version

Summary of OsREG524 (All List)

OrganismOryza sativa  
IDOsREG524  
SequenceCCAGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count952  

Entry Sequences (952 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952CCTGGGCCTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCTGGGCCTGGNONE 
J013123J12CCTGGGCCTGGNONE 
J033026O19CCTGGGCCTGGNONE 
J033128C08CCTGGGCCTGGNONE 
J065116M14CCTGGGCCTGGNONE 
J090058F15CCTGGGCCTGGNONE 
J090079F20CCTGGGCCTGGNONE 
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE 
009-028-D05GCCCATGGGCCTGGNONE 
009-058-B11GCCCATGGGCCTGGNONE 
009-151-D09GCCCATGGGCCTGGNONE 
013-026-G03GCCCATGGGCCTGGNONE 
013-063-F04GCCCATGGGCCTGGNONE 
013-069-B05GCCCATGGGCCTGGNONE 
014-029-E04GCCCATGGGCCTGGNONE 
014-072-H04GCCCATGGGCCTGGNONE 
014-089-E09GCCCATGGGCCTGGNONE 
015-047-G05GCCCATGGGCCTGGNONE 
016-033-G06GCCCATGGGCCTGGNONE 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08GCCCATGGGCCTGGNONE 
J023077K21GCCCATGGGCCTGGNONE 
J023081F19GCCCATGGGCCTGGNONE 
J033052N11GCCCATGGGCCTGGNONE 
J033058N11GCCCATGGGCCTGGNONE 
J033114G05GCCCATGGGCCTGGNONE 
J033114O17GCCCATGGGCCTGGNONE 
J033129L14GCCCATGGGCCTGGNONE 
J053029I12GCCCATGGGCCTGGNONE 
J065067N19GCCCATGGGCCTGGNONE 
J065084I19GCCCATGGGCCTGGNONE 
J065099O03GCCCATGGGCCTGGNONE 
J065201I08GCCCATGGGCCTGGNONE 
J075035B08GCCCATGGGCCTGGNONE 
J075037B22GCCCATGGGCCTGGNONE 
J075054L16GCCCATGGGCCTGGNONE 
J075059D15GCCCATGGGCCTGGNONE 
J075164I08GCCCATGGGCCTGGNONE 
J075185J01GCCCATGGGCCTGGNONE 
J090042O06GCCCATGGGCCTGGNONE 
J090044F12GCCCATGGGCCTGGNONE 
J090063L02GCCCATGGGCCTGGNONE 
J090073I10GCCCATGGGCCTGGNONE 
J090078E18GCCCATGGGCCTGGNONE 
J100072K16GCCCATGGGCCTGGNONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0337600AK099595CCAGGCCCATPase, F1 complex, gamma subunit family protein. 
AK119468CCAGGCCCNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0654100AK069482CCAGGCCCSimilar to CTP synthase (EC 6.3.4.2) (UTP--ammonia ligase) (CTP synthetase). 
AK111300CCAGGCCCNONE 
J013022O07CCAGGCCCNONE 
J023020O19CCAGGCCCNONE 
J065189L15CCAGGCCCNONE 
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE 
J065006G21ACGTGGGCCAGGCCCNONE 
J065025M24ACGTGGGCCAGGCCCNONE 
J065041J02ACGTGGGCCAGGCCCNONE 
J065044B14ACGTGGGCCAGGCCCNONE 
J065061J06ACGTGGGCCAGGCCCNONE 
J065116L21ACGTGGGCCAGGCCCNONE 
J075030F18ACGTGGGCCAGGCCCNONE 
J075034K17ACGTGGGCCAGGCCCNONE 
J075063I02ACGTGGGCCAGGCCCNONE 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075188L15ACGTGGGCCAGGCCCNONE 
J075197B17ACGTGGGCCAGGCCCNONE 
Os01g0754000014-081-F07CCAGGCCCATCTNONE 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
J065219A11CCAGGCCCATCTNONE 
J075136N13CCAGGCCCATCTNONE 
J100051G01CCAGGCCCATCTNONE 
J100053M22CCAGGCCCATCTNONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0833200AK121629ACTGGGCCTGGConserved hypothetical protein. 
J023093N07ACTGGGCCTGGNONE 
J033050C20ACTGGGCCTGGNONE 
J080302F22ACTGGGCCTGGNONE 
J080303H06ACTGGGCCTGGNONE 
J080306J04ACTGGGCCTGGNONE 
J080309K06ACTGGGCCTGGNONE 
J080311E18ACTGGGCCTGGNONE 
J080318A20ACTGGGCCTGGNONE 
J100031F20ACTGGGCCTGGNONE 
J100034P21ACTGGGCCTGGNONE 
J100042K08ACTGGGCCTGGNONE 
J100047H24ACTGGGCCTGGNONE 
J100065C14ACTGGGCCTGGNONE 
J100074E23ACTGGGCCTGGNONE 
Os01g0852200AK063954CCAGGCCCAAGCCCNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
Os01g0896800AK065268CCAGGCCCACANONE 
AK104693CCAGGCCCACAEukaryotic ribosomal protein L5 family protein. 
J013126P09CCAGGCCCACANONE 
J033046N15CCAGGCCCACANONE 
J090008K02CCAGGCCCACANONE 
J090024F15CCAGGCCCACANONE 
J090074I23CCAGGCCCACANONE 
J090093F03CCAGGCCCACANONE 
J090096N02CCAGGCCCACANONE 
Os01g0897800AK060771CCAGGCCCNONE 
Os01g0906425J065161F19CCAGGCCCConserved hypothetical protein. 
J080030J06CCAGGCCCNONE 
J080062E23CCAGGCCCNONE 
J080080G14CCAGGCCCNONE 
Os01g0948100AK111411GGGCCTGGERCC4 domain containing protein. 
J090089O16GGGCCTGGNONE 
Os01g0960800AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTGGNONE 
J033075P16TAATGGGCCTGGNONE 
J065051H06TAATGGGCCTGGNONE 
J065167L02TAATGGGCCTGGNONE 
J090083C22TAATGGGCCTGGNONE 
Os01g0973300AK102519GGGCCTGGAdaptin, N-terminal domain containing protein. 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CCAGGCCCATCANONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0245000AK119770CCAGGCCCACGANONE 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
J065038L11CCAGGCCCACGANONE 
J100059I06CCAGGCCCACGANONE 
J100076C23CCAGGCCCACGANONE 
J100081P08CCAGGCCCACGANONE 
J100084C13CCAGGCCCACGANONE 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein. 
Os02g0439700AK067803CCGTGGGCGGGCCTGGPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0473000AK065460CCAGGCCCCAGRiboflavin biosynthesis protein RibD family protein. 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE 
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE 
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE 
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE 
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE 
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-154-G01GTTGGGCCTGGNONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
009-172-H09GTTGGGCCTGGNONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
AK099885GTTGGGCCTGGGlutaredoxin 2 family protein. 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
Os02g0802400J065054M13AGGTGGGCCTGGNONE 
J065061I04AGGTGGGCCTGGNONE 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
J100050L24AGGTGGGCCTGGNONE 
J100059D20AGGTGGGCCTGGNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK099203CCAGGCCCATAANONE 
Os02g0814800AK109850TATTGGGCCTGGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0213800AK103114CCAGGCCCGGAMitochondrial substrate carrier family protein. 
Os03g0238800AY224467GTGGGGCCTGGCCACCAACConserved hypothetical protein. 
J013042E23GTGGGGCCTGGCCACCAACNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0277500014-019-A09GGGCCTGGNONE 
AK063650GGGCCTGGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GGGCCTGGNONE 
J065092A08GGGCCTGGNONE 
J065122E17GGGCCTGGNONE 
J065182K12GGGCCTGGNONE 
J065197H15GGGCCTGGNONE 
J075115A05GGGCCTGGNONE 
Os03g0321000AK103653CCAGGCCCAATASimilar to Steroid membrane binding protein-like. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0360500009-103-B05GGATGGGCCTGGNONE 
AK059166GGATGGGCCTGGNONE 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
J033061G19GGATGGGCCTGGNONE 
J065169P12GGATGGGCCTGGNONE 
J075104C18GGATGGGCCTGGNONE 
J075166G07GGATGGGCCTGGNONE 
J075170J04GGATGGGCCTGGNONE 
Os03g0386000AK072984GGCTGGGCCTGGSimilar to WD domain protein-like. 
J065009K18GGCTGGGCCTGGNONE 
J065165P09GGCTGGGCCTGGNONE 
Os03g0428800AK060233CCAGGCCCTetratricopeptide-like helical domain containing protein. 
Os03g0445700AK071624CCAGGCCCCAGSimilar to LOB domain protein 39. 
J023106M18CCAGGCCCCAGNONE 
J065178J05CCAGGCCCCAGNONE 
J065196F10CCAGGCCCCAGNONE 
Os03g0579000AK061586CCAGGCCCATATNONE 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0586800003-114-H11CCAGGCCCATTTNONE 
003-114-H11TCATGGGCCAGGCCCNONE 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302CCAGGCCCATTTNONE 
AK099302TCATGGGCCAGGCCCNONE 
J090004H06CCAGGCCCATTTNONE 
J090004H06TCATGGGCCAGGCCCNONE 
J090022N15CCAGGCCCATTTNONE 
J090022N15TCATGGGCCAGGCCCNONE 
J100035E05CCAGGCCCATTTNONE 
J100035E05TCATGGGCCAGGCCCNONE 
J100041L05CCAGGCCCATTTNONE 
J100041L05TCATGGGCCAGGCCCNONE 
J100041M18CCAGGCCCATTTNONE 
J100041M18TCATGGGCCAGGCCCNONE 
J100057P04CCAGGCCCATTTNONE 
J100057P04TCATGGGCCAGGCCCNONE 
J100089H06CCAGGCCCATTTNONE 
J100089H06TCATGGGCCAGGCCCNONE 
J100090C23CCAGGCCCATTTNONE 
J100090C23TCATGGGCCAGGCCCNONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0606200009-030-E09CCAGGCCCACTNONE 
009-076-H10CCAGGCCCACTNONE 
009-122-H12CCAGGCCCACTNONE 
009-153-F09CCAGGCCCACTNONE 
AB055076CCAGGCCCACTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCAGGCCCACTNONE 
AK107928CCAGGCCCACTNONE 
J023078E13CCAGGCCCACTNONE 
J053031N01CCAGGCCCACTNONE 
J053046K19CCAGGCCCACTNONE 
J053062P07CCAGGCCCACTNONE 
J053091C23CCAGGCCCACTNONE 
J053099N19CCAGGCCCACTNONE 
J065005E06CCAGGCCCACTNONE 
J065030N03CCAGGCCCACTNONE 
J065138O21CCAGGCCCACTNONE 
J065159K03CCAGGCCCACTNONE 
J075030M08CCAGGCCCACTNONE 
J080006E23CCAGGCCCACTNONE 
J080010D10CCAGGCCCACTNONE 
J080016N17CCAGGCCCACTNONE 
J080024N09CCAGGCCCACTNONE 
J080028E23CCAGGCCCACTNONE 
J080035I11CCAGGCCCACTNONE 
J080038D15CCAGGCCCACTNONE 
J080040H08CCAGGCCCACTNONE 
J080043L04CCAGGCCCACTNONE 
J080047C06CCAGGCCCACTNONE 
J080061G04CCAGGCCCACTNONE 
J080066E10CCAGGCCCACTNONE 
J080067P03CCAGGCCCACTNONE 
J080082D07CCAGGCCCACTNONE 
J080089M13CCAGGCCCACTNONE 
J080094O09CCAGGCCCACTNONE 
J080095C24CCAGGCCCACTNONE 
J080309E21CCAGGCCCACTNONE 
J090016G15CCAGGCCCACTNONE 
J090031C20CCAGGCCCACTNONE 
J090033A15CCAGGCCCACTNONE 
J090037L07CCAGGCCCACTNONE 
J090038I10CCAGGCCCACTNONE 
J090072P19CCAGGCCCACTNONE 
J100040J02CCAGGCCCACTNONE 
J100047N05CCAGGCCCACTNONE 
J100048M10CCAGGCCCACTNONE 
J100076C02CCAGGCCCACTNONE 
J100077G23CCAGGCCCACTNONE 
J100080O08CCAGGCCCACTNONE 
J100085C06CCAGGCCCACTNONE 
J100085F16CCAGGCCCACTNONE 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0757000012-094-G12CCCAGCCCCCAGGCCCNONE 
J065191P15CCCAGCCCCCAGGCCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os03g0770100AK108776CCAGGCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0795900012-092-G05CCAGGCCCATTANONE 
015-043-D09CCAGGCCCATTANONE 
016-078-G11CCAGGCCCATTANONE 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CCAGGCCCATTANONE 
J023001L04CCAGGCCCATTANONE 
J053032K11CCAGGCCCATTANONE 
J065059E10CCAGGCCCATTANONE 
J065095H19CCAGGCCCATTANONE 
J065181M06CCAGGCCCATTANONE 
J100047D11CCAGGCCCATTANONE 
J100068G04CCAGGCCCATTANONE 
Os03g0833900AK073655CCAGGCCCSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CCAGGCCCNONE 
AK104068CCAGGCCCNONE 
J075031J11CCAGGCCCNONE 
J075051N01CCAGGCCCNONE 
J075166D18CCAGGCCCNONE 
J075171E14CCAGGCCCNONE 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os03g0857500AK072880ACCCCCCAGGCCCProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0432400AK061496CCAGGCCCNONE 
J013030A21CCAGGCCCNONE 
J065102A17CCAGGCCCNONE 
Os04g0446500015-073-B06CCAGGCCCAATTNONE 
AB118009CCAGGCCCAATTNONE 
AK073743CCAGGCCCAATTNONE 
AK103814CCAGGCCCAATTSimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15CCAGGCCCAATTNONE 
J033067L09CCAGGCCCAATTNONE 
J033147C19CCAGGCCCAATTNONE 
J033147C20CCAGGCCCAATTNONE 
Os04g0565500006-022-C06CCAGGCCCACGTNONE 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK071118CCAGGCCCACGTNONE 
AK105902CCAGGCCCACGTNONE 
J023052I22CCAGGCCCACGTNONE 
J023082L01CCAGGCCCACGTNONE 
J023112P14CCAGGCCCACGTNONE 
J065043O12CCAGGCCCACGTNONE 
J065045B08CCAGGCCCACGTNONE 
J065059N01CCAGGCCCACGTNONE 
J065073A04CCAGGCCCACGTNONE 
J065078K06CCAGGCCCACGTNONE 
J065124J08CCAGGCCCACGTNONE 
J065140G16CCAGGCCCACGTNONE 
J065185E13CCAGGCCCACGTNONE 
J065197N09CCAGGCCCACGTNONE 
J100024A03CCAGGCCCACGTNONE 
J100042E11CCAGGCCCACGTNONE 
J100069L15CCAGGCCCACGTNONE 
J100078K13CCAGGCCCACGTNONE 
Os04g0584100012-063-E01GCTGGGCCTGGNONE 
AK105292GCTGGGCCTGGConserved hypothetical protein. 
Os04g0586100009-190-F11CCAGGCCCNONE 
AK063206CCAGGCCCProtein of unknown function DUF581 family protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0625000J065157C10CCAGGCCCAGATNONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0659000009-172-A09GGGCCTGGNONE 
AK063095GGGCCTGGConserved hypothetical protein. 
J065062J07GGGCCTGGNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-047-H10CCAGGCCCAATANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
006-107-D08CCAGGCCCAATANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
009-122-B09CCAGGCCCAATANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK059807CCAGGCCCAATANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK060875CCAGGCCCAATANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
AK071726CCAGGCCCAATAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J023110I24CCAGGCCCAATANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J033091O06CCAGGCCCAATANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053027N16CCAGGCCCAATANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053089E19CCAGGCCCAATANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053098H12CCAGGCCCAATANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J053099N13CCAGGCCCAATANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J075031B15CCAGGCCCAATANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013D12CCAGGCCCAATANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H05CCAGGCCCAATANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080013H07CCAGGCCCAATANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
J080088I03CCAGGCCCAATANONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0325200J090038J19CCAGGCCCGGTCyclin-like domain containing protein. 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0559900AK067197GGGCCTGGCCCAAGtRNA-binding arm domain containing protein. 
J013074C15GGGCCTGGCCCAAGNONE 
J013098O16GGGCCTGGCCCAAGNONE 
J033030M01GGGCCTGGCCCAAGNONE 
J090058H12GGGCCTGGCCCAAGNONE 
J090075M06GGGCCTGGCCCAAGNONE 
Os05g0561500006-066-D12GGTTGGGCCTGGNONE 
AK061788GGTTGGGCCTGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862GGTTGGGCCTGGNONE 
J013000O09GGTTGGGCCTGGNONE 
J033145C24GGTTGGGCCTGGNONE 
Os05g0563600009-152-H06CCAGGCCCACGTNONE 
AK058836CCAGGCCCACGTNONE 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0571300AK072262CCAGGCCCAACAConserved hypothetical protein. 
AK109853CCAGGCCCAACANONE 
AK111014CCAGGCCCAACANONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0146900AK071352CCAGGCCCAAAHypothetical protein. 
J065068D05CCAGGCCCAAANONE 
J075036G17CCAGGCCCAAANONE 
Os06g0187900009-171-C09CCAGGCCCAAACNONE 
AK063879CCAGGCCCAAACNONE 
AK071765CCAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CCAGGCCCAAACNONE 
J033098E13CCAGGCCCAAACNONE 
J100036J11CCAGGCCCAAACNONE 
J100047B19CCAGGCCCAAACNONE 
Os06g0246600AK107692CCAGGCCCCACGCGTSimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3). 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17CCAGGCCCATCCNONE 
J065038I02CCAGGCCCATCCNONE 
J065214J02CCAGGCCCATCCNONE 
Os06g0494400AK067594CCAGGCCCAATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0573700015-015-F02CCAGGCCCATATNONE 
AK106254CCAGGCCCATATConserved hypothetical protein. 
J065172G24CCAGGCCCATATNONE 
Os06g0622700AK107021CCAGGCCCGTTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CCAGGCCCGTTNONE 
J065100L18CCAGGCCCGTTNONE 
J065129N15CCAGGCCCGTTNONE 
J065152M08CCAGGCCCGTTNONE 
J065198M12CCAGGCCCGTTNONE 
J090077J22CCAGGCCCGTTNONE 
J100024G23CCAGGCCCGTTNONE 
J100027L01CCAGGCCCGTTNONE 
J100047C06CCAGGCCCGTTNONE 
J100055D01CCAGGCCCGTTNONE 
J100067M05CCAGGCCCGTTNONE 
J100077M16CCAGGCCCGTTNONE 
J100078M22CCAGGCCCGTTNONE 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os06g0678200AK059456CCAGGCCCATCGNONE 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
Os06g0681000009-105-G11CCAGGCCCGTTNONE 
AK062780CCAGGCCCGTTConserved hypothetical protein. 
J100021E01CCAGGCCCGTTNONE 
Os06g0702800009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os07g0105300AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK109521GCCGGGCCTGGGCCGGCNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0586700AK102792CCAGGCCCGGGTCGGATCConserved hypothetical protein. 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0603100AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
J023077E09TCATGGGCCTGGNONE 
J023081N15TCATGGGCCTGGNONE 
J033022N22TCATGGGCCTGGNONE 
J033024M18TCATGGGCCTGGNONE 
J033034P09TCATGGGCCTGGNONE 
J033046A06TCATGGGCCTGGNONE 
J033051K01TCATGGGCCTGGNONE 
J033081P09TCATGGGCCTGGNONE 
J033091B17TCATGGGCCTGGNONE 
J033092K23TCATGGGCCTGGNONE 
J033132J09TCATGGGCCTGGNONE 
J033144A14TCATGGGCCTGGNONE 
J033145A14TCATGGGCCTGGNONE 
J043021B20TCATGGGCCTGGNONE 
J053024D23TCATGGGCCTGGNONE 
J065212J10TCATGGGCCTGGNONE 
J090055M05TCATGGGCCTGGNONE 
J090065E14TCATGGGCCTGGNONE 
J090092J06TCATGGGCCTGGNONE 
Os08g0162500AK121633ATCTGGGCCTGGConserved hypothetical protein. 
J033105E19ATCTGGGCCTGGNONE 
J080012K11ATCTGGGCCTGGNONE 
J080041I12ATCTGGGCCTGGNONE 
J080049G05ATCTGGGCCTGGNONE 
J080050P09ATCTGGGCCTGGNONE 
J080051A10ATCTGGGCCTGGNONE 
J080054G05ATCTGGGCCTGGNONE 
J080058M08ATCTGGGCCTGGNONE 
J080064N23ATCTGGGCCTGGNONE 
J080072L15ATCTGGGCCTGGNONE 
J080096H09ATCTGGGCCTGGNONE 
J100079I08ATCTGGGCCTGGNONE 
Os08g0224200AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0474600J075102L06CCAGGCCCATATNONE 
J075103J21CCAGGCCCATATNONE 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0511000AK107578TATTGGGCCTGGProtein prenyltransferase domain containing protein. 
Os09g0272000AK068208CCAGGCCCHeavy metal transport/detoxification protein domain containing protein. 
J013149O20CCAGGCCCNONE 
J023138G15CCAGGCCCNONE 
J075034J08CCAGGCCCNONE 
J075178H18CCAGGCCCNONE 
J075185F11CCAGGCCCNONE 
Os09g0325700011-041-G03CACGTGTCCGGGCCTGGNONE 
AK063334CACGTGTCCGGGCCTGGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CACGTGTCCGGGCCTGGNONE 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0371200J100027I16CCAGGCCCCACAMajor facilitator superfamily MFS_1 protein. 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0411700005-017-C05CCAGGCCCACAANONE 
009-163-B01CCAGGCCCACAANONE 
AK058290CCAGGCCCACAAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919CCAGGCCCACAANONE 
AK121091CCAGGCCCACAANONE 
J013039D20CCAGGCCCACAANONE 
J023066F16CCAGGCCCACAANONE 
J023082H09CCAGGCCCACAANONE 
J023088H05CCAGGCCCACAANONE 
J065013G09CCAGGCCCACAANONE 
J065065C12CCAGGCCCACAANONE 
J065111I04CCAGGCCCACAANONE 
J065179H22CCAGGCCCACAANONE 
J075023N14CCAGGCCCACAANONE 
J090041J17CCAGGCCCACAANONE 
J100031J21CCAGGCCCACAANONE 
J100057A18CCAGGCCCACAANONE 
J100068P22CCAGGCCCACAANONE 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0538200009-076-A07CCAGGCCCATATNONE 
AB032061CCAGGCCCATATProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10CCAGGCCCATATNONE 
J075134I16CCAGGCCCATATNONE 
J100031G24CCAGGCCCATATNONE 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os11g0102200AJ252142GGGCCTGGSimilar to NPH1-1. 
J065179F12GGGCCTGGNONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0181900011-064-E11AGTGGGCCTGGNONE 
016-031-C07AGTGGGCCTGGNONE 
AK063374AGTGGGCCTGGPrefoldin domain containing protein. 
J065083K20AGTGGGCCTGGNONE 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0264600J100079I22CCAGGCCCNONE 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0586300AK072257CCAGGCCCAAGConserved hypothetical protein. 
Os11g0664700012-064-D03TCATGGGCCTGGGCCTGNONE 
AK100084TCATGGGCCTGGGCCTGConserved hypothetical protein. 
J023002K05TCATGGGCCTGGGCCTGNONE 
J023037C21TCATGGGCCTGGGCCTGNONE 
J033029N10TCATGGGCCTGGGCCTGNONE 
J090047F07TCATGGGCCTGGGCCTGNONE 
Os12g0120000011-024-E09CCAGGCCCNONE 
AK105399CCAGGCCCProtein of unknown function DUF936, plant family protein. 
Os12g0136600AK064762CCAGGCCCConserved hypothetical protein. 
J075198J21CCAGGCCCNONE 
J080024B04CCAGGCCCNONE 
J080042H13CCAGGCCCNONE 
J080042J18CCAGGCCCNONE 
J080068A13CCAGGCCCNONE 
J080076G10CCAGGCCCNONE 
J080076H12CCAGGCCCNONE 
J080097E20CCAGGCCCNONE 
J080097L07CCAGGCCCNONE 
J090049I08CCAGGCCCNONE 
Os12g0156400012-065-D02CCAGGCCCATTTNONE 
AK072086CCAGGCCCATTTNONE 
AK099278CCAGGCCCATTTDcp1-like decapping family protein. 
J013063H09CCAGGCCCATTTNONE 
J023125D09CCAGGCCCATTTNONE 
J023149G21CCAGGCCCATTTNONE 
J033064E07CCAGGCCCATTTNONE 
J033093C07CCAGGCCCATTTNONE 
J033107E06CCAGGCCCATTTNONE 
J075172A11CCAGGCCCATTTNONE 
J090009E07CCAGGCCCATTTNONE 
J090023F13CCAGGCCCATTTNONE 
J090071N18CCAGGCCCATTTNONE 
Os12g0168700AK065708CCAGGCCCAACAAMP-dependent synthetase and ligase domain containing protein. 
AK065718CCAGGCCCAACANONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0557800AK121691GCCGGGCCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J013095M03GCCGGGCCTGGGCCGGCNONE 
J033071H11GCCGGGCCTGGGCCGGCNONE 
J065101B02GCCGGGCCTGGGCCGGCNONE 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
Os12g0624800AK103828TAATGGGCCTGGHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.