. 
Os05g0520600AK067487CCACCAACConserved hypothetical protein. 
Os05g0521600013-027-G05CCACCAACNONE 
AK063238CCACCAACVirulence factor, pectin lyase fold family protein. 
Os05g0522600AK072881CCACCAACLeucine-rich repeat, plant specific containing protein. 
AK100082CCACCAACNONE 
Os05g0534100Os05g0534100CCACCAACAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
Os05g0563600009-152-H06CCACCAACNONE 
AK058836CCACCAACNONE 
AK099313CCACCAACBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0576600AK107732CCACCAACConserved hypothetical protein. 
Os06g0103200011-003-H09TGTTGGGCCACCAACNONE 
011-017-H05TGTTGGGCCACCAACNONE 
011-027-G08TGTTGGGCCACCAACNONE 
011-059-F08TGTTGGGCCACCAACNONE 
AK103757TGTTGGGCCACCAACTransferase family protein. 
J033143E17TGTTGGGCCACCAACNONE 
Os06g0115000AK108096CCACCAACConserved hypothetical protein. 
Os06g0115300009-165-C05CCACCAACGGCCCNONE 
AK058833CCACCAACGGCCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09CCACCAACGGCCCNONE 
J075002E09CCACCAACGGCCCNONE 
J075015K23CCACCAACGGCCCNONE 
J075043B06CCACCAACGGCCCNONE 
J075057O21CCACCAACGGCCCNONE 
J075085L21CCACCAACGGCCCNONE 
J075134N20CCACCAACGGCCCNONE 
J075155O22CCACCAACGGCCCNONE 
J075198N22CCACCAACGGCCCNONE 
Os06g0134800014-049-H04CCACCAACNONE 
AK063692CCACCAACGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0163500AK071415GTTGGTGGPeptidase S8 and S53, subtilisin, kexin, sedolisin domain containing protein. 
J043030E01GTTGGTGGNONE 
Os06g0194400AK102980CCACCAACTranscriptional factor B3 family protein. 
Os06g0225200005-009-B07ATGGCCCACCAACNONE 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK104692ATGGCCCACCAACNONE 
J013096A05ATGGCCCACCAACNONE 
J090092C03ATGGCCCACCAACNONE 
Os06g0247800AK102187CCACCAACTCGGCCCATCCSimilar to Dynamin-like protein (Fragment). 
AY224491CCACCAACTCGGCCCATCCNONE 
Os06g0498800AK107056CCACCAACSimilar to MOTHER of FT and TF1 protein. 
J075147L06CCACCAACNONE 
Os06g0506600009-119-E12GTTGGTGGNONE 
J023086A18GTTGGTGGNONE 
J033036I02GTTGGTGGNONE 
J033125C16GTTGGTGGNONE 
J065013I11GTTGGTGGNONE 
J065026O21GTTGGTGGNONE 
J065060H10GTTGGTGGNONE 
J065067A15GTTGGTGGNONE 
J065068F07GTTGGTGGNONE 
J065085N06GTTGGTGGNONE 
J065108N10GTTGGTGGNONE 
J065161O11GTTGGTGGNONE 
J065185J15GTTGGTGGNONE 
J065191H18GTTGGTGGNONE 
J065199J09GTTGGTGGNONE 
J075005G03GTTGGTGGNONE 
J075018C16GTTGGTGGNONE 
J075061K20GTTGGTGGNONE 
J075069J06GTTGGTGGNONE 
J075075H19GTTGGTGGNONE 
J075076D20GTTGGTGGNONE 
J075078D16GTTGGTGGNONE 
J075100J19GTTGGTGGNONE 
J075110M11GTTGGTGGNONE 
J075157N05GTTGGTGGNONE 
J075171F20GTTGGTGGNONE 
J075177G08GTTGGTGGNONE 
J075179G08GTTGGTGGNONE 
Os06g0625500006-034-A05CCACCAACNONE 
AK058459CCACCAACSimilar to Thioredoxin peroxidase. 
AK068955CCACCAACNONE 
AK104130CCACCAACNONE 
J023003C09CCACCAACNONE 
J033043I02CCACCAACNONE 
J065063E05CCACCAACNONE 
J065190D24CCACCAACNONE 
J065198I01CCACCAACNONE 
J075107A02CCACCAACNONE 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0684000AK102878CATCCACCAACSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os06g0707200006-022-G09CCACCAACNONE 
006-022-G09GTTGGTGGNONE 
AK059411CCACCAACNONE 
AK059411GTTGGTGGNONE 
AK071568CCACCAACProtein of unknown function DUF563 family protein. 
AK071568GTTGGTGGProtein of unknown function DUF563 family protein. 
J065101E21CCACCAACNONE 
J065101E21GTTGGTGGNONE 
Os06g0725000015-061-F03GCCCACCAACNONE 
016-069-A10GCCCACCAACNONE 
AK111790GCCCACCAACSimilar to Ntdin. 
J013089K14GCCCACCAACNONE 
J023095D11GCCCACCAACNONE 
J023114G14GCCCACCAACNONE 
J053091M03GCCCACCAACNONE 
J065006E20GCCCACCAACNONE 
J065042J07GCCCACCAACNONE 
J065054B17GCCCACCAACNONE 
J065057B20GCCCACCAACNONE 
J065078M02GCCCACCAACNONE 
J065176J12GCCCACCAACNONE 
J065177K13GCCCACCAACNONE 
J065184O14GCCCACCAACNONE 
J065190J16GCCCACCAACNONE 
J065205E08GCCCACCAACNONE 
Os07g0108300003-106-A05CCACCAACNONE 
AK060835CCACCAACNONE 
Os07g0122000AK102508CCACCAACProtein of unknown function DUF1719, Oryza sativa family protein. 
J033095G03CCACCAACNONE 
J065177D19CCACCAACNONE 
Os07g0159800009-100-A07CCACCAACNONE 
009-140-B04CCACCAACNONE 
AK059284CCACCAACNONE 
AK060475CCACCAACE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCACCAACNONE 
J023083L17CCACCAACNONE 
J043005N13CCACCAACNONE 
J065164K01CCACCAACNONE 
J065192C18CCACCAACNONE 
J090058G23CCACCAACNONE 
J100017G10CCACCAACNONE 
J100081F12CCACCAACNONE 
Os07g0167200003-103-H10CCACCAACNONE 
012-001-G01CCACCAACNONE 
AK120608CCACCAACSimilar to Zinc finger POZ domain protein (Fragment). 
J023093N23CCACCAACNONE 
J100059P15CCACCAACNONE 
Os07g0173200AK061624CCACCAACFrigida-like family protein. 
AK065275CCACCAACNONE 
AK098856CCACCAACNONE 
AK098899CCACCAACNONE 
Os07g0176900004-001-E11CCACCAACNONE 
009-094-F12CCACCAACNONE 
AK060861CCACCAACSimilar to Ribose-5-phosphate isomerase precursor (EC 5.3.1.6). 
AK067117CCACCAACNONE 
J013094G20CCACCAACNONE 
J065142M22CCACCAACNONE 
J075098K24CCACCAACNONE 
Os07g0190900012-063-F11CCACCAACNONE 
AK073533CCACCAACSMAD/FHA domain containing protein. 
J013110O09CCACCAACNONE 
J033041I12CCACCAACNONE 
J033046D05CCACCAACNONE 
J033101K24CCACCAACNONE 
J090009F10CCACCAACNONE 
J090095B17CCACCAACNONE 
Os07g0191000AK071379GTTGGTGGInositol monophosphatase family protein. 
AK103440GTTGGTGGNONE 
Os07g0211800AK065959CCACCAACProtein of unknown function DUF1749 family protein. 
J013045P18CCACCAACNONE 
J023054M01CCACCAACNONE 
J053075O04CCACCAACNONE 
J065041J23CCACCAACNONE 
J065066E24CCACCAACNONE 
J090007J10CCACCAACNONE 
J100025A22CCACCAACNONE 
J100042C19CCACCAACNONE 
Os07g0252400AK100914CCACCAACSimilar to Cellulose synthase-8. 
Os07g0479200005-017-H08GTTGGTGGNONE 
AK058326GTTGGTGGSimilar to SL15-like (Fragment). 
J013092A08GTTGGTGGNONE 
J033139E04GTTGGTGGNONE 
J043016M16GTTGGTGGNONE 
J053050O18GTTGGTGGNONE 
J053098B03GTTGGTGGNONE 
J065068G10GTTGGTGGNONE 
J065091I17GTTGGTGGNONE 
J065109A03GTTGGTGGNONE 
J065168B17GTTGGTGGNONE 
J065177A05GTTGGTGGNONE 
J065180J01GTTGGTGGNONE 
J075006F13GTTGGTGGNONE 
J075022J03GTTGGTGGNONE 
J075024N09GTTGGTGGNONE 
J075114B12GTTGGTGGNONE 
J080023M06GTTGGTGGNONE 
J080081N24GTTGGTGGNONE 
J090060N07GTTGGTGGNONE 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0510200011-058-A03CCACCAACNONE 
AK063956CCACCAACGlycoside hydrolase, family 17 protein. 
AK069383CCACCAACNONE 
AK101250CCACCAACNONE 
J023013E15CCACCAACNONE 
J065117L22CCACCAACNONE 
J075019H12CCACCAACNONE 
J075054E24CCACCAACNONE 
Os07g0564700AK059018GTTGGTGGHypothetical protein. 
Os07g0582800011-039-B08GTTGGTGGNONE 
AK069022GTTGGTGGConserved hypothetical protein. 
J023003P14GTTGGTGGNONE 
J065192L23GTTGGTGGNONE 
J090024H24GTTGGTGGNONE 
J090049C15GTTGGTGGNONE 
J090053P21GTTGGTGGNONE 
J090082K08GTTGGTGGNONE 
J100024J06GTTGGTGGNONE 
J100033A05GTTGGTGGNONE 
J100050G19GTTGGTGGNONE 
J100050M06GTTGGTGGNONE 
J100090D16GTTGGTGGNONE 
J100090H14GTTGGTGGNONE 
Os07g0588600AK108320CCACCAACZinc finger, C2H2-type domain containing protein. 
Os07g0602000AK071832CCACCAACGCGTGCGSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11CCACCAACGCGTGCGNONE 
J023138E01CCACCAACGCGTGCGNONE 
J023149O13CCACCAACGCGTGCGNONE 
J090074M19CCACCAACGCGTGCGNONE 
Os07g0622200AB122058CCCATCCACCAACNONE 
AK069968CCCATCCACCAACNONE 
AK105687CCCATCCACCAACSimilar to M-160-u1_1 (Fragment). 
J075095A10CCCATCCACCAACNONE 
Os07g0628500AK059560GTTGGTGGNONE 
AK070963GTTGGTGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337GTTGGTGGNONE 
J023068N18GTTGGTGGNONE 
J023088M08GTTGGTGGNONE 
J033072H21GTTGGTGGNONE 
Os07g0653100J065130E21GTTGGTGGConserved hypothetical protein. 
J065186P07GTTGGTGGNONE 
Os07g0668900AK067054CCACCAACSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
AK119572CCACCAACNONE 
Os07g0670300006-085-D04CCACCAACNONE 
006-116-A08CCACCAACNONE 
AK061154CCACCAACC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK099020CCACCAACNONE 
J100056C05CCACCAACNONE 
Os07g0674400AK119672GTTGGTGGConserved hypothetical protein. 
Os08g0102700003-114-A12CCACCAACNONE 
006-028-E04CCACCAACNONE 
006-035-A11CCACCAACNONE 
006-045-F06CCACCAACNONE 
006-054-C02CCACCAACNONE 
006-057-H03CCACCAACNONE 
006-061-H07CCACCAACNONE 
006-077-E01CCACCAACNONE 
006-078-A10CCACCAACNONE 
006-091-A08CCACCAACNONE 
006-113-B10CCACCAACNONE 
006-113-E08CCACCAACNONE 
006-120-G01CCACCAACNONE 
009-006-D09CCACCAACNONE 
009-034-G03CCACCAACNONE 
009-037-E10CCACCAACNONE 
009-174-E04CCACCAACNONE 
009-197-G12CCACCAACNONE 
013-021-D07CCACCAACNONE 
013-034-F03CCACCAACNONE 
AK061430CCACCAACNONE 
AK061546CCACCAACNONE 
AK061780CCACCAACNONE 
AK067526CCACCAACHarpin-induced 1 domain containing protein. 
AK072003CCACCAACNONE 
AK099239CCACCAACNONE 
AK104488CCACCAACNONE 
J013033J16CCACCAACNONE 
J013040J17CCACCAACNONE 
J013055I04CCACCAACNONE 
J013067M14CCACCAACNONE 
J013089I07CCACCAACNONE 
J013097I23CCACCAACNONE 
J013097J23CCACCAACNONE 
J013109O20CCACCAACNONE 
J013130I12CCACCAACNONE 
J013134P06CCACCAACNONE 
J013135B01CCACCAACNONE 
J013153P22CCACCAACNONE 
J013160B06CCACCAACNONE 
J023009C14CCACCAACNONE 
J023011J04CCACCAACNONE 
J023027B05CCACCAACNONE 
J023054H11CCACCAACNONE 
J023078F02CCACCAACNONE 
J023104P14CCACCAACNONE 
J023106D09CCACCAACNONE 
J023118O11CCACCAACNONE 
J023129I11CCACCAACNONE 
J033113N09CCACCAACNONE 
J065057F15CCACCAACNONE 
J065136P05CCACCAACNONE 
J065213B15CCACCAACNONE 
J075012G16CCACCAACNONE 
J075022J19CCACCAACNONE 
J075051J24CCACCAACNONE 
J075111L02CCACCAACNONE 
J075124A11CCACCAACNONE 
J075140D18CCACCAACNONE 
J075184E13CCACCAACNONE 
J075199O13CCACCAACNONE 
J090029I20CCACCAACNONE 
J100018N20CCACCAACNONE 
J100023N06CCACCAACNONE 
J100033L19CCACCAACNONE 
J100036I17CCACCAACNONE 
J100054E24CCACCAACNONE 
Os08g0125200AK070694CCACCAACConcanavalin A-like lectin/glucanase domain containing protein. 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0157500006-104-C12GTTGGTGGNONE 
AB122056GTTGGTGGNONE 
AK061859GTTGGTGGNONE 
AK064768GTTGGTGGSimilar to Caffeic acid 3-O-methyltransferase (EC 2.1.1.68) (S-adenosysl-L- methionine:caffeic acid 3-O-methyltransferase) (COMT) (CAOMT). 
J013000A05GTTGGTGGNONE 
J013020B06GTTGGTGGNONE 
J013026D02GTTGGTGGNONE 
J013038K10GTTGGTGGNONE 
J013067G24GTTGGTGGNONE 
J013070G04GTTGGTGGNONE 
J013089B03GTTGGTGGNONE 
J013096A12GTTGGTGGNONE 
J013099L07GTTGGTGGNONE 
J013110E24GTTGGTGGNONE 
J013119C21GTTGGTGGNONE 
J013126K12GTTGGTGGNONE 
J013127G09GTTGGTGGNONE 
J013132N18GTTGGTGGNONE 
J013146E16GTTGGTGGNONE 
J013159N22GTTGGTGGNONE 
J023013M14GTTGGTGGNONE 
J023019J05GTTGGTGGNONE 
J023039L07GTTGGTGGNONE 
J023042B12GTTGGTGGNONE 
J023045J23GTTGGTGGNONE 
J023049G18GTTGGTGGNONE 
J023072B09GTTGGTGGNONE 
J023073I03GTTGGTGGNONE 
J023073J16GTTGGTGGNONE 
J023078G10GTTGGTGGNONE 
J023082N04GTTGGTGGNONE 
J023088L04GTTGGTGGNONE 
J023093C18GTTGGTGGNONE 
J023102N15GTTGGTGGNONE 
J023108A06GTTGGTGGNONE 
J023118D01GTTGGTGGNONE 
J023120A03GTTGGTGGNONE 
J023143N09GTTGGTGGNONE 
J023145M11GTTGGTGGNONE 
J023146J11GTTGGTGGNONE 
J033040N23GTTGGTGGNONE 
J033082G24GTTGGTGGNONE 
J043003L23GTTGGTGGNONE 
J043024F21GTTGGTGGNONE 
J065047H14GTTGGTGGNONE 
J065059F15GTTGGTGGNONE 
J065213O16GTTGGTGGNONE 
J100027D12GTTGGTGGNONE 
J100028D15GTTGGTGGNONE 
J100030F05GTTGGTGGNONE 
J100033A22GTTGGTGGNONE 
J100037G14GTTGGTGGNONE 
J100038M15GTTGGTGGNONE 
J100040E23GTTGGTGGNONE 
J100047L05GTTGGTGGNONE 
J100067O03GTTGGTGGNONE 
J100084A07GTTGGTGGNONE 
Os08g0200100J065120A21CCACCAACFatty acid desaturase, type 2 family protein. 
J065138H01CCACCAACNONE 
Os08g0331800J100090O04CCACCAACConserved hypothetical protein. 
Os08g0333000AK108356GTTGGTGGSimilar to F7O18.23 protein (SWP1) (Struwwelpeter 1 protein). 
Os08g0387700011-052-C04GTTGGTGGNONE 
AK063348GTTGGTGGNONE 
AK069497GTTGGTGGDisease resistance protein family protein. 
J065209B03GTTGGTGGNONE 
Os08g0440100AK068551CCACCAACSimilar to Temperature stress-induced lipocalin. 
J013155M04CCACCAACNONE 
J033041C20CCACCAACNONE 
J043031L02CCACCAACNONE 
J043038J23CCACCAACNONE 
J065006F20CCACCAACNONE 
J065030H05CCACCAACNONE 
J065069H05CCACCAACNONE 
J065078M19CCACCAACNONE 
J065146E24CCACCAACNONE 
J065154J17CCACCAACNONE 
J065158L04CCACCAACNONE 
J065182J20CCACCAACNONE 
J065211P16CCACCAACNONE 
J075020M18CCACCAACNONE 
J075035J01CCACCAACNONE 
J075037K13CCACCAACNONE 
J075052E12CCACCAACNONE 
J075056I12CCACCAACNONE 
J075064H18CCACCAACNONE 
J075121E06CCACCAACNONE 
J075123H03CCACCAACNONE 
J075146P20CCACCAACNONE 
J075156O06CCACCAACNONE 
J075158A14CCACCAACNONE 
J075169L03CCACCAACNONE 
J090013K02CCACCAACNONE 
Os08g0485700AK068131CCACCAACNONE 
J013130L03CCACCAACNONE 
Os08g0498100006-021-A02CCACCAACNONE 
006-023-A11CCACCAACNONE 
006-030-F06CCACCAACNONE 
006-030-H09CCACCAACNONE 
006-036-F02CCACCAACNONE 
006-041-G03CCACCAACNONE 
006-048-C06CCACCAACNONE 
006-054-B09CCACCAACNONE 
006-055-H11CCACCAACNONE 
006-058-A05CCACCAACNONE 
006-067-H01CCACCAACNONE 
006-075-E10CCACCAACNONE 
006-075-G10CCACCAACNONE 
006-078-G01CCACCAACNONE 
006-087-F08CCACCAACNONE 
006-094-B02CCACCAACNONE 
006-094-D07CCACCAACNONE 
006-094-G04CCACCAACNONE 
006-095-B05CCACCAACNONE 
006-095-C10CCACCAACNONE 
006-099-C11CCACCAACNONE 
006-100-G11CCACCAACNONE 
006-103-A01CCACCAACNONE 
006-104-D10CCACCAACNONE 
006-107-F12CCACCAACNONE 
006-115-B10CCACCAACNONE 
006-117-C05CCACCAACNONE 
006-118-A01CCACCAACNONE 
006-120-E06CCACCAACNONE 
006-120-H08CCACCAACNONE 
009-107-F08CCACCAACNONE 
009-114-B07CCACCAACNONE 
009-153-C12CCACCAACNONE 
009-166-B03CCACCAACNONE 
AB110168CCACCAACNONE 
AK071482CCACCAACSimilar to Caffeoyl-CoA O-methyltransferase 2 (EC 2.1.1.104) (Trans-caffeoyl-CoA 3-O-methyltransferase 2) (CCoAMT-2) (CCoAOMT-2). 
AK104326CCACCAACNONE 
AK104801CCACCAACNONE 
J013097M21CCACCAACNONE 
J023084B07CCACCAACNONE 
J023093N24CCACCAACNONE 
J033089B10CCACCAACNONE 
J065047L15CCACCAACNONE 
J065106O12CCACCAACNONE 
J065190P10CCACCAACNONE 
J090026B04CCACCAACNONE 
J100065D22CCACCAACNONE 
J100072K13CCACCAACNONE 
J100083E01CCACCAACNONE 
J100090A05CCACCAACNONE 
Os08g0540900AK111094CCACCAACConserved hypothetical protein. 
Os08g0547500AK065731CCACCAACNONE 
AK102208CCACCAACSimilar to Kinesin-like protein NACK1. 
J013060E07CCACCAACNONE 
J013129D12CCACCAACNONE 
Os08g0549300009-008-F01TCAGCCCACCAACNONE 
009-033-G10TCAGCCCACCAACNONE 
AK120938TCAGCCCACCAACSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420TCAGCCCACCAACNONE 
J023037A21TCAGCCCACCAACNONE 
J023066D20TCAGCCCACCAACNONE 
J033099K13TCAGCCCACCAACNONE 
J065116C14TCAGCCCACCAACNONE 
J075009K15TCAGCCCACCAACNONE 
J075071P13TCAGCCCACCAACNONE 
J075080D18TCAGCCCACCAACNONE 
J075124F24TCAGCCCACCAACNONE 
J075198F23TCAGCCCACCAACNONE 
J080006B15TCAGCCCACCAACNONE 
J090078H13TCAGCCCACCAACNONE 
J090089J09TCAGCCCACCAACNONE 
J100017A03TCAGCCCACCAACNONE 
J100023G03TCAGCCCACCAACNONE 
Os08g0556200009-008-D12CCACCAACNONE 
AK121222CCACCAACSimilar to Dihydroneopterin aldolase. 
J023090H22CCACCAACNONE 
J075027J23CCACCAACNONE 
J075032L14CCACCAACNONE 
J075053H04CCACCAACNONE 
J075171P20CCACCAACNONE 
J100057F12CCACCAACNONE 
Os08g0566900AK100851CCACCAACMpv17/PMP22 family protein. 
J023075L09CCACCAACNONE 
J023123J02CCACCAACNONE 
J090048G12CCACCAACNONE 
J100049C15CCACCAACNONE 
Os09g0325700011-041-G03GTTGGTGGNONE 
AK063334GTTGGTGGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GTTGGTGGNONE 
Os09g0326800AK071400GTTGGTGGSimilar to PSMD2 subunit (Fragment). 
Os09g0338500AK058543CCACCAACSimilar to Desaturase/cytochrome b5 protein. 
Os09g0362800AK068512CCACCAACPeptidase M1, membrane alanine aminopeptidase family protein. 
Os09g0364100AK071233CCACCAACLateral organ boundaries, LOB domain containing protein. 
Os09g0446800AK061999GTCCCACCAACNONE 
J013049P03GTCCCACCAACNONE 
J013055J11GTCCCACCAACNONE 
J013070P19GTCCCACCAACNONE 
J013072C09GTCCCACCAACNONE 
J013108I17GTCCCACCAACNONE 
J013118L14GTCCCACCAACNONE 
J013123A14GTCCCACCAACNONE 
J013124L24GTCCCACCAACNONE 
J013128P10GTCCCACCAACNONE 
J013134H01GTCCCACCAACNONE 
J013152O16GTCCCACCAACNONE 
J013153N08GTCCCACCAACNONE 
J013157H14GTCCCACCAACNONE 
J013158P14GTCCCACCAACNONE 
J023066A03GTCCCACCAACNONE 
J023086N13GTCCCACCAACNONE 
J023103G22GTCCCACCAACNONE 
J023114B07GTCCCACCAACNONE 
J033071D05GTCCCACCAACNONE 
J033098F14GTCCCACCAACNONE 
J033099H02GTCCCACCAACNONE 
J043017M24GTCCCACCAACNONE 
J090011H01GTCCCACCAACNONE 
J090017C01GTCCCACCAACNONE 
J090029F09GTCCCACCAACNONE 
J090041K03GTCCCACCAACNONE 
Os09g0463300AK060628GTTGGTGGNONE 
AK068942GTTGGTGGProtein of unknown function DUF547 domain containing protein. 
J013170B09GTTGGTGGNONE 
J065104J17GTTGGTGGNONE 
J065214B14GTTGGTGGNONE 
J090031M17GTTGGTGGNONE 
J090066H22GTTGGTGGNONE 
Os09g0498600AK066995CCACCAACNONE 
Os09g0527900AK058794GTTGGTGGNONE 
Os09g0533900003-104-E05CCACCAACNONE 
012-076-C03CCACCAACNONE 
AK067774CCACCAACNONE 
AK100449CCACCAACSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07CCACCAACNONE 
J023026E11CCACCAACNONE 
J023028B20CCACCAACNONE 
J023050P11CCACCAACNONE 
J023052K08CCACCAACNONE 
J023075J03CCACCAACNONE 
J023078E15CCACCAACNONE 
J023090P12CCACCAACNONE 
J023120E01CCACCAACNONE 
J023142K01CCACCAACNONE 
J033027K23CCACCAACNONE 
J033058A09CCACCAACNONE 
J033058C12CCACCAACNONE 
J033125A04CCACCAACNONE 
J043040L01CCACCAACNONE 
J053061D06CCACCAACNONE 
J053096N13CCACCAACNONE 
J065193H10CCACCAACNONE 
J090075L17CCACCAACNONE 
J100050D10CCACCAACNONE 
Os09g0535000AK058712GTTGGTGGSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488GTTGGTGGNONE 
AK069832GTTGGTGGNONE 
J100065D20GTTGGTGGNONE 
Os09g0539100AK071977CCACCAACSimilar to 3-dehydroquinate synthase-like protein. 
AK071977CCACCAACSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CCACCAACNONE 
AK098959CCACCAACNONE 
Os11g0127800006-035-E01CCACCAACNONE 
006-060-G02CCACCAACNONE 
006-082-D01CCACCAACNONE 
006-104-F10CCACCAACNONE 
006-110-B07CCACCAACNONE 
006-112-D02CCACCAACNONE 
AK059969CCACCAACSMAD/FHA domain containing protein. 
AK104015CCACCAACNONE 
AK104179CCACCAACNONE 
AK104250CCACCAACNONE 
J065085P11CCACCAACNONE 
J065160C07CCACCAACNONE 
J065172K01CCACCAACNONE 
J065189L16CCACCAACNONE 
J065201E06CCACCAACNONE 
J065209L06CCACCAACNONE 
J075042M10CCACCAACNONE 
J075080O12CCACCAACNONE 
J075087M02CCACCAACNONE 
J075117O20CCACCAACNONE 
J075185C03CCACCAACNONE 
J075188L14CCACCAACNONE 
Os11g0427800006-118-B04CCACCAACNONE 
006-119-H06CCACCAACNONE 
009-027-G07CCACCAACNONE 
009-190-C07CCACCAACNONE 
AK061288CCACCAACSimilar to Lipid transfer protein LPT III. 
AK071260CCACCAACNONE 
J023086A05CCACCAACNONE 
J065162A10CCACCAACNONE 
J075049P09CCACCAACNONE 
J075076D02CCACCAACNONE 
J075090E13CCACCAACNONE 
J075097L03CCACCAACNONE 
J075130I05CCACCAACNONE 
J075146C14CCACCAACNONE 
J075179A05CCACCAACNONE 
J075179H18CCACCAACNONE 
Os11g0579200AK108054GTTGGTGGConserved hypothetical protein. 
Os11g0588300006-029-G01CCACCAACNONE 
006-046-G09CCACCAACNONE 
AF402793CCACCAACSimilar to Glutathione transferase AtGST 10 (EC 2.5.1.18). 
AK060166CCACCAACNONE 
AK104738CCACCAACNONE 
J013023N07CCACCAACNONE 
J013043K06CCACCAACNONE 
J013070I07CCACCAACNONE 
J013157B16CCACCAACNONE 
J013159P05CCACCAACNONE 
J023041P18CCACCAACNONE 
J033082F03CCACCAACNONE 
J033092G07CCACCAACNONE 
J033115A10CCACCAACNONE 
J043030O20CCACCAACNONE 
J043038M22CCACCAACNONE 
J090041F22CCACCAACNONE 
J100032G24CCACCAACNONE 
J100066B06CCACCAACNONE 
J100080F06CCACCAACNONE 
J100089J05CCACCAACNONE 
Os11g0615200015-083-D10CCACCAACNONE 
J065098E17CCACCAACSSXT family protein. 
J065137B05CCACCAACNONE 
J065140D01CCACCAACNONE 
J065211M18CCACCAACNONE 
J075022H18CCACCAACNONE 
J075094G17CCACCAACNONE 
J075095O13CCACCAACNONE 
J075176M06CCACCAACNONE 
J100063M04CCACCAACNONE 
J100087D05CCACCAACNONE 
J100088A09CCACCAACNONE 
Os11g0657200AK059959GTTGGTGG2OG-Fe(II) oxygenase domain containing protein. 
Os12g0134000AK066940CCACCAACSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0166700AK071570CCACCAACConserved hypothetical protein. 
J065023H24CCACCAACNONE 
J090081C23CCACCAACNONE 
Os12g0235800AK071066CTCCCCCACCAACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0239300006-023-C01GTTGGTGGNONE 
006-023-C01GTTGGTGGNONE 
006-024-A12GTTGGTGGNONE 
006-024-A12GTTGGTGGNONE 
006-040-H11GTTGGTGGNONE 
006-040-H11GTTGGTGGNONE 
006-068-E04GTTGGTGGNONE 
006-068-E04GTTGGTGGNONE 
006-089-G07GTTGGTGGNONE 
006-089-G07GTTGGTGGNONE 
006-109-H12GTTGGTGGNONE 
006-109-H12GTTGGTGGNONE 
012-068-A12GTTGGTGGNONE 
012-068-A12GTTGGTGGNONE 
013-031-E05GTTGGTGGNONE 
013-031-E05GTTGGTGGNONE 
013-036-C05GTTGGTGGNONE 
013-036-C05GTTGGTGGNONE 
013-040-D05GTTGGTGGNONE 
013-040-D05GTTGGTGGNONE 
013-051-B07GTTGGTGGNONE 
013-051-B07GTTGGTGGNONE 
013-095-C07GTTGGTGGNONE 
013-095-C07GTTGGTGGNONE 
AK067904GTTGGTGGConserved hypothetical protein. 
AK067904GTTGGTGGConserved hypothetical protein. 
AK109345GTTGGTGGNONE 
AK109345GTTGGTGGNONE 
J013122E13GTTGGTGGNONE 
J013122E13GTTGGTGGNONE 
J013123H01GTTGGTGGNONE 
J013123H01GTTGGTGGNONE 
J013146H22GTTGGTGGNONE 
J013146H22GTTGGTGGNONE 
J023067C13GTTGGTGGNONE 
J023067C13GTTGGTGGNONE 
J023142F15GTTGGTGGNONE 
J023142F15GTTGGTGGNONE 
J033108D06GTTGGTGGNONE 
J033108D06GTTGGTGGNONE 
J033123M11GTTGGTGGNONE 
J033123M11GTTGGTGGNONE 
J065179L24GTTGGTGGNONE 
J065179L24GTTGGTGGNONE 
J100024G03GTTGGTGGNONE 
J100024G03GTTGGTGGNONE 
J100030G23GTTGGTGGNONE 
J100030G23GTTGGTGGNONE 
Os12g0270300AK070311GGTCCCACCAACGGCDisease resistance protein family protein. 
AK103036GGTCCCACCAACGGCNONE 
Os12g0564400009-069-F12CCTCGCCCACCAACNONE 
AK059949CCTCGCCCACCAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548CCTCGCCCACCAACNONE 
Os12g0624000AK067726GTTGGTGGNONE 
AK067757GTTGGTGGSimilar to Methionine synthase protein. 
J013039E03GTTGGTGGNONE 
J013040D22GTTGGTGGNONE 
J013047K12GTTGGTGGNONE 
J013056C04GTTGGTGGNONE 
J013062K01GTTGGTGGNONE 
J013108K09GTTGGTGGNONE 
J013126I24GTTGGTGGNONE 
J013128D18GTTGGTGGNONE 
J013147D23GTTGGTGGNONE 
J013154N13GTTGGTGGNONE 
J023003C20GTTGGTGGNONE 
J023003N19GTTGGTGGNONE 
J023007B09GTTGGTGGNONE 
J023008L12GTTGGTGGNONE 
J023037O10GTTGGTGGNONE 
J023044F11GTTGGTGGNONE 
J023062H22GTTGGTGGNONE 
J023064O07GTTGGTGGNONE 
J023067D16GTTGGTGGNONE 
J023082C19GTTGGTGGNONE 
J023090A08GTTGGTGGNONE 
J023102P21GTTGGTGGNONE 
J023122G15GTTGGTGGNONE 
J023123I24GTTGGTGGNONE 
J023134N07GTTGGTGGNONE 
J023140M21GTTGGTGGNONE 
J033023G06GTTGGTGGNONE 
J033025J02GTTGGTGGNONE 
J033025L06GTTGGTGGNONE 
J033026I21GTTGGTGGNONE 
J033028G20GTTGGTGGNONE 
J033028L03GTTGGTGGNONE 
J033030P14GTTGGTGGNONE 
J033031C02GTTGGTGGNONE 
J033031I06GTTGGTGGNONE 
J033037D21GTTGGTGGNONE 
J033037M24GTTGGTGGNONE 
J033040P06GTTGGTGGNONE 
J033046J18GTTGGTGGNONE 
J033048A14GTTGGTGGNONE 
J033048B14GTTGGTGGNONE 
J033051N03GTTGGTGGNONE 
J033060A19GTTGGTGGNONE 
J033060K19GTTGGTGGNONE 
J033065O13GTTGGTGGNONE 
J033067I23GTTGGTGGNONE 
J033068N13GTTGGTGGNONE 
J033070N02GTTGGTGGNONE 
J033072K15GTTGGTGGNONE 
J033073D09GTTGGTGGNONE 
J033075H17GTTGGTGGNONE 
J033076O22GTTGGTGGNONE 
J033086K06GTTGGTGGNONE 
J033086L03GTTGGTGGNONE 
J033088J09GTTGGTGGNONE 
J033091D17GTTGGTGGNONE 
J033096B11GTTGGTGGNONE 
J033099A05GTTGGTGGNONE 
J033101B15GTTGGTGGNONE 
J033101D20GTTGGTGGNONE 
J033105D22GTTGGTGGNONE 
J033106J20GTTGGTGGNONE 
J033107J01GTTGGTGGNONE 
J033111N08GTTGGTGGNONE 
J033112B18GTTGGTGGNONE 
J033113L04GTTGGTGGNONE 
J033114F02GTTGGTGGNONE 
J033118A22GTTGGTGGNONE 
J033119J02GTTGGTGGNONE 
J033120F22GTTGGTGGNONE 
J033120O16GTTGGTGGNONE 
J033127A12GTTGGTGGNONE 
J033127J08GTTGGTGGNONE 
J033127N13GTTGGTGGNONE 
J033131N09GTTGGTGGNONE 
J033135I05GTTGGTGGNONE 
J033140D04GTTGGTGGNONE 
J033142D04GTTGGTGGNONE 
J033145B14GTTGGTGGNONE 
J043007I15GTTGGTGGNONE 
J043021N20GTTGGTGGNONE 
J043037I05GTTGGTGGNONE 
J065008P22GTTGGTGGNONE 
J065038C05GTTGGTGGNONE 
J065060A16GTTGGTGGNONE 
J065111M10GTTGGTGGNONE 
J065112L11GTTGGTGGNONE 
J065114B07GTTGGTGGNONE 
J065116M04GTTGGTGGNONE 
J065152D15GTTGGTGGNONE 
J065171C15GTTGGTGGNONE 
J065173N07GTTGGTGGNONE 
J065185N18GTTGGTGGNONE 
J065187F09GTTGGTGGNONE 
J065188L15GTTGGTGGNONE 
J065190K15GTTGGTGGNONE 
J065214C16GTTGGTGGNONE 
J065215F05GTTGGTGGNONE 
J075108J08GTTGGTGGNONE 
J090002C16GTTGGTGGNONE 
J090002K12GTTGGTGGNONE 
J090003M10GTTGGTGGNONE 
J090007J12GTTGGTGGNONE 
J090010D06GTTGGTGGNONE 
J090010F21GTTGGTGGNONE 
J090014E20GTTGGTGGNONE 
J090014J03GTTGGTGGNONE 
J090017E15GTTGGTGGNONE 
J090019J18GTTGGTGGNONE 
J090021B21GTTGGTGGNONE 
J090021H21GTTGGTGGNONE 
J090021J12GTTGGTGGNONE 
J090022K10GTTGGTGGNONE 
J090024C24GTTGGTGGNONE 
J090026D12GTTGGTGGNONE 
J090034F08GTTGGTGGNONE 
J090036H24GTTGGTGGNONE 
J090036L04GTTGGTGGNONE 
J090040C21GTTGGTGGNONE 
J090045J21GTTGGTGGNONE 
J090052D21GTTGGTGGNONE 
J090053A01GTTGGTGGNONE 
J090057E01GTTGGTGGNONE 
J090059A01GTTGGTGGNONE 
J090059M24GTTGGTGGNONE 
J090062A08GTTGGTGGNONE 
J090065H17GTTGGTGGNONE 
J090073M22GTTGGTGGNONE 
J090074J05GTTGGTGGNONE 
J090074L22GTTGGTGGNONE 
J090077E04GTTGGTGGNONE 
J090077K10GTTGGTGGNONE 
J090088E21GTTGGTGGNONE 
J090088L13GTTGGTGGNONE 
J090089M05GTTGGTGGNONE 
J090092E18GTTGGTGGNONE 
J090092P07GTTGGTGGNONE 
J090096M04GTTGGTGGNONE 
J090099I04GTTGGTGGNONE 
J100023P11GTTGGTGGNONE 
J100024K13GTTGGTGGNONE 
J100026P20GTTGGTGGNONE 
J100027I15GTTGGTGGNONE 
J100027M21GTTGGTGGNONE 
J100029H05GTTGGTGGNONE 
J100030E10GTTGGTGGNONE 
J100030F11GTTGGTGGNONE 
J100031C13GTTGGTGGNONE 
J100032P16GTTGGTGGNONE 
J100034G02GTTGGTGGNONE 
J100037D06GTTGGTGGNONE 
J100050D08GTTGGTGGNONE 
J100051J22GTTGGTGGNONE 
J100055G12GTTGGTGGNONE 
J100056O15GTTGGTGGNONE 
J100057E06GTTGGTGGNONE 
J100061P11GTTGGTGGNONE 
J100064H05GTTGGTGGNONE 
J100066D14GTTGGTGGNONE 
J100067D10GTTGGTGGNONE 
J100070L11GTTGGTGGNONE 
J100071N11GTTGGTGGNONE 
J100073D21GTTGGTGGNONE 
J100074L06GTTGGTGGNONE 
J100081I01GTTGGTGGNONE 
J100083F08GTTGGTGGNONE 
J100083I15GTTGGTGGNONE 
J100084P13GTTGGTGGNONE 
J100086N12GTTGGTGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.