version

Summary of OsREG521 (All List)

OrganismOryza sativa  
IDOsREG521  
SequenceCCACGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1724  

Entry Sequences (1724 entries)

LocusGene modelSequenceDescription
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0142200AK103082GGCCGTGGConserved hypothetical protein. 
AK109417GGCCGTGGNONE 
J033118F12GGCCGTGGNONE 
J065039C03GGCCGTGGNONE 
J065214J22GGCCGTGGNONE 
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0146200J090080H03CCACGGCCConserved hypothetical protein. 
Os01g0164400006-027-E10GGCCGTGGNONE 
009-049-A12GGCCGTGGNONE 
AK061428GGCCGTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0175000AK061797CCACGGCCNONE 
AK101698CCACGGCCNONE 
Os01g0179000015-092-B11CCACGGCCTransferase family protein. 
J033107B12CCACGGCCNONE 
Os01g0179400012-059-A11CCACGGCCNONE 
AK063507CCACGGCCConserved hypothetical protein. 
Os01g0233900011-038-E11GGCCGTGGCGTGNONE 
AK100714GGCCGTGGCGTGUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023115K12GGCCGTGGCGTGNONE 
J033103B07GGCCGTGGCGTGNONE 
J075011L24GGCCGTGGCGTGNONE 
J075022O12GGCCGTGGCGTGNONE 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0343100J065039P06CCACGGCCCProtein of unknown function DUF594 family protein. 
Os01g0584900AK108522GGCCGTGGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846GGCCGTGGNONE 
J065161G19GGCCGTGGNONE 
J065193D14GGCCGTGGNONE 
J065193L05GGCCGTGGNONE 
J065196K16GGCCGTGGNONE 
Os01g0612600004-008-D07GGCCGTGGNONE 
009-057-C09GGCCGTGGNONE 
009-130-C01GGCCGTGGNONE 
AK062906GGCCGTGGNONE 
AK066561GGCCGTGGProtein of unknown function DUF1644 family protein. 
J013065E14GGCCGTGGNONE 
J013073D14GGCCGTGGNONE 
J023014A21GGCCGTGGNONE 
J023073M13GGCCGTGGNONE 
J023079F02GGCCGTGGNONE 
J023083B16GGCCGTGGNONE 
J023090G19GGCCGTGGNONE 
J023095F15GGCCGTGGNONE 
J023119H11GGCCGTGGNONE 
J033040B01GGCCGTGGNONE 
J033044F13GGCCGTGGNONE 
J033081E23GGCCGTGGNONE 
J033121K07GGCCGTGGNONE 
J033124D11GGCCGTGGNONE 
J033131N22GGCCGTGGNONE 
J065179E10GGCCGTGGNONE 
J090020A13GGCCGTGGNONE 
J090045K17GGCCGTGGNONE 
J090047M24GGCCGTGGNONE 
J090064G23GGCCGTGGNONE 
J090084G08GGCCGTGGNONE 
J090086F18GGCCGTGGNONE 
J100032D09GGCCGTGGNONE 
J100037O18GGCCGTGGNONE 
J100042B03GGCCGTGGNONE 
J100061D06GGCCGTGGNONE 
J100061I03GGCCGTGGNONE 
J100063B17GGCCGTGGNONE 
Os01g0623900J090025M21CCACGGCCCGNONE 
J090082F22CCACGGCCCGNONE 
J090084L02CCACGGCCCGSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0662600009-056-E10CCACGGCCCNONE 
AK062234CCACGGCCCNONE 
AK098887CCACGGCCCNONE 
AK099656CCACGGCCCNONE 
AK119723CCACGGCCCSimilar to NifU-like protein. 
J013001K01CCACGGCCCNONE 
J013090F20CCACGGCCCNONE 
J013119A14CCACGGCCCNONE 
J013121P12CCACGGCCCNONE 
J033132I15CCACGGCCCNONE 
J075023F22CCACGGCCCNONE 
J075023M13CCACGGCCCNONE 
J100024D10CCACGGCCCNONE 
J100024N01CCACGGCCCNONE 
J100026H09CCACGGCCCNONE 
J100027H07CCACGGCCCNONE 
J100045K07CCACGGCCCNONE 
J100057K18CCACGGCCCNONE 
J100085C22CCACGGCCCNONE 
Os01g0672800AK101605GGCCGTGGProtein of unknown function DUF1421 family protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0736900AK062151CCACGGCCNONE 
J013070F03CCACGGCCNONE 
Os01g0754000014-081-F07CGGGCCGTGGNONE 
AK063730CGGGCCGTGGConserved hypothetical protein. 
J065219A11CGGGCCGTGGNONE 
J075136N13CGGGCCGTGGNONE 
J100051G01CGGGCCGTGGNONE 
J100053M22CGGGCCGTGGNONE 
Os01g0772500AK109736CCACGGCCGlycosyl transferase, family 14 protein. 
Os01g0834700AK101559CCACGGCCZinc finger, CCCH-type domain containing protein. 
AK106074CCACGGCCNONE 
Os01g0842200003-126-E01GGCCGTGGACCNONE 
AK102593GGCCGTGGACCNONE 
AK119896GGCCGTGGACCSimilar to Scarecrow-like 9 (Fragment). 
J013151G12GGCCGTGGACCNONE 
J033098G15GGCCGTGGACCNONE 
J090041L03GGCCGTGGACCNONE 
J090069J20GGCCGTGGACCNONE 
Os01g0849600AK108159CCACGGCCSimilar to ENOD18 protein (Fragment). 
Os01g0856900AK107570CCACGGCCGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CCACGGCCNONE 
J075028J03CCACGGCCNONE 
J075052C05CCACGGCCNONE 
J075199J04CCACGGCCNONE 
J090052L20CCACGGCCNONE 
J090075L24CCACGGCCNONE 
Os01g0863166J065007F23CCACGGCCCATTTNONE 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
Os01g0866500AK111757CGGGCCGTGGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
J023060L20CGGGCCGTGGNONE 
J023143G12CGGGCCGTGGNONE 
Os01g0867900AK061366CCACGGCCProtein of unknown function DUF502 family protein. 
Os01g0870100AK103428GGCCGTGGNONE 
Os01g0875500012-063-E07CCACGGCCNONE 
AK101399CCACGGCCSimilar to Beta-galactosidase (EC 3.2.1.23). 
AK102715CCACGGCCNONE 
J023104F17CCACGGCCNONE 
J023128M07CCACGGCCNONE 
J033022B13CCACGGCCNONE 
J033034C09CCACGGCCNONE 
J033037E13CCACGGCCNONE 
J033044E15CCACGGCCNONE 
J033085M16CCACGGCCNONE 
J033087L24CCACGGCCNONE 
J033089G01CCACGGCCNONE 
J033093D16CCACGGCCNONE 
J033102B22CCACGGCCNONE 
J033108E02CCACGGCCNONE 
J033115P07CCACGGCCNONE 
J033122A10CCACGGCCNONE 
J090033B09CCACGGCCNONE 
J090038A15CCACGGCCNONE 
J090053G04CCACGGCCNONE 
J090069H01CCACGGCCNONE 
J090093F16CCACGGCCNONE 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0908700AK120427GGCCGTGGSimilar to Hnrpa2b1-prov protein. 
Os01g0939200AK110814CCACGGCCConserved hypothetical protein. 
AK110814GGCCGTGGConserved hypothetical protein. 
Os01g0944700006-058-E06CTTGGGCCGTGGNONE 
006-065-A04CTTGGGCCGTGGNONE 
006-076-E07CTTGGGCCGTGGNONE 
006-087-A09CTTGGGCCGTGGNONE 
006-091-B05CTTGGGCCGTGGNONE 
006-105-C12CTTGGGCCGTGGNONE 
006-108-G03CTTGGGCCGTGGNONE 
006-113-C02CTTGGGCCGTGGNONE 
006-115-G03CTTGGGCCGTGGNONE 
009-047-H03CTTGGGCCGTGGNONE 
009-120-E11CTTGGGCCGTGGNONE 
009-195-C06CTTGGGCCGTGGNONE 
009-199-D12CTTGGGCCGTGGNONE 
013-006-E01CTTGGGCCGTGGNONE 
013-025-C06CTTGGGCCGTGGNONE 
013-035-D10CTTGGGCCGTGGNONE 
AF443600CTTGGGCCGTGGNONE 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
J013106C20CTTGGGCCGTGGNONE 
J023023O17CTTGGGCCGTGGNONE 
J023038J21CTTGGGCCGTGGNONE 
J023041A20CTTGGGCCGTGGNONE 
J023066P09CTTGGGCCGTGGNONE 
J023072F21CTTGGGCCGTGGNONE 
J023090L19CTTGGGCCGTGGNONE 
J023093M17CTTGGGCCGTGGNONE 
J023120D21CTTGGGCCGTGGNONE 
J023134O19CTTGGGCCGTGGNONE 
J023141D14CTTGGGCCGTGGNONE 
J033026N18CTTGGGCCGTGGNONE 
J033048M05CTTGGGCCGTGGNONE 
J033070N13CTTGGGCCGTGGNONE 
J033143C11CTTGGGCCGTGGNONE 
J033143O12CTTGGGCCGTGGNONE 
J043015L22CTTGGGCCGTGGNONE 
J053048D16CTTGGGCCGTGGNONE 
J053053L14CTTGGGCCGTGGNONE 
J053059O17CTTGGGCCGTGGNONE 
J053060N14CTTGGGCCGTGGNONE 
J053077B10CTTGGGCCGTGGNONE 
J053090L06CTTGGGCCGTGGNONE 
J053090M04CTTGGGCCGTGGNONE 
J075032N21CTTGGGCCGTGGNONE 
J075074O15CTTGGGCCGTGGNONE 
J075078I24CTTGGGCCGTGGNONE 
J090081N23CTTGGGCCGTGGNONE 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0976600AK072971GGCCGTGGCCGTTGGSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GGCCGTGGCCGTTGGNONE 
J075095H03GGCCGTGGCCGTTGGNONE 
J090089M19GGCCGTGGCCGTTGGNONE 
Os02g0102900012-093-F04CCACGGCCNONE 
AK070603CCACGGCCSimilar to RuBisCO subunit binding-protein beta subunit, chloroplast (60 kDa chaperonin beta subunit) (CPN-60 beta) (Fragment). 
AK101537CCACGGCCNONE 
J013021H14CCACGGCCNONE 
J013162G08CCACGGCCNONE 
J023001E11CCACGGCCNONE 
J023059D06CCACGGCCNONE 
J023064K16CCACGGCCNONE 
J033022K15CCACGGCCNONE 
J033025O05CCACGGCCNONE 
J033035H05CCACGGCCNONE 
J033037A05CCACGGCCNONE 
J033066D15CCACGGCCNONE 
J033073N13CCACGGCCNONE 
J033088A22CCACGGCCNONE 
J033111I24CCACGGCCNONE 
J033114F06CCACGGCCNONE 
J033120I01CCACGGCCNONE 
J043001I24CCACGGCCNONE 
J090049O14CCACGGCCNONE 
J090061B20CCACGGCCNONE 
J090063P20CCACGGCCNONE 
J090073G18CCACGGCCNONE 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0192300Os02g0192300CCACGGCCZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0195500AK062207CTCCCCCACGGCCACGGCCNONE 
Os02g0314600AK068924CCACGGCCPeptidase A1, pepsin family protein. 
J065021N06CCACGGCCNONE 
J065120N03CCACGGCCNONE 
J100058F22CCACGGCCNONE 
Os02g0461500AK108772CCACGGCCBeta-Ig-H3/fasciclin domain containing protein. 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0591700AK072777CCACGGCCGAAASimilar to Candida glabrata strain CBS138 chromosome L complete sequence. 
J013096O06CCACGGCCGAAANONE 
J023139B06CCACGGCCGAAANONE 
J065114F05CCACGGCCGAAANONE 
J090059C21CCACGGCCGAAANONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0592700AK107229GGCCGTGGConserved hypothetical protein. 
AK108162GGCCGTGGNONE 
J075025M24GGCCGTGGNONE 
Os02g0610700014-008-A03GCCCACGGCCACACGNONE 
014-008-A03GGCCGTGGNONE 
AK059205GCCCACGGCCACACGConserved hypothetical protein. 
AK059205GGCCGTGGConserved hypothetical protein. 
AK100281GCCCACGGCCACACGNONE 
AK100281GGCCGTGGNONE 
J023074H03GCCCACGGCCACACGNONE 
J023074H03GGCCGTGGNONE 
J065002J16GCCCACGGCCACACGNONE 
J065002J16GGCCGTGGNONE 
J065032I20GCCCACGGCCACACGNONE 
J065032I20GGCCGTGGNONE 
J065076A07GCCCACGGCCACACGNONE 
J065076A07GGCCGTGGNONE 
J065142O21GCCCACGGCCACACGNONE 
J065142O21GGCCGTGGNONE 
J065203A03GCCCACGGCCACACGNONE 
J065203A03GGCCGTGGNONE 
J075017F24GCCCACGGCCACACGNONE 
J075017F24GGCCGTGGNONE 
J075017G24GCCCACGGCCACACGNONE 
J075017G24GGCCGTGGNONE 
Os02g0618400AK099283CCTGGGCCGTGGNONE 
AK111807CCTGGGCCGTGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CCTGGGCCGTGGNONE 
J090067D02CCTGGGCCGTGGNONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0638200J065176A11CCACGGCCConserved hypothetical protein. 
Os02g0669500AK111117CCACGGCCCGProtein of unknown function DUF241, plant family protein. 
Os02g0672500AK109266CCACGGCCCACCTNONE 
Os02g0684400008-002-F10CCACGGCCNONE 
AK065103CCACGGCCConserved hypothetical protein. 
J013001N07CCACGGCCNONE 
J065161G12CCACGGCCNONE 
J100064F24CCACGGCCNONE 
J100074K01CCACGGCCNONE 
J100083A09CCACGGCCNONE 
J100083E03CCACGGCCNONE 
J100088P03CCACGGCCNONE 
Os02g0751600006-048-C01CCACGGCCNONE 
006-059-E07CCACGGCCNONE 
AK060441CCACGGCCNONE 
AK061027CCACGGCCNONE 
AK072946CCACGGCCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401CCACGGCCNONE 
J023150D22CCACGGCCNONE 
J075005E17CCACGGCCNONE 
J075019F10CCACGGCCNONE 
J075047K24CCACGGCCNONE 
J075052B13CCACGGCCNONE 
J075063M19CCACGGCCNONE 
J075136P10CCACGGCCNONE 
J075139E24CCACGGCCNONE 
J075152K11CCACGGCCNONE 
J075161A10CCACGGCCNONE 
J075187F20CCACGGCCNONE 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0797300J023065F09CCACGGCCNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0814300AK111376CCACGGCCCytochrome c, monohaem domain containing protein. 
J065063I24CCACGGCCNONE 
Os02g0814400009-105-D08GGCCGTGGNONE 
009-143-A10GGCCGTGGNONE 
009-158-F10GGCCGTGGNONE 
009-185-E12GGCCGTGGNONE 
AK120394GGCCGTGGCytochrome c, monohaem domain containing protein. 
J013075E17GGCCGTGGNONE 
J013123D07GGCCGTGGNONE 
J100043H24GGCCGTGGNONE 
J100044A20GGCCGTGGNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
AK065925GGCCGTGGProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J013047E20GGCCGTGGNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065026F21GGCCGTGGNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065047B03GGCCGTGGNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065054J12GGCCGTGGNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065079M24GGCCGTGGNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065093M07GGCCGTGGNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065153F02GGCCGTGGNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065155E21GGCCGTGGNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J065179H15GGCCGTGGNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075019N02GGCCGTGGNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J075089E01GGCCGTGGNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090066I18GGCCGTGGNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J090087K20GGCCGTGGNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
J100079F05GGCCGTGGNONE 
Os03g0116800AK068678GGCCGTGGNONE 
J013158H22GGCCGTGGNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076CCACGGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0132800AK104997GCCCACGGCCNONE 
AK122069GCCCACGGCCSimilar to protein kinase-like protein [Oryza sativa (japonica cultivar-group)]. 
Os03g0148400AK072852CCACGGCCProtein of unknown function DUF740 family protein. 
J023138H13CCACGGCCNONE 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0156500011-075-F02CCACGGCCNONE 
012-077-G10CCACGGCCNONE 
AK103466CCACGGCCLupus La protein family protein. 
J013088H17CCACGGCCNONE 
J013135G21CCACGGCCNONE 
J033050E10CCACGGCCNONE 
J033050J01CCACGGCCNONE 
J033129N23CCACGGCCNONE 
J065085L16CCACGGCCNONE 
J065101B19CCACGGCCNONE 
J065167N03CCACGGCCNONE 
J090009O21CCACGGCCNONE 
J090049D11CCACGGCCNONE 
J100017F23CCACGGCCNONE 
J100040E12CCACGGCCNONE 
J100055O18CCACGGCCNONE 
J100061K08CCACGGCCNONE 
J100072M05CCACGGCCNONE 
J100077B08CCACGGCCNONE 
J100086G03CCACGGCCNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0186800AK100356CCACGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0199500J065099N05CCACGGCCCNONE 
J065152P14CCACGGCCCConserved hypothetical protein. 
J080009C14CCACGGCCCNONE 
J080011K01CCACGGCCCNONE 
J080015H12CCACGGCCCNONE 
J080022K05CCACGGCCCNONE 
J080034G01CCACGGCCCNONE 
J080038I04CCACGGCCCNONE 
J080039F20CCACGGCCCNONE 
J080042J22CCACGGCCCNONE 
J080042N23CCACGGCCCNONE 
J080043E07CCACGGCCCNONE 
J080050A12CCACGGCCCNONE 
J080050C11CCACGGCCCNONE 
J080052B01CCACGGCCCNONE 
J080052H22CCACGGCCCNONE 
J080060E02CCACGGCCCNONE 
J080063K24CCACGGCCCNONE 
J080067I07CCACGGCCCNONE 
J080081H22CCACGGCCCNONE 
J080085J10CCACGGCCCNONE 
J080089E20CCACGGCCCNONE 
J080092N04CCACGGCCCNONE 
J080093B01CCACGGCCCNONE 
J080093N04CCACGGCCCNONE 
J080097B03CCACGGCCCNONE 
Os03g0253100AK119618GGCCGTGGPhosphomevalonate kinase Erg8 family protein. 
J033052A14GGCCGTGGNONE 
Os03g0255100AK067479GGCCGTGGSimilar to Relative to SR12 protein (Fragment). 
J013047D12GGCCGTGGNONE 
J013063F07GGCCGTGGNONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCACGGCCCAAGNONE 
J023079P21CCACGGCCCAAGNONE 
J023120G14CCACGGCCCAAGNONE 
J090042F16CCACGGCCCAAGNONE 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0336100AK105307GGCCGTGG11-S plant seed storage protein family protein. 
Os03g0342900006-032-D01GGCCGTGGNONE 
006-033-E10GGCCGTGGNONE 
006-051-G06GGCCGTGGNONE 
006-053-E05GGCCGTGGNONE 
006-056-B05GGCCGTGGNONE 
006-058-F04GGCCGTGGNONE 
006-059-E05GGCCGTGGNONE 
006-060-F10GGCCGTGGNONE 
006-104-D12GGCCGTGGNONE 
009-129-C12GGCCGTGGNONE 
AK060136GGCCGTGGNONE 
AK060980GGCCGTGGNONE 
AK064815GGCCGTGGDormancyauxin associated family protein. 
AK104244GGCCGTGGNONE 
AK104391GGCCGTGGNONE 
AK104590GGCCGTGGNONE 
AK104744GGCCGTGGNONE 
AK106100GGCCGTGGNONE 
J013000E10GGCCGTGGNONE 
J075027O22GGCCGTGGNONE 
J075052J03GGCCGTGGNONE 
J075066E15GGCCGTGGNONE 
J075095C17GGCCGTGGNONE 
J075118N05GGCCGTGGNONE 
J075187K22GGCCGTGGNONE 
J090026L04GGCCGTGGNONE 
J090059G16GGCCGTGGNONE 
J100055P20GGCCGTGGNONE 
J100062A10GGCCGTGGNONE 
J100068G20GGCCGTGGNONE 
Os03g0343500009-042-G06CCACGGCCCAACNONE 
009-063-D01CCACGGCCCAACNONE 
009-156-H09CCACGGCCCAACNONE 
AB117995CCACGGCCCAACNONE 
AK058737CCACGGCCCAACNONE 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK121502CCACGGCCCAACNONE 
J023082D10CCACGGCCCAACNONE 
J033022G11CCACGGCCCAACNONE 
J075048M16CCACGGCCCAACNONE 
J075049O20CCACGGCCCAACNONE 
J075082I02CCACGGCCCAACNONE 
J075105G01CCACGGCCCAACNONE 
J075131K05CCACGGCCCAACNONE 
J080002H01CCACGGCCCAACNONE 
J080003H01CCACGGCCCAACNONE 
J080005G08CCACGGCCCAACNONE 
J080011M13CCACGGCCCAACNONE 
J080020M02CCACGGCCCAACNONE 
J080026N24CCACGGCCCAACNONE 
J080028L09CCACGGCCCAACNONE 
J080032O14CCACGGCCCAACNONE 
J080033J12CCACGGCCCAACNONE 
J080035D05CCACGGCCCAACNONE 
J080039H01CCACGGCCCAACNONE 
J080044B07CCACGGCCCAACNONE 
J080044E23CCACGGCCCAACNONE 
J080049N11CCACGGCCCAACNONE 
J080050A21CCACGGCCCAACNONE 
J080055L24CCACGGCCCAACNONE 
J080059N20CCACGGCCCAACNONE 
J080061F04CCACGGCCCAACNONE 
J080078I16CCACGGCCCAACNONE 
J080079G24CCACGGCCCAACNONE 
J080080K13CCACGGCCCAACNONE 
J080083G20CCACGGCCCAACNONE 
J080087B08CCACGGCCCAACNONE 
J080091L19CCACGGCCCAACNONE 
J080094D06CCACGGCCCAACNONE 
J090038L06CCACGGCCCAACNONE 
J090075H06CCACGGCCCAACNONE 
J090081D12CCACGGCCCAACNONE 
Os03g0363800AK103387GGCCGTGGSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0381500AK108125CCACGGCCConserved hypothetical protein. 
Os03g0428800AK060233CCACGGCCTetratricopeptide-like helical domain containing protein. 
Os03g0574300AK072541CCAAGCCCACGGCCHypothetical protein. 
J023134M10CCAAGCCCACGGCCNONE 
Os03g0624600009-086-F08GGCCGTGGNONE 
AK062675GGCCGTGGNo apical meristem (NAM) protein domain containing protein. 
J100090F17GGCCGTGGNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0639600AK111569CCACGGCCCSimilar to Zinc-finger protein Lsd1. 
J013071E13CCACGGCCCNONE 
J053039O11CCACGGCCCNONE 
J053048C05CCACGGCCCNONE 
J065171F11CCACGGCCCNONE 
J065188I07CCACGGCCCNONE 
J075172K20CCACGGCCCNONE 
J075199C18CCACGGCCCNONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0651700006-061-B11CCACGGCCNONE 
AK059828CCACGGCCConserved hypothetical protein. 
Os03g0654700AK107417CCACGGCCGTCCGProtein of unknown function DUF1637 family protein. 
Os03g0656100AK062338CCACGGCCConserved hypothetical protein. 
Os03g0663800011-023-B06GCCCACGGCCNONE 
011-033-C06GCCCACGGCCNONE 
012-011-E03GCCCACGGCCNONE 
012-014-F04GCCCACGGCCNONE 
012-027-C01GCCCACGGCCNONE 
012-027-H07GCCCACGGCCNONE 
012-031-A02GCCCACGGCCNONE 
012-044-E05GCCCACGGCCNONE 
012-045-G10GCCCACGGCCNONE 
012-049-H02GCCCACGGCCNONE 
012-053-G08GCCCACGGCCNONE 
012-058-D07GCCCACGGCCNONE 
012-061-H02GCCCACGGCCNONE 
012-066-A02GCCCACGGCCNONE 
012-074-F12GCCCACGGCCNONE 
012-079-D08GCCCACGGCCNONE 
012-081-E05GCCCACGGCCNONE 
012-083-F04GCCCACGGCCNONE 
012-084-F08GCCCACGGCCNONE 
012-086-E08GCCCACGGCCNONE 
012-086-F01GCCCACGGCCNONE 
012-087-F03GCCCACGGCCNONE 
012-087-H02GCCCACGGCCNONE 
012-088-E05GCCCACGGCCNONE 
012-089-B02GCCCACGGCCNONE 
014-016-A04GCCCACGGCCNONE 
AK105347GCCCACGGCCNONE 
J075032I06GCCCACGGCCNONE 
J075041O22GCCCACGGCCNONE 
J075093E24GCCCACGGCCNONE 
J075094E06GCCCACGGCCNONE 
U45322GCCCACGGCCCupin region domain containing protein. 
Os03g0699600AK070428CCACGGCCCyclin-like F-box domain containing protein. 
Os03g0701000J075172J23CCACGGCCNONE 
Os03g0719500AK106321CCACGGCCNONE 
Os03g0736600AK060375CCACGGCCConserved hypothetical protein. 
Os03g0736700AK060219CCACGGCCCGNONE 
Os03g0748900006-088-H04GGCCGTGGGCNONE 
AK061165GGCCGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065097I23GGCCGTGGGCNONE 
J100025O17GGCCGTGGGCNONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0762400AK071181GGCCGTGGSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20GGCCGTGGNONE 
J033039C18GGCCGTGGNONE 
J033108N03GGCCGTGGNONE 
J043017N16GGCCGTGGNONE 
J065026C13GGCCGTGGNONE 
J065045C01GGCCGTGGNONE 
J065045D11GGCCGTGGNONE 
J065050N09GGCCGTGGNONE 
J065058P21GGCCGTGGNONE 
J065075I20GGCCGTGGNONE 
J065077I17GGCCGTGGNONE 
J065081I20GGCCGTGGNONE 
J065085B14GGCCGTGGNONE 
J065101K21GGCCGTGGNONE 
J065112A17GGCCGTGGNONE 
J065112N13GGCCGTGGNONE 
J065118J02GGCCGTGGNONE 
J065123E01GGCCGTGGNONE 
J065134N12GGCCGTGGNONE 
J065139L04GGCCGTGGNONE 
J065141I11GGCCGTGGNONE 
J065161J24GGCCGTGGNONE 
J065164I10GGCCGTGGNONE 
J065171L01GGCCGTGGNONE 
J065178P21GGCCGTGGNONE 
J065185L24GGCCGTGGNONE 
J065219C04GGCCGTGGNONE 
J075029B07GGCCGTGGNONE 
J075033G20GGCCGTGGNONE 
J075054N01GGCCGTGGNONE 
J075068B22GGCCGTGGNONE 
J075096N11GGCCGTGGNONE 
J075098C11GGCCGTGGNONE 
J075115J22GGCCGTGGNONE 
J075127D11GGCCGTGGNONE 
J075156J21GGCCGTGGNONE 
J075166G08GGCCGTGGNONE 
J075166P17GGCCGTGGNONE 
J075170O18GGCCGTGGNONE 
J075181A16GGCCGTGGNONE 
J075195J11GGCCGTGGNONE 
Os03g0832200AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0844800AK071813GGCCGTGGGACCCGCGCConserved hypothetical protein. 
J023114B14GGCCGTGGGACCCGCGCNONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0854800J090007D13CCACGGCCCNONE 
J090085N22CCACGGCCCNONE 
Os04g0194500AK121164CCACGGCCSimilar to ABC transporter-like protein. 
Os04g0208400AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
Os04g0352400016-007-G12CCACGGCCNONE 
AF140495CCACGGCCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK100844CCACGGCCNONE 
Os04g0406600AK103609GGCCGTGGPrephenate dehydratase domain containing protein. 
J033133I10GGCCGTGGNONE 
J075092D11GGCCGTGGNONE 
J100031M09GGCCGTGGNONE 
Os04g0407900AK064758GGCCGTGGCCGTGGSimilar to Cytochrom P450-like protein. 
Os04g0434400014-079-B10CCACGGCCNONE 
AK063725CCACGGCCConserved hypothetical protein. 
Os04g0438300AK066277GGCCGTGGCCGTGGProtein of unknown function DUF150 family protein. 
J013060K17GGCCGTGGCCGTGGNONE 
J065143E08GGCCGTGGCCGTGGNONE 
J065147E10GGCCGTGGCCGTGGNONE 
Os04g0438400AK067975CCACGGCCACGGCCSimilar to Pectin methylesterase-like protein. 
Os04g0462500006-073-E08GGCCGTGGGACCCACNONE 
AK062065GGCCGTGGGACCCACNONE 
AK071311GGCCGTGGGACCCACSimilar to 14-3-3-like protein GF14-6. 
AK071822GGCCGTGGGACCCACNONE 
AK099243GGCCGTGGGACCCACNONE 
AK101938GGCCGTGGGACCCACNONE 
J013056F02GGCCGTGGGACCCACNONE 
J023020E08GGCCGTGGGACCCACNONE 
J023085B16GGCCGTGGGACCCACNONE 
J023117D08GGCCGTGGGACCCACNONE 
J023133K12GGCCGTGGGACCCACNONE 
J033025G04GGCCGTGGGACCCACNONE 
J033052A15GGCCGTGGGACCCACNONE 
J033074G16GGCCGTGGGACCCACNONE 
J033090A16GGCCGTGGGACCCACNONE 
J033122A07GGCCGTGGGACCCACNONE 
J033133G09GGCCGTGGGACCCACNONE 
J065002F16GGCCGTGGGACCCACNONE 
J065030M09GGCCGTGGGACCCACNONE 
J065056B11GGCCGTGGGACCCACNONE 
J065115I10GGCCGTGGGACCCACNONE 
J065120O09GGCCGTGGGACCCACNONE 
J065124G21GGCCGTGGGACCCACNONE 
J075031C14GGCCGTGGGACCCACNONE 
J075040H07GGCCGTGGGACCCACNONE 
J075047F04GGCCGTGGGACCCACNONE 
J075065F14GGCCGTGGGACCCACNONE 
J075066G20GGCCGTGGGACCCACNONE 
J075105D01GGCCGTGGGACCCACNONE 
J075147B04GGCCGTGGGACCCACNONE 
J075149A12GGCCGTGGGACCCACNONE 
J075172D07GGCCGTGGGACCCACNONE 
J075190J11GGCCGTGGGACCCACNONE 
J090038H18GGCCGTGGGACCCACNONE 
J090087G05GGCCGTGGGACCCACNONE 
J100025A10GGCCGTGGGACCCACNONE 
J100025O10GGCCGTGGGACCCACNONE 
J100027D02GGCCGTGGGACCCACNONE 
J100027P06GGCCGTGGGACCCACNONE 
J100032K04GGCCGTGGGACCCACNONE 
J100056D21GGCCGTGGGACCCACNONE 
J100060J08GGCCGTGGGACCCACNONE 
J100063N19GGCCGTGGGACCCACNONE 
J100064C14GGCCGTGGGACCCACNONE 
J100064K18GGCCGTGGGACCCACNONE 
J100070L21GGCCGTGGGACCCACNONE 
J100072M17GGCCGTGGGACCCACNONE 
J100074F21GGCCGTGGGACCCACNONE 
J100087E05GGCCGTGGGACCCACNONE 
U65956GGCCGTGGGACCCACNONE 
Os04g0477500AK063950CCACGGCCNONE 
AK067372CCACGGCCGlycosyl transferase, family 17 protein. 
AK100897CCACGGCCNONE 
J013106K01CCACGGCCNONE 
J043012L06CCACGGCCNONE 
J065025M07CCACGGCCNONE 
J065025M08CCACGGCCNONE 
Os04g0513400012-070-C07GGCCGTGGNONE 
AK066850GGCCGTGGNONE 
AK068772GGCCGTGGSimilar to Beta-glucosidase. 
J065054D24GGCCGTGGNONE 
J065072G04GGCCGTGGNONE 
J065190D11GGCCGTGGNONE 
Os04g0531100013-046-D02CCACGGCCCACNONE 
AF090698CCACGGCCCACNONE 
AK063584CCACGGCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CCACGGCCCACNONE 
J065028L15CCACGGCCCACNONE 
J065048O03CCACGGCCCACNONE 
J065053K10CCACGGCCCACNONE 
J065072H10CCACGGCCCACNONE 
J065081H10CCACGGCCCACNONE 
J065082N17CCACGGCCCACNONE 
J065104K08CCACGGCCCACNONE 
J065106M03CCACGGCCCACNONE 
J065119I05CCACGGCCCACNONE 
J065122F04CCACGGCCCACNONE 
J065140N24CCACGGCCCACNONE 
J065153G09CCACGGCCCACNONE 
J065171H07CCACGGCCCACNONE 
J065172M23CCACGGCCCACNONE 
J065173K13CCACGGCCCACNONE 
J065177D22CCACGGCCCACNONE 
J065189H10CCACGGCCCACNONE 
J065198H24CCACGGCCCACNONE 
J065204D19CCACGGCCCACNONE 
J075006C08CCACGGCCCACNONE 
J075029I08CCACGGCCCACNONE 
J075039A16CCACGGCCCACNONE 
J075107I24CCACGGCCCACNONE 
J075135M22CCACGGCCCACNONE 
J075181P06CCACGGCCCACNONE 
J075190O11CCACGGCCCACNONE 
J075193F04CCACGGCCCACNONE 
Os04g0549300AK063296GCCCACCACGGCCSimilar to GA protein (Fragment). 
J065073I11GCCCACCACGGCCNONE 
J065172C13GCCCACCACGGCCNONE 
J090004B10GCCCACCACGGCCNONE 
J090039N18GCCCACCACGGCCNONE 
J090088F09GCCCACCACGGCCNONE 
Os04g0591000006-090-E02GGCCGTGGNONE 
AK072902GGCCGTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23GGCCGTGGNONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0610500006-115-C07GGCCGTGGNONE 
AK066289GGCCGTGGPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817GGCCGTGGNONE 
J013096N09GGCCGTGGNONE 
J023054I11GGCCGTGGNONE 
J023121P20GGCCGTGGNONE 
J053039O20GGCCGTGGNONE 
J053071L20GGCCGTGGNONE 
J053088H23GGCCGTGGNONE 
J053096J03GGCCGTGGNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-097-D05AAATGGGCCGTGGNONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
J013035J20AAATGGGCCGTGGNONE 
Os04g0649100009-130-C08CCACGGCCNONE 
J013131A17CCACGGCCNONE 
Os04g0656100015-034-C11GGCCGTGGNONE 
015-051-F12GGCCGTGGNONE 
016-038-H09GGCCGTGGNONE 
AK073066GGCCGTGGNONE 
AK105082GGCCGTGGNONE 
AY224445GGCCGTGGNONE 
J043029M08GGCCGTGGNONE 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075157N21CCACGGCCCACGGNONE 
Os04g0663800013-021-G09CCACGGCCNONE 
013-021-G09CCACGGCCNONE 
AK105321CCACGGCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
AK105321CCACGGCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0674800AK119913CCACGGCCSimilar to CEL1=CELLULASE 1 (Fragment). 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0130600009-059-G05GGCCGTGGNONE 
009-084-F08GGCCGTGGNONE 
009-173-H08GGCCGTGGNONE 
009-196-F07GGCCGTGGNONE 
009-200-E06GGCCGTGGNONE 
AK063251GGCCGTGGConserved hypothetical protein. 
J075099A02GGCCGTGGNONE 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
Os05g0203900AK069504GGTCCACGGCCConserved hypothetical protein. 
J023019E20GGTCCACGGCCNONE 
Os05g0272900AK107093GGCCGTGGB-cell receptor-associated 31-like family protein. 
J065214G16GGCCGTGGNONE 
J100022C20GGCCGTGGNONE 
J100040B08GGCCGTGGNONE 
J100088C21GGCCGTGGNONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0357200014-046-H09TCGTGGGCCCCACGGCCNONE 
AK064069TCGTGGGCCCCACGGCCNONE 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
J065038M01TCGTGGGCCCCACGGCCNONE 
J065121C16TCGTGGGCCCCACGGCCNONE 
J075173E09TCGTGGGCCCCACGGCCNONE 
J080307A20TCGTGGGCCCCACGGCCNONE 
J090046B19TCGTGGGCCCCACGGCCNONE 
J100033N12TCGTGGGCCCCACGGCCNONE 
J100036G01TCGTGGGCCCCACGGCCNONE 
J100057B19TCGTGGGCCCCACGGCCNONE 
Os05g0397300009-051-E02GGGGCCCACGGCCNONE 
009-060-E03GGGGCCCACGGCCNONE 
009-075-B01GGGGCCCACGGCCNONE 
009-082-B11GGGGCCCACGGCCNONE 
009-136-D05GGGGCCCACGGCCNONE 
AK062621GGGGCCCACGGCCNONE 
AK066003GGGGCCCACGGCCNONE 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
J023066C05GGGGCCCACGGCCNONE 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0408200AK100057CCACGGCCACCAACSBP domain containing protein. 
J065182F20CCACGGCCACCAACNONE 
Os05g0430200J090095K16GGTCCACGGCCNONE 
Os05g0443300Os05g0443300GGGCTTGGCCGTGGSec23/Sec24 trunk region domain containing protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0477600006-063-A11GGCCGTGGNONE 
006-084-B09GGCCGTGGNONE 
006-088-C08GGCCGTGGNONE 
006-100-D02GGCCGTGGNONE 
011-038-C05GGCCGTGGNONE 
AK100179GGCCGTGGAlpha-expansin OsEXPA4. 
J023029P10GGCCGTGGNONE 
J043012I16GGCCGTGGNONE 
U85246GGCCGTGGNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0495100AK108028CCTGGGCCGTGGConserved hypothetical protein. 
Os05g0534800Os05g0534800CCACGGCCArf GTPase activating protein family protein. 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0548800009-070-B06GGCCGTGGNONE 
AK062554GGCCGTGGAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0577200AK069756TGATGGGCCGTGGCarboxylesterase, type B family protein. 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0268800AK120796CCACGGCCProtein of unknown function UPF0005 family protein. 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0650900AK071882CAACGGCCACGGCCNONE 
AK107961CAACGGCCACGGCCHeat shock protein DnaJ family protein. 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os07g0105300AK107419CCACGGCCConserved hypothetical protein. 
AK109521CCACGGCCNONE 
Os07g0301200AB110202CTTGGGCCGTGCTTGGGCCGTGGNONE 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
Os07g0418000AK060294CCACGGCCNONE 
AK065942CCACGGCCConserved hypothetical protein. 
AK105006CCACGGCCNONE 
J013047M02CCACGGCCNONE 
J023074D13CCACGGCCNONE 
J053045I08CCACGGCCNONE 
J075048C07CCACGGCCNONE 
Os07g0480900012-002-E04CCACGGCCNONE 
AK063422CCACGGCCSimilar to Cysteine protease (Fragment). 
J065073E02CCACGGCCNONE 
J065122P21CCACGGCCNONE 
J075108D13CCACGGCCNONE 
J075147K14CCACGGCCNONE 
Os07g0500300006-084-C04GGCCGTGGNONE 
009-135-G04GGCCGTGGNONE 
AK061939GGCCGTGGNONE 
AK120268GGCCGTGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J013033D11GGCCGTGGNONE 
J013043K24GGCCGTGGNONE 
J013047I20GGCCGTGGNONE 
J023148G02GGCCGTGGNONE 
J033091M05GGCCGTGGNONE 
J033109D13GGCCGTGGNONE 
J033120A18GGCCGTGGNONE 
J053045F06GGCCGTGGNONE 
J053051A20GGCCGTGGNONE 
J053059L01GGCCGTGGNONE 
J053061B17GGCCGTGGNONE 
J053089M02GGCCGTGGNONE 
J065016O03GGCCGTGGNONE 
J065076J09GGCCGTGGNONE 
J065084P13GGCCGTGGNONE 
J065187H20GGCCGTGGNONE 
J065205O10GGCCGTGGNONE 
J065216G08GGCCGTGGNONE 
J075060G14GGCCGTGGNONE 
J075105F17GGCCGTGGNONE 
J075123O11GGCCGTGGNONE 
J090051G07GGCCGTGGNONE 
J100051E03GGCCGTGGNONE 
Os07g0526600AK109058CCACGGCCEsterase/lipase/thioesterase domain containing protein. 
Os07g0544800009-021-C02GGCCGTGGNONE 
009-170-G02GGCCGTGGNONE 
009-178-H12GGCCGTGGNONE 
AK069170GGCCGTGGSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP). 
AK099127GGCCGTGGNONE 
J065088D21GGCCGTGGNONE 
J065106G19GGCCGTGGNONE 
J065156I24GGCCGTGGNONE 
J065162C10GGCCGTGGNONE 
J065211G14GGCCGTGGNONE 
J075003F05GGCCGTGGNONE 
J075046I10GGCCGTGGNONE 
J075055M11GGCCGTGGNONE 
J075074I12GGCCGTGGNONE 
J075088B06GGCCGTGGNONE 
J075091K13GGCCGTGGNONE 
J075093I10GGCCGTGGNONE 
J075097M09GGCCGTGGNONE 
J075106H11GGCCGTGGNONE 
J075121C22GGCCGTGGNONE 
J075145F05GGCCGTGGNONE 
J075173H16GGCCGTGGNONE 
J075190L07GGCCGTGGNONE 
J100063N21GGCCGTGGNONE 
J100073C24GGCCGTGGNONE 
J100085E01GGCCGTGGNONE 
J100088I23GGCCGTGGNONE 
Os07g0567700006-108-A09CCACGGCCNONE 
AK061242CCACGGCCSimilar to SCARECROW. 
AK120140CCACGGCCNONE 
J075098N22CCACGGCCNONE 
J075194P18CCACGGCCNONE 
J080054H07CCACGGCCNONE 
Os07g0568900009-083-H02GGCCGTGGNONE 
AK062660GGCCGTGGConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0618000009-079-E06GGCCGTGGNONE 
AK105179GGCCGTGGConserved hypothetical protein. 
Os07g0623300AK070292GGCCGTGGCCCAATSimilar to Splicing factor SC35. 
J023050C05GGCCGTGGCCCAATNONE 
J090025O12GGCCGTGGCCCAATNONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0647800AK102332GGGCCGTGGConserved hypothetical protein. 
Os07g0667000AK060587GGCCGTGGSimilar to Tubby-like protein 3. 
AK071159GGCCGTGGNONE 
Os07g0673900J080092A21CCACGGCCGTTTNONE 
Os07g0677300AK073616CCACGGCCNONE 
D16442CCACGGCCPeroxidase. 
J033051E10CCACGGCCNONE 
J075007M03CCACGGCCNONE 
J075018B13CCACGGCCNONE 
J075051I02CCACGGCCNONE 
J075074K03CCACGGCCNONE 
J075091M06CCACGGCCNONE 
J075145A19CCACGGCCNONE 
J075182I12CCACGGCCNONE 
J075182N18CCACGGCCNONE 
J100021I06CCACGGCCNONE 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0695400015-036-B08GGGCCGTGGNONE 
AK100615GGGCCGTGGNONE 
AK106304GGGCCGTGGKIP1-like domain containing protein. 
J023108B01GGGCCGTGGNONE 
Os08g0128200AK120428GGCCGTGGConserved hypothetical protein. 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0178800009-155-D05GGCCGTGGTGGTGGGGGAGNONE 
AK063025GGCCGTGGTGGTGGGGGAGHypothetical protein. 
Os08g0202200AK058765CCACGGCCConserved hypothetical protein. 
Os08g0327200AK069803GGCCGTGGVirulence factor, pectin lyase fold family protein. 
Os08g0409500AK109792CCACGGCCVQ domain containing protein. 
Os08g0440500AK058761CCACGGCCCATTAMIR domain containing protein. 
Os08g0547000AK120698CCACGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0547500AK065731CCACGGCCNONE 
AK102208CCACGGCCSimilar to Kinesin-like protein NACK1. 
J013060E07CCACGGCCNONE 
J013129D12CCACGGCCNONE 
Os08g0557400006-024-C02CCACGGCCCATATNONE 
AK060067CCACGGCCCATATProtein tyrosine phosphatase-like protein. 
AY224424CCACGGCCCATATNONE 
Os09g0130800AK066693GGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069947GGCCGTGGNONE 
AK099972GGCCGTGGNONE 
Os09g0134500AK065095CCACGGCCNONE 
AK074022CCACGGCCSimilar to Trithorax-like protein 1. 
J013001M12CCACGGCCNONE 
J013122N21CCACGGCCNONE 
J033024A02CCACGGCCNONE 
J033039K15CCACGGCCNONE 
J033074A15CCACGGCCNONE 
J065032I05CCACGGCCNONE 
J065087M02CCACGGCCNONE 
J065182B06CCACGGCCNONE 
J065183O07CCACGGCCNONE 
J090036I19CCACGGCCNONE 
Os09g0338400AK059171CCACGGCCCAACANONE 
AK068798CCACGGCCCAACANONE 
AK072043CCACGGCCCAACANONE 
AK098947CCACGGCCCAACASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0341500AK073913GGCCGTGGConserved hypothetical protein. 
J033076F19GGCCGTGGNONE 
J100085E04GGCCGTGGNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0372900006-044-C02GCCCCACGGCCNONE 
AK059785GCCCCACGGCCCyclin-like F-box domain containing protein. 
AK067586GCCCCACGGCCNONE 
AK100129GCCCCACGGCCNONE 
J023009I10GCCCCACGGCCNONE 
J065195A19GCCCCACGGCCNONE 
J065202M02GCCCCACGGCCNONE 
J065215H14GCCCCACGGCCNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0516600AK070780AGGTGGGCCCCACGGCCCGNONE 
AK103563AGGTGGGCCCCACGGCCCGNONE 
AY054407AGGTGGGCCCCACGGCCCGGlyoxalase II. 
J013058P06AGGTGGGCCCCACGGCCCGNONE 
J013093G04AGGTGGGCCCCACGGCCCGNONE 
J023007G05AGGTGGGCCCCACGGCCCGNONE 
J023091A08AGGTGGGCCCCACGGCCCGNONE 
J023136K23AGGTGGGCCCCACGGCCCGNONE 
J023138D20AGGTGGGCCCCACGGCCCGNONE 
J033022N20AGGTGGGCCCCACGGCCCGNONE 
J033065N15AGGTGGGCCCCACGGCCCGNONE 
J033109L23AGGTGGGCCCCACGGCCCGNONE 
J053073C08AGGTGGGCCCCACGGCCCGNONE 
J075094J24AGGTGGGCCCCACGGCCCGNONE 
J075106P21AGGTGGGCCCCACGGCCCGNONE 
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os09g0535000AK058712CCACGGCCCSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CCACGGCCCNONE 
AK069832CCACGGCCCNONE 
J100065D20CCACGGCCCNONE 
Os09g0549700J053039F06CCACGGCCCAAATNONE 
J065089F23CCACGGCCCAAATRibosomal protein L18P/L5E family protein. 
J065090G14CCACGGCCCAAATNONE 
J065093M17CCACGGCCCAAATNONE 
J065096L23CCACGGCCCAAATNONE 
J065152A18CCACGGCCCAAATNONE 
J065155H12CCACGGCCCAAATNONE 
Os09g0558200016-083-C09GGCCGTGGCGCGGGTNONE 
AK068834GGCCGTGGCGCGGGTNONE 
AK103673GGCCGTGGCGCGGGTHomeodomain-like containing protein. 
J013159M18GGCCGTGGCGCGGGTNONE 
J065022I04GGCCGTGGCGCGGGTNONE 
J065089B19GGCCGTGGCGCGGGTNONE 
Os09g0567400AK072521GGCCGTGGSimilar to Histidine-containing phosphotransfer protein. 
AK104879GGCCGTGGNONE 
AY345241GGCCGTGGNONE 
J013055N16GGCCGTGGNONE 
J023131B06GGCCGTGGNONE 
J023149P12GGCCGTGGNONE 
J033074B19GGCCGTGGNONE 
J053024J01GGCCGTGGNONE 
J053054M07GGCCGTGGNONE 
J053059A11GGCCGTGGNONE 
J053060K04GGCCGTGGNONE 
J053063F20GGCCGTGGNONE 
J053089G08GGCCGTGGNONE 
J053094D10GGCCGTGGNONE 
J065012B16GGCCGTGGNONE 
J065014F12GGCCGTGGNONE 
J065032O04GGCCGTGGNONE 
J065045J12GGCCGTGGNONE 
J065065J10GGCCGTGGNONE 
J065106C19GGCCGTGGNONE 
J065135I07GGCCGTGGNONE 
J065144G01GGCCGTGGNONE 
J065178E14GGCCGTGGNONE 
J065190M08GGCCGTGGNONE 
J065201L17GGCCGTGGNONE 
J075010O13GGCCGTGGNONE 
J075031L11GGCCGTGGNONE 
J075041A15GGCCGTGGNONE 
J075080E07GGCCGTGGNONE 
J075108A09GGCCGTGGNONE 
J075125M20GGCCGTGGNONE 
J075131L03GGCCGTGGNONE 
J075163J08GGCCGTGGNONE 
J090033B10GGCCGTGGNONE 
J090045C22GGCCGTGGNONE 
J100043J24GGCCGTGGNONE 
J100052K01GGCCGTGGNONE 
J100062C17GGCCGTGGNONE 
Os09g0573200J013027J02AGTGGGCCGTGGNONE 
J013034M08AGTGGGCCGTGGNONE 
J013037L03AGTGGGCCGTGGNONE 
J013041D10AGTGGGCCGTGGNONE 
J013042D15AGTGGGCCGTGGNONE 
J013109H17AGTGGGCCGTGGNONE 
J013132A18AGTGGGCCGTGGNONE 
J013160N13AGTGGGCCGTGGNONE 
J013169I09AGTGGGCCGTGGNONE 
J023029F18AGTGGGCCGTGGNONE 
J023041A02AGTGGGCCGTGGNONE 
J023097B14AGTGGGCCGTGGNONE 
J023142I04AGTGGGCCGTGGNONE 
J023142N06AGTGGGCCGTGGNONE 
J033023I21AGTGGGCCGTGGNONE 
J033032G15AGTGGGCCGTGGNONE 
J033042M17AGTGGGCCGTGGNONE 
J033070F09AGTGGGCCGTGGNONE 
J053063L09AGTGGGCCGTGGNONE 
J053064A09AGTGGGCCGTGGNONE 
J065073M19AGTGGGCCGTGGNONE 
J075005H11AGTGGGCCGTGGNONE 
J075026D12AGTGGGCCGTGGNONE 
J075043G07AGTGGGCCGTGGNONE 
J075084N05AGTGGGCCGTGGNONE 
J075092D05AGTGGGCCGTGGNONE 
J075110E24AGTGGGCCGTGGNONE 
J075176I05AGTGGGCCGTGGNONE 
J090009H19AGTGGGCCGTGGNONE 
J090025K11AGTGGGCCGTGGNONE 
J090049E20AGTGGGCCGTGGNONE 
J090070G02AGTGGGCCGTGGNONE 
Os11g0114700AK065865AGTGGGCCGTGGNONE 
AK066583AGTGGGCCGTGGNONE 
AK070834AGTGGGCCGTGGPAP/25A core domain containing protein. 
AK072543AGTGGGCCGTGGNONE 
Os11g0209700012-068-H08CCACGGCCNONE 
012-068-H08CCACGGCCCCCACCACNONE 
015-016-B07CCACGGCCNONE 
015-016-B07CCACGGCCCCCACCACNONE 
AK068331CCACGGCCNONE 
AK068331CCACGGCCCCCACCACNONE 
Os11g0303200J023135L01GGCCGTGGNONE 
J075074O21GGCCGTGGNONE 
Os11g0303800AK068654CCACGGCCGCCACGTConserved hypothetical protein. 
J075084L14CCACGGCCGCCACGTNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0454200012-068-B06CCACGGCCNONE 
AK063517CCACGGCCDehydrin RAB 16B. 
J065042O09CCACGGCCNONE 
J065097L16CCACGGCCNONE 
J065107F23CCACGGCCNONE 
J065157J04CCACGGCCNONE 
J065208D04CCACGGCCNONE 
J075021M18CCACGGCCNONE 
J075031A19CCACGGCCNONE 
J075095C10CCACGGCCNONE 
J075173B13CCACGGCCNONE 
J075195A20CCACGGCCNONE 
Os11g0479300AK099761CCACGGCCCCACCRabGAP/TBC domain containing protein. 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os12g0116900J023029P11CCACGGCCNONE 
J023150B17CCACGGCCNONE 
J075053O04CCACGGCCNONE 
J075152K05CCACGGCCNONE 
J075168M02CCACGGCCNONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0244500AK102026ACTGGGCCGTGGConserved hypothetical protein. 
J023014D06ACTGGGCCGTGGNONE 
J023060C12ACTGGGCCGTGGNONE 
J033080M18ACTGGGCCGTGGNONE 
J090017I22ACTGGGCCGTGGNONE 
J090023D21ACTGGGCCGTGGNONE 
J090036J05ACTGGGCCGTGGNONE 
J090053M19ACTGGGCCGTGGNONE 
Os12g0274700003-008-G09CCACGGCCNONE 
006-028-B09CCACGGCCNONE 
006-029-D12CCACGGCCNONE 
006-034-G05CCACGGCCNONE 
006-036-A02CCACGGCCNONE 
006-039-A08CCACGGCCNONE 
006-057-H10CCACGGCCNONE 
006-064-D08CCACGGCCNONE 
006-064-G03CCACGGCCNONE 
006-071-B05CCACGGCCNONE 
006-089-D01CCACGGCCNONE 
006-095-G02CCACGGCCNONE 
006-098-H02CCACGGCCNONE 
006-109-H01CCACGGCCNONE 
006-115-H09CCACGGCCNONE 
006-120-B02CCACGGCCNONE 
009-005-E08CCACGGCCNONE 
009-027-E04CCACGGCCNONE 
009-028-A10CCACGGCCNONE 
009-050-G03CCACGGCCNONE 
009-070-E05CCACGGCCNONE 
009-095-D10CCACGGCCNONE 
009-103-A05CCACGGCCNONE 
009-113-G09CCACGGCCNONE 
009-116-E08CCACGGCCNONE 
009-125-F02CCACGGCCNONE 
009-125-F09CCACGGCCNONE 
009-129-F03CCACGGCCNONE 
009-130-F01CCACGGCCNONE 
009-140-F07CCACGGCCNONE 
009-151-F07CCACGGCCNONE 
009-153-D04CCACGGCCNONE 
009-165-D08CCACGGCCNONE 
009-170-E11CCACGGCCNONE 
009-171-C01CCACGGCCNONE 
009-171-G05CCACGGCCNONE 
009-189-F07CCACGGCCNONE 
009-193-H05CCACGGCCNONE 
009-194-D08CCACGGCCNONE 
AF017364CCACGGCCNONE 
AF052305CCACGGCCNONE 
AK061611CCACGGCCNONE 
AK119219CCACGGCCNONE 
AK121444CCACGGCCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
D00643CCACGGCCNONE 
J013031F15CCACGGCCNONE 
J013037P20CCACGGCCNONE 
J013050D13CCACGGCCNONE 
J013056J24CCACGGCCNONE 
J013063C09CCACGGCCNONE 
J013071M01CCACGGCCNONE 
J013074G12CCACGGCCNONE 
J013120E19CCACGGCCNONE 
J013124M17CCACGGCCNONE 
J013127I18CCACGGCCNONE 
J013129G13CCACGGCCNONE 
J013132L16CCACGGCCNONE 
J013146M05CCACGGCCNONE 
J023044F05CCACGGCCNONE 
J023056E16CCACGGCCNONE 
J023141B14CCACGGCCNONE 
J065008E12CCACGGCCNONE 
J065010I24CCACGGCCNONE 
J065013B01CCACGGCCNONE 
J065019L16CCACGGCCNONE 
J065021E19CCACGGCCNONE 
J065027G11CCACGGCCNONE 
J065039B19CCACGGCCNONE 
J065039K03CCACGGCCNONE 
J065044I07CCACGGCCNONE 
J065047B10CCACGGCCNONE 
J065050A16CCACGGCCNONE 
J065050B15CCACGGCCNONE 
J065052H09CCACGGCCNONE 
J065053K05CCACGGCCNONE 
J065061H12CCACGGCCNONE 
J065061M13CCACGGCCNONE 
J065078M16CCACGGCCNONE 
J065083L13CCACGGCCNONE 
J065084L01CCACGGCCNONE 
J065091O21CCACGGCCNONE 
J065095D06CCACGGCCNONE 
J065095J12CCACGGCCNONE 
J065097I18CCACGGCCNONE 
J065114N19CCACGGCCNONE 
J065118P09CCACGGCCNONE 
J065123D11CCACGGCCNONE 
J065123F08CCACGGCCNONE 
J065124B04CCACGGCCNONE 
J065128C04CCACGGCCNONE 
J065137J07CCACGGCCNONE 
J065165K23CCACGGCCNONE 
J065183D22CCACGGCCNONE 
J065195B17CCACGGCCNONE 
J065201N18CCACGGCCNONE 
J065204K15CCACGGCCNONE 
J065208F08CCACGGCCNONE 
J075011P21CCACGGCCNONE 
J075020D18CCACGGCCNONE 
J075028H08CCACGGCCNONE 
J075065H14CCACGGCCNONE 
J075069O11CCACGGCCNONE 
J075071P10CCACGGCCNONE 
J075177C11CCACGGCCNONE 
J080002E12CCACGGCCNONE 
J080002F23CCACGGCCNONE 
J080002J09CCACGGCCNONE 
J080003L11CCACGGCCNONE 
J080004C05CCACGGCCNONE 
J080004E12CCACGGCCNONE 
J080004L13CCACGGCCNONE 
J080006E06CCACGGCCNONE 
J080006H14CCACGGCCNONE 
J080008B07CCACGGCCNONE 
J080008C21CCACGGCCNONE 
J080008G01CCACGGCCNONE 
J080008I09CCACGGCCNONE 
J080008J10CCACGGCCNONE 
J080008O08CCACGGCCNONE 
J080009C10CCACGGCCNONE 
J080009M22CCACGGCCNONE 
J080009O11CCACGGCCNONE 
J080009P22CCACGGCCNONE 
J080010B11CCACGGCCNONE 
J080010K04CCACGGCCNONE 
J080011F13CCACGGCCNONE 
J080013K07CCACGGCCNONE 
J080014H24CCACGGCCNONE 
J080015A13CCACGGCCNONE 
J080015G11CCACGGCCNONE 
J080015N21CCACGGCCNONE 
J080016N04CCACGGCCNONE 
J080018I15CCACGGCCNONE 
J080018O22CCACGGCCNONE 
J080020N07CCACGGCCNONE 
J080021F19CCACGGCCNONE 
J080021K02CCACGGCCNONE 
J080023E20CCACGGCCNONE 
J080025M08CCACGGCCNONE 
J080026E10CCACGGCCNONE 
J080027M18CCACGGCCNONE 
J080029C04CCACGGCCNONE 
J080030A07CCACGGCCNONE 
J080030A13CCACGGCCNONE 
J080030D14CCACGGCCNONE 
J080030D18CCACGGCCNONE 
J080031H14CCACGGCCNONE 
J080031N07CCACGGCCNONE 
J080032B12CCACGGCCNONE 
J080036N19CCACGGCCNONE 
J080036O03CCACGGCCNONE 
J080038J23CCACGGCCNONE 
J080040D10CCACGGCCNONE 
J080040E08CCACGGCCNONE 
J080041K04CCACGGCCNONE 
J080042F24CCACGGCCNONE 
J080042H22CCACGGCCNONE 
J080042H23CCACGGCCNONE 
J080044N24CCACGGCCNONE 
J080045F16CCACGGCCNONE 
J080046C04CCACGGCCNONE 
J080046C19CCACGGCCNONE 
J080046L07CCACGGCCNONE 
J080046M19CCACGGCCNONE 
J080048N16CCACGGCCNONE 
J080048P05CCACGGCCNONE 
J080049N15CCACGGCCNONE 
J080050G22CCACGGCCNONE 
J080052A09CCACGGCCNONE 
J080052J01CCACGGCCNONE 
J080053N04CCACGGCCNONE 
J080055K09CCACGGCCNONE 
J080056N06CCACGGCCNONE 
J080057G09CCACGGCCNONE 
J080058E22CCACGGCCNONE 
J080059E04CCACGGCCNONE 
J080061F19CCACGGCCNONE 
J080062C19CCACGGCCNONE 
J080062E15CCACGGCCNONE 
J080063M12CCACGGCCNONE 
J080063P12CCACGGCCNONE 
J080064F02CCACGGCCNONE 
J080064O16CCACGGCCNONE 
J080065E22CCACGGCCNONE 
J080066C18CCACGGCCNONE 
J080068E10CCACGGCCNONE 
J080068O13CCACGGCCNONE 
J080069A09CCACGGCCNONE 
J080069M24CCACGGCCNONE 
J080071B21CCACGGCCNONE 
J080071C23CCACGGCCNONE 
J080072H01CCACGGCCNONE 
J080072I16CCACGGCCNONE 
J080074D12CCACGGCCNONE 
J080075F18CCACGGCCNONE 
J080075J08CCACGGCCNONE 
J080075N24CCACGGCCNONE 
J080076L02CCACGGCCNONE 
J080076L21CCACGGCCNONE 
J080077E23CCACGGCCNONE 
J080079M18CCACGGCCNONE 
J080080B19CCACGGCCNONE 
J080080H19CCACGGCCNONE 
J080080L11CCACGGCCNONE 
J080081L18CCACGGCCNONE 
J080082N16CCACGGCCNONE 
J080083M19CCACGGCCNONE 
J080084C20CCACGGCCNONE 
J080084M05CCACGGCCNONE 
J080085O19CCACGGCCNONE 
J080086E02CCACGGCCNONE 
J080087B17CCACGGCCNONE 
J080088G21CCACGGCCNONE 
J080088M20CCACGGCCNONE 
J080089H02CCACGGCCNONE 
J080090F01CCACGGCCNONE 
J080090O03CCACGGCCNONE 
J080091F10CCACGGCCNONE 
J080091F21CCACGGCCNONE 
J080091G07CCACGGCCNONE 
J080091H02CCACGGCCNONE 
J080092C01CCACGGCCNONE 
J080092C08CCACGGCCNONE 
J080092H03CCACGGCCNONE 
J080092L08CCACGGCCNONE 
J080094F04CCACGGCCNONE 
J080094H13CCACGGCCNONE 
J080095B19CCACGGCCNONE 
J080096G21CCACGGCCNONE 
J080096M14CCACGGCCNONE 
J080097M21CCACGGCCNONE 
J080308I23CCACGGCCNONE 
J080319A21CCACGGCCNONE 
J090009G07CCACGGCCNONE 
J090015E19CCACGGCCNONE 
L22155CCACGGCCNONE 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein. 
AK069292AACGGCCCACGGCCCACGTNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.