version

Summary of OsREG523 (All List)

OrganismOryza sativa  
IDOsREG523  
SequenceCCAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2777  

Entry Sequences (2777 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0102500011-064-A09CCAGCCCACCAACNONE 
015-011-E06CCAGCCCACCAACNONE 
016-083-H11CCAGCCCACCAACNONE 
AK100002CCAGCCCACCAACConserved hypothetical protein. 
J065063K05CCAGCCCACCAACNONE 
J065191H24CCAGCCCACCAACNONE 
J100079N16CCAGCCCACCAACNONE 
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0132800AK068422CCAGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0179300AB118015CCCAGCCCAGNONE 
AK066179CCCAGCCCAGConserved hypothetical protein. 
J013027I24CCCAGCCCAGNONE 
J013057C04CCCAGCCCAGNONE 
J013114A12CCCAGCCCAGNONE 
J033044D13CCCAGCCCAGNONE 
J033088C17CCCAGCCCAGNONE 
J065079P13CCCAGCCCAGNONE 
J065097I15CCCAGCCCAGNONE 
J100025A19CCCAGCCCAGNONE 
J100027L07CCCAGCCCAGNONE 
J100035E12CCCAGCCCAGNONE 
J100076G01CCCAGCCCAGNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0248800009-103-G11CCAGCCCATTTNONE 
AK062766CCAGCCCATTTConserved hypothetical protein. 
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE 
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein. 
Os01g0286600AB057749CCCAGCCCATTSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0358300AK060388AAATGGGCTGGGNONE 
AK072081AAATGGGCTGGGTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11CCCAGCCCATTTNONE 
006-083-B11CCCAGCCCATTTNONE 
006-083-C09CCCAGCCCATTTNONE 
006-088-H03CCCAGCCCATTTNONE 
006-102-H05CCCAGCCCATTTNONE 
AK061826CCCAGCCCATTTSimilar to 40S ribosomal protein S4. 
J013105M07CCCAGCCCATTTNONE 
J013155A16CCCAGCCCATTTNONE 
J033025C03CCCAGCCCATTTNONE 
J033072L20CCCAGCCCATTTNONE 
J033095I15CCCAGCCCATTTNONE 
J033105E03CCCAGCCCATTTNONE 
J033112G18CCCAGCCCATTTNONE 
J033125D09CCCAGCCCATTTNONE 
J065100L16CCCAGCCCATTTNONE 
J065176I05CCCAGCCCATTTNONE 
J090001C14CCCAGCCCATTTNONE 
J090058E15CCCAGCCCATTTNONE 
J090068F07CCCAGCCCATTTNONE 
Os01g0527700006-102-G07GTTTGGGCTGGNONE 
012-094-B11GTTTGGGCTGGNONE 
015-096-C04GTTTGGGCTGGNONE 
AK061861GTTTGGGCTGGProtoheme IX farnesyltransferase family protein. 
AK099005GTTTGGGCTGGNONE 
J013109B04GTTTGGGCTGGNONE 
J033057L14GTTTGGGCTGGNONE 
J090072H04GTTTGGGCTGGNONE 
J100030A14GTTTGGGCTGGNONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0587000AK067605CCCAGCCCASimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0590200011-100-E06CGATGGGCTGGNONE 
012-005-A05CGATGGGCTGGNONE 
AK063416CGATGGGCTGGConserved hypothetical protein. 
AK099235CGATGGGCTGGNONE 
AK105022CGATGGGCTGGNONE 
J065030D21CGATGGGCTGGNONE 
J065031C10CGATGGGCTGGNONE 
J065105A22CGATGGGCTGGNONE 
J065173M19CGATGGGCTGGNONE 
J075188F15CGATGGGCTGGNONE 
J090050C15CGATGGGCTGGNONE 
J100058K07CGATGGGCTGGNONE 
Os01g0593600AK069058CTGGGCTGGConserved hypothetical protein. 
J023004I01CTGGGCTGGNONE 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0626300016-070-G04ATATGGGCTGGNONE 
016-070-G04CCAGCCCAAACNONE 
AK122071ATATGGGCTGGSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
AK122071CCAGCCCAAACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04ATATGGGCTGGNONE 
J023108I04CCAGCCCAAACNONE 
J033117J08ATATGGGCTGGNONE 
J033117J08CCAGCCCAAACNONE 
J065007O12ATATGGGCTGGNONE 
J065007O12CCAGCCCAAACNONE 
J065020K12ATATGGGCTGGNONE 
J065020K12CCAGCCCAAACNONE 
J065142D24ATATGGGCTGGNONE 
J065142D24CCAGCCCAAACNONE 
J065157K19ATATGGGCTGGNONE 
J065157K19CCAGCCCAAACNONE 
J080307H19ATATGGGCTGGNONE 
J080307H19CCAGCCCAAACNONE 
J080311D16ATATGGGCTGGNONE 
J080311D16CCAGCCCAAACNONE 
J080316C12ATATGGGCTGGNONE 
J080316C12CCAGCCCAAACNONE 
J080316E03ATATGGGCTGGNONE 
J080316E03CCAGCCCAAACNONE 
J100033K16ATATGGGCTGGNONE 
J100033K16CCAGCCCAAACNONE 
J100042J21ATATGGGCTGGNONE 
J100042J21CCAGCCCAAACNONE 
J100051E06ATATGGGCTGGNONE 
J100051E06CCAGCCCAAACNONE 
J100071E22ATATGGGCTGGNONE 
J100071E22CCAGCCCAAACNONE 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0680900AK060690CCAGCCCANONE 
AK069379CCAGCCCADOMON related domain containing protein. 
Os01g0683400AB110983CCAGCCCAGCCNONE 
AK102997CCAGCCCAGCCSimilar to Origin recognition complex 4. 
J033116E22CCAGCCCAGCCNONE 
J090087A03CCAGCCCAGCCNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0752300AK121755CCAGCCCATATSimilar to 60S ribosomal protein L18a-1. 
J013049F10CCAGCCCATATNONE 
J013088L10CCAGCCCATATNONE 
J023020B21CCAGCCCATATNONE 
J023038M01CCAGCCCATATNONE 
J033058H15CCAGCCCATATNONE 
J033088C04CCAGCCCATATNONE 
J033115N19CCAGCCCATATNONE 
J033131H04CCAGCCCATATNONE 
J065067E05CCAGCCCATATNONE 
J065085C07CCAGCCCATATNONE 
J065095D12CCAGCCCATATNONE 
J065124B19CCAGCCCATATNONE 
J065181H07CCAGCCCATATNONE 
J065197B09CCAGCCCATATNONE 
J075090K22CCAGCCCATATNONE 
J075101P17CCAGCCCATATNONE 
J075181F13CCAGCCCATATNONE 
J075190H19CCAGCCCATATNONE 
J090004P17CCAGCCCATATNONE 
J090066I03CCAGCCCATATNONE 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0772200AK060471CCAGCCCACATranscription initiation factor IIF, beta subunit family protein. 
AK103491CCAGCCCACANONE 
J023093E05CCAGCCCACANONE 
J023101M03CCAGCCCACANONE 
J033130N17CCAGCCCACANONE 
J043021L02CCAGCCCACANONE 
J065001E22CCAGCCCACANONE 
J065070G06CCAGCCCACANONE 
J065081D15CCAGCCCACANONE 
J065123G09CCAGCCCACANONE 
J065170K04CCAGCCCACANONE 
J065187A01CCAGCCCACANONE 
J065210E10CCAGCCCACANONE 
J075172K06CCAGCCCACANONE 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0813400006-025-B06CATCCACCAGCCCAAANONE 
006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07CATCCACCAGCCCAAANONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06CATCCACCAGCCCAAANONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09CATCCACCAGCCCAAANONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11CATCCACCAGCCCAAANONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02CATCCACCAGCCCAAANONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251CATCCACCAGCCCAAANONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370CATCCACCAGCCCAAASimilar to ADP-ribosylation factor 1. 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24CATCCACCAGCCCAAANONE 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07CATCCACCAGCCCAAANONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17CATCCACCAGCCCAAANONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07CATCCACCAGCCCAAANONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05CATCCACCAGCCCAAANONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01CATCCACCAGCCCAAANONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17CATCCACCAGCCCAAANONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03CATCCACCAGCCCAAANONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20CATCCACCAGCCCAAANONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0821700AK060539CCAGCCCACCSimilar to Chitin-binding lectin 1 precursor (PL-I). 
J090069K02CCAGCCCACCNONE 
Os01g0825500AK060613AGTTGGGCTGGNONE 
AK072321AGTTGGGCTGGNONE 
AK103941AGTTGGGCTGGNodulin-like domain containing protein. 
J075053A14AGTTGGGCTGGNONE 
J075151J22AGTTGGGCTGGNONE 
J075174K14AGTTGGGCTGGNONE 
Os01g0832200004-009-E08ATTTGGGCTGGNONE 
009-103-F06ATTTGGGCTGGNONE 
AK060017ATTTGGGCTGGNONE 
AK068980ATTTGGGCTGGConserved hypothetical protein. 
J023085I24ATTTGGGCTGGNONE 
J090016I03ATTTGGGCTGGNONE 
J090078K06ATTTGGGCTGGNONE 
Os01g0833000AK067226CCAGCCCAACAProtein prenyltransferase domain containing protein. 
J013098M23CCAGCCCAACANONE 
Os01g0834900AK063898CCAGCCCAGCHypothetical protein. 
Os01g0838350J065034O10CCAGCCCATGNONE 
J065151M02CCAGCCCATGConserved hypothetical protein. 
J065187I12CCAGCCCATGNONE 
J075083I04CCAGCCCATGNONE 
J075117N03CCAGCCCATGNONE 
Os01g0838800AK066366CCAGCCCAATANONE 
AK073775CCAGCCCAATAClathrin adaptor complex, small chain family protein. 
J013067M01CCAGCCCAATANONE 
J033030I24CCAGCCCAATANONE 
J090089A10CCAGCCCAATANONE 
Os01g0850900009-089-D11CCAGCCCATGANONE 
AK063822CCAGCCCATGANONE 
AK102887CCAGCCCATGASOUL heme-binding protein family protein. 
J033112K22CCAGCCCATGANONE 
J065087B10CCAGCCCATGANONE 
J065100A05CCAGCCCATGANONE 
J075077M10CCAGCCCATGANONE 
Os01g0867900AK061366CCAGCCCAAACProtein of unknown function DUF502 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0876500J053026A07CCAGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CCAGCCCAGCNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0904500AK119437GTGGTGGGCTGGConserved hypothetical protein. 
J065022O22GTGGTGGGCTGGNONE 
J065102M14GTGGTGGGCTGGNONE 
J065192C12GTGGTGGGCTGGNONE 
Os01g0913300AK100698CCAGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07CCAGCCCAGCCNONE 
J023102B09CCAGCCCAGCCNONE 
J023102N03CCAGCCCAGCCNONE 
J023114K11CCAGCCCAGCCNONE 
J023140A21CCAGCCCAGCCNONE 
J043017F23CCAGCCCAGCCNONE 
J075058O15CCAGCCCAGCCNONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0929000AK073334CTGGGCTGGGConserved hypothetical protein. 
J033024D22CTGGGCTGGGNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0949700AK069037CCAGCCCATGGNONE 
J023004F17CCAGCCCATGGNONE 
J065063D04CCAGCCCATGGNONE 
J065196H02CCAGCCCATGGNONE 
J075198A05CCAGCCCATGGNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0972800AK110625CTGGGCTGGGNONE 
AY341842CTGGGCTGGGWRKY1 (WRKY transcription factor 17). 
AY870605CTGGGCTGGGNONE 
Os02g0102600AK060523CCAGCCCAAGNONE 
AK103103CCAGCCCAAGAnkyrin repeat containing protein. 
J033118O11CCAGCCCAAGNONE 
J033133B21CCAGCCCAAGNONE 
J033145O05CCAGCCCAAGNONE 
J065001D20CCAGCCCAAGNONE 
J065028P14CCAGCCCAAGNONE 
J065054G04CCAGCCCAAGNONE 
J065058L16CCAGCCCAAGNONE 
J065063K15CCAGCCCAAGNONE 
J065102A18CCAGCCCAAGNONE 
J065174B01CCAGCCCAAGNONE 
J065175C10CCAGCCCAAGNONE 
J065205O04CCAGCCCAAGNONE 
J075018I16CCAGCCCAAGNONE 
J075067G03CCAGCCCAAGNONE 
J075087G10CCAGCCCAAGNONE 
J075166J07CCAGCCCAAGNONE 
J075179O17CCAGCCCAAGNONE 
J090004K08CCAGCCCAAGNONE 
J090029D14CCAGCCCAAGNONE 
J090066G23CCAGCCCAAGNONE 
J090075M15CCAGCCCAAGNONE 
J090090C06CCAGCCCAAGNONE 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0160200AK109618GGCTGGGCTGGCyclin-like F-box domain containing protein. 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0173100AK066680TGGGCTGGNONE 
AK100596TGGGCTGGSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10TGGGCTGGNONE 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0184200J075194A02TTTGGGCTGGNONE 
Os02g0188500AK102004CCAGCCCACCANONE 
AK106917CCAGCCCACCAUbiquitin domain containing protein. 
J090039N13CCAGCCCACCANONE 
Os02g0192700004-020-H12AACTGGGCTGGNONE 
006-024-H06AACTGGGCTGGNONE 
006-042-F06AACTGGGCTGGNONE 
006-050-D04AACTGGGCTGGNONE 
006-059-E10AACTGGGCTGGNONE 
006-070-B02AACTGGGCTGGNONE 
006-084-A09AACTGGGCTGGNONE 
006-114-E11AACTGGGCTGGNONE 
006-117-E05AACTGGGCTGGNONE 
009-126-D11AACTGGGCTGGNONE 
AK061629AACTGGGCTGGSimilar to Thioredoxin peroxidase. 
AK065909AACTGGGCTGGNONE 
J013043E11AACTGGGCTGGNONE 
J065038I09AACTGGGCTGGNONE 
J065078C12AACTGGGCTGGNONE 
J065122O14AACTGGGCTGGNONE 
J065198H04AACTGGGCTGGNONE 
Os02g0205000AK060003CCAGCCCATCANONE 
AK073514CCAGCCCATCARibosomal protein L19 family protein. 
J065106I07CCAGCCCATCANONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0241100Os02g0241100CCAGCCCAAGProtein kinase-like domain containing protein. 
Os02g0241100TTGTGGGCTGGProtein kinase-like domain containing protein. 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0439700AK067803CCAGCCCATATPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0618250009-115-E10CCAGCCCAACCNONE 
014-076-A03CCAGCCCAACCNONE 
J065096D10CCAGCCCAACCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAGCCCAACCNONE 
J075092J11CCAGCCCAACCNONE 
J075134F02CCAGCCCAACCNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
J023056H15GCCCAGCCCAAATNONE 
Os02g0621700011-079-F10CCAGCCCATACNONE 
AK101006CCAGCCCATACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525CCAGCCCATACNONE 
J013026C02CCAGCCCATACNONE 
J013104M10CCAGCCCATACNONE 
J023003D01CCAGCCCATACNONE 
J023007H13CCAGCCCATACNONE 
J023019G09CCAGCCCATACNONE 
J023020L19CCAGCCCATACNONE 
J023022L12CCAGCCCATACNONE 
J023022O14CCAGCCCATACNONE 
J023036F16CCAGCCCATACNONE 
J023047D16CCAGCCCATACNONE 
J023052P08CCAGCCCATACNONE 
J023077C01CCAGCCCATACNONE 
J023083M06CCAGCCCATACNONE 
J023105A11CCAGCCCATACNONE 
J023117F21CCAGCCCATACNONE 
J023119D20CCAGCCCATACNONE 
J023148E03CCAGCCCATACNONE 
J023149B13CCAGCCCATACNONE 
J033029A10CCAGCCCATACNONE 
J033046L17CCAGCCCATACNONE 
J033052M04CCAGCCCATACNONE 
J033057M14CCAGCCCATACNONE 
J033066K24CCAGCCCATACNONE 
J033069K02CCAGCCCATACNONE 
J033079G14CCAGCCCATACNONE 
J033101E06CCAGCCCATACNONE 
J033116E06CCAGCCCATACNONE 
J033118L18CCAGCCCATACNONE 
J033135B13CCAGCCCATACNONE 
J033136C10CCAGCCCATACNONE 
J033136P08CCAGCCCATACNONE 
J043027B13CCAGCCCATACNONE 
J065039I03CCAGCCCATACNONE 
J065185N21CCAGCCCATACNONE 
J090008D14CCAGCCCATACNONE 
J090029K17CCAGCCCATACNONE 
J090047H20CCAGCCCATACNONE 
J090048N17CCAGCCCATACNONE 
J090085G08CCAGCCCATACNONE 
J090089F07CCAGCCCATACNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0651500AK066333CGGGTGGGCTGGGNONE 
AK121865CGGGTGGGCTGGGHypothetical protein. 
J090038J11CGGGTGGGCTGGGNONE 
Os02g0653400Os02g0653400CCCAGCCCACCTTransferase family protein. 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0668500006-056-A05CCAGCCCACGCNONE 
AK060958CCAGCCCACGCNONE 
AK071867CCAGCCCACGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAGCCCACGCNONE 
J065013J03CCAGCCCACGCNONE 
J065021P16CCAGCCCACGCNONE 
J065044B07CCAGCCCACGCNONE 
J065059E23CCAGCCCACGCNONE 
J065087N20CCAGCCCACGCNONE 
J065185I04CCAGCCCACGCNONE 
J065190G19CCAGCCCACGCNONE 
J065199C15CCAGCCCACGCNONE 
J065213L12CCAGCCCACGCNONE 
J080305C01CCAGCCCACGCNONE 
J080308C07CCAGCCCACGCNONE 
J080310F02CCAGCCCACGCNONE 
Os02g0673000AK108650CCAGCCCAATAProtein of unknown function UPF0005 family protein. 
Os02g0690600AK110831CCAGCCCATATU box domain containing protein. 
Os02g0697700AK120209TGGGCTGGConserved hypothetical protein. 
J013038N05TGGGCTGGNONE 
J013170I01TGGGCTGGNONE 
J033144L08TGGGCTGGNONE 
J033145L08TGGGCTGGNONE 
J043004E24TGGGCTGGNONE 
J065032A08TGGGCTGGNONE 
J065166F03TGGGCTGGNONE 
J075174D13TGGGCTGGNONE 
J100019I19TGGGCTGGNONE 
J100073F13TGGGCTGGNONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0725200005-020-F05CCAGCCCACAANONE 
AK058309CCAGCCCACAANONE 
AK103602CCAGCCCACAARubisco methyltransferase family protein. 
J013109C13CCAGCCCACAANONE 
J033133G01CCAGCCCACAANONE 
J075087L23CCAGCCCACAANONE 
J090073J10CCAGCCCACAANONE 
Os02g0729400J075028G02CCAGCCCAGNONE 
Os02g0732900AK065796CTGGGCTGGGProtein of unknown function DUF794, plant family protein. 
AK104342CTGGGCTGGGNONE 
Os02g0758200AK111266CCAGCCCAGCCConserved hypothetical protein. 
Os02g0759800012-036-G11CCAGCCCAAGNONE 
012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153CCAGCCCAAGSimilar to GAMYB-binding protein (Fragment). 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666CCAGCCCAAGNONE 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03CCAGCCCAAGNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02CCAGCCCAAGNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20CCAGCCCAAGNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09CCAGCCCAAGNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19CCAGCCCAAGNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16CCAGCCCAAGNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17CCAGCCCAAGNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0771700011-075-D10CCAGCCCAAGNONE 
011-086-E10CCAGCCCAAGNONE 
AK058571CCAGCCCAAGGlycoside hydrolase, family 17 protein. 
AK102185CCAGCCCAAGNONE 
J023001D03CCAGCCCAAGNONE 
J023041N11CCAGCCCAAGNONE 
J033086N13CCAGCCCAAGNONE 
J033106K14CCAGCCCAAGNONE 
J033125P22CCAGCCCAAGNONE 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0776800AB042415CCAGCCCATCCANONE 
AK072308CCAGCCCATCCAReplication protein A 70kDa. 
AK101212CCAGCCCATCCANONE 
J033031B02CCAGCCCATCCANONE 
J090004E18CCAGCCCATCCANONE 
J090084C24CCAGCCCATCCANONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os02g0831300AK106522CCAGCCCAGNONE 
J065042E05CCAGCCCAGNONE 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0119900AK058741CCAGCCCAAGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CCAGCCCAAGNONE 
J065165C24CCAGCCCAAGNONE 
J075039M05CCAGCCCAAGNONE 
Os03g0126000AK121680CTGGGCTGGSimilar to Phosphorybosyl anthranilate transferase 1. 
AY224452CTGGGCTGGNONE 
Os03g0131400015-012-D11CCAGCCCAGTANONE 
AK103714CCAGCCCAGTAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TACTGGGCTGGVitamin K epoxide reductase domain containing protein. 
Os03g0142900011-054-A05CCCAGCCCAGNONE 
AK067103CCCAGCCCAGNONE 
AK120438CCCAGCCCAGProtein of unknown function DUF946, plant family protein. 
J013097D18CCCAGCCCAGNONE 
J013098E18CCCAGCCCAGNONE 
J013099I17CCCAGCCCAGNONE 
J013108C09CCCAGCCCAGNONE 
J023045J15CCCAGCCCAGNONE 
J033034E13CCCAGCCCAGNONE 
J033095F07CCCAGCCCAGNONE 
J033102N22CCCAGCCCAGNONE 
J065016C14CCCAGCCCAGNONE 
J065034E13CCCAGCCCAGNONE 
J065065F21CCCAGCCCAGNONE 
J065159M09CCCAGCCCAGNONE 
J075012C13CCCAGCCCAGNONE 
J075017P18CCCAGCCCAGNONE 
J075018M03CCCAGCCCAGNONE 
J075021H19CCCAGCCCAGNONE 
J075070K23CCCAGCCCAGNONE 
J075077B18CCCAGCCCAGNONE 
J075085E20CCCAGCCCAGNONE 
J075090N23CCCAGCCCAGNONE 
J075137M16CCCAGCCCAGNONE 
J075151E03CCCAGCCCAGNONE 
J090042L02CCCAGCCCAGNONE 
J090060C21CCCAGCCCAGNONE 
J090089I17CCCAGCCCAGNONE 
J100024L19CCCAGCCCAGNONE 
J100025A06CCCAGCCCAGNONE 
J100033C24CCCAGCCCAGNONE 
J100052J17CCCAGCCCAGNONE 
J100063H10CCCAGCCCAGNONE 
J100073P04CCCAGCCCAGNONE 
J100075D01CCCAGCCCAGNONE 
J100077J17CCCAGCCCAGNONE 
J100087F03CCCAGCCCAGNONE 
J100087F09CCCAGCCCAGNONE 
Os03g0146300011-078-E08CCAGCCCACGCCACNONE 
014-009-B07CCAGCCCACGCCACNONE 
AK121395CCAGCCCACGCCACSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319CCAGCCCACGCCACNONE 
J013104I06CCAGCCCACGCCACNONE 
J023130M16CCAGCCCACGCCACNONE 
J053037E13CCAGCCCACGCCACNONE 
J075104M08CCAGCCCACGCCACNONE 
J075144I22CCAGCCCACGCCACNONE 
J100057B09CCAGCCCACGCCACNONE 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
Os03g0197000AK071163CCATGGGCTGGConserved hypothetical protein. 
J023079A07CCATGGGCTGGNONE 
Os03g0213800AK103114AGATGGGCTGGMitochondrial substrate carrier family protein. 
Os03g0249400009-059-H08GCTGGGCTGGNONE 
AK062522GCTGGGCTGGSimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05GCTGGGCTGGNONE 
J053052E06GCTGGGCTGGNONE 
J053061K22GCTGGGCTGGNONE 
J065108I02GCTGGGCTGGNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0269300011-021-H03CCAGCCCAGCNONE 
011-029-B01CCAGCCCAGCNONE 
AK111855CCAGCCCAGCNONE 
AK111884CCAGCCCAGCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0279600006-070-A07CCAGCCCATATNONE 
AK061080CCAGCCCATATConserved hypothetical protein. 
AK071043CCAGCCCATATNONE 
AK103191CCAGCCCATATNONE 
J065077E22CCAGCCCATATNONE 
J065208F22CCAGCCCATATNONE 
J075156K12CCAGCCCATATNONE 
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE 
014-027-E07TCCGGGCCAGCCCAACCNONE 
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase. 
J065009N21TCCGGGCCAGCCCAACCNONE 
Os03g0297400AK060653CCAGCCCACCANONE 
AK061403CCAGCCCACCANONE 
AK101597CCAGCCCACCAMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0313600AK067474ATTGGGCTGGSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0315400AK120551CCAGCCCAGCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
J013130B13CCAGCCCAGCCNONE 
J065053B05CCAGCCCAGCCNONE 
J065169H20CCAGCCCAGCCNONE 
J065169M22CCAGCCCAGCCNONE 
J100061H19CCAGCCCAGCCNONE 
Os03g0331900AK063044CCAGCCCAGNONE 
AK099570CCAGCCCAGConserved hypothetical protein. 
J065064G01CCAGCCCAGNONE 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0335100AK107094CCAGCCCAAATConserved hypothetical protein. 
Os03g0336200AK059473CATCCCCCAGCCCAGNONE 
AK070466CATCCCCCAGCCCAGTranscription factor RF2b. 
AY466471CATCCCCCAGCCCAGNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0372700AK064323TTTTGGGCTGGNONE 
AK073312TTTTGGGCTGGLow temperature viability protein family protein. 
Os03g0386000AK072984CCAGCCCATGSimilar to WD domain protein-like. 
J065009K18CCAGCCCATGNONE 
J065165P09CCAGCCCATGNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0437200006-066-E02CCAGCCCACACNONE 
AK059839CCAGCCCACACZinc finger, C2H2-type domain containing protein. 
AY295345CCAGCCCACACNONE 
Os03g0569800AK070080CCCATCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK120873CCCATCCAGCCCATTANONE 
Os03g0596800AK073603TCGTGGGCTGGConserved hypothetical protein. 
J033052N01TCGTGGGCTGGNONE 
Os03g0604600J090093K23CCAGCCCAGATGGGCTConserved hypothetical protein. 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0689300AK068765CCCAGCCCAAAAPlasma membrane H+ ATPase (EC 3.6.3.6) (H-ATPase). 
AK100996CCCAGCCCAAAANONE 
D10207CCCAGCCCAAAANONE 
J013162E15CCCAGCCCAAAANONE 
J033116I16CCCAGCCCAAAANONE 
J043027N09CCCAGCCCAAAANONE 
J075112N21CCCAGCCCAAAANONE 
J090035D23CCCAGCCCAAAANONE 
J090095G13CCCAGCCCAAAANONE 
Os03g0712600015-008-G03CCAGCCCAGNONE 
AK103705CCAGCCCAGHypothetical protein. 
J033136N14CCAGCCCAGNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0764600AK105625ATGGGCTGGHomeodomain-like containing protein. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0833500AK119356CCATGGGCTGGSimilar to 98kDa HDM allergen. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0844100AK067164CCAGCCCAACCSimilar to Pti1 kinase-like protein. 
Os03g0845700009-075-D05AGTTGGGCTGGNONE 
AK062622AGTTGGGCTGGSimilar to RPB17 (Fragment). 
J065068H03AGTTGGGCTGGNONE 
J065075A18AGTTGGGCTGGNONE 
J065118C19AGTTGGGCTGGNONE 
J075001B15AGTTGGGCTGGNONE 
J075048D11AGTTGGGCTGGNONE 
J075056D01AGTTGGGCTGGNONE 
J075092P03AGTTGGGCTGGNONE 
J075111I04AGTTGGGCTGGNONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os03g0854000009-186-C03TAATGGGCTGGNONE 
AK061374TAATGGGCTGGProtein of unknown function UPF0131 family protein. 
J065138B11TAATGGGCTGGNONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117100009-025-D02AGCCCAGCCCANONE 
009-056-D03AGCCCAGCCCANONE 
009-145-F01AGCCCAGCCCANONE 
009-146-C06AGCCCAGCCCANONE 
009-186-C05AGCCCAGCCCANONE 
AK060395AGCCCAGCCCANONE 
AK121763AGCCCAGCCCAConserved hypothetical protein. 
J033090J17AGCCCAGCCCANONE 
J065058O06AGCCCAGCCCANONE 
J065058P05AGCCCAGCCCANONE 
J065141C14AGCCCAGCCCANONE 
J065162F07AGCCCAGCCCANONE 
J065199N16AGCCCAGCCCANONE 
J065214I05AGCCCAGCCCANONE 
J075003L04AGCCCAGCCCANONE 
J075014C14AGCCCAGCCCANONE 
J075063K14AGCCCAGCCCANONE 
J075111N19AGCCCAGCCCANONE 
J075138E13AGCCCAGCCCANONE 
J075189E23AGCCCAGCCCANONE 
J080304J23AGCCCAGCCCANONE 
J080310L07AGCCCAGCCCANONE 
J080318A16AGCCCAGCCCANONE 
J100054P14AGCCCAGCCCANONE 
Os04g0118100006-100-G08CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
AK058463CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
J065078C03CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
Os04g0208400AK069629CCAGCCCACGTGCyclin-like F-box domain containing protein. 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0343900AK107841GCCCAGCCCAConserved hypothetical protein. 
Os04g0376600J033065H17GGCTGGGCTGGGNONE 
Os04g0381000AK105435CCAGCCCATAADynamin family protein. 
J075003I06CCAGCCCATAANONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0391900AK101777CCAGCCCAGCAmidohydrolase 2 family protein. 
Os04g0406600AK103609CCCAGCCCACGCPrephenate dehydratase domain containing protein. 
J033133I10CCCAGCCCACGCNONE 
J075092D11CCCAGCCCACGCNONE 
J100031M09CCCAGCCCACGCNONE 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0431000009-127-C01CCAGCCCATANONE 
Os04g0432000AB125308CCAGCCCATCCCCCSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087CCAGCCCATCCCCCNONE 
J065206O17CCAGCCCATCCCCCNONE 
Os04g0477900006-046-B01CCAGCCCANONE 
006-103-C03CCAGCCCANONE 
006-106-F09CCAGCCCANONE 
009-093-B07CCAGCCCANONE 
AK059948CCAGCCCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268CCAGCCCANONE 
J013158A11CCAGCCCANONE 
J023050E17CCAGCCCANONE 
J023078J03CCAGCCCANONE 
J033027G18CCAGCCCANONE 
J033086G10CCAGCCCANONE 
J090060G14CCAGCCCANONE 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0552400AK069623TTCGTGGGCTGGSimilar to ZPT2-13. 
J023023M18TTCGTGGGCTGGNONE 
J023063H11TTCGTGGGCTGGNONE 
Os04g0589200AK068571AGCCCAGCCCAGCCConserved hypothetical protein. 
AK102463AGCCCAGCCCAGCCNONE 
J075083K10AGCCCAGCCCAGCCNONE 
Os04g0604200013-087-H05CCAGCCCATAANONE 
AK063614CCAGCCCATAASimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0650200AK072573ATTGGGCTGGNONE 
AK109786ATTGGGCTGGLipolytic enzyme, G-D-S-L family protein. 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0665000009-149-A12TGTTGGGCTGGNONE 
AK062995TGTTGGGCTGGCHCH domain containing protein. 
J065017G19TGTTGGGCTGGNONE 
J080301G12TGTTGGGCTGGNONE 
Os04g0667000AK069874CCAGCCCATAATafazzin family protein. 
J100055P09CCAGCCCATAANONE 
J100057O12CCAGCCCATAANONE 
J100067H07CCAGCCCATAANONE 
J100070D06CCAGCCCATAANONE 
J100071J16CCAGCCCATAANONE 
J100072C15CCAGCCCATAANONE 
Os04g0682800AK121846CCAGCCCAGCCCAGCSodium/hydrogen exchanger family protein. 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0102900006-056-A01AGGTGGGCTGGGNONE 
AK061764AGGTGGGCTGGGNONE 
AK065749AGGTGGGCTGGGSnf7 family protein. 
AK104101AGGTGGGCTGGGNONE 
J013042C01AGGTGGGCTGGGNONE 
J033038P15AGGTGGGCTGGGNONE 
J065032F16AGGTGGGCTGGGNONE 
J065039I22AGGTGGGCTGGGNONE 
J065150F19AGGTGGGCTGGGNONE 
J075079I21AGGTGGGCTGGGNONE 
J075082F14AGGTGGGCTGGGNONE 
J075098G16AGGTGGGCTGGGNONE 
J075167I08AGGTGGGCTGGGNONE 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0121800AK101222CCAGCCCAAGConserved hypothetical protein. 
J033031D02CCAGCCCAAGNONE 
J065078F10CCAGCCCAAGNONE 
J065151J16CCAGCCCAAGNONE 
J065151K04CCAGCCCAAGNONE 
J090057E18CCAGCCCAAGNONE 
Os05g0123400AK069521CCAGCCCAAACConserved hypothetical protein. 
AK069521CCAGCCCATGAConserved hypothetical protein. 
J023022O05CCAGCCCAAACNONE 
J023022O05CCAGCCCATGANONE 
Os05g0140800AK110652CCAGCCCAACCSimilar to Dormancy related protein (Fragment). 
J075019K14CCAGCCCAACCNONE 
J075020O11CCAGCCCAACCNONE 
J075028P06CCAGCCCAACCNONE 
J075050A16CCAGCCCAACCNONE 
J075051F18CCAGCCCAACCNONE 
J075085K03CCAGCCCAACCNONE 
J075112P22CCAGCCCAACCNONE 
J075118I09CCAGCCCAACCNONE 
J075144H09CCAGCCCAACCNONE 
J075166I07CCAGCCCAACCNONE 
J075191J02CCAGCCCAACCNONE 
J075195I23CCAGCCCAACCNONE 
Os05g0144800AK099724CCAGCCCATCTSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0148300009-031-A08CCCAGCCCAACCNONE 
AK062421CCCAGCCCAACCRibosomal protein S27, mitochondrial family protein. 
Os05g0150300AK100732CCAGCCCAAGSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0220900AK109172CCCAGCCCAATTNONE 
AK109456CCCAGCCCAATTPrefoldin domain containing protein. 
Os05g0223200015-037-E09CCCAGCCCAAGNONE 
AK106308CCCAGCCCAAGSimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CCCAGCCCAAGNONE 
J065056N06CCCAGCCCAAGNONE 
J065080I11CCCAGCCCAAGNONE 
J065104F11CCCAGCCCAAGNONE 
J065183L10CCCAGCCCAAGNONE 
J065185H12CCCAGCCCAAGNONE 
J065186N17CCCAGCCCAAGNONE 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0316200AK060608CCAGCCCATCCANONE 
AK101705CCAGCCCATCCAConserved hypothetical protein. 
AK111481CCAGCCCATCCANONE 
Os05g0345700AK121350CCAGCCCACACConserved hypothetical protein. 
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE 
009-036-C03CGCGACGCCCCAGCCCAAGNONE 
009-040-H02CGCGACGCCCCAGCCCAAGNONE 
009-173-H12CGCGACGCCCCAGCCCAAGNONE 
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein. 
J065137N04CGCGACGCCCCAGCCCAAGNONE 
J065164C10CGCGACGCCCCAGCCCAAGNONE 
J065210H22CGCGACGCCCCAGCCCAAGNONE 
Os05g0378900AK103841CCAGCCCATCAConserved hypothetical protein. 
AK103841GTATGGGCTGGConserved hypothetical protein. 
J033148I18CCAGCCCATCANONE 
J033148I18GTATGGGCTGGNONE 
J065085F12CCAGCCCATCANONE 
J065085F12GTATGGGCTGGNONE 
J075041H24CCAGCCCATCANONE 
J075041H24GTATGGGCTGGNONE 
J075180P06CCAGCCCATCANONE 
J075180P06GTATGGGCTGGNONE 
Os05g0469900AK109700AAATGGGCTGGGConserved hypothetical protein. 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0486200009-099-B03CCAGCCCAACTNONE 
AK121022CCAGCCCAACTConserved hypothetical protein. 
J023049I09CCAGCCCAACTNONE 
J033029N07CCAGCCCAACTNONE 
J075074I18CCAGCCCAACTNONE 
Os05g0490200016-097-B03CCAGCCCAACCNONE 
AK101147CCAGCCCAACCProtein of unknown function DUF1692 domain containing protein. 
AK105601CCAGCCCAACCNONE 
J033026P06CCAGCCCAACCNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
J065037L19CCAGCCCAGNONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0531400J065101L04CCAGCCCACACGConserved hypothetical protein. 
J065130M24CCAGCCCACACGNONE 
Os05g0540100AB021666CCCAGCCCAGCCNONE 
AK060623CCCAGCCCAGCCNONE 
AK103819CCCAGCCCAGCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541500AK101190AGATGGGCTGGCyclin-like F-box domain containing protein. 
AK101531AGATGGGCTGGNONE 
J033030F10AGATGGGCTGGNONE 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0548100AK060333TGTGGGCTGGConserved hypothetical protein. 
AK100682TGTGGGCTGGNONE 
J013151E01TGTGGGCTGGNONE 
J023113L22TGTGGGCTGGNONE 
J043027A19TGTGGGCTGGNONE 
J075093E06TGTGGGCTGGNONE 
J090060D15TGTGGGCTGGNONE 
J090082J03TGTGGGCTGGNONE 
J100050E01TGTGGGCTGGNONE 
Os05g0551700AK071216CCCAGCCCAGCCtRNA isopentenyltransferase family protein. 
Os05g0552900AK102095CCAGCCCAATTMAP65/ASE1 family protein. 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0554400AK102948CCAGCCCAACANONE 
AK107427CCAGCCCAACAPhosphatidyl serine synthase family protein. 
J023089D16CCAGCCCAACANONE 
Os05g0558900AK101679ACATGGGCTGGSimilar to Frsb-prov protein. 
J013028M08ACATGGGCTGGNONE 
J013074E16ACATGGGCTGGNONE 
J013096L01ACATGGGCTGGNONE 
J023085M19ACATGGGCTGGNONE 
J033058I10ACATGGGCTGGNONE 
J033091D18ACATGGGCTGGNONE 
J033111H13ACATGGGCTGGNONE 
J033114C18ACATGGGCTGGNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0588700AK100256CCAGCCCAHistone deacetylase interacting domain containing protein. 
J023061J06CCAGCCCANONE 
Os05g0589000AK061980CCAGCCCAAGNONE 
AK099181CCAGCCCAAGConserved hypothetical protein. 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0594800AK058332CCAGCCCAGCAdhesion regulating molecule family protein. 
AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013CCAGCCCAGCNONE 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24CCAGCCCAGCNONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0113900AK067430CCCAGCCCAACCNONE 
AK102259CCCAGCCCAACCNONE 
AK120464CCCAGCCCAACCConserved hypothetical protein. 
J065144I06CCCAGCCCAACCNONE 
Os06g0119300AK067271CCAGCCCAATCCAGCCCAGProtein of unknown function DUF594 family protein. 
Os06g0129000Os06g0129000CCAGCCCACAConserved hypothetical protein. 
Os06g0134000AK102796GCCCAGCCCACCTNONE 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0163000AK069245CCCAGCCCACCTGNONE 
AK069675CCCAGCCCACCTGSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CCCAGCCCACCTGNONE 
Os06g0167600AK067977CCAGCCCATAASimilar to Proteasome subunit alpha-3 (Fragment). 
J013123K20CCAGCCCATAANONE 
J033125P19CCAGCCCATAANONE 
J065002M08CCAGCCCATAANONE 
J065045C13CCAGCCCATAANONE 
J065045J07CCAGCCCATAANONE 
J065098M04CCAGCCCATAANONE 
J065110M02CCAGCCCATAANONE 
J065113H12CCAGCCCATAANONE 
J065214E15CCAGCCCATAANONE 
Os06g0194000006-041-H12CCAGCCCATATNONE 
006-077-B02CCAGCCCATATNONE 
013-029-A09CCAGCCCATATNONE 
AF190770CCAGCCCATATNONE 
AK060742CCAGCCCATATNONE 
AK069833CCAGCCCATATSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCAGCCCATATNONE 
J013060G01CCAGCCCATATNONE 
J013069I06CCAGCCCATATNONE 
J013134D15CCAGCCCATATNONE 
J013149A16CCAGCCCATATNONE 
J023031B06CCAGCCCATATNONE 
J023074E17CCAGCCCATATNONE 
J023091C14CCAGCCCATATNONE 
J023101P18CCAGCCCATATNONE 
J023106O14CCAGCCCATATNONE 
J023110J17CCAGCCCATATNONE 
J023110N02CCAGCCCATATNONE 
J023128D07CCAGCCCATATNONE 
J033024O19CCAGCCCATATNONE 
J033068G19CCAGCCCATATNONE 
J033095G01CCAGCCCATATNONE 
J033108C12CCAGCCCATATNONE 
J033114C23CCAGCCCATATNONE 
J043003E04CCAGCCCATATNONE 
J053023J03CCAGCCCATATNONE 
J053026B01CCAGCCCATATNONE 
J065172F15CCAGCCCATATNONE 
J075036K13CCAGCCCATATNONE 
J090020A10CCAGCCCATATNONE 
J090073E10CCAGCCCATATNONE 
J100034P18CCAGCCCATATNONE 
J100048O18CCAGCCCATATNONE 
J100064K09CCAGCCCATATNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0248200Os06g0248200CCAGCCCANONE 
Os06g0304500AK119441CCAGCCCATTACRS1/YhbY domain containing protein. 
J075143M24CCAGCCCATTANONE 
J075194D03CCAGCCCATTANONE 
Os06g0332400AK058294CCAGCCCAAGNONE 
AK101738CCAGCCCAAGVHS domain containing protein. 
J013119B12CCAGCCCAAGNONE 
J013132G17CCAGCCCAAGNONE 
J023034E06CCAGCCCAAGNONE 
J023039I05CCAGCCCAAGNONE 
J033024E14CCAGCCCAAGNONE 
J033039N04CCAGCCCAAGNONE 
J033048P16CCAGCCCAAGNONE 
J033069F24CCAGCCCAAGNONE 
J033071D15CCAGCCCAAGNONE 
J033106D01CCAGCCCAAGNONE 
J033106D09CCAGCCCAAGNONE 
J033106F09CCAGCCCAAGNONE 
J033107K03CCAGCCCAAGNONE 
J033129G10CCAGCCCAAGNONE 
J065016B15CCAGCCCAAGNONE 
J065022H07CCAGCCCAAGNONE 
J065048E07CCAGCCCAAGNONE 
J065068B11CCAGCCCAAGNONE 
J065157C13CCAGCCCAAGNONE 
J100042J02CCAGCCCAAGNONE 
Os06g0351500006-083-H04CTGGGCTGGNONE 
006-090-H02CTGGGCTGGNONE 
006-113-H07CTGGGCTGGNONE 
AK061188CTGGGCTGGNONE 
AK067876CTGGGCTGGLipolytic enzyme, G-D-S-L family protein. 
AK099072CTGGGCTGGNONE 
J090059P21CTGGGCTGGNONE 
J090062K17CTGGGCTGGNONE 
Os06g0542200AK058589CCAGCCCAATANADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0556300AK063985CCCAGCCCAAGCyclin-like F-box domain containing protein. 
AK101552CCCAGCCCAAGNONE 
Os06g0581300AK070987CCAGCCCATAProtein of unknown function DUF1475 family protein. 
AK070987CCAGCCCATTProtein of unknown function DUF1475 family protein. 
AK073185CCAGCCCATANONE 
AK073185CCAGCCCATTNONE 
J065209C10CCAGCCCATANONE 
J065209C10CCAGCCCATTNONE 
J075060B03CCAGCCCATANONE 
J075060B03CCAGCCCATTNONE 
J075117M08CCAGCCCATANONE 
J075117M08CCAGCCCATTNONE 
J075126E04CCAGCCCATANONE 
J075126E04CCAGCCCATTNONE 
J075189G04CCAGCCCATANONE 
J075189G04CCAGCCCATTNONE 
J075189L16CCAGCCCATANONE 
J075189L16CCAGCCCATTNONE 
J100061E16CCAGCCCATANONE 
J100061E16CCAGCCCATTNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0683200AK060024AGTTGGGCTGGSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432AGTTGGGCTGGNONE 
J023002B12AGTTGGGCTGGNONE 
J023054E10AGTTGGGCTGGNONE 
J023123F19AGTTGGGCTGGNONE 
J065035K13AGTTGGGCTGGNONE 
J065129P09AGTTGGGCTGGNONE 
J065184B14AGTTGGGCTGGNONE 
Os06g0683400009-047-C07CCAGCCCACGCCCAACTNONE 
009-060-B06CCAGCCCACGCCCAACTNONE 
013-057-F12CCAGCCCACGCCCAACTNONE 
AK111852CCAGCCCACGCCCAACTNONE 
AK111897CCAGCCCACGCCCAACTNONE 
AK112082CCAGCCCACGCCCAACTSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CCAGCCCACGCCCAACTNONE 
J065187J11CCAGCCCACGCCCAACTNONE 
J065197L08CCAGCCCACGCCCAACTNONE 
J100045K14CCAGCCCACGCCCAACTNONE 
J100074M08CCAGCCCACGCCCAACTNONE 
J100088H21CCAGCCCACGCCCAACTNONE 
Os06g0691200AK108191CCAGCCCAGCSimilar to Thaumatin-like protein precursor. 
Os06g0711600016-047-G09TCATGGGCTGGNONE 
AK064384TCATGGGCTGGmRNA splicing factor SYF2 family protein. 
AK102831TCATGGGCTGGNONE 
J013072P18TCATGGGCTGGNONE 
J023049G01TCATGGGCTGGNONE 
J023088I01TCATGGGCTGGNONE 
J033023I22TCATGGGCTGGNONE 
J033106I12TCATGGGCTGGNONE 
J033109G07TCATGGGCTGGNONE 
J065030F22TCATGGGCTGGNONE 
J065132H19TCATGGGCTGGNONE 
J080301D07TCATGGGCTGGNONE 
J080305C09TCATGGGCTGGNONE 
J080312C03TCATGGGCTGGNONE 
J080313I15TCATGGGCTGGNONE 
J080315B09TCATGGGCTGGNONE 
J090056N21TCATGGGCTGGNONE 
J100027B07TCATGGGCTGGNONE 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os06g0731700J065089G16CTGGGCTGGGNONE 
J065157E16CTGGGCTGGGNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0154300009-070-E08CCCAGCCCAACTNONE 
009-077-E01CCCAGCCCAACTNONE 
009-196-F05CCCAGCCCAACTNONE 
AK105386CCCAGCCCAACTConserved hypothetical protein. 
AK122093CCCAGCCCAACTNONE 
J033124K14CCCAGCCCAACTNONE 
J075006I22CCCAGCCCAACTNONE 
J075185G02CCCAGCCCAACTNONE 
J090039C02CCCAGCCCAACTNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0185900009-023-G07CCCAGCCCAAGNONE 
009-105-E06CCCAGCCCAAGNONE 
009-125-B01CCCAGCCCAAGNONE 
009-169-A01CCCAGCCCAAGNONE 
AK070315CCCAGCCCAAGConserved hypothetical protein. 
J065140H13CCCAGCCCAAGNONE 
J100024L12CCCAGCCCAAGNONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0242600AK065752CCCAGCCCATATCyclin-like F-box domain containing protein. 
AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22CCCAGCCCATATNONE 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0256200AK072904GCTGGGCTGGGCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCTGGGCTGGGCTNONE 
Os07g0300200AK120733CCCAGCCCAGProtein prenyltransferase domain containing protein. 
Os07g0408100AK108466CCAGCCCAGNONE 
AK111780CCAGCCCAGWD40-like domain containing protein. 
Os07g0408700004-019-E03CCAGCCCAGNONE 
015-093-D01CCAGCCCAGNONE 
AJ251298CCAGCCCAGNONE 
AK060916CCAGCCCAGNONE 
AK099606CCAGCCCAGSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2). 
J013052G01CCAGCCCAGNONE 
Os07g0418600006-074-A11AATGGGCTGGTGGGCNONE 
009-043-A03AATGGGCTGGTGGGCNONE 
013-024-A10AATGGGCTGGTGGGCNONE 
AK105956AATGGGCTGGTGGGCConserved hypothetical protein. 
J065107I10AATGGGCTGGTGGGCNONE 
J075110E12AATGGGCTGGTGGGCNONE 
Os07g0496000AK111986CCAGCCCACCCSimilar to Nt-rab6 protein. 
J065098H22CCAGCCCACCCNONE 
J065172F22CCAGCCCACCCNONE 
J075001F01CCAGCCCACCCNONE 
J075017I20CCAGCCCACCCNONE 
J075035G14CCAGCCCACCCNONE 
J075082D07CCAGCCCACCCNONE 
J075134M14CCAGCCCACCCNONE 
J075146P21CCAGCCCACCCNONE 
J075167H19CCAGCCCACCCNONE 
J075176L08CCAGCCCACCCNONE 
J075190E06CCAGCCCACCCNONE 
J100026M06CCAGCCCACCCNONE 
J100061L07CCAGCCCACCCNONE 
J100079J12CCAGCCCACCCNONE 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0520400J065124A13AGATGGGCTGGConserved hypothetical protein. 
Os07g0568900009-083-H02CCAGCCCAGTTNONE 
AK062660CCAGCCCAGTTConserved hypothetical protein. 
Os07g0569000AK073915AACTGGGCTGGConserved hypothetical protein. 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0571100AK119301CCCAGCCCAGCConserved hypothetical protein. 
Os07g0573800AK072835CCAGCCCATTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154CCAGCCCATTNONE 
AK104308CCAGCCCATTNONE 
AK107962CCAGCCCATTNONE 
J023134F17CCAGCCCATTNONE 
J043027A09CCAGCCCATTNONE 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0583700AK070537CCCAGCCCACGCWRKY transcription factor 78. 
AY341850CCCAGCCCACGCNONE 
J013089A12CCCAGCCCACGCNONE 
J013118N13CCCAGCCCACGCNONE 
J023039L18CCCAGCCCACGCNONE 
J023062H03CCCAGCCCACGCNONE 
J100029J20CCCAGCCCACGCNONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0602600AK065696CCAGCCCAACSimilar to RNA binding protein. 
J013035K23CCAGCCCAACNONE 
Os07g0607800012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0679500AK102562CCAGCCCAATSimilar to Transcription factor RF2b. 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os08g0102000009-020-B12CCCAGCCCAATNONE 
009-068-H05CCCAGCCCAATNONE 
009-119-F03CCCAGCCCAATNONE 
009-166-A06CCCAGCCCAATNONE 
009-176-G12CCCAGCCCAATNONE 
AK068156CCCAGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0116800AK063695CCAGCCCATTExoribonuclease domain containing protein. 
Os08g0130500AK062008ATATGGGCTGGNONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0151400AK059440CCCAGCCCATCGSimilar to Small nuclear ribonucleoprotein homolog. 
Os08g0158900AK067062TTGTGGGCTGGGTP1/OBG domain containing protein. 
AK067062TTTTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTGTGGGCTGGNONE 
J013089F04TTTTGGGCTGGNONE 
J013092D16TTGTGGGCTGGNONE 
J013092D16TTTTGGGCTGGNONE 
J033120K14TTGTGGGCTGGNONE 
J033120K14TTTTGGGCTGGNONE 
J033133F24TTGTGGGCTGGNONE 
J033133F24TTTTGGGCTGGNONE 
J033145A10TTGTGGGCTGGNONE 
J033145A10TTTTGGGCTGGNONE 
J033145A11TTGTGGGCTGGNONE 
J033145A11TTTTGGGCTGGNONE 
J053048H24TTGTGGGCTGGNONE 
J053048H24TTTTGGGCTGGNONE 
J053075H10TTGTGGGCTGGNONE 
J053075H10TTTTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCAAAANONE 
AK073617CCAGCCCACAANONE 
AK103973CCAGCCCAAAASimilar to DnaJ homolog subfamily C member 1. 
AK103973CCAGCCCACAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCAAAANONE 
J023130H14CCAGCCCACAANONE 
J033051J11CCAGCCCAAAANONE 
J033051J11CCAGCCCACAANONE 
J065101C10CCAGCCCAAAANONE 
J065101C10CCAGCCCACAANONE 
J065168B04CCAGCCCAAAANONE 
J065168B04CCAGCCCACAANONE 
J065184E22CCAGCCCAAAANONE 
J065184E22CCAGCCCACAANONE 
J080021D11CCAGCCCAAAANONE 
J080021D11CCAGCCCACAANONE 
J080025H10CCAGCCCAAAANONE 
J080025H10CCAGCCCACAANONE 
J080026N19CCAGCCCAAAANONE 
J080026N19CCAGCCCACAANONE 
J080034A12CCAGCCCAAAANONE 
J080034A12CCAGCCCACAANONE 
J080040L02CCAGCCCAAAANONE 
J080040L02CCAGCCCACAANONE 
J080042H19CCAGCCCAAAANONE 
J080042H19CCAGCCCACAANONE 
J080047B05CCAGCCCAAAANONE 
J080047B05CCAGCCCACAANONE 
J080047E09CCAGCCCAAAANONE 
J080047E09CCAGCCCACAANONE 
J080047I01CCAGCCCAAAANONE 
J080047I01CCAGCCCACAANONE 
J080052H19CCAGCCCAAAANONE 
J080052H19CCAGCCCACAANONE 
J080062K13CCAGCCCAAAANONE 
J080062K13CCAGCCCACAANONE 
J080063A22CCAGCCCAAAANONE 
J080063A22CCAGCCCACAANONE 
J080068G18CCAGCCCAAAANONE 
J080068G18CCAGCCCACAANONE 
J080068N19CCAGCCCAAAANONE 
J080068N19CCAGCCCACAANONE 
J080076G08CCAGCCCAAAANONE 
J080076G08CCAGCCCACAANONE 
J080077H13CCAGCCCAAAANONE 
J080077H13CCAGCCCACAANONE 
J080077K06CCAGCCCAAAANONE 
J080077K06CCAGCCCACAANONE 
J080093D15CCAGCCCAAAANONE 
J080093D15CCAGCCCACAANONE 
J080094D21CCAGCCCAAAANONE 
J080094D21CCAGCCCACAANONE 
J080097A20CCAGCCCAAAANONE 
J080097A20CCAGCCCACAANONE 
J080097E21CCAGCCCAAAANONE 
J080097E21CCAGCCCACAANONE 
J080097N17CCAGCCCAAAANONE 
J080097N17CCAGCCCACAANONE 
J100071K18CCAGCCCAAAANONE 
J100071K18CCAGCCCACAANONE 
J100072F09CCAGCCCAAAANONE 
J100072F09CCAGCCCACAANONE 
Os08g0161700009-088-D09CCAGCCCAACCNONE 
009-131-H02CCAGCCCAACCNONE 
009-182-D04CCAGCCCAACCNONE 
AK059272CCAGCCCAACCConserved hypothetical protein. 
J075002M21CCAGCCCAACCNONE 
J075090H12CCAGCCCAACCNONE 
J075129C21CCAGCCCAACCNONE 
J075146N03CCAGCCCAACCNONE 
J075178P18CCAGCCCAACCNONE 
J075190M03CCAGCCCAACCNONE 
J090030G01CCAGCCCAACCNONE 
J100088M23CCAGCCCAACCNONE 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0195400006-057-E04CACGTGGGCTGGNONE 
006-060-B10CACGTGGGCTGGNONE 
AK070464CACGTGGGCTGGConserved hypothetical protein. 
AK104389CACGTGGGCTGGNONE 
AK106140CACGTGGGCTGGNONE 
J023013G08CACGTGGGCTGGNONE 
J023054K19CACGTGGGCTGGNONE 
J023089D18CACGTGGGCTGGNONE 
J023092K05CACGTGGGCTGGNONE 
J033025A08CACGTGGGCTGGNONE 
J033067P12CACGTGGGCTGGNONE 
J033098A10CACGTGGGCTGGNONE 
J065219L04CACGTGGGCTGGNONE 
J090021P06CACGTGGGCTGGNONE 
J090062M05CACGTGGGCTGGNONE 
J090079F15CACGTGGGCTGGNONE 
J100041H19CACGTGGGCTGGNONE 
Os08g0224200AK101331CACGTGGGCTGGSimilar to Ythdf2-prov protein. 
Os08g0260600AK108529CCCAGCCCATGCCCATGTCD9/CD37/CD63 antigen family protein. 
Os08g0270200AK101221CCATGGGCTGGExosome-associated family protein. 
J090067H03CCATGGGCTGGNONE 
Os08g0271400009-101-A03TGTTGGGCTGGNONE 
AK062750TGTTGGGCTGGConserved hypothetical protein. 
Os08g0319900AK108030GCGTGGGCTGGPutative cyclase family protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0435800AK121712ACATGGGCTGGSimilar to Lipoate protein ligase-like protein. 
AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15ACATGGGCTGGNONE 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0476900AK101432CTGGGCTGGSimilar to Patatin-like protein 1. 
J033038K22CTGGGCTGGNONE 
J065089F13CTGGGCTGGNONE 
Os08g0492100AK060178ATTTGGGCTGGNONE 
AK071053ATTTGGGCTGGParaneoplastic encephalomyelitis antigen family protein. 
AK100101ATTTGGGCTGGNONE 
J023004I20ATTTGGGCTGGNONE 
J023067D13ATTTGGGCTGGNONE 
J033028G05ATTTGGGCTGGNONE 
J033060L15ATTTGGGCTGGNONE 
J033103N12ATTTGGGCTGGNONE 
J033125B19ATTTGGGCTGGNONE 
J065132A12ATTTGGGCTGGNONE 
J065161F02ATTTGGGCTGGNONE 
J065162L05ATTTGGGCTGGNONE 
J090093I18ATTTGGGCTGGNONE 
J100061I05ATTTGGGCTGGNONE 
J100081G13ATTTGGGCTGGNONE 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0527400AK119389AGCCCATACCAGCCCACCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
J013030C19CCCAGCCCACCACNONE 
J033029A20CCCAGCCCACCACNONE 
J033050L14CCCAGCCCACCACNONE 
J033058F03CCCAGCCCACCACNONE 
J033110K01CCCAGCCCACCACNONE 
J033123D21CCCAGCCCACCACNONE 
Os08g0557400006-024-C02CCAGCCCACANONE 
AK060067CCAGCCCACAProtein tyrosine phosphatase-like protein. 
AY224424CCAGCCCACANONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0101800AK102345ATTTGGGCTGGGWD40-like domain containing protein. 
J090030C23ATTTGGGCTGGGNONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
Os09g0133600006-034-E08CCCAGCCCATCANONE 
AK061477CCCAGCCCATCAPAP fibrillin family protein. 
AK099394CCCAGCCCATCANONE 
AK104742CCCAGCCCATCANONE 
AY224474CCCAGCCCATCANONE 
Os09g0243200AK107718CCCAGCCCAACAZinc finger, RING-type domain containing protein. 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0381400AK070060CCAGCCCAGCSimilar to Ervatamin C (EC 3.4.22.-) (ERV-C). 
AK071091CCAGCCCAGCNONE 
AK121482CCAGCCCAGCNONE 
J023012A12CCAGCCCAGCNONE 
J023020C17CCAGCCCAGCNONE 
J023022A04CCAGCCCAGCNONE 
J023023L01CCAGCCCAGCNONE 
J023030H24CCAGCCCAGCNONE 
J023037K19CCAGCCCAGCNONE 
J023039D03CCAGCCCAGCNONE 
J023039L09CCAGCCCAGCNONE 
J023041D01CCAGCCCAGCNONE 
J023042B22CCAGCCCAGCNONE 
J023042J06CCAGCCCAGCNONE 
J023045I18CCAGCCCAGCNONE 
J023061G16CCAGCCCAGCNONE 
J023079N05CCAGCCCAGCNONE 
J023107I09CCAGCCCAGCNONE 
J023110N16CCAGCCCAGCNONE 
J023111F23CCAGCCCAGCNONE 
J023112D15CCAGCCCAGCNONE 
J023112P12CCAGCCCAGCNONE 
J023121J19CCAGCCCAGCNONE 
J023125B04CCAGCCCAGCNONE 
J023132B12CCAGCCCAGCNONE 
J023146J21CCAGCCCAGCNONE 
J090046I17CCAGCCCAGCNONE 
J090073M23CCAGCCCAGCNONE 
J090080L22CCAGCCCAGCNONE 
J100043P14CCAGCCCAGCNONE 
J100047M20CCAGCCCAGCNONE 
J100055M10CCAGCCCAGCNONE 
J100080J10CCAGCCCAGCNONE 
Os09g0416200AK065807CCAGCCCATCCSimilar to Glucose transporter (Fragment). 
Os09g0419500016-067-D11CCAGCCCAATTNONE 
AK064394CCAGCCCAATTZinc finger, RING-type domain containing protein. 
AK073786CCAGCCCAATTNONE 
J033067G01CCAGCCCAATTNONE 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0471900AK073815CGCGTCTCCAGCCCACACGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0501100009-126-C12CCAGCCCAAACNONE 
009-126-C12CCAGCCCACCNONE 
AK063752CCAGCCCAAACSimilar to 60S ribosomal protein L32A. 
AK063752CCAGCCCACCSimilar to 60S ribosomal protein L32A. 
AK099282CCAGCCCAAACNONE 
AK099282CCAGCCCACCNONE 
J023130H04CCAGCCCAAACNONE 
J023130H04CCAGCCCACCNONE 
J075013C11CCAGCCCAAACNONE 
J075013C11CCAGCCCACCNONE 
J075060E07CCAGCCCAAACNONE 
J075060E07CCAGCCCACCNONE 
J075106K07CCAGCCCAAACNONE 
J075106K07CCAGCCCACCNONE 
J075124L15CCAGCCCAAACNONE 
J075124L15CCAGCCCACCNONE 
J075161D15CCAGCCCAAACNONE 
J075161D15CCAGCCCACCNONE 
J080311I18CCAGCCCAAACNONE 
J080311I18CCAGCCCACCNONE 
J080315G08CCAGCCCAAACNONE 
J080315G08CCAGCCCACCNONE 
J080316F09CCAGCCCAAACNONE 
J080316F09CCAGCCCACCNONE 
J080318B05CCAGCCCAAACNONE 
J080318B05CCAGCCCACCNONE 
J100052O18CCAGCCCAAACNONE 
J100052O18CCAGCCCACCNONE 
J100064D07CCAGCCCAAACNONE 
J100064D07CCAGCCCACCNONE 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0106700006-055-F11CCAGCCCAAAANONE 
006-099-D08CCAGCCCAAAANONE 
009-155-A12CCAGCCCAAAANONE 
AF519570CCAGCCCAAAANONE 
AK059354CCAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0129800Os11g0129800CCAGCCCAGConserved hypothetical protein. 
Os11g0139500AK121845ATTTGGGCTGGNONE 
Os11g0168200005-010-H01CCCAGCCCAGCCCAGNONE 
009-156-F07CCCAGCCCAGCCCAGNONE 
012-025-F01CCCAGCCCAGCCCAGNONE 
012-089-A02CCCAGCCCAGCCCAGNONE 
016-016-E08CCCAGCCCAGCCCAGNONE 
AK073392CCCAGCCCAGCCCAG60S ribosomal protein L3. 
AK099225CCCAGCCCAGCCCAGNONE 
AK101469CCCAGCCCAGCCCAGNONE 
AY236158CCCAGCCCAGCCCAGNONE 
J013152M22CCCAGCCCAGCCCAGNONE 
J023013N11CCCAGCCCAGCCCAGNONE 
J023038J11CCCAGCCCAGCCCAGNONE 
J023054N21CCCAGCCCAGCCCAGNONE 
J033041E13CCCAGCCCAGCCCAGNONE 
J033050O09CCCAGCCCAGCCCAGNONE 
J033093G05CCCAGCCCAGCCCAGNONE 
J033094J17CCCAGCCCAGCCCAGNONE 
J033112J24CCCAGCCCAGCCCAGNONE 
J033113D05CCCAGCCCAGCCCAGNONE 
J033120K10CCCAGCCCAGCCCAGNONE 
J033121H19CCCAGCCCAGCCCAGNONE 
J033129C08CCCAGCCCAGCCCAGNONE 
J033140H24CCCAGCCCAGCCCAGNONE 
J065020I18CCCAGCCCAGCCCAGNONE 
J065058L01CCCAGCCCAGCCCAGNONE 
J065059G22CCCAGCCCAGCCCAGNONE 
J065212L09CCCAGCCCAGCCCAGNONE 
J075047P09CCCAGCCCAGCCCAGNONE 
J075063C18CCCAGCCCAGCCCAGNONE 
J075076E07CCCAGCCCAGCCCAGNONE 
J075077F14CCCAGCCCAGCCCAGNONE 
J075086C22CCCAGCCCAGCCCAGNONE 
J075161L09CCCAGCCCAGCCCAGNONE 
J075177K20CCCAGCCCAGCCCAGNONE 
J090007L06CCCAGCCCAGCCCAGNONE 
J090010M02CCCAGCCCAGCCCAGNONE 
J090013M20CCCAGCCCAGCCCAGNONE 
J090044I15CCCAGCCCAGCCCAGNONE 
J090045O06CCCAGCCCAGCCCAGNONE 
J090060L04CCCAGCCCAGCCCAGNONE 
J090061C17CCCAGCCCAGCCCAGNONE 
J090062F10CCCAGCCCAGCCCAGNONE 
J090066L03CCCAGCCCAGCCCAGNONE 
J090089E13CCCAGCCCAGCCCAGNONE 
J090096D21CCCAGCCCAGCCCAGNONE 
J100039F12CCCAGCCCAGCCCAGNONE 
J100053N06CCCAGCCCAGCCCAGNONE 
Os11g0169900006-048-A03AATGGGCTGGNONE 
006-066-G11AATGGGCTGGNONE 
006-117-D09AATGGGCTGGNONE 
009-188-B11AATGGGCTGGNONE 
AK105044AATGGGCTGGSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
AK121233AATGGGCTGGNONE 
D21104AATGGGCTGGNONE 
J013108B05AATGGGCTGGNONE 
J013118B15AATGGGCTGGNONE 
J023008C14AATGGGCTGGNONE 
J023024D08AATGGGCTGGNONE 
J023093E21AATGGGCTGGNONE 
J065024J08AATGGGCTGGNONE 
J065070G07AATGGGCTGGNONE 
J065103B06AATGGGCTGGNONE 
J080011O10AATGGGCTGGNONE 
J080012O15AATGGGCTGGNONE 
J080016F12AATGGGCTGGNONE 
J080022P11AATGGGCTGGNONE 
J080023C02AATGGGCTGGNONE 
J080024I11AATGGGCTGGNONE 
J080024L13AATGGGCTGGNONE 
J080034N23AATGGGCTGGNONE 
J080036D13AATGGGCTGGNONE 
J080036M18AATGGGCTGGNONE 
J080037G09AATGGGCTGGNONE 
J080037G12AATGGGCTGGNONE 
J080049K01AATGGGCTGGNONE 
J080052J04AATGGGCTGGNONE 
J080057A14AATGGGCTGGNONE 
J080068O21AATGGGCTGGNONE 
J080072A14AATGGGCTGGNONE 
J080077E17AATGGGCTGGNONE 
J080080D15AATGGGCTGGNONE 
J080080H12AATGGGCTGGNONE 
J080083C19AATGGGCTGGNONE 
J080084M21AATGGGCTGGNONE 
J080088A08AATGGGCTGGNONE 
J080090B13AATGGGCTGGNONE 
J080094B08AATGGGCTGGNONE 
J080094F23AATGGGCTGGNONE 
J080095N07AATGGGCTGGNONE 
J090050G07AATGGGCTGGNONE 
U27098AATGGGCTGGNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0219400AK069850CCCGTGGGCTGGAnkyrin repeat containing protein. 
AK099123CCCGTGGGCTGGNONE 
J023143G18CCCGTGGGCTGGNONE 
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein. 
Os11g0297900AK067692CCAGCCCAGSimilar to Txnl4b protein. 
J013118F01CCAGCCCAGNONE 
J023066E22CCAGCCCAGNONE 
J023066E24CCAGCCCAGNONE 
Os11g0303200J023135L01GCGTGGGCTGGNONE 
J075074O21GCGTGGGCTGGNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0545800AK073687CCAGCCCAGCCCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
AK073687CCAGCCCAGTTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGCCCNONE 
J090050C14CCAGCCCAGTTNONE 
Os11g0549690J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065218B08CCAGCCCAACANONE 
J065218B08CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
Os11g0568300016-075-B02TGGGCTGGGNONE 
AK064398TGGGCTGGGHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282TGGGCTGGGNONE 
J033124M10TGGGCTGGGNONE 
J065120I21TGGGCTGGGNONE 
J065144H16TGGGCTGGGNONE 
Os11g0585900AK070793CCAGCCCACCTSimilar to ETO1-like protein 1 (Ethylene overproducer 1-like protein 1). 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os11g0664700012-064-D03ATTGGGCTGGNONE 
AK100084ATTGGGCTGGConserved hypothetical protein. 
J023002K05ATTGGGCTGGNONE 
J023037C21ATTGGGCTGGNONE 
J033029N10ATTGGGCTGGNONE 
J090047F07ATTGGGCTGGNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0154000AK101335GGATGGGCTGGNONE 
AK105118GGATGGGCTGGProtein of unknown function DUF250 domain containing protein. 
Os12g0164300AK120100GCCCAGCCCAAGCyclin-like F-box domain containing protein. 
J013022J17GCCCAGCCCAAGNONE 
J013040L22GCCCAGCCCAAGNONE 
J013041G05GCCCAGCCCAAGNONE 
J013096I02GCCCAGCCCAAGNONE 
J013156F05GCCCAGCCCAAGNONE 
J023122E20GCCCAGCCCAAGNONE 
J065008K06GCCCAGCCCAAGNONE 
J065073G14GCCCAGCCCAAGNONE 
J065105H07GCCCAGCCCAAGNONE 
J065117A15GCCCAGCCCAAGNONE 
J075025K21GCCCAGCCCAAGNONE 
J075051A13GCCCAGCCCAAGNONE 
J075119C17GCCCAGCCCAAGNONE 
J075143A02GCCCAGCCCAAGNONE 
J075149K04GCCCAGCCCAAGNONE 
J080304A20GCCCAGCCCAAGNONE 
J080305H17GCCCAGCCCAAGNONE 
J080306D14GCCCAGCCCAAGNONE 
J080306N01GCCCAGCCCAAGNONE 
J080308P13GCCCAGCCCAAGNONE 
J080310C04GCCCAGCCCAAGNONE 
J090048B12GCCCAGCCCAAGNONE 
J090092A18GCCCAGCCCAAGNONE 
J090099G20GCCCAGCCCAAGNONE 
Os12g0190100AK109819CCAGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0223700J075049J03TGTTGGGCTGGHypothetical protein. 
J075101F23TGTTGGGCTGGNONE 
Os12g0244000AK106408CCAGCCCAGTTHypothetical protein. 
Os12g0421000AK071491CCAGCCCAGSimilar to Barley stem rust resistance protein. 
J023098J19CCAGCCCAGNONE 
J065215L22CCAGCCCAGNONE 
J090094F02CCAGCCCAGNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0527500AK109836CCCAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0554400AK072345CCCAGCCCATCCTetratricopeptide-like helical domain containing protein. 
Os12g0557800AK121691CCAGCCCACGGGProtein prenyltransferase domain containing protein. 
J013095M03CCAGCCCACGGGNONE 
J033071H11CCAGCCCACGGGNONE 
J065101B02CCAGCCCACGGGNONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0577900015-034-E07CCAGCCCACANONE 
AK106299CCAGCCCACAProtein prenyltransferase domain containing protein. 
Os12g0578500AK065485TGGGCTGGGGlycosyl transferase, family 8 protein. 
J043027D21TGGGCTGGGNONE 
J075120F12TGGGCTGGGNONE 
J080010J21TGGGCTGGGNONE 
J080015L10TGGGCTGGGNONE 
J080016C19TGGGCTGGGNONE 
J080016F10TGGGCTGGGNONE 
J080022A12TGGGCTGGGNONE 
J080024B10TGGGCTGGGNONE 
J080025C16TGGGCTGGGNONE 
J080026B03TGGGCTGGGNONE 
J080028B11TGGGCTGGGNONE 
J080028M19TGGGCTGGGNONE 
J080030I02TGGGCTGGGNONE 
J080032F18TGGGCTGGGNONE 
J080038O16TGGGCTGGGNONE 
J080040D01TGGGCTGGGNONE 
J080043H19TGGGCTGGGNONE 
J080045N21TGGGCTGGGNONE 
J080046H14TGGGCTGGGNONE 
J080053B20TGGGCTGGGNONE 
J080053P14TGGGCTGGGNONE 
J080056L15TGGGCTGGGNONE 
J080057F14TGGGCTGGGNONE 
J080060C10TGGGCTGGGNONE 
J080061D20TGGGCTGGGNONE 
J080061J12TGGGCTGGGNONE 
J080062F17TGGGCTGGGNONE 
J080065M15TGGGCTGGGNONE 
J080066N15TGGGCTGGGNONE 
J080069K21TGGGCTGGGNONE 
J080070L14TGGGCTGGGNONE 
J080072L05TGGGCTGGGNONE 
J080072L16TGGGCTGGGNONE 
J080075D08TGGGCTGGGNONE 
J080075I19TGGGCTGGGNONE 
J080076M24TGGGCTGGGNONE 
J080077M11TGGGCTGGGNONE 
J080078O10TGGGCTGGGNONE 
J080081K24TGGGCTGGGNONE 
J080082J02TGGGCTGGGNONE 
J080083N20TGGGCTGGGNONE 
J080085M09TGGGCTGGGNONE 
J080093K05TGGGCTGGGNONE 
J080094J19TGGGCTGGGNONE 
J080095E06TGGGCTGGGNONE 
J080096B04TGGGCTGGGNONE 
J080096H08TGGGCTGGGNONE 
J090034I21TGGGCTGGGNONE 
J090045J19TGGGCTGGGNONE 
J090065F20TGGGCTGGGNONE 
J100077M24TGGGCTGGGNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0596300AK109146CCAGCCCAGTTDC1 domain containing protein. 
AK109146CCAGCCCAGTTDC1 domain containing protein. 
Os12g0597500AK101904CCAGCCCATGGGCCTCNONE 
AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCAGCCCATGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCAGCCCATGGGCCTCNONE 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCAGCCCATGGGCCTCNONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0609800AK101303AGATGGGCTGGGCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01AGATGGGCTGGGNONE 
J033033K21AGATGGGCTGGGNONE 
J033082L13AGATGGGCTGGGNONE 
J043034M20AGATGGGCTGGGNONE 
J065137J24AGATGGGCTGGGNONE 
J065141A11AGATGGGCTGGGNONE 
J065217H09AGATGGGCTGGGNONE 
Os12g0624000AK067726CCCACCACTTTGGGCTGGGNONE 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein. 
J013039E03CCCACCACTTTGGGCTGGGNONE 
J013040D22CCCACCACTTTGGGCTGGGNONE 
J013047K12CCCACCACTTTGGGCTGGGNONE 
J013056C04CCCACCACTTTGGGCTGGGNONE 
J013062K01CCCACCACTTTGGGCTGGGNONE 
J013108K09CCCACCACTTTGGGCTGGGNONE 
J013126I24CCCACCACTTTGGGCTGGGNONE 
J013128D18CCCACCACTTTGGGCTGGGNONE 
J013147D23CCCACCACTTTGGGCTGGGNONE 
J013154N13CCCACCACTTTGGGCTGGGNONE 
J023003C20CCCACCACTTTGGGCTGGGNONE 
J023003N19CCCACCACTTTGGGCTGGGNONE 
J023007B09CCCACCACTTTGGGCTGGGNONE 
J023008L12CCCACCACTTTGGGCTGGGNONE 
J023037O10CCCACCACTTTGGGCTGGGNONE 
J023044F11CCCACCACTTTGGGCTGGGNONE 
J023062H22CCCACCACTTTGGGCTGGGNONE 
J023064O07CCCACCACTTTGGGCTGGGNONE 
J023067D16CCCACCACTTTGGGCTGGGNONE 
J023082C19CCCACCACTTTGGGCTGGGNONE 
J023090A08CCCACCACTTTGGGCTGGGNONE 
J023102P21CCCACCACTTTGGGCTGGGNONE 
J023122G15CCCACCACTTTGGGCTGGGNONE 
J023123I24CCCACCACTTTGGGCTGGGNONE 
J023134N07CCCACCACTTTGGGCTGGGNONE 
J023140M21CCCACCACTTTGGGCTGGGNONE 
J033023G06CCCACCACTTTGGGCTGGGNONE 
J033025J02CCCACCACTTTGGGCTGGGNONE 
J033025L06CCCACCACTTTGGGCTGGGNONE 
J033026I21CCCACCACTTTGGGCTGGGNONE 
J033028G20CCCACCACTTTGGGCTGGGNONE 
J033028L03CCCACCACTTTGGGCTGGGNONE 
J033030P14CCCACCACTTTGGGCTGGGNONE 
J033031C02CCCACCACTTTGGGCTGGGNONE 
J033031I06CCCACCACTTTGGGCTGGGNONE 
J033037D21CCCACCACTTTGGGCTGGGNONE 
J033037M24CCCACCACTTTGGGCTGGGNONE 
J033040P06CCCACCACTTTGGGCTGGGNONE 
J033046J18CCCACCACTTTGGGCTGGGNONE 
J033048A14CCCACCACTTTGGGCTGGGNONE 
J033048B14CCCACCACTTTGGGCTGGGNONE 
J033051N03CCCACCACTTTGGGCTGGGNONE 
J033060A19CCCACCACTTTGGGCTGGGNONE 
J033060K19CCCACCACTTTGGGCTGGGNONE 
J033065O13CCCACCACTTTGGGCTGGGNONE 
J033067I23CCCACCACTTTGGGCTGGGNONE 
J033068N13CCCACCACTTTGGGCTGGGNONE 
J033070N02CCCACCACTTTGGGCTGGGNONE 
J033072K15CCCACCACTTTGGGCTGGGNONE 
J033073D09CCCACCACTTTGGGCTGGGNONE 
J033075H17CCCACCACTTTGGGCTGGGNONE 
J033076O22CCCACCACTTTGGGCTGGGNONE 
J033086K06CCCACCACTTTGGGCTGGGNONE 
J033086L03CCCACCACTTTGGGCTGGGNONE 
J033088J09CCCACCACTTTGGGCTGGGNONE 
J033091D17CCCACCACTTTGGGCTGGGNONE 
J033096B11CCCACCACTTTGGGCTGGGNONE 
J033099A05CCCACCACTTTGGGCTGGGNONE 
J033101B15CCCACCACTTTGGGCTGGGNONE 
J033101D20CCCACCACTTTGGGCTGGGNONE 
J033105D22CCCACCACTTTGGGCTGGGNONE 
J033106J20CCCACCACTTTGGGCTGGGNONE 
J033107J01CCCACCACTTTGGGCTGGGNONE 
J033111N08CCCACCACTTTGGGCTGGGNONE 
J033112B18CCCACCACTTTGGGCTGGGNONE 
J033113L04CCCACCACTTTGGGCTGGGNONE 
J033114F02CCCACCACTTTGGGCTGGGNONE 
J033118A22CCCACCACTTTGGGCTGGGNONE 
J033119J02CCCACCACTTTGGGCTGGGNONE 
J033120F22CCCACCACTTTGGGCTGGGNONE 
J033120O16CCCACCACTTTGGGCTGGGNONE 
J033127A12CCCACCACTTTGGGCTGGGNONE 
J033127J08CCCACCACTTTGGGCTGGGNONE 
J033127N13CCCACCACTTTGGGCTGGGNONE 
J033131N09CCCACCACTTTGGGCTGGGNONE 
J033135I05CCCACCACTTTGGGCTGGGNONE 
J033140D04CCCACCACTTTGGGCTGGGNONE 
J033142D04CCCACCACTTTGGGCTGGGNONE 
J033145B14CCCACCACTTTGGGCTGGGNONE 
J043007I15CCCACCACTTTGGGCTGGGNONE 
J043021N20CCCACCACTTTGGGCTGGGNONE 
J043037I05CCCACCACTTTGGGCTGGGNONE 
J065008P22CCCACCACTTTGGGCTGGGNONE 
J065038C05CCCACCACTTTGGGCTGGGNONE 
J065060A16CCCACCACTTTGGGCTGGGNONE 
J065111M10CCCACCACTTTGGGCTGGGNONE 
J065112L11CCCACCACTTTGGGCTGGGNONE 
J065114B07CCCACCACTTTGGGCTGGGNONE 
J065116M04CCCACCACTTTGGGCTGGGNONE 
J065152D15CCCACCACTTTGGGCTGGGNONE 
J065171C15CCCACCACTTTGGGCTGGGNONE 
J065173N07CCCACCACTTTGGGCTGGGNONE 
J065185N18CCCACCACTTTGGGCTGGGNONE 
J065187F09CCCACCACTTTGGGCTGGGNONE 
J065188L15CCCACCACTTTGGGCTGGGNONE 
J065190K15CCCACCACTTTGGGCTGGGNONE 
J065214C16CCCACCACTTTGGGCTGGGNONE 
J065215F05CCCACCACTTTGGGCTGGGNONE 
J075108J08CCCACCACTTTGGGCTGGGNONE 
J090002C16CCCACCACTTTGGGCTGGGNONE 
J090002K12CCCACCACTTTGGGCTGGGNONE 
J090003M10CCCACCACTTTGGGCTGGGNONE 
J090007J12CCCACCACTTTGGGCTGGGNONE 
J090010D06CCCACCACTTTGGGCTGGGNONE 
J090010F21CCCACCACTTTGGGCTGGGNONE 
J090014E20CCCACCACTTTGGGCTGGGNONE 
J090014J03CCCACCACTTTGGGCTGGGNONE 
J090017E15CCCACCACTTTGGGCTGGGNONE 
J090019J18CCCACCACTTTGGGCTGGGNONE 
J090021B21CCCACCACTTTGGGCTGGGNONE 
J090021H21CCCACCACTTTGGGCTGGGNONE 
J090021J12CCCACCACTTTGGGCTGGGNONE 
J090022K10CCCACCACTTTGGGCTGGGNONE 
J090024C24CCCACCACTTTGGGCTGGGNONE 
J090026D12CCCACCACTTTGGGCTGGGNONE 
J090034F08CCCACCACTTTGGGCTGGGNONE 
J090036H24CCCACCACTTTGGGCTGGGNONE 
J090036L04CCCACCACTTTGGGCTGGGNONE 
J090040C21CCCACCACTTTGGGCTGGGNONE 
J090045J21CCCACCACTTTGGGCTGGGNONE 
J090052D21CCCACCACTTTGGGCTGGGNONE 
J090053A01CCCACCACTTTGGGCTGGGNONE 
J090057E01CCCACCACTTTGGGCTGGGNONE 
J090059A01CCCACCACTTTGGGCTGGGNONE 
J090059M24CCCACCACTTTGGGCTGGGNONE 
J090062A08CCCACCACTTTGGGCTGGGNONE 
J090065H17CCCACCACTTTGGGCTGGGNONE 
J090073M22CCCACCACTTTGGGCTGGGNONE 
J090074J05CCCACCACTTTGGGCTGGGNONE 
J090074L22CCCACCACTTTGGGCTGGGNONE 
J090077E04CCCACCACTTTGGGCTGGGNONE 
J090077K10CCCACCACTTTGGGCTGGGNONE 
J090088E21CCCACCACTTTGGGCTGGGNONE 
J090088L13CCCACCACTTTGGGCTGGGNONE 
J090089M05CCCACCACTTTGGGCTGGGNONE 
J090092E18CCCACCACTTTGGGCTGGGNONE 
J090092P07CCCACCACTTTGGGCTGGGNONE 
J090096M04CCCACCACTTTGGGCTGGGNONE 
J090099I04CCCACCACTTTGGGCTGGGNONE 
J100023P11CCCACCACTTTGGGCTGGGNONE 
J100024K13CCCACCACTTTGGGCTGGGNONE 
J100026P20CCCACCACTTTGGGCTGGGNONE 
J100027I15CCCACCACTTTGGGCTGGGNONE 
J100027M21CCCACCACTTTGGGCTGGGNONE 
J100029H05CCCACCACTTTGGGCTGGGNONE 
J100030E10CCCACCACTTTGGGCTGGGNONE 
J100030F11CCCACCACTTTGGGCTGGGNONE 
J100031C13CCCACCACTTTGGGCTGGGNONE 
J100032P16CCCACCACTTTGGGCTGGGNONE 
J100034G02CCCACCACTTTGGGCTGGGNONE 
J100037D06CCCACCACTTTGGGCTGGGNONE 
J100050D08CCCACCACTTTGGGCTGGGNONE 
J100051J22CCCACCACTTTGGGCTGGGNONE 
J100055G12CCCACCACTTTGGGCTGGGNONE 
J100056O15CCCACCACTTTGGGCTGGGNONE 
J100057E06CCCACCACTTTGGGCTGGGNONE 
J100061P11CCCACCACTTTGGGCTGGGNONE 
J100064H05CCCACCACTTTGGGCTGGGNONE 
J100066D14CCCACCACTTTGGGCTGGGNONE 
J100067D10CCCACCACTTTGGGCTGGGNONE 
J100070L11CCCACCACTTTGGGCTGGGNONE 
J100071N11CCCACCACTTTGGGCTGGGNONE 
J100073D21CCCACCACTTTGGGCTGGGNONE 
J100074L06CCCACCACTTTGGGCTGGGNONE 
J100081I01CCCACCACTTTGGGCTGGGNONE 
J100083F08CCCACCACTTTGGGCTGGGNONE 
J100083I15CCCACCACTTTGGGCTGGGNONE 
J100084P13CCCACCACTTTGGGCTGGGNONE 
J100086N12CCCACCACTTTGGGCTGGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.