version

Summary of OsREG522 (All List)

OrganismOryza sativa  
IDOsREG522  
SequenceCCACTGAC  
Annotation  
PPDB Motif 
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count924  

Entry Sequences (924 entries)

LocusGene modelSequenceDescription
Os01g0145200J100017K24TGTCAGTGGNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0272600015-046-G06CCACTGACANONE 
AK067786CCACTGACAConserved hypothetical protein. 
Os01g0276900009-014-B04TGTCAGTGGNONE 
AK105130TGTCAGTGGConserved hypothetical protein. 
Os01g0293100AK106850GTCAGTGGGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0532200AK070288CCACTGACNONE 
AK105807CCACTGACFF domain containing protein. 
J090026N08CCACTGACNONE 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE 
009-057-C09TGCGGGCCCCACTGACNONE 
009-130-C01TGCGGGCCCCACTGACNONE 
AK062906TGCGGGCCCCACTGACNONE 
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCCCACTGACNONE 
J013073D14TGCGGGCCCCACTGACNONE 
J023014A21TGCGGGCCCCACTGACNONE 
J023073M13TGCGGGCCCCACTGACNONE 
J023079F02TGCGGGCCCCACTGACNONE 
J023083B16TGCGGGCCCCACTGACNONE 
J023090G19TGCGGGCCCCACTGACNONE 
J023095F15TGCGGGCCCCACTGACNONE 
J023119H11TGCGGGCCCCACTGACNONE 
J033040B01TGCGGGCCCCACTGACNONE 
J033044F13TGCGGGCCCCACTGACNONE 
J033081E23TGCGGGCCCCACTGACNONE 
J033121K07TGCGGGCCCCACTGACNONE 
J033124D11TGCGGGCCCCACTGACNONE 
J033131N22TGCGGGCCCCACTGACNONE 
J065179E10TGCGGGCCCCACTGACNONE 
J090020A13TGCGGGCCCCACTGACNONE 
J090045K17TGCGGGCCCCACTGACNONE 
J090047M24TGCGGGCCCCACTGACNONE 
J090064G23TGCGGGCCCCACTGACNONE 
J090084G08TGCGGGCCCCACTGACNONE 
J090086F18TGCGGGCCCCACTGACNONE 
J100032D09TGCGGGCCCCACTGACNONE 
J100037O18TGCGGGCCCCACTGACNONE 
J100042B03TGCGGGCCCCACTGACNONE 
J100061D06TGCGGGCCCCACTGACNONE 
J100061I03TGCGGGCCCCACTGACNONE 
J100063B17TGCGGGCCCCACTGACNONE 
Os01g0649900AK068077CCACTGACLipolytic enzyme, G-D-S-L family protein. 
Os01g0663300AK071667CCACTGACASimilar to (1-4)-beta-mannan endohydrolase-like protein. 
J023055F22CCACTGACANONE 
J023105N15CCACTGACANONE 
J090042C10CCACTGACANONE 
Os01g0673800AK072055CCACTGACNONE 
AK099934CCACTGACConserved hypothetical protein. 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0846600AK070193CCACTGACAProtein of unknown function DUF248, methyltransferase putative family protein. 
J023041I24CCACTGACANONE 
J065002B03CCACTGACANONE 
J065140C09CCACTGACANONE 
J090052A18CCACTGACANONE 
J090081O13CCACTGACANONE 
J100056L06CCACTGACANONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0961200011-099-H06CCACTGACAGGNONE 
AK105424CCACTGACAGGCBS domain containing protein. 
J065169J18CCACTGACAGGNONE 
J075109H12CCACTGACAGGNONE 
Os01g0971100009-033-D02GTCAGTGGNONE 
AK069516GTCAGTGGDrought induced 19 family protein. 
J023022E04GTCAGTGGNONE 
J023067L15GTCAGTGGNONE 
J023110D22GTCAGTGGNONE 
J075034M07GTCAGTGGNONE 
J075107K18GTCAGTGGNONE 
J075172M23GTCAGTGGNONE 
J100067J03GTCAGTGGNONE 
Os01g0976800J065105P05CCCACTCCCACTGACZinc finger, GATA-type domain containing protein. 
J065189M03CCCACTCCCACTGACNONE 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0133900AK107180GTCAGTGGProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0491400AK073233CCACTGACSimilar to Peptidylprolyl isomerase. 
J090046J15CCACTGACNONE 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0608500AK071922CCACTGACANONE 
AK099756CCACTGACASimilar to Ankyrin-kinase protein (Fragment). 
Os02g0613200AK064869GCCCCCACTGACNONE 
AK065051GCCCCCACTGACNONE 
AK098853GCCCCCACTGACConserved hypothetical protein. 
AK098974GCCCCCACTGACNONE 
J013000H15GCCCCCACTGACNONE 
J013001I18GCCCCCACTGACNONE 
J013022I18GCCCCCACTGACNONE 
J013025D06GCCCCCACTGACNONE 
J013037H17GCCCCCACTGACNONE 
J013043F22GCCCCCACTGACNONE 
J013075E01GCCCCCACTGACNONE 
J013088D09GCCCCCACTGACNONE 
J013088E19GCCCCCACTGACNONE 
J013102O18GCCCCCACTGACNONE 
J013110C08GCCCCCACTGACNONE 
J013118C06GCCCCCACTGACNONE 
J013119F22GCCCCCACTGACNONE 
J013128K14GCCCCCACTGACNONE 
J013158C17GCCCCCACTGACNONE 
J023013P15GCCCCCACTGACNONE 
J023044L21GCCCCCACTGACNONE 
J033023I04GCCCCCACTGACNONE 
J033038I22GCCCCCACTGACNONE 
J033095M02GCCCCCACTGACNONE 
J043022F05GCCCCCACTGACNONE 
J080307N20GCCCCCACTGACNONE 
J080315C02GCCCCCACTGACNONE 
J080316A15GCCCCCACTGACNONE 
J080316G03GCCCCCACTGACNONE 
J090029E24GCCCCCACTGACNONE 
J090031H15GCCCCCACTGACNONE 
J090034F13GCCCCCACTGACNONE 
J090047G02GCCCCCACTGACNONE 
J090069M24GCCCCCACTGACNONE 
J100052E15GCCCCCACTGACNONE 
Os02g0625500011-025-C06GTCAGTGGNONE 
AB050624GTCAGTGGNONE 
AK059188GTCAGTGGNONE 
AK059771GTCAGTGGNONE 
AK101791GTCAGTGGSimilar to Adenosine kinase-like protein (Fragment). 
AY224510GTCAGTGGNONE 
J013152H02GTCAGTGGNONE 
J023012P09GTCAGTGGNONE 
J023127D16GTCAGTGGNONE 
J033024G01GTCAGTGGNONE 
J033025L19GTCAGTGGNONE 
J033080M04GTCAGTGGNONE 
J033101A08GTCAGTGGNONE 
J033121L12GTCAGTGGNONE 
J043017N15GTCAGTGGNONE 
J065207J01GTCAGTGGNONE 
J090049G12GTCAGTGGNONE 
J100036A07GTCAGTGGNONE 
J100076C04GTCAGTGGNONE 
J100080N22GTCAGTGGNONE 
Os02g0686700AK111294CCACTGACProtein of unknown function DUF581 family protein. 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0735200015-035-A06CCACTGACANONE 
015-048-A05CCACTGACANONE 
015-091-A06CCACTGACANONE 
016-082-G07CCACTGACANONE 
016-086-G04CCACTGACANONE 
AB037595CCACTGACANONE 
AK061157CCACTGACANONE 
AK071969CCACTGACANONE 
AK104987CCACTGACANONE 
AK109397CCACTGACAGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28). 
X14245CCACTGACANONE 
Os02g0759500AK072404TGTCAGTGGProtein prenyltransferase domain containing protein. 
AK110954TGTCAGTGGNONE 
J023077D13TGTCAGTGGNONE 
J065053L15TGTCAGTGGNONE 
J065087D20TGTCAGTGGNONE 
Os02g0761600AK120494CCACTGACAConserved hypothetical protein. 
Os02g0766700AK072062ATCCCCCACACCACTGACASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09ATCCCCCACACCACTGACANONE 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0804300006-046-D12CCACTGACNONE 
AK060165CCACTGACNONE 
Os03g0124100AK107007CCACTGACFringe-like family protein. 
Os03g0124200AK102524GTCAGTGGSimilar to Pto-like protein kinase F. 
AK105735GTCAGTGGNONE 
J033096A14GTCAGTGGNONE 
J090082I09GTCAGTGGNONE 
Os03g0206400AK066494CCACTGACAConserved hypothetical protein. 
AK107011CCACTGACANONE 
J065162G04CCACTGACANONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0238800AY224467CCACTGACAConserved hypothetical protein. 
J013042E23CCACTGACANONE 
Os03g0245500AK064707ATCCCCCACTGACACurculin-like (mannose-binding) lectin domain containing protein. 
J100045N08ATCCCCCACTGACANONE 
Os03g0254700AK112052CCACTGACNONE 
Os03g0283100006-097-E01CCACTGACNONE 
AK061849CCACTGACNONE 
AK065887CCACTGACSimilar to In2-1 protein. 
J013044J05CCACTGACNONE 
J013130I02CCACTGACNONE 
J013162M18CCACTGACNONE 
J023014O17CCACTGACNONE 
J023139N17CCACTGACNONE 
Os03g0322200009-102-F01CCACTGACANONE 
009-144-G06CCACTGACANONE 
016-048-D06CCACTGACANONE 
AK062978CCACTGACAConserved hypothetical protein. 
Os03g0326200AK099837CCACTGACNONE 
AK108821CCACTGACSimilar to Phospholipid-transporting ATPase 1 (EC 3.6.3.1) (Aminophospholipid flippase 1). 
J065001D06CCACTGACNONE 
J065037M19CCACTGACNONE 
Os03g0340500012-007-F10CCACTGACANONE 
012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406CCACTGACANONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158CCACTGACASimilar to Sucrose synthase (EC 2.4.1.13). 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CCACTGACANONE 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02CCACTGACANONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02CCACTGACANONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07CCACTGACANONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05CCACTGACANONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05CCACTGACANONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16CCACTGACANONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19CCACTGACANONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24CCACTGACANONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01CCACTGACANONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22CCACTGACANONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13CCACTGACANONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15CCACTGACANONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21CCACTGACANONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09CCACTGACANONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06CCACTGACANONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17CCACTGACANONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10CCACTGACANONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05CCACTGACANONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0687000004-020-F11GTCAGTGGNONE 
AK065253GTCAGTGGConserved hypothetical protein. 
AK099321GTCAGTGGNONE 
AK099910GTCAGTGGNONE 
AK104378GTCAGTGGNONE 
J013002J10GTCAGTGGNONE 
J013096H20GTCAGTGGNONE 
J023012P19GTCAGTGGNONE 
J043027G24GTCAGTGGNONE 
Os03g0712800AK063913CCACTGACSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290CCACTGACNONE 
J023127P21CCACTGACNONE 
Os03g0735000AK069296CCACTGACSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment). 
Os03g0780400011-100-D09CCACTGACANONE 
AK061347CCACTGACANONE 
AK073162CCACTGACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCACTGACANONE 
J065045I07CCACTGACANONE 
J090036F17CCACTGACANONE 
J090077M14CCACTGACANONE 
J100055G20CCACTGACANONE 
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE 
014-009-H06CCACTGACAAGTGGGTCCCNONE 
014-025-G05CCACTGACAAGTGGGTCCCNONE 
014-033-G02CCACTGACAAGTGGGTCCCNONE 
014-038-G06CCACTGACAAGTGGGTCCCNONE 
014-047-H10CCACTGACAAGTGGGTCCCNONE 
014-054-H04CCACTGACAAGTGGGTCCCNONE 
014-055-F05CCACTGACAAGTGGGTCCCNONE 
014-075-E04CCACTGACAAGTGGGTCCCNONE 
014-084-B02CCACTGACAAGTGGGTCCCNONE 
014-087-F10CCACTGACAAGTGGGTCCCNONE 
014-098-D02CCACTGACAAGTGGGTCCCNONE 
014-099-B04CCACTGACAAGTGGGTCCCNONE 
014-100-H10CCACTGACAAGTGGGTCCCNONE 
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein. 
AK102425CCACTGACAAGTGGGTCCCNONE 
J065134M15CCACTGACAAGTGGGTCCCNONE 
J090053B16CCACTGACAAGTGGGTCCCNONE 
Os03g0823500AK058972CCACTGACTGF-beta receptor, type I/II extracellular region family protein. 
AK099193CCACTGACNONE 
J023109G05CCACTGACNONE 
J023114H09CCACTGACNONE 
J065017L13CCACTGACNONE 
J065093G04CCACTGACNONE 
J065218D16CCACTGACNONE 
J090036G14CCACTGACNONE 
Os03g0832600AK120137CCACTGACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
Os04g0384000009-095-E04GTCAGTGGNONE 
AK062717GTCAGTGGNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0474500AK062029CCACTGACNONE 
AK065793CCACTGACSimilar to Cyanogenic beta-glucosidase precursor (EC 3.2.1.21) (Linamarase) (Fragment). 
J013068M03CCACTGACNONE 
J013089M14CCACTGACNONE 
J065131H24CCACTGACNONE 
Os04g0476800AK070908CCACTGACSimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0503500AK099404CCACTGACALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CCACTGACANONE 
Os04g0537800AK103654CCACTGACProtein of unknown function DUF26 domain containing protein. 
J023003K20CCACTGACNONE 
J023007K15CCACTGACNONE 
J023041L14CCACTGACNONE 
J033135E09CCACTGACNONE 
Os04g0549300AK063296CCACTGACASimilar to GA protein (Fragment). 
J065073I11CCACTGACANONE 
J065172C13CCACTGACANONE 
J090004B10CCACTGACANONE 
J090039N18CCACTGACANONE 
J090088F09CCACTGACANONE 
Os04g0606800009-159-H11GTCAGTGGNONE 
009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824GTCAGTGGConserved hypothetical protein. 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06GTCAGTGGNONE 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03GTCAGTGGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05GTCAGTGGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01GTCAGTGGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0610500006-115-C07CCACTGACNONE 
AK066289CCACTGACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817CCACTGACNONE 
J013096N09CCACTGACNONE 
J023054I11CCACTGACNONE 
J023121P20CCACTGACNONE 
J053039O20CCACTGACNONE 
J053071L20CCACTGACNONE 
J053088H23CCACTGACNONE 
J053096J03CCACTGACNONE 
Os04g0636100003-115-H08GTCAGTGGATGGGNONE 
AK067760GTCAGTGGATGGGGlycosyl transferase, family 8 protein. 
J013119I03GTCAGTGGATGGGNONE 
J075092K10GTCAGTGGATGGGNONE 
Os04g0687900009-068-D03CCACTGACACGTGGGNONE 
015-097-H12CCACTGACACGTGGGNONE 
AK062547CCACTGACACGTGGGNONE 
AK066910CCACTGACACGTGGGNONE 
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333CCACTGACACGTGGGNONE 
J013023N16CCACTGACACGTGGGNONE 
J013031I07CCACTGACACGTGGGNONE 
J013063L06CCACTGACACGTGGGNONE 
J013091C11CCACTGACACGTGGGNONE 
J013123M06CCACTGACACGTGGGNONE 
J013126D14CCACTGACACGTGGGNONE 
J023023E09CCACTGACACGTGGGNONE 
J023039C19CCACTGACACGTGGGNONE 
J023068D23CCACTGACACGTGGGNONE 
J023080C21CCACTGACACGTGGGNONE 
J033092J17CCACTGACACGTGGGNONE 
J033112P12CCACTGACACGTGGGNONE 
J033135O08CCACTGACACGTGGGNONE 
J053023C13CCACTGACACGTGGGNONE 
J065030O05CCACTGACACGTGGGNONE 
J065065P07CCACTGACACGTGGGNONE 
J065190O06CCACTGACACGTGGGNONE 
J090011M19CCACTGACACGTGGGNONE 
J090061F08CCACTGACACGTGGGNONE 
J090064H09CCACTGACACGTGGGNONE 
J090064P11CCACTGACACGTGGGNONE 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0116500AK102231GTCAGTGGConserved hypothetical protein. 
J033088A05GTCAGTGGNONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0148600003-016-C11CCACTGACAGGNONE 
AK066168CCACTGACAGGNONE 
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter. 
AY360145CCACTGACAGGNONE 
J013055J22CCACTGACAGGNONE 
J013057M24CCACTGACAGGNONE 
J013074N03CCACTGACAGGNONE 
J013158A22CCACTGACAGGNONE 
J075118H09CCACTGACAGGNONE 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0163700AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
Os05g0300700014-079-G07TAGGCCCACTGACNONE 
AK063728TAGGCCCACTGACNONE 
AK067846TAGGCCCACTGACConserved hypothetical protein. 
Os05g0319800AK100483TGTCAGTGGSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6). 
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE 
AK064069CCACTGACACGTGGACCNONE 
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein. 
J065038M01CCACTGACACGTGGACCNONE 
J065121C16CCACTGACACGTGGACCNONE 
J075173E09CCACTGACACGTGGACCNONE 
J080307A20CCACTGACACGTGGACCNONE 
J090046B19CCACTGACACGTGGACCNONE 
J100033N12CCACTGACACGTGGACCNONE 
J100036G01CCACTGACACGTGGACCNONE 
J100057B19CCACTGACACGTGGACCNONE 
Os05g0361700AJ575218GTCAGTGGNONE 
AK100184GTCAGTGGSimilar to EREBP-2 protein (Fragment). 
AK111676GTCAGTGGNONE 
J013155B14GTCAGTGGNONE 
J065073N01GTCAGTGGNONE 
J065161J12GTCAGTGGNONE 
J075074A07GTCAGTGGNONE 
J100029H13GTCAGTGGNONE 
Os05g0393400AK059594GTCAGTGGNONE 
AK099875GTCAGTGGNONE 
AK100039GTCAGTGGSimilar to PAC (Fragment). 
Os05g0406800AK062566GTCAGTGGNONE 
AK099640GTCAGTGGLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GTCAGTGGNONE 
J090013F14GTCAGTGGNONE 
J090062E13GTCAGTGGNONE 
J090063D09GTCAGTGGNONE 
J090075H10GTCAGTGGNONE 
J090096E22GTCAGTGGNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0429700AK069203CCACTGACGGCTCGGCCCCACCNONE 
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0467300006-113-H02CCACTGACANONE 
AK061873CCACTGACASelT/selW/selH selenoprotein family protein. 
AK098945CCACTGACANONE 
J013050H09CCACTGACANONE 
J023108B17CCACTGACANONE 
J065189J01CCACTGACANONE 
J075011H05CCACTGACANONE 
J075019G20CCACTGACANONE 
Os05g0510100Os05g0510100CCACTGACProtein of unknown function DUF567 family protein. 
Os05g0519900AK101078TGTCAGTGGNONE 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0181500AK068950GTCAGTGGNONE 
AK100878GTCAGTGGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16GTCAGTGGNONE 
Os06g0224900AK065678TGTCAGTGGMitochodrial transcription termination factor-related family protein. 
AK105790TGTCAGTGGNONE 
Os06g0239500AK064959GTCAGTGGTGF-beta receptor, type I/II extracellular region family protein. 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0552300011-011-G12GTCAGTGGNONE 
AK101229GTCAGTGGBZR1, transcriptional repressor family protein. 
J023061O03GTCAGTGGNONE 
J033031H19GTCAGTGGNONE 
J075103K14GTCAGTGGNONE 
J075108I16GTCAGTGGNONE 
J075194I23GTCAGTGGNONE 
J090008K01GTCAGTGGNONE 
J100062P15GTCAGTGGNONE 
Os06g0604000006-085-H11CCACTGACAGNONE 
AK061163CCACTGACAGNONE 
AK066422CCACTGACAGSimilar to Ethylene response factor 1. 
J065063N22CCACTGACAGNONE 
J065099J09CCACTGACAGNONE 
J090023J05CCACTGACAGNONE 
Os06g0611500AK072708GTCAGTGGSimilar to Polygalacturonase (Fragment). 
Os06g0618000AK110866CCACTGACAConserved hypothetical protein. 
Os06g0633900Os06g0633900TGTCAGTGGEsterase/lipase/thioesterase domain containing protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0695900011-023-F07CTGTCAGTGGNONE 
J023143A16CTGTCAGTGGZinc finger, RING-type domain containing protein. 
Os06g0715500AK059749CTGTCAGTGGNONE 
AK060137CTGTCAGTGGNONE 
AK100782CTGTCAGTGGSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha). 
Os07g0106700009-004-C02GTCAGTGGGGGAGNONE 
009-037-F10GTCAGTGGGGGAGNONE 
AK060004GTCAGTGGGGGAGNONE 
AK100221GTCAGTGGGGGAGNONE 
J065041B01GTCAGTGGGGGAGNONE 
J065183O15GTCAGTGGGGGAGNONE 
J075030L24GTCAGTGGGGGAGNONE 
J075097O21GTCAGTGGGGGAGNONE 
J075109P03GTCAGTGGGGGAGNONE 
J075114J05GTCAGTGGGGGAGNONE 
J075185N04GTCAGTGGGGGAGNONE 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0209000AK059111CCACTGACGGTGGGGCCGGASimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319CCACTGACGGTGGGGCCGGANONE 
Os07g0213600AK107696CCACTGACAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CCACTGACANONE 
J100082J05CCACTGACANONE 
Os07g0256200AK072904GGACCCACTGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GGACCCACTGACNONE 
Os07g0459400AK101767GTCAGTGGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0522500AK105311TGTCAGTGGSimilar to PDR6 ABC transporter. 
Os07g0558200AK065243GTCAGTGGInositol monophosphatase family protein. 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0585800006-106-A05GTCAGTGGNONE 
AK066419GTCAGTGGNONE 
AK105064GTCAGTGGSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GTCAGTGGNONE 
J065085B08GTCAGTGGNONE 
J065099I23GTCAGTGGNONE 
J065169A01GTCAGTGGNONE 
J065187N13GTCAGTGGNONE 
J065191L18GTCAGTGGNONE 
J065194D04GTCAGTGGNONE 
J065211M09GTCAGTGGNONE 
J065212I02GTCAGTGGNONE 
J090003C10GTCAGTGGNONE 
J090025O11GTCAGTGGNONE 
J090092F10GTCAGTGGNONE 
J100055A04GTCAGTGGNONE 
J100064A01GTCAGTGGNONE 
J100080L02GTCAGTGGNONE 
Os07g0637300AF323611CCACTGACANONE 
AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACANONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACANONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0661400006-083-E05CCACTGACANONE 
006-084-B12CCACTGACANONE 
006-096-B03CCACTGACANONE 
009-013-C12CCACTGACANONE 
009-017-C10CCACTGACANONE 
009-027-A02CCACTGACANONE 
009-035-A06CCACTGACANONE 
009-047-H11CCACTGACANONE 
009-050-B11CCACTGACANONE 
009-051-C02CCACTGACANONE 
009-089-G06CCACTGACANONE 
009-091-C05CCACTGACANONE 
009-095-B11CCACTGACANONE 
009-151-C01CCACTGACANONE 
009-154-F06CCACTGACANONE 
009-169-F02CCACTGACANONE 
009-171-G01CCACTGACANONE 
009-179-F07CCACTGACANONE 
013-018-H06CCACTGACANONE 
013-024-E05CCACTGACANONE 
013-038-F09CCACTGACANONE 
013-099-F06CCACTGACANONE 
014-042-E09CCACTGACANONE 
014-086-C02CCACTGACANONE 
014-093-B08CCACTGACANONE 
015-039-G11CCACTGACANONE 
016-036-E05CCACTGACANONE 
AK068814CCACTGACANONE 
AK102682CCACTGACANONE 
AK105973CCACTGACANONE 
AK107202CCACTGACAConserved hypothetical protein. 
J053035N21CCACTGACANONE 
J053099D11CCACTGACANONE 
J065023B18CCACTGACANONE 
J065031M15CCACTGACANONE 
J065035G23CCACTGACANONE 
J065060M18CCACTGACANONE 
J065073J18CCACTGACANONE 
J065103E20CCACTGACANONE 
J065105N19CCACTGACANONE 
J065137A08CCACTGACANONE 
J065152K09CCACTGACANONE 
J065156M12CCACTGACANONE 
J065162G23CCACTGACANONE 
J065162L13CCACTGACANONE 
J065163H16CCACTGACANONE 
J065165E06CCACTGACANONE 
J065171J04CCACTGACANONE 
J065180L23CCACTGACANONE 
J065183K23CCACTGACANONE 
J065186H13CCACTGACANONE 
J065195D10CCACTGACANONE 
J065209G11CCACTGACANONE 
J075006J08CCACTGACANONE 
J075112O07CCACTGACANONE 
J080301H14CCACTGACANONE 
J100058C17CCACTGACANONE 
J100077I23CCACTGACANONE 
J100080I24CCACTGACANONE 
Os07g0691800AK058311GTCAGTGGSimilar to 26S proteasome subunit 4-like protein (26S proteasome subunit AtRPT2a). 
AK099264GTCAGTGGNONE 
AK105861GTCAGTGGNONE 
D17789GTCAGTGGNONE 
J065005K03GTCAGTGGNONE 
J065053H14GTCAGTGGNONE 
J065122H01GTCAGTGGNONE 
J075115N24GTCAGTGGNONE 
J090023C17GTCAGTGGNONE 
J090048E03GTCAGTGGNONE 
J090067G13GTCAGTGGNONE 
J100037C03GTCAGTGGNONE 
J100054H14GTCAGTGGNONE 
J100081C14GTCAGTGGNONE 
J100086K13GTCAGTGGNONE 
J100087M03GTCAGTGGNONE 
J100090M23GTCAGTGGNONE 
Os07g0694000006-033-G12CCACTGACNONE 
AK061472CCACTGACNONE 
Os08g0114400009-103-H04CCACTGACANONE 
AK063165CCACTGACAConserved hypothetical protein. 
Os08g0116400006-081-D11CCACTGACANONE 
006-090-D05CCACTGACANONE 
AK061804CCACTGACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103042CCACTGACANONE 
J033086K15CCACTGACANONE 
J065005G03CCACTGACANONE 
J065010M18CCACTGACANONE 
J065025G07CCACTGACANONE 
J065027C08CCACTGACANONE 
J065061M11CCACTGACANONE 
J065132K02CCACTGACANONE 
J065143J05CCACTGACANONE 
J065170E23CCACTGACANONE 
J065210I02CCACTGACANONE 
J090017N12CCACTGACANONE 
J090022C02CCACTGACANONE 
J090049B17CCACTGACANONE 
J090052B14CCACTGACANONE 
J090072D03CCACTGACANONE 
J100019C06CCACTGACANONE 
J100028N03CCACTGACANONE 
J100032N18CCACTGACANONE 
J100046E01CCACTGACANONE 
Os08g0128200AK120428CCACTGACAConserved hypothetical protein. 
Os08g0157900012-025-H08CCACTGACAGGNONE 
012-069-E02CCACTGACAGGNONE 
012-074-H11CCACTGACAGGNONE 
AK065294CCACTGACAGGSimilar to NAM protein. 
J013002N10CCACTGACAGGNONE 
J013042J10CCACTGACAGGNONE 
J023060K03CCACTGACAGGNONE 
J023145N12CCACTGACAGGNONE 
J033040L20CCACTGACAGGNONE 
J033044L13CCACTGACAGGNONE 
J033057C19CCACTGACAGGNONE 
J033107E01CCACTGACAGGNONE 
J033123M07CCACTGACAGGNONE 
J033136I18CCACTGACAGGNONE 
J065051P18CCACTGACAGGNONE 
J065055L08CCACTGACAGGNONE 
J065196D15CCACTGACAGGNONE 
Os08g0320100011-088-D10GTCAGTGGNONE 
AK121802GTCAGTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0374100006-043-B11GTCAGTGGNONE 
006-065-D12GTCAGTGGNONE 
006-071-B11GTCAGTGGNONE 
006-101-C05GTCAGTGGNONE 
009-159-A03GTCAGTGGNONE 
AK070541GTCAGTGGSimilar to Ubiquitin-conjugating enzyme E2 M (EC 6.3.2.19) (Ubiquitin-protein ligase M) (Ubiquitin carrier protein M) (Nedd8-conjugating enzyme Ubc12). 
AK104158GTCAGTGGNONE 
AK104511GTCAGTGGNONE 
J023056A05GTCAGTGGNONE 
J100059M16GTCAGTGGNONE 
Os08g0387500AK105106CCACTGACSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
009-168-F06GCCACGTGTCAGTGGNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK061339GCCACGTGTCAGTGGConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
AK101198GCCACGTGTCAGTGGNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J033030L06GCCACGTGTCAGTGGNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100036D08GCCACGTGTCAGTGGNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
J100052I22GCCACGTGTCAGTGGNONE 
Os08g0467400AK070501CCACTGACAZinc/iron permease family protein. 
AK102279CCACTGACANONE 
AK105607CCACTGACANONE 
Os08g0476900AK101432CCACTGACSimilar to Patatin-like protein 1. 
J033038K22CCACTGACNONE 
J065089F13CCACTGACNONE 
Os08g0500200AK059046CCACTGACGTGGTGGGCCCCACCNONE 
AK064018CCACTGACGTGGTGGGCCCCACCConserved hypothetical protein. 
J075091E11CCACTGACGTGGTGGGCCCCACCNONE 
J090039E22CCACTGACGTGGTGGGCCCCACCNONE 
J100072K15CCACTGACGTGGTGGGCCCCACCNONE 
Os08g0536300AF358777CTGGCCCACTGACANONE 
AK099722CTGGCCCACTGACASimilar to Hd1. 
J100054G13CTGGCCCACTGACANONE 
Os08g0537900016-065-F08CCACTGACNONE 
AK064252CCACTGACNONE 
J065051J18CCACTGACNONE 
J065124N12CCACTGACNONE 
J065179L23CCACTGACNONE 
J065193F20CCACTGACNONE 
J090062A17CCACTGACNONE 
J100035G03CCACTGACNONE 
J100036E08CCACTGACNONE 
J100036K06CCACTGACNONE 
J100055M04CCACTGACNONE 
Os08g0547200AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os08g0562500AK109443CCACTGACTransferase family protein. 
Os09g0280500AK106988CCACTGACASimilar to Transcription factor HBP-1b(C38) (Fragment). 
Os09g0325300011-005-H08GTCAGTGGNONE 
AK068435GTCAGTGGConserved hypothetical protein. 
AK073998GTCAGTGGNONE 
J033071H21GTCAGTGGNONE 
J065214H05GTCAGTGGNONE 
Os09g0406900012-044-F05GTCAGTGGNONE 
AK063485GTCAGTGGNONE 
AK067460GTCAGTGGConserved hypothetical protein. 
Os09g0407300AK069164CCACTGACANONE 
AK103905CCACTGACAConserved hypothetical protein. 
Os09g0416400J075067A16GTCAGTGGGCCGGAConserved hypothetical protein. 
J075104N21GTCAGTGGGCCGGANONE 
J075106F04GTCAGTGGGCCGGANONE 
J075131F08GTCAGTGGGCCGGANONE 
Os09g0463300AK060628CCACTGACNONE 
AK068942CCACTGACProtein of unknown function DUF547 domain containing protein. 
J013170B09CCACTGACNONE 
J065104J17CCACTGACNONE 
J065214B14CCACTGACNONE 
J090031M17CCACTGACNONE 
J090066H22CCACTGACNONE 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0518700AK064305CCACTGACANONE 
Os09g0529300AK066042CTGTCAGTGGGGCCCCANONE 
AY702437CTGTCAGTGGGGCCCCAConserved hypothetical protein. 
J013048L17CTGTCAGTGGGGCCCCANONE 
Os09g0558200016-083-C09GGGCGAGGCGTGGTCAGTGGNONE 
AK068834GGGCGAGGCGTGGTCAGTGGNONE 
AK103673GGGCGAGGCGTGGTCAGTGGHomeodomain-like containing protein. 
J013159M18GGGCGAGGCGTGGTCAGTGGNONE 
J065022I04GGGCGAGGCGTGGTCAGTGGNONE 
J065089B19GGGCGAGGCGTGGTCAGTGGNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os11g0112100J075033D01CCACTGACANONE 
J075074L17CCACTGACAHypothetical protein. 
J075120E08CCACTGACANONE 
Os11g0131900AK065240TGTCAGTGGGCCCCSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0137200J013093A11CCACTGACANONE 
J013093B11CCACTGACANONE 
J023131E04CCACTGACANONE 
J033128M14CCACTGACANONE 
J065169D05CCACTGACANONE 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0307300J043031F24CCACTGACNONE 
J043034A04CCACTGACWinged helix repressor DNA-binding domain containing protein. 
Os11g0437600J065181M02CCACTGACAProtein of unknown function DUF506, plant family protein. 
Os11g0544600AK064128GCCACGTCAGTGGConserved hypothetical protein. 
J075118L07GCCACGTCAGTGGNONE 
Os11g0696900J065089F22GTCAGTGGNONE 
J065097H05GTCAGTGGCupredoxin domain containing protein. 
J065109M18GTCAGTGGNONE 
J065158G09GTCAGTGGNONE 
Os12g0134000AK066940CCACTGACASimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0182200AK099737GTCAGTGGSimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0502100Os12g0502100TGTCAGTGGConserved hypothetical protein. 
Os12g0503200014-087-C11CCTGTCAGTGGNONE 
AK105377CCTGTCAGTGGNONE 
Os12g0566900AK109171CCACTGACANONE 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0631600J075087C06CCACTGACConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.