version

Summary of OsREG525 (All List)

OrganismOryza sativa  
IDOsREG525  
SequenceCCATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCATGG  function unknown  
PLACE Motif 
Total Entry Count1849  

Entry Sequences (1849 entries)

LocusGene modelSequenceDescription
Os01g0157800AK121694GCCCATGGHeat shock protein DnaJ, N-terminal domain containing protein. 
J033072F06GCCCATGGNONE 
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE 
009-028-D05GCCCATGGGCCTGGNONE 
009-058-B11GCCCATGGGCCTGGNONE 
009-151-D09GCCCATGGGCCTGGNONE 
013-026-G03GCCCATGGGCCTGGNONE 
013-063-F04GCCCATGGGCCTGGNONE 
013-069-B05GCCCATGGGCCTGGNONE 
014-029-E04GCCCATGGGCCTGGNONE 
014-072-H04GCCCATGGGCCTGGNONE 
014-089-E09GCCCATGGGCCTGGNONE 
015-047-G05GCCCATGGGCCTGGNONE 
016-033-G06GCCCATGGGCCTGGNONE 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08GCCCATGGGCCTGGNONE 
J023077K21GCCCATGGGCCTGGNONE 
J023081F19GCCCATGGGCCTGGNONE 
J033052N11GCCCATGGGCCTGGNONE 
J033058N11GCCCATGGGCCTGGNONE 
J033114G05GCCCATGGGCCTGGNONE 
J033114O17GCCCATGGGCCTGGNONE 
J033129L14GCCCATGGGCCTGGNONE 
J053029I12GCCCATGGGCCTGGNONE 
J065067N19GCCCATGGGCCTGGNONE 
J065084I19GCCCATGGGCCTGGNONE 
J065099O03GCCCATGGGCCTGGNONE 
J065201I08GCCCATGGGCCTGGNONE 
J075035B08GCCCATGGGCCTGGNONE 
J075037B22GCCCATGGGCCTGGNONE 
J075054L16GCCCATGGGCCTGGNONE 
J075059D15GCCCATGGGCCTGGNONE 
J075164I08GCCCATGGGCCTGGNONE 
J075185J01GCCCATGGGCCTGGNONE 
J090042O06GCCCATGGGCCTGGNONE 
J090044F12GCCCATGGGCCTGGNONE 
J090063L02GCCCATGGGCCTGGNONE 
J090073I10GCCCATGGGCCTGGNONE 
J090078E18GCCCATGGGCCTGGNONE 
J100072K16GCCCATGGGCCTGGNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0203300015-045-F03CCATGGGCTTCNONE 
AK106329CCATGGGCTTCConserved hypothetical protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0303800006-024-G06CCATGGGCNONE 
006-025-F12CCATGGGCNONE 
006-085-E12CCATGGGCNONE 
006-092-F12CCATGGGCNONE 
AK060078CCATGGGCUniversal stress protein (Usp) family protein. 
AK121626CCATGGGCNONE 
J023044K21CCATGGGCNONE 
J023069K09CCATGGGCNONE 
J023091A17CCATGGGCNONE 
J033048C05CCATGGGCNONE 
J033126M13CCATGGGCNONE 
J065040E06CCATGGGCNONE 
J065060D14CCATGGGCNONE 
Os01g0312800AK106887CCATGGGCSimilar to CEL4=CELLULASE 4 (Fragment). 
J065045N15CCATGGGCNONE 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023121K24CCATGGGCCACNONE 
Os01g0513700AK058445ACCGGCCCATGGNONE 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
J023001F01ACCGGCCCATGGNONE 
J065065I18ACCGGCCCATGGNONE 
J065165A09ACCGGCCCATGGNONE 
J065184N12ACCGGCCCATGGNONE 
J065205M05ACCGGCCCATGGNONE 
J075172I17ACCGGCCCATGGNONE 
J090025O09ACCGGCCCATGGNONE 
J100087H03ACCGGCCCATGGNONE 
Os01g0548000AK100868GCCCATGGConserved hypothetical protein. 
AK108360GCCCATGGNONE 
Os01g0590300014-089-E04CCATGGGCTGANONE 
AK063740CCATGGGCTGAConserved hypothetical protein. 
Os01g0674150J065197O06GCCCATGGGCNONE 
J065199N24GCCCATGGGCNONE 
J090055L03GCCCATGGGCConserved hypothetical protein. 
Os01g0700500AK072715GCAGCCCATGGCytochrome P450 family protein. 
AK119264GCAGCCCATGGNONE 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AAGGCCCATGGNONE 
J065007E03AAGGCCCATGGNONE 
J065015A13AAGGCCCATGGNONE 
J065093J17AAGGCCCATGGNONE 
J065116C09AAGGCCCATGGNONE 
J065120E04AAGGCCCATGGNONE 
J065197I17AAGGCCCATGGNONE 
J065208L13AAGGCCCATGGNONE 
J065213P07AAGGCCCATGGNONE 
J075056K07AAGGCCCATGGNONE 
J090036L08AAGGCCCATGGNONE 
Os01g0709500AK065353AAGGCCCATGGNONE 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os01g0721900AK059581TCAGCCCATGGNONE 
J065191A18TCAGCCCATGGNONE 
J100064H01TCAGCCCATGGNONE 
J100075M23TCAGCCCATGGNONE 
J100090A11TCAGCCCATGGNONE 
Os01g0730500AK100064GCCCATGGSimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0736400AK069723GCCCATGGNONE 
AK100689GCCCATGGAminotransferase, class I and II domain containing protein. 
Os01g0737900012-087-D12CCATGGGCNONE 
AK072600CCATGGGCProtein prenyltransferase domain containing protein. 
J023006E12CCATGGGCNONE 
J023130A18CCATGGGCNONE 
J023134O05CCATGGGCNONE 
Os01g0738600AK073479CCATGGGCTENTH/VHS domain containing protein. 
AK073479TTGGCCCATGGENTH/VHS domain containing protein. 
AK120616CCATGGGCTNONE 
AK120616TTGGCCCATGGNONE 
J013046M12CCATGGGCTNONE 
J013046M12TTGGCCCATGGNONE 
J013152B11CCATGGGCTNONE 
J013152B11TTGGCCCATGGNONE 
J023007A09CCATGGGCTNONE 
J023007A09TTGGCCCATGGNONE 
J023007N03CCATGGGCTNONE 
J023007N03TTGGCCCATGGNONE 
J023042A01CCATGGGCTNONE 
J023042A01TTGGCCCATGGNONE 
J023059P06CCATGGGCTNONE 
J023059P06TTGGCCCATGGNONE 
J023113A05CCATGGGCTNONE 
J023113A05TTGGCCCATGGNONE 
J033044K11CCATGGGCTNONE 
J033044K11TTGGCCCATGGNONE 
J033082E04CCATGGGCTNONE 
J033082E04TTGGCCCATGGNONE 
J090033B13CCATGGGCTNONE 
J090033B13TTGGCCCATGGNONE 
J090062H08CCATGGGCTNONE 
J090062H08TTGGCCCATGGNONE 
J100086G23CCATGGGCTNONE 
J100086G23TTGGCCCATGGNONE 
Os01g0787000006-035-E12GCCCATGGNONE 
015-056-B07GCCCATGGNONE 
AK101743GCCCATGGSimilar to Peroxidase (EC 1.11.1.7). 
AK109348GCCCATGGNONE 
J065096L02GCCCATGGNONE 
J065185H10GCCCATGGNONE 
J065186E06GCCCATGGNONE 
J090081I17GCCCATGGNONE 
Os01g0831900011-058-G07CCATGGGCCAGANONE 
AK063959CCATGGGCCAGANONE 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
J033084D13CCATGGGCCAGANONE 
Os01g0834700AK101559CCATGGGCZinc finger, CCCH-type domain containing protein. 
AK106074CCATGGGCNONE 
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH. 
Os01g0856600016-013-C05CCATGGGCNONE 
AK064176CCATGGGCNsp1-like, C-terminal family protein. 
Os01g0863300014-030-D08ATGGCCCATGGNONE 
AK111571ATGGCCCATGGSimilar to MCB2 protein. 
J013071A13ATGGCCCATGGNONE 
J075060E09ATGGCCCATGGNONE 
J075138C14ATGGCCCATGGNONE 
J075150M17ATGGCCCATGGNONE 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0904400AJ535210GCGGCCCATGGNONE 
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog. 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os01g0937300AK062872CCATGGGCCACNONE 
J033136K12CCATGGGCCACNONE 
J053048E20CCATGGGCCACNONE 
J053088K08CCATGGGCCACNONE 
J065011G23CCATGGGCCACNONE 
J065202J09CCATGGGCCACNONE 
Os01g0949700AK069037CCAGCCCATGGNONE 
J023004F17CCAGCCCATGGNONE 
J065063D04CCAGCCCATGGNONE 
J065196H02CCAGCCCATGGNONE 
J075198A05CCAGCCCATGGNONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os01g0971000AK061660GCCCATGGConserved hypothetical protein. 
AK120145GCCCATGGNONE 
J013028J10GCCCATGGNONE 
J013127C22GCCCATGGNONE 
J065028I23GCCCATGGNONE 
J065041P03GCCCATGGNONE 
J065048M20GCCCATGGNONE 
J065048N19GCCCATGGNONE 
J065068A03GCCCATGGNONE 
J065195H10GCCCATGGNONE 
J065209B18GCCCATGGNONE 
J075007K05GCCCATGGNONE 
J075049C23GCCCATGGNONE 
J075082P22GCCCATGGNONE 
J075102H09GCCCATGGNONE 
J100042D11GCCCATGGNONE 
J100057M03GCCCATGGNONE 
Os01g0976700AK068121CCATGGGCTGCNONE 
AK100571CCATGGGCTGCSimilar to Protein phosphatase 2C-like protein. 
Os02g0140200AK066454GCCCATGGSimilar to Beta-amyrin synthase. 
Os02g0141000009-053-C03AGCCCATGGNONE 
AK121058AGCCCATGGAIG2-like family protein. 
J023054F06AGCCCATGGNONE 
J023056J21AGCCCATGGNONE 
J053031K06AGCCCATGGNONE 
J053098J23AGCCCATGGNONE 
J065178E11AGCCCATGGNONE 
Os02g0177700AK119941GCCCATGGCGCACGCGTCTCProtein of unknown function DUF588 family protein. 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0202800011-038-F08AGCCCATGGNONE 
015-041-G02AGCCCATGGNONE 
AK102082AGCCCATGGFAR1 domain containing protein. 
AK102813AGCCCATGGNONE 
AK109243AGCCCATGGNONE 
J033108L18AGCCCATGGNONE 
J033129C24AGCCCATGGNONE 
J065138F15AGCCCATGGNONE 
Os02g0255100AK060458GCCCATGGNONE 
Os02g0288100AK107019GCCCATGGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0441000AK108073CCATGGGCConserved hypothetical protein. 
Os02g0581500AK059396GCCCATGGEpoxide hydrolase family protein. 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0614600AK058581GCCCATGGNONE 
Os02g0655300006-024-H05CCATGGGCCACNONE 
006-032-G04CCATGGGCCACNONE 
006-045-F03CCATGGGCCACNONE 
006-076-D04CCATGGGCCACNONE 
006-086-C09CCATGGGCCACNONE 
006-104-C07CCATGGGCCACNONE 
AK061544CCATGGGCCACNONE 
AK103778CCATGGGCCACNONE 
AK106107CCATGGGCCACNONE 
AK120006CCATGGGCCACNONE 
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21CCATGGGCCACNONE 
J065021C16CCATGGGCCACNONE 
J065182F01CCATGGGCCACNONE 
J075063I18CCATGGGCCACNONE 
J075151E01CCATGGGCCACNONE 
J075198K18CCATGGGCCACNONE 
J090026M06CCATGGGCCACNONE 
J090081H02CCATGGGCCACNONE 
J100061E20CCATGGGCCACNONE 
Os02g0670900003-115-B09GCCCATGGNONE 
005-004-F12GCCCATGGNONE 
006-037-B11GCCCATGGNONE 
006-094-B07GCCCATGGNONE 
011-020-A12GCCCATGGNONE 
AK061649GCCCATGGNONE 
AK061743GCCCATGGNONE 
AK064827GCCCATGGNONE 
AK100650GCCCATGGSimilar to Amino acid transporter protein-like. 
AK119517GCCCATGGNONE 
J013000F07GCCCATGGNONE 
J013027M02GCCCATGGNONE 
J013027M22GCCCATGGNONE 
J013031G16GCCCATGGNONE 
J013044H17GCCCATGGNONE 
J013045G22GCCCATGGNONE 
J013059N20GCCCATGGNONE 
J013063G15GCCCATGGNONE 
J013064J09GCCCATGGNONE 
J013089F14GCCCATGGNONE 
J013099L15GCCCATGGNONE 
J013119A08GCCCATGGNONE 
J013119B13GCCCATGGNONE 
J013126K07GCCCATGGNONE 
J023019J06GCCCATGGNONE 
J023019K19GCCCATGGNONE 
J023038I17GCCCATGGNONE 
J023042O17GCCCATGGNONE 
J023060G23GCCCATGGNONE 
J023064A12GCCCATGGNONE 
J023072G01GCCCATGGNONE 
J023108K16GCCCATGGNONE 
J023111D04GCCCATGGNONE 
J023134O14GCCCATGGNONE 
J023142P09GCCCATGGNONE 
J033039F01GCCCATGGNONE 
J033068J18GCCCATGGNONE 
J033117B05GCCCATGGNONE 
J033118I01GCCCATGGNONE 
J033136E10GCCCATGGNONE 
J033140C15GCCCATGGNONE 
J043024E09GCCCATGGNONE 
J043038B21GCCCATGGNONE 
J090005F19GCCCATGGNONE 
J090022N04GCCCATGGNONE 
J090023F15GCCCATGGNONE 
J090038O19GCCCATGGNONE 
J090042N22GCCCATGGNONE 
J090051C06GCCCATGGNONE 
J090063O09GCCCATGGNONE 
J090079N05GCCCATGGNONE 
J090096L17GCCCATGGNONE 
J100038G08GCCCATGGNONE 
J100041F17GCCCATGGNONE 
J100042G15GCCCATGGNONE 
J100042N11GCCCATGGNONE 
J100048B10GCCCATGGNONE 
J100056C24GCCCATGGNONE 
J100059K07GCCCATGGNONE 
J100069A06GCCCATGGNONE 
J100077B01GCCCATGGNONE 
J100089D17GCCCATGGNONE 
Os02g0697500AK105680GCCCATGGSimilar to Selenium-binding protein-like. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0751600006-048-C01GGGAAAGCCCATGGNONE 
006-059-E07GGGAAAGCCCATGGNONE 
AK060441GGGAAAGCCCATGGNONE 
AK061027GGGAAAGCCCATGGNONE 
AK072946GGGAAAGCCCATGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401GGGAAAGCCCATGGNONE 
J023150D22GGGAAAGCCCATGGNONE 
J075005E17GGGAAAGCCCATGGNONE 
J075019F10GGGAAAGCCCATGGNONE 
J075047K24GGGAAAGCCCATGGNONE 
J075052B13GGGAAAGCCCATGGNONE 
J075063M19GGGAAAGCCCATGGNONE 
J075136P10GGGAAAGCCCATGGNONE 
J075139E24GGGAAAGCCCATGGNONE 
J075152K11GGGAAAGCCCATGGNONE 
J075161A10GGGAAAGCCCATGGNONE 
J075187F20GGGAAAGCCCATGGNONE 
Os02g0753300012-010-H04ATGGCCCATGGNONE 
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein. 
AK104930ATGGCCCATGGNONE 
J013038J04ATGGCCCATGGNONE 
J065041B21ATGGCCCATGGNONE 
J065162K13ATGGCCCATGGNONE 
J065187G18ATGGCCCATGGNONE 
J075051J11ATGGCCCATGGNONE 
J100027H02ATGGCCCATGGNONE 
Os02g0756200AK063454CGGGCCCATGGNONE 
AK101655CGGGCCCATGGSimilar to Phi-1 protein. 
J065104L21CGGGCCCATGGNONE 
J065141A07CGGGCCCATGGNONE 
Os02g0759700AK111935AGCCCATGGNONE 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein. 
Os03g0197000AK071163CCATGGGCTGGConserved hypothetical protein. 
J023079A07CCATGGGCTGGNONE 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE 
AK067356CGCGACGCCATGGGCTTCNONE 
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0305400009-198-D04CCATGGGCNONE 
013-012-C06CCATGGGCNONE 
014-034-D01CCATGGGCNONE 
AK071397CCATGGGCUniversal stress protein (Usp) family protein. 
J023012O22CCATGGGCNONE 
J023097A13CCATGGGCNONE 
J023107P16CCATGGGCNONE 
J023113C14CCATGGGCNONE 
Os03g0306301J065212M16GCCCATGGConserved hypothetical protein. 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
J100033H02CCATGGGCCCACCNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0389700AK061085CCATGGGCCNONE 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0410700J065102A22GCGGCCCATGGNONE 
Os03g0410900J065067F10CCATGGGCCGCNONE 
J065073D08CCATGGGCCGCNONE 
J065176C06CCATGGGCCGCNONE 
J065189O13CCATGGGCCGCNONE 
J065214E05CCATGGGCCGCNONE 
J080007H09CCATGGGCCGCNONE 
J080012B19CCATGGGCCGCNONE 
J080020J16CCATGGGCCGCNONE 
J080038J22CCATGGGCCGCNONE 
J080045I09CCATGGGCCGCNONE 
J080059M16CCATGGGCCGCNONE 
J080060C19CCATGGGCCGCNONE 
J080080P22CCATGGGCCGCNONE 
J080083C03CCATGGGCCGCNONE 
J080093M17CCATGGGCCGCNONE 
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
Os03g0568500AK058939GCCCATGGProtein of unknown function UPF0136, Transmembrane family protein. 
J065036G14GCCCATGGNONE 
J065044A09GCCCATGGNONE 
Os03g0622300AK107931AGCCCATGGGCTGTConserved hypothetical protein. 
J065184K14AGCCCATGGGCTGTNONE 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0668000AK111705TAAGCCCATGGNONE 
AK111783TAAGCCCATGGCyclin-like F-box domain containing protein. 
J023087J12TAAGCCCATGGNONE 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0712400AK106604GCCCATGGGCSimilar to Atypical receptor-like kinase MARK. 
Os03g0726900AK072553CCATGGGCConserved hypothetical protein. 
AK100280CCATGGGCNONE 
Os03g0730500AK066477GCCCATGGNONE 
AK066640GCCCATGGPeptidase S10, serine carboxypeptidase family protein. 
Os03g0736700006-022-F08ATGGCCCATGGNONE 
006-042-H09ATGGCCCATGGNONE 
006-053-H02ATGGCCCATGGNONE 
009-127-A06ATGGCCCATGGNONE 
013-089-C06ATGGCCCATGGNONE 
AK060947ATGGCCCATGGGRAM domain containing protein. 
AK073026ATGGCCCATGGNONE 
AK104415ATGGCCCATGGNONE 
AK104642ATGGCCCATGGNONE 
J065027H19ATGGCCCATGGNONE 
J065059K06ATGGCCCATGGNONE 
J065065I02ATGGCCCATGGNONE 
J065085E10ATGGCCCATGGNONE 
J065140M09ATGGCCCATGGNONE 
J075115M21ATGGCCCATGGNONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0757900011-060-H04GTGGCCCATGGNONE 
011-082-B10GTGGCCCATGGNONE 
012-053-F12GTGGCCCATGGNONE 
013-029-C07GTGGCCCATGGNONE 
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
J023009B02GTGGCCCATGGNONE 
J023085H11GTGGCCCATGGNONE 
J023135M18GTGGCCCATGGNONE 
J023147P04GTGGCCCATGGNONE 
J033072J22GTGGCCCATGGNONE 
J033128J06GTGGCCCATGGNONE 
Os03g0769600AK100054CCATGGGCCACResB-like family protein. 
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0824400AK070153CACGGCCCATGGNONE 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0833500AK119356CCATGGGCTGGSimilar to 98kDa HDM allergen. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850100AK101126AGCCCATGGNLI interacting factor domain containing protein. 
Os03g0855600006-029-G09GTGGCCCATGGNONE 
006-033-E02GTGGCCCATGGNONE 
006-069-G07GTGGCCCATGGNONE 
006-083-A02GTGGCCCATGGNONE 
006-098-H04GTGGCCCATGGNONE 
009-054-C04GTGGCCCATGGNONE 
AK060030GTGGCCCATGGNONE 
AK061467GTGGCCCATGGConserved hypothetical protein. 
AK067858GTGGCCCATGGNONE 
AK106030GTGGCCCATGGNONE 
J013123A10GTGGCCCATGGNONE 
J065001I24GTGGCCCATGGNONE 
J065015N21GTGGCCCATGGNONE 
J065016H07GTGGCCCATGGNONE 
J065040A05GTGGCCCATGGNONE 
J065040F01GTGGCCCATGGNONE 
J065066G17GTGGCCCATGGNONE 
J065077I09GTGGCCCATGGNONE 
J065099M22GTGGCCCATGGNONE 
J065135B13GTGGCCCATGGNONE 
J065144H19GTGGCCCATGGNONE 
J065146I03GTGGCCCATGGNONE 
J065169E02GTGGCCCATGGNONE 
J065177D21GTGGCCCATGGNONE 
J065189L20GTGGCCCATGGNONE 
J065207H13GTGGCCCATGGNONE 
J065210D24GTGGCCCATGGNONE 
J065212I03GTGGCCCATGGNONE 
J075007E21GTGGCCCATGGNONE 
J075013H07GTGGCCCATGGNONE 
J075023K06GTGGCCCATGGNONE 
J075031D23GTGGCCCATGGNONE 
J075038K09GTGGCCCATGGNONE 
J075084C08GTGGCCCATGGNONE 
J075098K20GTGGCCCATGGNONE 
J090028E04GTGGCCCATGGNONE 
J090031E20GTGGCCCATGGNONE 
J090042F06GTGGCCCATGGNONE 
J090049L05GTGGCCCATGGNONE 
J090086G03GTGGCCCATGGNONE 
J090096J04GTGGCCCATGGNONE 
J100035O03GTGGCCCATGGNONE 
J100053H24GTGGCCCATGGNONE 
J100056L17GTGGCCCATGGNONE 
J100058K06GTGGCCCATGGNONE 
J100059G09GTGGCCCATGGNONE 
J100081C15GTGGCCCATGGNONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0220300AK058435GCCCATGGGCTConserved hypothetical protein. 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0476400J033082D17CCATGGGCCGANONE 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0481800AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24TCGGCCCATGGNONE 
Os04g0494600AK110895AGCCCATGGGCTTCProtein of unknown function DUF642 family protein. 
Os04g0528100009-090-G06CCATGGGCCTCNONE 
009-168-C11CCATGGGCCTCNONE 
AK065957CCATGGGCCTCConserved hypothetical protein. 
J013039G20CCATGGGCCTCNONE 
J013044D08CCATGGGCCTCNONE 
J065013L14CCATGGGCCTCNONE 
J065143H08CCATGGGCCTCNONE 
J065146C14CCATGGGCCTCNONE 
J065149K22CCATGGGCCTCNONE 
J065156B18CCATGGGCCTCNONE 
J065201A04CCATGGGCCTCNONE 
J065209A04CCATGGGCCTCNONE 
Os04g0551800016-049-G12CCATGGGCGAGGNONE 
AK121568CCATGGGCGAGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CCATGGGCGAGGNONE 
J013111B11CCATGGGCGAGGNONE 
J013121H23CCATGGGCGAGGNONE 
J023012A17CCATGGGCGAGGNONE 
J023092M05CCATGGGCGAGGNONE 
J033026P14CCATGGGCGAGGNONE 
J033033C10CCATGGGCGAGGNONE 
J033033M10CCATGGGCGAGGNONE 
J033035C24CCATGGGCGAGGNONE 
J033052E19CCATGGGCGAGGNONE 
J033140K19CCATGGGCGAGGNONE 
J065036F18CCATGGGCGAGGNONE 
J065067L12CCATGGGCGAGGNONE 
J065095G09CCATGGGCGAGGNONE 
J065115B08CCATGGGCGAGGNONE 
J065218E24CCATGGGCGAGGNONE 
J090002N13CCATGGGCGAGGNONE 
J090008B12CCATGGGCGAGGNONE 
J090016F24CCATGGGCGAGGNONE 
J090019H14CCATGGGCGAGGNONE 
J090020G20CCATGGGCGAGGNONE 
J090029L18CCATGGGCGAGGNONE 
J090057C23CCATGGGCGAGGNONE 
J090073H23CCATGGGCGAGGNONE 
J090081C16CCATGGGCGAGGNONE 
J090081E21CCATGGGCGAGGNONE 
J090084L14CCATGGGCGAGGNONE 
J090086M01CCATGGGCGAGGNONE 
J090089E16CCATGGGCGAGGNONE 
J100031P12CCATGGGCGAGGNONE 
J100090N23CCATGGGCGAGGNONE 
Os04g0636900011-028-G03CCATGGGCCTTNONE 
012-040-G03CCATGGGCCTTNONE 
AK058405CCATGGGCCTTNONE 
AK065789CCATGGGCCTTNONE 
AK101408CCATGGGCCTTNONE 
AK119286CCATGGGCCTTNONE 
J013042J24CCATGGGCCTTNONE 
J033037I12CCATGGGCCTTNONE 
J043031B12CCATGGGCCTTNONE 
J065152N10CCATGGGCCTTNONE 
J090060K17CCATGGGCCTTNONE 
J090083K14CCATGGGCCTTNONE 
J100046O13CCATGGGCCTTNONE 
J100066G22CCATGGGCCTTNONE 
Os04g0656800011-008-B09AGCCCATGGNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein. 
J100055P09CCATGGGCGGCCCACANONE 
J100057O12CCATGGGCGGCCCACANONE 
J100067H07CCATGGGCGGCCCACANONE 
J100070D06CCATGGGCGGCCCACANONE 
J100071J16CCATGGGCGGCCCACANONE 
J100072C15CCATGGGCGGCCCACANONE 
Os04g0674350J065104O14TCTCGGCCCATGGNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0138000AK120814GCCCATGGConserved hypothetical protein. 
J023014M12GCCCATGGNONE 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
Os05g0162500AK067124CCATGGGCProtein kinase-like domain containing protein. 
J013072E19CCATGGGCNONE 
J013098L04CCATGGGCNONE 
J023002B02CCATGGGCNONE 
J023012O16CCATGGGCNONE 
J033107H18CCATGGGCNONE 
J065154H15CCATGGGCNONE 
J065157K22CCATGGGCNONE 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0349000AK070681CCATGGGCGTTGGGCCTCConserved hypothetical protein. 
AK120753CCATGGGCGTTGGGCCTCNONE 
J023006K02CCATGGGCGTTGGGCCTCNONE 
J023063E02CCATGGGCGTTGGGCCTCNONE 
J043003J19CCATGGGCGTTGGGCCTCNONE 
Os05g0383100AK121835AGCCCATGGGCTClathrin adaptor complex, medium chain family protein. 
AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0456300006-096-G05GTGGCCCATGGNONE 
006-108-F09GTGGCCCATGGNONE 
AK061843GTGGCCCATGGNONE 
AK068616GTGGCCCATGGSimilar to Aldose reductase. 
J013156J23GTGGCCCATGGNONE 
J023080O21GTGGCCCATGGNONE 
J043031L21GTGGCCCATGGNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033143O14GAGGCCCATGGGCCATNONE 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK101531CCATGGGCCTTNONE 
J033030F10CCATGGGCCTTNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK107350CCATGGGCCTTNONE 
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE 
012-009-E07GCGTGGGCCCATGGNONE 
012-096-B01GCGTGGGCCCATGGNONE 
AK059614GCGTGGGCCCATGGNONE 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
J033040P21GCGTGGGCCCATGGNONE 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0130000AK064427CCATGGGCNONE 
AK070084CCATGGGCNONE 
AK119321CCATGGGCSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0134000AK102796CCATGGGCCAGNONE 
Os06g0137500AK072896ACAGCCCATGGGCBrix domain containing protein. 
AK121945ACAGCCCATGGGCNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0181500AK068950GCCCATGGNONE 
AK100878GCCCATGGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16GCCCATGGNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0219900AK058704CCATGGGCSimilar to Phi-1 protein. 
Os06g0220800AK059876CCATGGGCCCCNONE 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
J075093C09CCATGGGCCCCNONE 
J100026J18CCATGGGCCCCNONE 
J100041O16CCATGGGCCCCNONE 
J100089K16CCATGGGCCCCNONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J075006K03AATTGGGCCCATGGNONE 
J075067F07AATTGGGCCCATGGNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068H14AATTGGGCCCATGGNONE 
J075098N06AATTGGGCCCATGGNONE 
J075099F08AATTGGGCCCATGGNONE 
J075154G24AATTGGGCCCATGGNONE 
J075195H09AATTGGGCCCATGGNONE 
Os06g0338900016-067-B02TCTGGACCATGGGCCGANONE 
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein. 
J013058L01TCTGGACCATGGGCCGANONE 
J013135N01TCTGGACCATGGGCCGANONE 
J023123E15TCTGGACCATGGGCCGANONE 
J033051J01TCTGGACCATGGGCCGANONE 
J090002O21TCTGGACCATGGGCCGANONE 
J090013F06TCTGGACCATGGGCCGANONE 
J090056F16TCTGGACCATGGGCCGANONE 
J090081G13TCTGGACCATGGGCCGANONE 
J090090P21TCTGGACCATGGGCCGANONE 
J100039F05TCTGGACCATGGGCCGANONE 
J100059J03TCTGGACCATGGGCCGANONE 
Os06g0556600AK072511GCCCATGGSimilar to Pollen allergen Phl p 11. 
J023077F02GCCCATGGNONE 
J023132A12GCCCATGGNONE 
Os06g0608700005-001-A05GCCCATGGNONE 
005-019-A07GCCCATGGNONE 
006-036-A06GCCCATGGNONE 
AK058288GCCCATGGNONE 
AK058302GCCCATGGNONE 
AK064989GCCCATGGSimilar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13). 
AK104381GCCCATGGNONE 
J013001D08GCCCATGGNONE 
J013029A21GCCCATGGNONE 
J013045K06GCCCATGGNONE 
J013060N12GCCCATGGNONE 
J013066O09GCCCATGGNONE 
J013073A17GCCCATGGNONE 
J013095B08GCCCATGGNONE 
J013105B15GCCCATGGNONE 
J013124E11GCCCATGGNONE 
J013153O07GCCCATGGNONE 
J013157H19GCCCATGGNONE 
J023007I10GCCCATGGNONE 
J023028A13GCCCATGGNONE 
J023052D09GCCCATGGNONE 
J023067K10GCCCATGGNONE 
J023087A18GCCCATGGNONE 
J023087E22GCCCATGGNONE 
J065023D07GCCCATGGNONE 
J065084F21GCCCATGGNONE 
J065116B13GCCCATGGNONE 
J065188G18GCCCATGGNONE 
J080001F22GCCCATGGNONE 
J080001H04GCCCATGGNONE 
J080013D13GCCCATGGNONE 
J080025B20GCCCATGGNONE 
J080025N19GCCCATGGNONE 
J080029C09GCCCATGGNONE 
J080029D04GCCCATGGNONE 
J080038P07GCCCATGGNONE 
J080053I03GCCCATGGNONE 
J080054B02GCCCATGGNONE 
J080057B13GCCCATGGNONE 
J080059O09GCCCATGGNONE 
J080064K18GCCCATGGNONE 
J080072F14GCCCATGGNONE 
J080074H03GCCCATGGNONE 
J080074O15GCCCATGGNONE 
J080079A02GCCCATGGNONE 
J080079I05GCCCATGGNONE 
J080080D11GCCCATGGNONE 
Os06g0609700AK067228AGCCCATGGEsterase/lipase/thioesterase domain containing protein. 
Os06g0673500J100018J12CCATGGGCCTTNONE 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
Os06g0694400AK065599GCCCATGGNONE 
AK120261GCCCATGGConserved hypothetical protein. 
J075019F13GCCCATGGNONE 
J075121H11GCCCATGGNONE 
J075188O15GCCCATGGNONE 
J075194O13GCCCATGGNONE 
J100017M20GCCCATGGNONE 
J100026G05GCCCATGGNONE 
J100032G09GCCCATGGNONE 
J100044M02GCCCATGGNONE 
J100064A07GCCCATGGNONE 
J100066K20GCCCATGGNONE 
J100082M20GCCCATGGNONE 
J100084A14GCCCATGGNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0698300AK071637CCATGGGCProtein phosphatase 2C family protein. 
J023098M15CCATGGGCNONE 
J023101G03CCATGGGCNONE 
J023139A04CCATGGGCNONE 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE 
AK065121GACACGTGAAGGCCCATGGNONE 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GACACGTGAAGGCCCATGGNONE 
AY302112GACACGTGAAGGCCCATGGNONE 
D10752GACACGTGAAGGCCCATGGNONE 
D11082GACACGTGAAGGCCCATGGNONE 
J013031L12GACACGTGAAGGCCCATGGNONE 
J013042M09GACACGTGAAGGCCCATGGNONE 
J013058E01GACACGTGAAGGCCCATGGNONE 
J013058O09GACACGTGAAGGCCCATGGNONE 
J013063J17GACACGTGAAGGCCCATGGNONE 
J013066I24GACACGTGAAGGCCCATGGNONE 
J013069F17GACACGTGAAGGCCCATGGNONE 
J013106E01GACACGTGAAGGCCCATGGNONE 
J013118D19GACACGTGAAGGCCCATGGNONE 
J013162M11GACACGTGAAGGCCCATGGNONE 
J023028B19GACACGTGAAGGCCCATGGNONE 
J023031A13GACACGTGAAGGCCCATGGNONE 
J023047H18GACACGTGAAGGCCCATGGNONE 
J023059N10GACACGTGAAGGCCCATGGNONE 
J023104N22GACACGTGAAGGCCCATGGNONE 
J033025J03GACACGTGAAGGCCCATGGNONE 
J033045B05GACACGTGAAGGCCCATGGNONE 
J033067M08GACACGTGAAGGCCCATGGNONE 
J033113D04GACACGTGAAGGCCCATGGNONE 
J043003D11GACACGTGAAGGCCCATGGNONE 
J043009O20GACACGTGAAGGCCCATGGNONE 
J043016P06GACACGTGAAGGCCCATGGNONE 
J043017C21GACACGTGAAGGCCCATGGNONE 
J043017J20GACACGTGAAGGCCCATGGNONE 
J043021P15GACACGTGAAGGCCCATGGNONE 
J043026I22GACACGTGAAGGCCCATGGNONE 
J043032L15GACACGTGAAGGCCCATGGNONE 
J043034G14GACACGTGAAGGCCCATGGNONE 
J043039L16GACACGTGAAGGCCCATGGNONE 
J075003D02GACACGTGAAGGCCCATGGNONE 
J075003O22GACACGTGAAGGCCCATGGNONE 
J075005I24GACACGTGAAGGCCCATGGNONE 
J075006N09GACACGTGAAGGCCCATGGNONE 
J075011A22GACACGTGAAGGCCCATGGNONE 
J075012K24GACACGTGAAGGCCCATGGNONE 
J075017D01GACACGTGAAGGCCCATGGNONE 
J075017I23GACACGTGAAGGCCCATGGNONE 
J075023D17GACACGTGAAGGCCCATGGNONE 
J075024B03GACACGTGAAGGCCCATGGNONE 
J075025H05GACACGTGAAGGCCCATGGNONE 
J075031D19GACACGTGAAGGCCCATGGNONE 
J075034B02GACACGTGAAGGCCCATGGNONE 
J075035C02GACACGTGAAGGCCCATGGNONE 
J075037J12GACACGTGAAGGCCCATGGNONE 
J075038M11GACACGTGAAGGCCCATGGNONE 
J075039J17GACACGTGAAGGCCCATGGNONE 
J075042P10GACACGTGAAGGCCCATGGNONE 
J075046J20GACACGTGAAGGCCCATGGNONE 
J075047F21GACACGTGAAGGCCCATGGNONE 
J075053E05GACACGTGAAGGCCCATGGNONE 
J075054D11GACACGTGAAGGCCCATGGNONE 
J075054K06GACACGTGAAGGCCCATGGNONE 
J075059E15GACACGTGAAGGCCCATGGNONE 
J075061O04GACACGTGAAGGCCCATGGNONE 
J075062I20GACACGTGAAGGCCCATGGNONE 
J075066I12GACACGTGAAGGCCCATGGNONE 
J075066L06GACACGTGAAGGCCCATGGNONE 
J075071H12GACACGTGAAGGCCCATGGNONE 
J075071N19GACACGTGAAGGCCCATGGNONE 
J075074K01GACACGTGAAGGCCCATGGNONE 
J075077H22GACACGTGAAGGCCCATGGNONE 
J075083H18GACACGTGAAGGCCCATGGNONE 
J075085F04GACACGTGAAGGCCCATGGNONE 
J075085K09GACACGTGAAGGCCCATGGNONE 
J075086C06GACACGTGAAGGCCCATGGNONE 
J075086E06GACACGTGAAGGCCCATGGNONE 
J075087A15GACACGTGAAGGCCCATGGNONE 
J075090N02GACACGTGAAGGCCCATGGNONE 
J075090N22GACACGTGAAGGCCCATGGNONE 
J075091C04GACACGTGAAGGCCCATGGNONE 
J075091G16GACACGTGAAGGCCCATGGNONE 
J075097E04GACACGTGAAGGCCCATGGNONE 
J075099E04GACACGTGAAGGCCCATGGNONE 
J075102P22GACACGTGAAGGCCCATGGNONE 
J075109B08GACACGTGAAGGCCCATGGNONE 
J075109J02GACACGTGAAGGCCCATGGNONE 
J075115I12GACACGTGAAGGCCCATGGNONE 
J075117E17GACACGTGAAGGCCCATGGNONE 
J075123C07GACACGTGAAGGCCCATGGNONE 
J075124N05GACACGTGAAGGCCCATGGNONE 
J075125E12GACACGTGAAGGCCCATGGNONE 
J075126B11GACACGTGAAGGCCCATGGNONE 
J075129E14GACACGTGAAGGCCCATGGNONE 
J075130N15GACACGTGAAGGCCCATGGNONE 
J075131I07GACACGTGAAGGCCCATGGNONE 
J075141B13GACACGTGAAGGCCCATGGNONE 
J075141B20GACACGTGAAGGCCCATGGNONE 
J075144D23GACACGTGAAGGCCCATGGNONE 
J075144N01GACACGTGAAGGCCCATGGNONE 
J075147M24GACACGTGAAGGCCCATGGNONE 
J075148L16GACACGTGAAGGCCCATGGNONE 
J075151A22GACACGTGAAGGCCCATGGNONE 
J075151D03GACACGTGAAGGCCCATGGNONE 
J075151D04GACACGTGAAGGCCCATGGNONE 
J075153E23GACACGTGAAGGCCCATGGNONE 
J075156D02GACACGTGAAGGCCCATGGNONE 
J075156P05GACACGTGAAGGCCCATGGNONE 
J075162E23GACACGTGAAGGCCCATGGNONE 
J075165J22GACACGTGAAGGCCCATGGNONE 
J075166A06GACACGTGAAGGCCCATGGNONE 
J075168H13GACACGTGAAGGCCCATGGNONE 
J075170D04GACACGTGAAGGCCCATGGNONE 
J075171C19GACACGTGAAGGCCCATGGNONE 
J075173B12GACACGTGAAGGCCCATGGNONE 
J075173M23GACACGTGAAGGCCCATGGNONE 
J075174C03GACACGTGAAGGCCCATGGNONE 
J075185O11GACACGTGAAGGCCCATGGNONE 
J075186G21GACACGTGAAGGCCCATGGNONE 
J075187D06GACACGTGAAGGCCCATGGNONE 
J075195G21GACACGTGAAGGCCCATGGNONE 
J090003D18GACACGTGAAGGCCCATGGNONE 
J090005I12GACACGTGAAGGCCCATGGNONE 
J090007D15GACACGTGAAGGCCCATGGNONE 
J090007G20GACACGTGAAGGCCCATGGNONE 
J090014G13GACACGTGAAGGCCCATGGNONE 
J090014L08GACACGTGAAGGCCCATGGNONE 
J090016J03GACACGTGAAGGCCCATGGNONE 
J090023P22GACACGTGAAGGCCCATGGNONE 
J090025C19GACACGTGAAGGCCCATGGNONE 
J090028F11GACACGTGAAGGCCCATGGNONE 
J090028G01GACACGTGAAGGCCCATGGNONE 
J090028H02GACACGTGAAGGCCCATGGNONE 
J090037I11GACACGTGAAGGCCCATGGNONE 
J090040F21GACACGTGAAGGCCCATGGNONE 
J090040N24GACACGTGAAGGCCCATGGNONE 
J090044M12GACACGTGAAGGCCCATGGNONE 
J090045B13GACACGTGAAGGCCCATGGNONE 
J090045M22GACACGTGAAGGCCCATGGNONE 
J090048C10GACACGTGAAGGCCCATGGNONE 
J090051J02GACACGTGAAGGCCCATGGNONE 
J090058O15GACACGTGAAGGCCCATGGNONE 
J090062F11GACACGTGAAGGCCCATGGNONE 
J090067D23GACACGTGAAGGCCCATGGNONE 
J090069G15GACACGTGAAGGCCCATGGNONE 
J090072I06GACACGTGAAGGCCCATGGNONE 
J090073H18GACACGTGAAGGCCCATGGNONE 
J090073L01GACACGTGAAGGCCCATGGNONE 
J090075O21GACACGTGAAGGCCCATGGNONE 
J090084K24GACACGTGAAGGCCCATGGNONE 
J090087P11GACACGTGAAGGCCCATGGNONE 
J090092B17GACACGTGAAGGCCCATGGNONE 
J100042H08GACACGTGAAGGCCCATGGNONE 
Os06g0730900AK062118GTGGCCCATGGNONE 
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
AK065172GTGGCCCATGGNONE 
AK099361GTGGCCCATGGNONE 
Os07g0118900009-112-E11GCCCATGGNONE 
AK063837GCCCATGGNONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0137900011-017-E12GCCCATGGNONE 
015-003-E11GCCCATGGNONE 
015-024-A08GCCCATGGNONE 
AK072448GCCCATGGNONE 
J023114G23GCCCATGGNONE 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0213400003-104-B01CCATGGGCNONE 
AK062273CCATGGGCConserved hypothetical protein. 
J065122P17CCATGGGCNONE 
J065160A01CCATGGGCNONE 
J090065M11CCATGGGCNONE 
Os07g0245100J023048C16CCATGGGCCCACTTGNONE 
J023110L14CCATGGGCCCACTTGNONE 
J053023B18CCATGGGCCCACTTGNONE 
J053031L17CCATGGGCCCACTTGNONE 
J065035I22CCATGGGCCCACTTGNONE 
J065043D21CCATGGGCCCACTTGNONE 
J065072L16CCATGGGCCCACTTGNONE 
J065214I23CCATGGGCCCACTTGNONE 
Os07g0257200AK070788GCCCATGGSimilar to OsNramp1 (Integral membrane protein). 
J023064O13GCCCATGGNONE 
J090040J06GCCCATGGNONE 
J090071P07GCCCATGGNONE 
J100036G17GCCCATGGNONE 
J100055E18GCCCATGGNONE 
J100062N13GCCCATGGNONE 
J100087P04GCCCATGGNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein. 
Os07g0408100AK108466GCCGGCCCATGGNONE 
AK111780GCCGGCCCATGGWD40-like domain containing protein. 
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
Os07g0498300009-045-C02CCATGGGCTTCNONE 
009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09CCATGGGCTTCNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04CCATGGGCTTCNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09CCATGGGCTTCNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02CCATGGGCTTCNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124CCATGGGCTTCConserved hypothetical protein. 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800CCATGGGCTTCNONE 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18CCATGGGCTTCNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21CCATGGGCTTCNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03CCATGGGCTTCNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22CCATGGGCTTCNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12CCATGGGCTTCNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01CCATGGGCTTCNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0521800J100058N12GCCCATGGDisease resistance protein family protein. 
Os07g0530700AK060014CCATGGGCTTCNONE 
AK099533CCATGGGCTTCConserved hypothetical protein. 
Os07g0533800016-078-C05GCCCATGGNONE 
AK064277GCCCATGGPeptidase A1, pepsin family protein. 
J100040M23GCCCATGGNONE 
J100058K11GCCCATGGNONE 
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0597000009-013-A01GCCCATGGNONE 
009-077-A02GCCCATGGNONE 
009-195-H04GCCCATGGNONE 
AF094773GCCCATGGNONE 
AK062134GCCCATGGNONE 
AK103429GCCCATGGSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19GCCCATGGNONE 
J013152D01GCCCATGGNONE 
J023024K09GCCCATGGNONE 
J023058J15GCCCATGGNONE 
J023097I07GCCCATGGNONE 
J023132B05GCCCATGGNONE 
J033065L11GCCCATGGNONE 
J033086B12GCCCATGGNONE 
J033128M07GCCCATGGNONE 
J043010M23GCCCATGGNONE 
J043024A05GCCCATGGNONE 
J053057P08GCCCATGGNONE 
J065022G24GCCCATGGNONE 
J065028I10GCCCATGGNONE 
J065065D08GCCCATGGNONE 
J065103D22GCCCATGGNONE 
J065153K16GCCCATGGNONE 
J065210B16GCCCATGGNONE 
J075015H18GCCCATGGNONE 
J075102C14GCCCATGGNONE 
J080302G09GCCCATGGNONE 
J080302L20GCCCATGGNONE 
J080303K11GCCCATGGNONE 
J080312C18GCCCATGGNONE 
J080316F08GCCCATGGNONE 
J090023I05GCCCATGGNONE 
J090023I07GCCCATGGNONE 
J090053C21GCCCATGGNONE 
J090067J22GCCCATGGNONE 
J090070E24GCCCATGGNONE 
J090078H04GCCCATGGNONE 
J090089P06GCCCATGGNONE 
J090092E21GCCCATGGNONE 
J100014G01GCCCATGGNONE 
J100022L20GCCCATGGNONE 
J100024I05GCCCATGGNONE 
J100025L08GCCCATGGNONE 
J100030J03GCCCATGGNONE 
J100031K12GCCCATGGNONE 
J100036N01GCCCATGGNONE 
J100050C23GCCCATGGNONE 
J100062G12GCCCATGGNONE 
J100067L17GCCCATGGNONE 
J100074O09GCCCATGGNONE 
Os07g0603100AK101352GCGGCCCATGGNuclear transport factor 2 domain containing protein. 
J023077E09GCGGCCCATGGNONE 
J023081N15GCGGCCCATGGNONE 
J033022N22GCGGCCCATGGNONE 
J033024M18GCGGCCCATGGNONE 
J033034P09GCGGCCCATGGNONE 
J033046A06GCGGCCCATGGNONE 
J033051K01GCGGCCCATGGNONE 
J033081P09GCGGCCCATGGNONE 
J033091B17GCGGCCCATGGNONE 
J033092K23GCGGCCCATGGNONE 
J033132J09GCGGCCCATGGNONE 
J033144A14GCGGCCCATGGNONE 
J033145A14GCGGCCCATGGNONE 
J043021B20GCGGCCCATGGNONE 
J053024D23GCGGCCCATGGNONE 
J065212J10GCGGCCCATGGNONE 
J090055M05GCGGCCCATGGNONE 
J090065E14GCGGCCCATGGNONE 
J090092J06GCGGCCCATGGNONE 
Os07g0607200AK065746GCCCATGGProtein of unknown function DUF751 family protein. 
J065037B15GCCCATGGNONE 
J065042E20GCCCATGGNONE 
J065161I08GCCCATGGNONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0627100AK119510GCCCATGGConserved hypothetical protein. 
Os07g0635500011-089-H07ATGGCCCATGGNONE 
016-030-A09ATGGCCCATGGNONE 
AK106081ATGGCCCATGGNONE 
AK121733ATGGCCCATGGSimilar to Cytochrome P450. 
J043036I03ATGGCCCATGGNONE 
J065001N22ATGGCCCATGGNONE 
J065035I03ATGGCCCATGGNONE 
J065167G12ATGGCCCATGGNONE 
J075041E07ATGGCCCATGGNONE 
J090007D08ATGGCCCATGGNONE 
J090089I24ATGGCCCATGGNONE 
J100026I23ATGGCCCATGGNONE 
J100027H19ATGGCCCATGGNONE 
J100044G07ATGGCCCATGGNONE 
J100089H22ATGGCCCATGGNONE 
J100090D03ATGGCCCATGGNONE 
J100090D22ATGGCCCATGGNONE 
Os07g0686600AK108527TGGGTCCCATGGGCCATVQ domain containing protein. 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0140300AK069031GCCCATGGSimilar to Tryptophan decarboxylase. 
J023003D15GCCCATGGNONE 
J053039H11GCCCATGGNONE 
Os08g0154200AK103192CAGGCCCATGGConserved hypothetical protein. 
J033121O14CAGGCCCATGGNONE 
Os08g0270200AK101221CCATGGGCTGGExosome-associated family protein. 
J090067H03CCATGGGCTGGNONE 
Os08g0372900AK073868CCATGGGCNONE 
AK102881CCATGGGCSimilar to Rhodopsin (Fragment). 
Os08g0435800AK121712TCCGGCCCATGGSimilar to Lipoate protein ligase-like protein. 
J065121P15TCCGGCCCATGGNONE 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0521400006-047-C11TAAGCCCATGGNONE 
016-014-E07TAAGCCCATGGNONE 
AK070148TAAGCCCATGGNONE 
AK101704TAAGCCCATGGZinc finger, RanBP2-type domain containing protein. 
AK105045TAAGCCCATGGNONE 
J013108K14TAAGCCCATGGNONE 
J013129E16TAAGCCCATGGNONE 
J013159M23TAAGCCCATGGNONE 
J023041G22TAAGCCCATGGNONE 
J033060G13TAAGCCCATGGNONE 
J033060J15TAAGCCCATGGNONE 
J065120J24TAAGCCCATGGNONE 
J065160I01TAAGCCCATGGNONE 
J065179A16TAAGCCCATGGNONE 
J065189K04TAAGCCCATGGNONE 
J090032O15TAAGCCCATGGNONE 
J090045A18TAAGCCCATGGNONE 
J090060B21TAAGCCCATGGNONE 
J090086F23TAAGCCCATGGNONE 
J090098O22TAAGCCCATGGNONE 
J100018K20TAAGCCCATGGNONE 
J100048P22TAAGCCCATGGNONE 
J100052I06TAAGCCCATGGNONE 
Os08g0548900006-043-D07CCATGGGCCCATGGNONE 
006-043-D07CCATGGGCTTTNONE 
006-043-D07TCCGGCCCATGGGCCAANONE 
006-043-H11CCATGGGCCCATGGNONE 
006-043-H11CCATGGGCTTTNONE 
006-043-H11TCCGGCCCATGGGCCAANONE 
006-081-G06CCATGGGCCCATGGNONE 
006-081-G06CCATGGGCTTTNONE 
006-081-G06TCCGGCCCATGGGCCAANONE 
006-109-E04CCATGGGCCCATGGNONE 
006-109-E04CCATGGGCTTTNONE 
006-109-E04TCCGGCCCATGGGCCAANONE 
011-033-E04CCATGGGCCCATGGNONE 
011-033-E04CCATGGGCTTTNONE 
011-033-E04TCCGGCCCATGGGCCAANONE 
AK061808CCATGGGCCCATGGSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK061808CCATGGGCTTTSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCCCATGGNONE 
AK098875CCATGGGCTTTNONE 
AK098875TCCGGCCCATGGGCCAANONE 
J013001D12CCATGGGCCCATGGNONE 
J013001D12CCATGGGCTTTNONE 
J013001D12TCCGGCCCATGGGCCAANONE 
J033126N14CCATGGGCCCATGGNONE 
J033126N14CCATGGGCTTTNONE 
J033126N14TCCGGCCCATGGGCCAANONE 
J053069M09CCATGGGCCCATGGNONE 
J053069M09CCATGGGCTTTNONE 
J053069M09TCCGGCCCATGGGCCAANONE 
J053098E10CCATGGGCCCATGGNONE 
J053098E10CCATGGGCTTTNONE 
J053098E10TCCGGCCCATGGGCCAANONE 
J053101C24CCATGGGCCCATGGNONE 
J053101C24CCATGGGCTTTNONE 
J053101C24TCCGGCCCATGGGCCAANONE 
J065002F21CCATGGGCCCATGGNONE 
J065002F21CCATGGGCTTTNONE 
J065002F21TCCGGCCCATGGGCCAANONE 
J065006C22CCATGGGCCCATGGNONE 
J065006C22CCATGGGCTTTNONE 
J065006C22TCCGGCCCATGGGCCAANONE 
J065076J02CCATGGGCCCATGGNONE 
J065076J02CCATGGGCTTTNONE 
J065076J02TCCGGCCCATGGGCCAANONE 
J065134M22CCATGGGCCCATGGNONE 
J065134M22CCATGGGCTTTNONE 
J065134M22TCCGGCCCATGGGCCAANONE 
J075007M19CCATGGGCCCATGGNONE 
J075007M19CCATGGGCTTTNONE 
J075007M19TCCGGCCCATGGGCCAANONE 
J075040I11CCATGGGCCCATGGNONE 
J075040I11CCATGGGCTTTNONE 
J075040I11TCCGGCCCATGGGCCAANONE 
J075047E20CCATGGGCCCATGGNONE 
J075047E20CCATGGGCTTTNONE 
J075047E20TCCGGCCCATGGGCCAANONE 
J075052D22CCATGGGCCCATGGNONE 
J075052D22CCATGGGCTTTNONE 
J075052D22TCCGGCCCATGGGCCAANONE 
J075076L13CCATGGGCCCATGGNONE 
J075076L13CCATGGGCTTTNONE 
J075076L13TCCGGCCCATGGGCCAANONE 
J075157P22CCATGGGCCCATGGNONE 
J075157P22CCATGGGCTTTNONE 
J075157P22TCCGGCCCATGGGCCAANONE 
J075161M18CCATGGGCCCATGGNONE 
J075161M18CCATGGGCTTTNONE 
J075161M18TCCGGCCCATGGGCCAANONE 
J075168P22CCATGGGCCCATGGNONE 
J075168P22CCATGGGCTTTNONE 
J075168P22TCCGGCCCATGGGCCAANONE 
J075181E04CCATGGGCCCATGGNONE 
J075181E04CCATGGGCTTTNONE 
J075181E04TCCGGCCCATGGGCCAANONE 
U92540CCATGGGCCCATGGNONE 
U92540CCATGGGCTTTNONE 
U92540TCCGGCCCATGGGCCAANONE 
Os08g0557000AK059917AGCCCATGGNONE 
AK059917TCCGGCCCATGGNONE 
AK100496AGCCCATGGSimilar to Protein-L-isoaspartate O-methyltransferase. 
AK100496TCCGGCCCATGGSimilar to Protein-L-isoaspartate O-methyltransferase. 
Os09g0251800006-100-E12AGCCCATGGCCCATGGNONE 
AK061218AGCCCATGGCCCATGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010AGCCCATGGCCCATGGNONE 
J065048A02AGCCCATGGCCCATGGNONE 
J065073P10AGCCCATGGCCCATGGNONE 
J065075B09AGCCCATGGCCCATGGNONE 
J065112B05AGCCCATGGCCCATGGNONE 
J090014H10AGCCCATGGCCCATGGNONE 
Os09g0392000AK120392CCATGGGCCCAGCConserved hypothetical protein. 
J013074N02CCATGGGCCCAGCNONE 
Os09g0397900AK101306AGGGCCCATGGGCTSimilar to FEG protein. 
Os09g0403000AK111051CCATGGGCConserved hypothetical protein. 
Os09g0445600AK107839GTGGGGCCCATGGConserved hypothetical protein. 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0501100009-126-C12GAGGCCCATGGNONE 
AK063752GAGGCCCATGGSimilar to 60S ribosomal protein L32A. 
AK099282GAGGCCCATGGNONE 
J023130H04GAGGCCCATGGNONE 
J075013C11GAGGCCCATGGNONE 
J075060E07GAGGCCCATGGNONE 
J075106K07GAGGCCCATGGNONE 
J075124L15GAGGCCCATGGNONE 
J075161D15GAGGCCCATGGNONE 
J080311I18GAGGCCCATGGNONE 
J080315G08GAGGCCCATGGNONE 
J080316F09GAGGCCCATGGNONE 
J080318B05GAGGCCCATGGNONE 
J100052O18GAGGCCCATGGNONE 
J100064D07GAGGCCCATGGNONE 
Os09g0548100009-134-B12AGCCCATGGNONE 
AK062925AGCCCATGGHypothetical protein. 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os11g0129800Os11g0129800CCATGGGCConserved hypothetical protein. 
Os11g0148000AK108267CTGGCCCATGGSodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTGGCCCATGGNONE 
J065110G12CTGGCCCATGGNONE 
Os11g0169600J075003I07AGCCCATGGNONE 
J100025P12AGCCCATGGNONE 
J100056P17AGCCCATGGNONE 
J100073F05AGCCCATGGNONE 
J100084H07AGCCCATGGNONE 
J100085M11AGCCCATGGConserved hypothetical protein. 
Os11g0423200AK111297ACAGCCCATGGHypothetical protein. 
Os11g0428800J100025N17GCCCATGGPlastocyanin-like domain containing protein. 
J100029J15GCCCATGGNONE 
J100033N08GCCCATGGNONE 
J100040O08GCCCATGGNONE 
J100047N18GCCCATGGNONE 
J100050E07GCCCATGGNONE 
J100067D17GCCCATGGNONE 
J100070J18GCCCATGGNONE 
J100071I20GCCCATGGNONE 
J100077I09GCCCATGGNONE 
J100084N04GCCCATGGNONE 
J100087F13GCCCATGGNONE 
Os11g0582400AF049348AGCCCATGGConserved hypothetical protein. 
AF516927AGCCCATGGNONE 
AK073083AGCCCATGGNONE 
AK108352AGCCCATGGNONE 
J075005O16AGCCCATGGNONE 
J075007D15AGCCCATGGNONE 
J075007L04AGCCCATGGNONE 
J075009C11AGCCCATGGNONE 
J075012L11AGCCCATGGNONE 
J075013A14AGCCCATGGNONE 
J075015K01AGCCCATGGNONE 
J075019O21AGCCCATGGNONE 
J075020G20AGCCCATGGNONE 
J075020H06AGCCCATGGNONE 
J075022D07AGCCCATGGNONE 
J075024M12AGCCCATGGNONE 
J075025G04AGCCCATGGNONE 
J075026F09AGCCCATGGNONE 
J075027D19AGCCCATGGNONE 
J075030A12AGCCCATGGNONE 
J075030C16AGCCCATGGNONE 
J075030D15AGCCCATGGNONE 
J075034M20AGCCCATGGNONE 
J075041H12AGCCCATGGNONE 
J075052D12AGCCCATGGNONE 
J075052G11AGCCCATGGNONE 
J075053L09AGCCCATGGNONE 
J075064G05AGCCCATGGNONE 
J075067J01AGCCCATGGNONE 
J075071O03AGCCCATGGNONE 
J075072G12AGCCCATGGNONE 
J075078H06AGCCCATGGNONE 
J075081D06AGCCCATGGNONE 
J075084G23AGCCCATGGNONE 
J075085M10AGCCCATGGNONE 
J075087N20AGCCCATGGNONE 
J075088E11AGCCCATGGNONE 
J075088O22AGCCCATGGNONE 
J075091E10AGCCCATGGNONE 
J075092B12AGCCCATGGNONE 
J075093E08AGCCCATGGNONE 
J075095D04AGCCCATGGNONE 
J075095J10AGCCCATGGNONE 
J075095O19AGCCCATGGNONE 
J075096H20AGCCCATGGNONE 
J075098F10AGCCCATGGNONE 
J075100H10AGCCCATGGNONE 
J075104C23AGCCCATGGNONE 
J075105B10AGCCCATGGNONE 
J075106I24AGCCCATGGNONE 
J075109H23AGCCCATGGNONE 
J075115A03AGCCCATGGNONE 
J075118M06AGCCCATGGNONE 
J075121G08AGCCCATGGNONE 
J075122C09AGCCCATGGNONE 
J075122J12AGCCCATGGNONE 
J075123E06AGCCCATGGNONE 
J075123E16AGCCCATGGNONE 
J075124N09AGCCCATGGNONE 
J075127F23AGCCCATGGNONE 
J075128H17AGCCCATGGNONE 
J075129C02AGCCCATGGNONE 
J075139P18AGCCCATGGNONE 
J075140H17AGCCCATGGNONE 
J075146E12AGCCCATGGNONE 
J075146I07AGCCCATGGNONE 
J075150A08AGCCCATGGNONE 
J075150I22AGCCCATGGNONE 
J075155D01AGCCCATGGNONE 
J075155N10AGCCCATGGNONE 
J075155O09AGCCCATGGNONE 
J075156K11AGCCCATGGNONE 
J075157N01AGCCCATGGNONE 
J075164L09AGCCCATGGNONE 
J075166F14AGCCCATGGNONE 
J075169E20AGCCCATGGNONE 
J075170B13AGCCCATGGNONE 
J075170F24AGCCCATGGNONE 
J075170N16AGCCCATGGNONE 
J075172H22AGCCCATGGNONE 
J075172I02AGCCCATGGNONE 
J075176E08AGCCCATGGNONE 
J075177H17AGCCCATGGNONE 
J075179C18AGCCCATGGNONE 
J075182H23AGCCCATGGNONE 
J075187B10AGCCCATGGNONE 
J075192L10AGCCCATGGNONE 
J075195C04AGCCCATGGNONE 
U25969AGCCCATGGNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0615700AB026561CCATGGGCCTCNONE 
AK059521CCATGGGCCTCNONE 
AK103487CCATGGGCCTCProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14CCATGGGCCTCNONE 
J065044A11CCATGGGCCTCNONE 
J065090I02CCATGGGCCTCNONE 
J065104I09CCATGGGCCTCNONE 
J065187J10CCATGGGCCTCNONE 
J075024E07CCATGGGCCTCNONE 
J075025O13CCATGGGCCTCNONE 
J090062N12CCATGGGCCTCNONE 
J090087G06CCATGGGCCTCNONE 
J090098K11CCATGGGCCTCNONE 
Os11g0634200AK066700CCATGGGCTGTConserved hypothetical protein. 
J013073J21CCATGGGCTGTNONE 
Os11g0689100AK073759CCATGGGCCGTTDisease resistance protein family protein. 
AK108692CCATGGGCCGTTNONE 
Os11g0708000006-046-G03ATGGCCCATGGNONE 
AK072065ATGGCCCATGGNONE 
AK120102ATGGCCCATGGConserved hypothetical protein. 
J013022N13ATGGCCCATGGNONE 
J013062I09ATGGCCCATGGNONE 
J013066H01ATGGCCCATGGNONE 
J013067A19ATGGCCCATGGNONE 
J033107A16ATGGCCCATGGNONE 
J065068A18ATGGCCCATGGNONE 
J065118D08ATGGCCCATGGNONE 
J075056H13ATGGCCCATGGNONE 
J075156I15ATGGCCCATGGNONE 
J100045J12ATGGCCCATGGNONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0254500J065147M01CCATGGGCConserved hypothetical protein. 
J090077A14CCATGGGCNONE 
Os12g0595800015-057-B08TAGGCCCATGGNONE 
AK121185TAGGCCCATGGProtein kinase-like domain containing protein. 
J065039H15TAGGCCCATGGNONE 
Os12g0597500AK101904CCAGCCCATGGGCCTCNONE 
AK103799CCAGCCCATGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCAGCCCATGGGCCTCNONE 
J100078O15CCAGCCCATGGGCCTCNONE 
Os12g0599900AK101252CCATGGGCCCAACTTetratricopeptide region domain containing protein. 
J033032F05CCATGGGCCCAACTNONE 
Os12g0601200AK059928GCCCATGGUridine kinase family protein. 
J033026B21GCCCATGGNONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0609800AK101303CTGGCCCATGGAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01CTGGCCCATGGAGCCCATCANONE 
J033033K21CTGGCCCATGGAGCCCATCANONE 
J033082L13CTGGCCCATGGAGCCCATCANONE 
J043034M20CTGGCCCATGGAGCCCATCANONE 
J065137J24CTGGCCCATGGAGCCCATCANONE 
J065141A11CTGGCCCATGGAGCCCATCANONE 
J065217H09CTGGCCCATGGAGCCCATCANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.