version

Summary of OsREG526 (All List)

OrganismOryza sativa  
IDOsREG526  
SequenceCCCACACG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1408  

Entry Sequences (1408 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683CCCACACGNONE 
AK100613CCCACACGSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06CCCACACGNONE 
J090042G02CCCACACGNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0191100009-011-A02TAGGCCCACACGNONE 
009-028-D05TAGGCCCACACGNONE 
009-058-B11TAGGCCCACACGNONE 
009-151-D09TAGGCCCACACGNONE 
013-026-G03TAGGCCCACACGNONE 
013-063-F04TAGGCCCACACGNONE 
013-069-B05TAGGCCCACACGNONE 
014-029-E04TAGGCCCACACGNONE 
014-072-H04TAGGCCCACACGNONE 
014-089-E09TAGGCCCACACGNONE 
015-047-G05TAGGCCCACACGNONE 
016-033-G06TAGGCCCACACGNONE 
AK058815TAGGCCCACACGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TAGGCCCACACGNONE 
J023077K21TAGGCCCACACGNONE 
J023081F19TAGGCCCACACGNONE 
J033052N11TAGGCCCACACGNONE 
J033058N11TAGGCCCACACGNONE 
J033114G05TAGGCCCACACGNONE 
J033114O17TAGGCCCACACGNONE 
J033129L14TAGGCCCACACGNONE 
J053029I12TAGGCCCACACGNONE 
J065067N19TAGGCCCACACGNONE 
J065084I19TAGGCCCACACGNONE 
J065099O03TAGGCCCACACGNONE 
J065201I08TAGGCCCACACGNONE 
J075035B08TAGGCCCACACGNONE 
J075037B22TAGGCCCACACGNONE 
J075054L16TAGGCCCACACGNONE 
J075059D15TAGGCCCACACGNONE 
J075164I08TAGGCCCACACGNONE 
J075185J01TAGGCCCACACGNONE 
J090042O06TAGGCCCACACGNONE 
J090044F12TAGGCCCACACGNONE 
J090063L02TAGGCCCACACGNONE 
J090073I10TAGGCCCACACGNONE 
J090078E18TAGGCCCACACGNONE 
J100072K16TAGGCCCACACGNONE 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0273300Os01g0273300GGTCCCACACGBSD domain containing protein. 
Os01g0295700AK070333CCCCACACGSimilar to Protein phosphatase-2C. 
Os01g0343100J065039P06CCCCACACGProtein of unknown function DUF594 family protein. 
Os01g0369000AK064940CCCACACGSimilar to Cullin-1. 
AK104340CCCACACGNONE 
AY336990CCCACACGNONE 
J013000P07CCCACACGNONE 
J013056B18CCCACACGNONE 
J013056B20CCCACACGNONE 
J013098C09CCCACACGNONE 
J013099E23CCCACACGNONE 
J023007E10CCCACACGNONE 
J023064L04CCCACACGNONE 
J023119B15CCCACACGNONE 
J023126O19CCCACACGNONE 
J033120G16CCCACACGNONE 
J043007K19CCCACACGNONE 
J065037I22CCCACACGNONE 
J065051D18CCCACACGNONE 
J065073N09CCCACACGNONE 
J065084K20CCCACACGNONE 
J065115C15CCCACACGNONE 
J065115M01CCCACACGNONE 
J065121O10CCCACACGNONE 
J065197H21CCCACACGNONE 
J065211L23CCCACACGNONE 
J065214M19CCCACACGNONE 
J090006F13CCCACACGNONE 
J090012M21CCCACACGNONE 
J090029M05CCCACACGNONE 
J090048P16CCCACACGNONE 
J090051H13CCCACACGNONE 
J090062C14CCCACACGNONE 
J090072F21CCCACACGNONE 
J090085D11CCCACACGNONE 
J090090N24CCCACACGNONE 
J090095K17CCCACACGNONE 
J090099H12CCCACACGNONE 
J100031B11CCCACACGNONE 
J100053C15CCCACACGNONE 
J100075F19CCCACACGNONE 
J100087L22CCCACACGNONE 
Os01g0531500004-017-G06CGTGTGGGCTGCNONE 
006-022-B04CGTGTGGGCTGCNONE 
006-084-A07CGTGTGGGCTGCNONE 
012-031-G11CGTGTGGGCTGCNONE 
AK059992CGTGTGGGCTGCNONE 
AK104379CGTGTGGGCTGCNONE 
AK106208CGTGTGGGCTGCDienelactone hydrolase domain containing protein. 
J013058J10CGTGTGGGCTGCNONE 
J013153A15CGTGTGGGCTGCNONE 
J033044K14CGTGTGGGCTGCNONE 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0572100J075122B22GCCCACACGZinc finger, CCCH-type domain containing protein. 
Os01g0587000AK067605CCCACACGSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0607300AK109289CTCCCCCACACGConserved hypothetical protein. 
Os01g0727100AK068181CCCACACGCCCACGCGGlycosyl transferase, family 8 protein. 
AK105758CCCACACGCCCACGCGNONE 
J013126C21CCCACACGCCCACGCGNONE 
J023049F24CCCACACGCCCACGCGNONE 
J033140G15CCCACACGCCCACGCGNONE 
Os01g0756600AK060989CGTGTGGGCNONE 
AK102373CGTGTGGGCProtein of unknown function DUF642 family protein. 
J090060D10CGTGTGGGCNONE 
J090076J11CGTGTGGGCNONE 
J090088M06CGTGTGGGCNONE 
J090088M08CGTGTGGGCNONE 
Os01g0764800AK102809CGTGTGGGCCACSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168ATGGCCCACACGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0819700006-061-E11CCCACACGNONE 
AK059227CCCACACGNONE 
AK106919CCCACACGHelix-turn-helix, Fis-type domain containing protein. 
J065182N23CCCACACGNONE 
Os01g0855600003-004-C02GTGGCCCACACGNONE 
016-023-G11GTGGCCCACACGNONE 
AK099776GTGGCCCACACGSimilar to Hs1pro-1 protein. 
AY224522GTGGCCCACACGNONE 
J013095E24GTGGCCCACACGNONE 
J023041J04GTGGCCCACACGNONE 
J065130B09GTGGCCCACACGNONE 
J075031B02GTGGCCCACACGNONE 
J075069H11GTGGCCCACACGNONE 
J100026O10GTGGCCCACACGNONE 
J100050J01GTGGCCCACACGNONE 
J100052G04GTGGCCCACACGNONE 
J100053D07GTGGCCCACACGNONE 
J100054K16GTGGCCCACACGNONE 
J100067A06GTGGCCCACACGNONE 
J100067G01GTGGCCCACACGNONE 
J100088C18GTGGCCCACACGNONE 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0913900AK110828CGTGTGGGConserved hypothetical protein. 
Os01g0924900AK067886CCCCACACGGTP-binding signal recognition particle SRP54, G-domain containing protein. 
Os02g0119400AK060055TGGGTCCCACACGNONE 
AK102774TGGGTCCCACACGSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TGGGTCCCACACGNONE 
J075175F09TGGGTCCCACACGNONE 
J090011H05TGGGTCCCACACGNONE 
J090091O05TGGGTCCCACACGNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0133800006-092-D12CGTGTGGGCCCCNONE 
006-111-G01CGTGTGGGCCCCNONE 
AK103646CGTGTGGGCCCCNONE 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CGTGTGGGCCCCNONE 
J033135B19CGTGTGGGCCCCNONE 
J065200F01CGTGTGGGCCCCNONE 
J065213J11CGTGTGGGCCCCNONE 
J075031N16CGTGTGGGCCCCNONE 
J075032N17CGTGTGGGCCCCNONE 
J075047P04CGTGTGGGCCCCNONE 
J075063D01CGTGTGGGCCCCNONE 
J075105F23CGTGTGGGCCCCNONE 
J075121E16CGTGTGGGCCCCNONE 
J075176F10CGTGTGGGCCCCNONE 
J075182M16CGTGTGGGCCCCNONE 
J075190E09CGTGTGGGCCCCNONE 
J075191B14CGTGTGGGCCCCNONE 
J100055J24CGTGTGGGCCCCNONE 
J100066H24CGTGTGGGCCCCNONE 
J100073N01CGTGTGGGCCCCNONE 
Os02g0150100AK060595CCCACACGSimilar to DEAD-box protein abstrakt. 
Os02g0173800AK069063CGTGTGGGProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os02g0192300Os02g0192300GCAGCCCACACGZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0461200012-026-A12GAAGCCCACACGNONE 
AK063459GAAGCCCACACGConserved hypothetical protein. 
J065183F11GAAGCCCACACGNONE 
J075190G18GAAGCCCACACGNONE 
Os02g0496300014-031-F08CCCACACGCCACNONE 
AK069861CCCACACGCCACNONE 
AK105361CCCACACGCCACConserved hypothetical protein. 
J023038A06CCCACACGCCACNONE 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein. 
Os02g0601800AB060276GGCCCCACACGNONE 
AK099539GGCCCCACACGNONE 
AK101873GGCCCCACACGBromodomain containing protein. 
AK106801GGCCCCACACGNONE 
AK121758GGCCCCACACGNONE 
AK121891GGCCCCACACGNONE 
J013059H01GGCCCCACACGNONE 
J013092F08GGCCCCACACGNONE 
J013146J04GGCCCCACACGNONE 
J023001K12GGCCCCACACGNONE 
J023002H16GGCCCCACACGNONE 
J023013B10GGCCCCACACGNONE 
J023081I22GGCCCCACACGNONE 
J023084K19GGCCCCACACGNONE 
J023150E24GGCCCCACACGNONE 
J033023B18GGCCCCACACGNONE 
J033025F18GGCCCCACACGNONE 
J033048P08GGCCCCACACGNONE 
J033060M24GGCCCCACACGNONE 
J033070G06GGCCCCACACGNONE 
J033088P12GGCCCCACACGNONE 
J033105C13GGCCCCACACGNONE 
J043009N18GGCCCCACACGNONE 
J065103G21GGCCCCACACGNONE 
J075039H15GGCCCCACACGNONE 
J090014K10GGCCCCACACGNONE 
J090022N02GGCCCCACACGNONE 
J090033F18GGCCCCACACGNONE 
J090033I04GGCCCCACACGNONE 
J090041F11GGCCCCACACGNONE 
J090045P20GGCCCCACACGNONE 
J090054B01GGCCCCACACGNONE 
J090055M12GGCCCCACACGNONE 
J090071K09GGCCCCACACGNONE 
J090098O16GGCCCCACACGNONE 
J090099P15GGCCCCACACGNONE 
J100050I16GGCCCCACACGNONE 
Os02g0603800AK105762CCCCACACGNONE 
AK120769CCCCACACGSimilar to Isoprenoid biosynthesis-like protein (Fragment). 
Os02g0640000AK120841CGTGTGGGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19CGTGTGGGGNONE 
J023081F22CGTGTGGGGNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0671200J065152N20CCCCACACGNONE 
J075053E22CCCCACACGConserved hypothetical protein. 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0777800AK066978ACCCCCCACACGCCTCSimilar to Avr9/Cf-9 induced kinase 1. 
AK066978CGTGTGGGCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0804900J065051L05CGTGTGGGGCCNONE 
J065069D19CGTGTGGGGCCNONE 
J065073L01CGTGTGGGGCCNONE 
J065147K04CGTGTGGGGCCNONE 
J065166D17CGTGTGGGGCCNONE 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
J100086K17CAAGGCCCACACGNONE 
Os03g0122000AK101458CGTGTGGGCTProtein kinase-like domain containing protein. 
J013035K10CGTGTGGGCTNONE 
J013050E10CGTGTGGGCTNONE 
J033040C13CGTGTGGGCTNONE 
Os03g0130400AK070255CGTGTGGGACCAdenylate kinase, subfamily protein. 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0132200003-010-G06CGTGTGGGGNONE 
012-006-B11CGTGTGGGGNONE 
AK061453CGTGTGGGGNONE 
AK067081CGTGTGGGGNONE 
AK099870CGTGTGGGGExpansin-like protein A. 
AY100693CGTGTGGGGNONE 
J013094I23CGTGTGGGGNONE 
J023105E16CGTGTGGGGNONE 
J065002A13CGTGTGGGGNONE 
J065152P15CGTGTGGGGNONE 
J065161P09CGTGTGGGGNONE 
J065185B14CGTGTGGGGNONE 
J075058K03CGTGTGGGGNONE 
J075175A03CGTGTGGGGNONE 
J075178B06CGTGTGGGGNONE 
J090078H10CGTGTGGGGNONE 
J100029B14CGTGTGGGGNONE 
J100039A19CGTGTGGGGNONE 
J100053K07CGTGTGGGGNONE 
J100082F12CGTGTGGGGNONE 
Os03g0146000006-105-H06GGACCCACACGNONE 
AK061250GGACCCACACGSimilar to RAB1X. 
AK099130GGACCCACACGNONE 
J023043D11GGACCCACACGNONE 
J043009O17GGACCCACACGNONE 
Os03g0156500011-075-F02CCCACACGNONE 
012-077-G10CCCACACGNONE 
AK103466CCCACACGLupus La protein family protein. 
J013088H17CCCACACGNONE 
J013135G21CCCACACGNONE 
J033050E10CCCACACGNONE 
J033050J01CCCACACGNONE 
J033129N23CCCACACGNONE 
J065085L16CCCACACGNONE 
J065101B19CCCACACGNONE 
J065167N03CCCACACGNONE 
J090009O21CCCACACGNONE 
J090049D11CCCACACGNONE 
J100017F23CCCACACGNONE 
J100040E12CCCACACGNONE 
J100055O18CCCACACGNONE 
J100061K08CCCACACGNONE 
J100072M05CCCACACGNONE 
J100077B08CCCACACGNONE 
J100086G03CCCACACGNONE 
Os03g0161200AK066932CCCACACGSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0161900AK066844CCCACACGNONE 
AY344489CCCACACGSimilar to Heat shock factor 1 (Fragment). 
J013088J01CCCACACGNONE 
J023114N08CCCACACGNONE 
Os03g0194600009-115-B11CCCCACACGCGCGGGTNONE 
AK062839CCCCACACGCGCGGGTDOMON related domain containing protein. 
Os03g0213600AK100407GGTCCCACACGConserved hypothetical protein. 
Os03g0244200003-114-A11CGTGTGGGGNONE 
015-089-B03CGTGTGGGGNONE 
016-048-G01CGTGTGGGGNONE 
AK101837CGTGTGGGGSimilar to Thaumatin-like protein. 
AK105771CGTGTGGGGNONE 
AK107182CGTGTGGGGNONE 
J065054I12CGTGTGGGGNONE 
J065208F20CGTGTGGGGNONE 
J075088F18CGTGTGGGGNONE 
J075092G13CGTGTGGGGNONE 
J075120G01CGTGTGGGGNONE 
J075147M20CGTGTGGGGNONE 
J075151J03CGTGTGGGGNONE 
J100064H21CGTGTGGGGNONE 
Os03g0263900AK121215ACAGCCCACACGCalcium-binding EF-hand domain containing protein. 
J075115D02ACAGCCCACACGNONE 
J090095P20ACAGCCCACACGNONE 
Os03g0269300011-021-H03CGTGTGGGCTNONE 
011-029-B01CGTGTGGGCTNONE 
AK111855CGTGTGGGCTNONE 
AK111884CGTGTGGGCTAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0294200AK069285CGTGTGGGGCCCSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0296600AK109176CCCACACGSimilar to ECA1 protein. 
Os03g0307900AK072469CCCCACACGConserved hypothetical protein. 
Os03g0327600014-081-C01TCTGGACCCCACACGNONE 
AK069815TCTGGACCCCACACGRicin B-related lectin domain containing protein. 
X95402TCTGGACCCCACACGNONE 
Os03g0374100AK066002CCCCACACGCGTCCHepatocellular carcinoma-associated antigen 59 family protein. 
AK099328CCCCACACGCGTCCNONE 
AK104845CCCCACACGCGTCCNONE 
Os03g0393900AK069809CGTGTGGGSimilar to S.tuberosum patatin (Fragment). 
J023030J03CGTGTGGGNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0608000AK111073GCCACACGCCCACACGHypothetical protein. 
Os03g0643300AK099445CCCACACGSimilar to AER123Wp. 
AK108010CCCACACGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0711600X88799CCCACACGSimilar to DNA binding protein (Fragment). 
Os03g0738600AK073529GCGCGCGACCCACACGSimilar to Lipoxygenase L-2 (EC 1.13.11.12). 
X64396GCGCGCGACCCACACGNONE 
Os03g0780400011-100-D09CCCACACGNONE 
AK061347CCCACACGNONE 
AK073162CCCACACGSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACACGNONE 
J065045I07CCCACACGNONE 
J090036F17CCCACACGNONE 
J090077M14CCCACACGNONE 
J100055G20CCCACACGNONE 
Os03g0832600AK120137CGTGTGGGCCAGSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0835600AK101677CCCACACGAcyl-coA-binding protein, ACBP family protein. 
Os03g0836800AK061197CGTGTGGGCSimilar to IAA-amino acid hydrolase 1 (EC 3.5.1.-). 
Os03g0844100AK067164CCCACACGSimilar to Pti1 kinase-like protein. 
Os04g0119500AJ698084CCCCACACGNONE 
AK061898CCCCACACGNONE 
AK065035CCCCACACGSimilar to Membrane related protein-like. 
J013001H07CCCCACACGNONE 
J013128B11CCCCACACGNONE 
J013153L13CCCCACACGNONE 
J013157F08CCCCACACGNONE 
J065140L14CCCCACACGNONE 
J075147J12CCCCACACGNONE 
J090087C14CCCCACACGNONE 
J100048O09CCCCACACGNONE 
J100051O16CCCCACACGNONE 
J100083H22CCCCACACGNONE 
Os04g0177400012-039-C04CGTGTGGGNONE 
Os04g0244800009-066-G06CGTGTGGGCCCCANONE 
011-024-D02CGTGTGGGCCCCANONE 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CGTGTGGGCCCCANONE 
J023150J09CGTGTGGGCCCCANONE 
J053097G24CGTGTGGGCCCCANONE 
J065001K24CGTGTGGGCCCCANONE 
J065009O13CGTGTGGGCCCCANONE 
J065076M12CGTGTGGGCCCCANONE 
J065081I15CGTGTGGGCCCCANONE 
J065105E10CGTGTGGGCCCCANONE 
J065106G04CGTGTGGGCCCCANONE 
J065123I12CGTGTGGGCCCCANONE 
J065137H16CGTGTGGGCCCCANONE 
J065151I11CGTGTGGGCCCCANONE 
J065164H06CGTGTGGGCCCCANONE 
J065173J07CGTGTGGGCCCCANONE 
J065196F02CGTGTGGGCCCCANONE 
J065198I17CGTGTGGGCCCCANONE 
J065206I11CGTGTGGGCCCCANONE 
J065216J02CGTGTGGGCCCCANONE 
J075076D10CGTGTGGGCCCCANONE 
J075098F06CGTGTGGGCCCCANONE 
J075115A20CGTGTGGGCCCCANONE 
J075184H05CGTGTGGGCCCCANONE 
J075193E17CGTGTGGGCCCCANONE 
J090014L09CGTGTGGGCCCCANONE 
J090015H16CGTGTGGGCCCCANONE 
J090024M04CGTGTGGGCCCCANONE 
J090062K08CGTGTGGGCCCCANONE 
J090082I08CGTGTGGGCCCCANONE 
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment). 
Os04g0281900006-042-E01GCCCACACGNONE 
006-085-B12GCCCACACGNONE 
009-029-B04GCCCACACGNONE 
009-092-C08GCCCACACGNONE 
009-168-H08GCCCACACGNONE 
AK060229GCCCACACGNONE 
AK061149GCCCACACGProtein of unknown function DUF588 family protein. 
J065056F11GCCCACACGNONE 
J065136G17GCCCACACGNONE 
J065142I09GCCCACACGNONE 
J065163L07GCCCACACGNONE 
J065191F15GCCCACACGNONE 
J065202P13GCCCACACGNONE 
J075046E09GCCCACACGNONE 
J075086M19GCCCACACGNONE 
J075116D21GCCCACACGNONE 
J075118N02GCCCACACGNONE 
J075181M06GCCCACACGNONE 
J075190I20GCCCACACGNONE 
J075197D04GCCCACACGNONE 
J090047D09GCCCACACGNONE 
Os04g0412100AK108223CCCCACACGConserved hypothetical protein. 
Os04g0414500AK121479GCCCACACGConserved hypothetical protein. 
J023149I19GCCCACACGNONE 
J090084C07GCCCACACGNONE 
Os04g0430600009-014-G12CCCCACACGNONE 
015-019-A08CCCCACACGNONE 
015-048-C08CCCCACACGNONE 
015-085-E11CCCCACACGNONE 
AK072050CCCCACACGNONE 
AK106337CCCCACACGConserved hypothetical protein. 
J065037C09CCCCACACGNONE 
J075125G18CCCCACACGNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0635700009-079-G03CCCACACGNONE 
AK062025CCCACACGRibbon-helix-helix domain containing protein. 
AK098916CCCACACGNONE 
J013002J07CCCACACGNONE 
J013109L20CCCACACGNONE 
J023055C07CCCACACGNONE 
J065036K04CCCACACGNONE 
J065164G12CCCACACGNONE 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACCACCCACACGCCACACGCCCAAAANONE 
Os04g0650200AK072573CGTGTGGGNONE 
AK109786CGTGTGGGLipolytic enzyme, G-D-S-L family protein. 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os05g0102500009-183-E08CGTGTGGGGCNONE 
AK063894CGTGTGGGGCNONE 
AK073341CGTGTGGGGCConserved hypothetical protein. 
J023022C11CGTGTGGGGCNONE 
J065095B14CGTGTGGGGCNONE 
J065130O12CGTGTGGGGCNONE 
J065142P07CGTGTGGGGCNONE 
J065155L18CGTGTGGGGCNONE 
Os05g0119200AK067943CCCACACGCGTCCConserved hypothetical protein. 
J013122C02CCCACACGCGTCCNONE 
J065077M14CCCACACGCGTCCNONE 
J065108P21CCCACACGCGTCCNONE 
J065138G20CCCACACGCGTCCNONE 
J065148H07CCCACACGCGTCCNONE 
J065205P09CCCACACGCGTCCNONE 
J075061H16CCCACACGCGTCCNONE 
J075140H13CCCACACGCGTCCNONE 
J075153H02CCCACACGCGTCCNONE 
J075170B14CCCACACGCGTCCNONE 
Os05g0150300AK100732CCCCACACGSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0164100AF456329CGTGTGGGCCCCACGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0184901Os05g0184901GCCCACACGSigma factor, regions 3 and 4 domain containing protein. 
Os05g0230600AK070398CGTGTGGGCProtein of unknown function DUF1620 domain containing protein. 
J023048G06CGTGTGGGCNONE 
J023104B17CGTGTGGGCNONE 
J023117E17CGTGTGGGCNONE 
J033141M04CGTGTGGGCNONE 
J043013P22CGTGTGGGCNONE 
J075106H10CGTGTGGGCNONE 
J090022K02CGTGTGGGCNONE 
J090027E17CGTGTGGGCNONE 
J090057K12CGTGTGGGCNONE 
J090058C13CGTGTGGGCNONE 
J090067E04CGTGTGGGCNONE 
J090069N19CGTGTGGGCNONE 
J090070J02CGTGTGGGCNONE 
J090088H01CGTGTGGGCNONE 
J090099A08CGTGTGGGCNONE 
Os05g0230900J023149B21CGTGTGGGNONE 
Os05g0365600AK105546CCCACACGSimilar to Hydroxyisourate hydrolase. 
J065131P20CCCACACGNONE 
Os05g0381400014-036-H12CCCATCCACCCACACGTGTCNONE 
014-085-H12CCCATCCACCCACACGTGTCNONE 
AK102039CCCATCCACCCACACGTGTCSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CCCATCCACCCACACGTGTCNONE 
J075057P04CCCATCCACCCACACGTGTCNONE 
J075066K19CCCATCCACCCACACGTGTCNONE 
J075068L13CCCATCCACCCACACGTGTCNONE 
J075074J21CCCATCCACCCACACGTGTCNONE 
J075076N10CCCATCCACCCACACGTGTCNONE 
J075078L14CCCATCCACCCACACGTGTCNONE 
J075099O16CCCATCCACCCACACGTGTCNONE 
J075120C05CCCATCCACCCACACGTGTCNONE 
J075140I24CCCATCCACCCACACGTGTCNONE 
J075148F21CCCATCCACCCACACGTGTCNONE 
J075151F01CCCATCCACCCACACGTGTCNONE 
J075151I10CCCATCCACCCACACGTGTCNONE 
J075156M15CCCATCCACCCACACGTGTCNONE 
J075191F07CCCATCCACCCACACGTGTCNONE 
J075192K20CCCATCCACCCACACGTGTCNONE 
J075195M22CCCATCCACCCACACGTGTCNONE 
Os05g0509500AB115419CGTGTGGGNONE 
AK068958CGTGTGGGSimilar to Signal recognition particle 54 kDa protein 2 (SRP54). 
Os05g0531400J065101L04CCAGCCCACACGConserved hypothetical protein. 
J065130M24CCAGCCCACACGNONE 
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE 
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein. 
J013047J05CAAGGCCCCACACGTCACNONE 
Os05g0548100AK060333CGTGTGGGGCCGTGConserved hypothetical protein. 
AK100682CGTGTGGGGCCGTGNONE 
J013151E01CGTGTGGGGCCGTGNONE 
J023113L22CGTGTGGGGCCGTGNONE 
J043027A19CGTGTGGGGCCGTGNONE 
J075093E06CGTGTGGGGCCGTGNONE 
J090060D15CGTGTGGGGCCGTGNONE 
J090082J03CGTGTGGGGCCGTGNONE 
J100050E01CGTGTGGGGCCGTGNONE 
Os05g0549100AK072422CCCACACGSimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0553000015-052-H09CCCCACACGNONE 
AK061681CCCCACACGATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143CCCCACACGNONE 
J013068H04CCCCACACGNONE 
J013124C06CCCCACACGNONE 
J033127N11CCCCACACGNONE 
J100056O04CCCCACACGNONE 
Os05g0554400AK102948GCCCACACGNONE 
AK107427GCCCACACGPhosphatidyl serine synthase family protein. 
J023089D16GCCCACACGNONE 
Os05g0556000AK059050CGTGTGGGConserved hypothetical protein. 
AK099318CGTGTGGGNONE 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0565500J100058A22CGTGTGGGG6-phosphogluconate dehydrogenase family protein. 
Os05g0566500AK073468CGTGTGGGCCACNONE 
AK099052CGTGTGGGCCACSimilar to Initiation factor 3d (Fragment). 
AK104093CGTGTGGGCCACNONE 
J090025I18CGTGTGGGCCACNONE 
Os05g0573700AK065295GGCCCCACACGCCTCSimilar to Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-acid reductoisomerase) (Alpha-keto-beta-hydroxylacil reductoisomerase). 
J065100L13GGCCCCACACGCCTCNONE 
J100062P20GGCCCCACACGCCTCNONE 
Os05g0595300011-076-H02GGGGCCCACACGCCACNONE 
012-009-E07GGGGCCCACACGCCACNONE 
012-096-B01GGGGCCCACACGCCACNONE 
AK059614GGGGCCCACACGCCACNONE 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
J033040P21GGGGCCCACACGCCACNONE 
Os06g0133600AK068474GCCCCCACACGNONE 
AK105690GCCCCCACACGPhosphate-induced protein 1 conserved region family protein. 
J013155H19GCCCCCACACGNONE 
J023054J01GCCCCCACACGNONE 
J065013N23GCCCCCACACGNONE 
Os06g0215900011-006-B01CCCCACACGNONE 
011-088-G08CCCCACACGNONE 
AK072596CCCCACACGSimilar to Oxo-phytodienoic acid reductase. 
AK105590CCCCACACGNONE 
J023125E21CCCCACACGNONE 
J033051F13CCCCACACGNONE 
J033091L21CCCCACACGNONE 
J033107E18CCCCACACGNONE 
J043034N06CCCCACACGNONE 
J065021A14CCCCACACGNONE 
J065136F10CCCCACACGNONE 
J065142G20CCCCACACGNONE 
J065166I12CCCCACACGNONE 
J065171G17CCCCACACGNONE 
J065179A21CCCCACACGNONE 
J065190J04CCCCACACGNONE 
J065214E03CCCCACACGNONE 
J100022N12CCCCACACGNONE 
J100025A03CCCCACACGNONE 
J100034H20CCCCACACGNONE 
J100054C23CCCCACACGNONE 
J100057K17CCCCACACGNONE 
J100061L01CCCCACACGNONE 
J100077K16CCCCACACGNONE 
J100078D16CCCCACACGNONE 
J100084G04CCCCACACGNONE 
Os06g0268800AK120796CCCGGCCCCACACGProtein of unknown function UPF0005 family protein. 
Os06g0308300AK059211TGGGGCCCACACGNONE 
AK101549TGGGGCCCACACGNONE 
AK102553TGGGGCCCACACGSimilar to 65kD microtubule associated protein. 
J090014G18TGGGGCCCACACGNONE 
J090082B01TGGGGCCCACACGNONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0597000006-049-F03GCCCACACGNONE 
006-113-H01GCCCACACGNONE 
AK061037GCCCACACGNONE 
AK069376GCCCACACGSimilar to Auxin responsive protein IAA-Re. 
J023012K19GCCCACACGNONE 
Os06g0609900AK109324GGTCCCACACGConserved hypothetical protein. 
Os06g0643000AK067701CCCCACACGPhox-like domain containing protein. 
J013032G04CCCCACACGNONE 
J013044B17CCCCACACGNONE 
J013114M13CCCCACACGNONE 
J023133A02CCCCACACGNONE 
J043022A07CCCCACACGNONE 
J075046O21CCCCACACGNONE 
J075142L01CCCCACACGNONE 
J090076I16CCCCACACGNONE 
J100056O17CCCCACACGNONE 
Os06g0643300006-021-C08CCCCACACGNONE 
006-027-G09CCCCACACGNONE 
006-029-D11CCCCACACGNONE 
006-036-A08CCCCACACGNONE 
006-039-G11CCCCACACGNONE 
006-043-H02CCCCACACGNONE 
006-085-G12CCCCACACGNONE 
006-087-C11CCCCACACGNONE 
AK061733CCCCACACGDevelopment protein-like protein. 
AK099061CCCCACACGNONE 
AK104266CCCCACACGNONE 
AY224520CCCCACACGNONE 
J013026N10CCCCACACGNONE 
J013155P17CCCCACACGNONE 
J013159N19CCCCACACGNONE 
J065041K15CCCCACACGNONE 
J065064A17CCCCACACGNONE 
J065172F08CCCCACACGNONE 
J065199P22CCCCACACGNONE 
J090017A13CCCCACACGNONE 
J090030A21CCCCACACGNONE 
J100028G08CCCCACACGNONE 
J100064K11CCCCACACGNONE 
Os06g0683400009-047-C07CCCACACGNONE 
009-060-B06CCCACACGNONE 
013-057-F12CCCACACGNONE 
AK111852CCCACACGNONE 
AK111897CCCACACGNONE 
AK112082CCCACACGSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CCCACACGNONE 
J065187J11CCCACACGNONE 
J065197L08CCCACACGNONE 
J100045K14CCCACACGNONE 
J100074M08CCCACACGNONE 
J100088H21CCCACACGNONE 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0717900AK069070CCCACACGPeptidase A1, pepsin family protein. 
AK121147CCCACACGNONE 
J023007C05CCCACACGNONE 
J043040A14CCCACACGNONE 
Os07g0133500015-010-H05CCCACACGNONE 
AB110179CCCACACGNONE 
AK106244CCCACACGProtein of unknown function DUF1005 family protein. 
J090075I21CCCACACGNONE 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0170900015-094-H05CGTGTGGGTCTGGGCCTCNONE 
AK106442CGTGTGGGTCTGGGCCTCConserved hypothetical protein. 
Os07g0171100AF272978CGTGTGGGCTGTNONE 
AK062132CGTGTGGGCTGTNONE 
AK066475CGTGTGGGCTGTTetratricopeptide-like helical domain containing protein. 
J013068C23CGTGTGGGCTGTNONE 
Os07g0201500Os07g0201500CGTGTGGGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os07g0435400AK111603CCCACACGSimilar to WD40. 
Os07g0448800003-112-B05CCCACACGNONE 
003-118-A02CCCACACGNONE 
006-029-E09CCCACACGNONE 
006-056-F11CCCACACGNONE 
006-081-F01CCCACACGNONE 
006-084-H12CCCACACGNONE 
006-094-A12CCCACACGNONE 
006-095-C01CCCACACGNONE 
006-098-F09CCCACACGNONE 
009-151-B09CCCACACGNONE 
009-169-C08CCCACACGNONE 
009-172-F09CCCACACGNONE 
009-200-H03CCCACACGNONE 
011-008-B03CCCACACGNONE 
011-035-C10CCCACACGNONE 
011-041-G11CCCACACGNONE 
011-059-H01CCCACACGNONE 
011-071-D12CCCACACGNONE 
013-010-E11CCCACACGNONE 
013-015-B06CCCACACGNONE 
013-028-A11CCCACACGNONE 
013-037-A04CCCACACGNONE 
013-057-B07CCCACACGNONE 
014-041-D03CCCACACGNONE 
014-073-G04CCCACACGNONE 
014-093-D10CCCACACGNONE 
016-030-F03CCCACACGNONE 
016-034-B08CCCACACGNONE 
016-064-D05CCCACACGNONE 
AB029446CCCACACGNONE 
AF062393CCCACACGNONE 
AK072519CCCACACGAquaporin. 
AK103938CCCACACGNONE 
AK103970CCCACACGNONE 
AK119656CCCACACGNONE 
J023026N01CCCACACGNONE 
J023055M16CCCACACGNONE 
J023063J21CCCACACGNONE 
J023128K12CCCACACGNONE 
J065041P10CCCACACGNONE 
J065134L07CCCACACGNONE 
J075198L17CCCACACGNONE 
J090031G17CCCACACGNONE 
J090032B21CCCACACGNONE 
J090032D13CCCACACGNONE 
J090057J22CCCACACGNONE 
J090062J02CCCACACGNONE 
J100028J09CCCACACGNONE 
J100053C06CCCACACGNONE 
J100056I11CCCACACGNONE 
J100067E10CCCACACGNONE 
Os07g0552800AF435651CGTGTGGGNONE 
AK066835CGTGTGGGNONE 
J023009K24CGTGTGGGNONE 
J023050L14CGTGTGGGNONE 
J023092I02CGTGTGGGNONE 
J023100P04CGTGTGGGNONE 
J023112O13CGTGTGGGNONE 
J023121J20CGTGTGGGNONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0561800AK108426CGTGTGGGCNONE 
AK111334CGTGTGGGCConserved hypothetical protein. 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0615900AK066317CCCCACACGZinc finger, GATA-type domain containing protein. 
AK073803CCCCACACGNONE 
J013026A07CCCCACACGNONE 
J013064I12CCCCACACGNONE 
J033068D01CCCCACACGNONE 
J033074A10CCCCACACGNONE 
J033129C06CCCCACACGNONE 
J100035K20CCCCACACGNONE 
J100044G13CCCCACACGNONE 
J100050K01CCCCACACGNONE 
J100069P20CCCCACACGNONE 
J100071O09CCCCACACGNONE 
J100086K01CCCCACACGNONE 
J100089G11CCCCACACGNONE 
Os07g0620800AK063671CGTGTGGGCyclin-like domain containing protein. 
Os07g0640900AK099354AGCCCACACGNONE 
Os07g0661400006-083-E05CCCACACGNONE 
006-083-E05CCCGGCCCCACACGNONE 
006-084-B12CCCACACGNONE 
006-084-B12CCCGGCCCCACACGNONE 
006-096-B03CCCACACGNONE 
006-096-B03CCCGGCCCCACACGNONE 
009-013-C12CCCACACGNONE 
009-013-C12CCCGGCCCCACACGNONE 
009-017-C10CCCACACGNONE 
009-017-C10CCCGGCCCCACACGNONE 
009-027-A02CCCACACGNONE 
009-027-A02CCCGGCCCCACACGNONE 
009-035-A06CCCACACGNONE 
009-035-A06CCCGGCCCCACACGNONE 
009-047-H11CCCACACGNONE 
009-047-H11CCCGGCCCCACACGNONE 
009-050-B11CCCACACGNONE 
009-050-B11CCCGGCCCCACACGNONE 
009-051-C02CCCACACGNONE 
009-051-C02CCCGGCCCCACACGNONE 
009-089-G06CCCACACGNONE 
009-089-G06CCCGGCCCCACACGNONE 
009-091-C05CCCACACGNONE 
009-091-C05CCCGGCCCCACACGNONE 
009-095-B11CCCACACGNONE 
009-095-B11CCCGGCCCCACACGNONE 
009-151-C01CCCACACGNONE 
009-151-C01CCCGGCCCCACACGNONE 
009-154-F06CCCACACGNONE 
009-154-F06CCCGGCCCCACACGNONE 
009-169-F02CCCACACGNONE 
009-169-F02CCCGGCCCCACACGNONE 
009-171-G01CCCACACGNONE 
009-171-G01CCCGGCCCCACACGNONE 
009-179-F07CCCACACGNONE 
009-179-F07CCCGGCCCCACACGNONE 
013-018-H06CCCACACGNONE 
013-018-H06CCCGGCCCCACACGNONE 
013-024-E05CCCACACGNONE 
013-024-E05CCCGGCCCCACACGNONE 
013-038-F09CCCACACGNONE 
013-038-F09CCCGGCCCCACACGNONE 
013-099-F06CCCACACGNONE 
013-099-F06CCCGGCCCCACACGNONE 
014-042-E09CCCACACGNONE 
014-042-E09CCCGGCCCCACACGNONE 
014-086-C02CCCACACGNONE 
014-086-C02CCCGGCCCCACACGNONE 
014-093-B08CCCACACGNONE 
014-093-B08CCCGGCCCCACACGNONE 
015-039-G11CCCACACGNONE 
015-039-G11CCCGGCCCCACACGNONE 
016-036-E05CCCACACGNONE 
016-036-E05CCCGGCCCCACACGNONE 
AK068814CCCACACGNONE 
AK068814CCCGGCCCCACACGNONE 
AK102682CCCACACGNONE 
AK102682CCCGGCCCCACACGNONE 
AK105973CCCACACGNONE 
AK105973CCCGGCCCCACACGNONE 
AK107202CCCACACGConserved hypothetical protein. 
AK107202CCCGGCCCCACACGConserved hypothetical protein. 
J053035N21CCCACACGNONE 
J053035N21CCCGGCCCCACACGNONE 
J053099D11CCCACACGNONE 
J053099D11CCCGGCCCCACACGNONE 
J065023B18CCCACACGNONE 
J065023B18CCCGGCCCCACACGNONE 
J065031M15CCCACACGNONE 
J065031M15CCCGGCCCCACACGNONE 
J065035G23CCCACACGNONE 
J065035G23CCCGGCCCCACACGNONE 
J065060M18CCCACACGNONE 
J065060M18CCCGGCCCCACACGNONE 
J065073J18CCCACACGNONE 
J065073J18CCCGGCCCCACACGNONE 
J065103E20CCCACACGNONE 
J065103E20CCCGGCCCCACACGNONE 
J065105N19CCCACACGNONE 
J065105N19CCCGGCCCCACACGNONE 
J065137A08CCCACACGNONE 
J065137A08CCCGGCCCCACACGNONE 
J065152K09CCCACACGNONE 
J065152K09CCCGGCCCCACACGNONE 
J065156M12CCCACACGNONE 
J065156M12CCCGGCCCCACACGNONE 
J065162G23CCCACACGNONE 
J065162G23CCCGGCCCCACACGNONE 
J065162L13CCCACACGNONE 
J065162L13CCCGGCCCCACACGNONE 
J065163H16CCCACACGNONE 
J065163H16CCCGGCCCCACACGNONE 
J065165E06CCCACACGNONE 
J065165E06CCCGGCCCCACACGNONE 
J065171J04CCCACACGNONE 
J065171J04CCCGGCCCCACACGNONE 
J065180L23CCCACACGNONE 
J065180L23CCCGGCCCCACACGNONE 
J065183K23CCCACACGNONE 
J065183K23CCCGGCCCCACACGNONE 
J065186H13CCCACACGNONE 
J065186H13CCCGGCCCCACACGNONE 
J065195D10CCCACACGNONE 
J065195D10CCCGGCCCCACACGNONE 
J065209G11CCCACACGNONE 
J065209G11CCCGGCCCCACACGNONE 
J075006J08CCCACACGNONE 
J075006J08CCCGGCCCCACACGNONE 
J075112O07CCCACACGNONE 
J075112O07CCCGGCCCCACACGNONE 
J080301H14CCCACACGNONE 
J080301H14CCCGGCCCCACACGNONE 
J100058C17CCCACACGNONE 
J100058C17CCCGGCCCCACACGNONE 
J100077I23CCCACACGNONE 
J100077I23CCCGGCCCCACACGNONE 
J100080I24CCCACACGNONE 
J100080I24CCCGGCCCCACACGNONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0677400AF014469CCCACACGPeroxidase. 
J065063M13CCCACACGNONE 
J065176G06CCCACACGNONE 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0136500006-092-G03GCCCACACGNONE 
AK061187GCCCACACGProtein of unknown function DUF26 domain containing protein. 
J065057C18GCCCACACGNONE 
Os08g0138500AK102951GCCCCCACACGCCCACCTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GCCCCCACACGCCCACCTNONE 
J033115D14GCCCCCACACGCCCACCTNONE 
J065013F04GCCCCCACACGCCCACCTNONE 
J065050P11GCCCCCACACGCCCACCTNONE 
J065063K18GCCCCCACACGCCCACCTNONE 
J090054H10GCCCCCACACGCCCACCTNONE 
J100083F11GCCCCCACACGCCCACCTNONE 
Os08g0173300J065196D12GCCCACACGConserved hypothetical protein. 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK067587GCCCACACGTGGCProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
AK099016GCCCACACGTGGCNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08GCCCACACGTGGCNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24GCCCACACGTGGCNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05GCCCACACGTGGCNONE 
Os08g0260600AK108529TCCACGCCCACACGCCACACGCD9/CD37/CD63 antigen family protein. 
Os08g0320100011-088-D10CGTGTGGGGNONE 
AK121802CGTGTGGGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0474750J075009C13CGTGTGGGCCATNONE 
J075122O14CGTGTGGGCCATHypothetical protein. 
Os08g0474800Os08g0474800CGTGTGGGCCATEsterase/lipase/thioesterase domain containing protein. 
Os08g0478500AK099704CGTGTGGGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0485800J075014D10CCCACACGNONE 
J075028F06CCCACACGNONE 
J075070M24CCCACACGNONE 
J075139K09CCCACACGNONE 
J090010M07CCCACACGExpansin/Lol pI family protein. 
J090010P05CCCACACGNONE 
Os08g0490600AK108305CCCACACGBeta-Ig-H3/fasciclin domain containing protein. 
Os08g0503800AK101954ATGGCCCACACGSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0526100011-072-E04CCCACACGNONE 
011-072-E04CGTGTGGGCNONE 
AK100965CCCACACGNAD-dependent epimerase/dehydratase family protein. 
AK100965CGTGTGGGCNAD-dependent epimerase/dehydratase family protein. 
J023142D13CCCACACGNONE 
J023142D13CGTGTGGGCNONE 
J033132L16CCCACACGNONE 
J033132L16CGTGTGGGCNONE 
J090006E20CCCACACGNONE 
J090006E20CGTGTGGGCNONE 
J100069L13CCCACACGNONE 
J100069L13CGTGTGGGCNONE 
Os08g0549100004-006-D12AGGGCCCACACGNONE 
006-085-H05AGGGCCCACACGNONE 
006-101-B02AGGGCCCACACGNONE 
AK070842AGGGCCCACACGSimilar to Peroxisome type ascorbate peroxidase. 
AK104490AGGGCCCACACGNONE 
J013095F24AGGGCCCACACGNONE 
J013111D10AGGGCCCACACGNONE 
J023031C15AGGGCCCACACGNONE 
J023067J02AGGGCCCACACGNONE 
J023074O14AGGGCCCACACGNONE 
J033058F18AGGGCCCACACGNONE 
J033101F12AGGGCCCACACGNONE 
J053026B20AGGGCCCACACGNONE 
J065070G12AGGGCCCACACGNONE 
J065196H18AGGGCCCACACGNONE 
J075021N20AGGGCCCACACGNONE 
J075069K22AGGGCCCACACGNONE 
J075093E22AGGGCCCACACGNONE 
J075110D17AGGGCCCACACGNONE 
J075119D06AGGGCCCACACGNONE 
J075181H15AGGGCCCACACGNONE 
J090038O15AGGGCCCACACGNONE 
J090043K23AGGGCCCACACGNONE 
J090082E12AGGGCCCACACGNONE 
J100022M19AGGGCCCACACGNONE 
J100027E06AGGGCCCACACGNONE 
J100028G17AGGGCCCACACGNONE 
J100061I16AGGGCCCACACGNONE 
J100065G23AGGGCCCACACGNONE 
J100087C13AGGGCCCACACGNONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os09g0251800006-100-E12CGTGTGGGCCCCACCNONE 
AK061218CGTGTGGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGTGTGGGCCCCACCNONE 
J065048A02CGTGTGGGCCCCACCNONE 
J065073P10CGTGTGGGCCCCACCNONE 
J065075B09CGTGTGGGCCCCACCNONE 
J065112B05CGTGTGGGCCCCACCNONE 
J090014H10CGTGTGGGCCCCACCNONE 
Os09g0280600AK070961CGTGTGGGGCTTTTMnd1 family protein. 
J023066B13CGTGTGGGGCTTTTNONE 
Os09g0355400AK099784CGTGTGGGProtein kinase-like domain containing protein. 
Os09g0361400006-109-H02AGGGCCCACACGNONE 
006-120-G04AGGGCCCACACGNONE 
AK060652AGGGCCCACACGOuter mitochondrial membrane protein porin (Voltage-dependent anion- selective channel protein) (VDAC). 
AK061261AGGGCCCACACGNONE 
AK072129AGGGCCCACACGNONE 
J023109H05AGGGCCCACACGNONE 
J065052I18AGGGCCCACACGNONE 
J065058M16AGGGCCCACACGNONE 
J065079L08AGGGCCCACACGNONE 
J065107J15AGGGCCCACACGNONE 
J065137A03AGGGCCCACACGNONE 
J090013N18AGGGCCCACACGNONE 
J090064O16AGGGCCCACACGNONE 
J100080N15AGGGCCCACACGNONE 
Y18104AGGGCCCACACGNONE 
Os09g0447900AK111436CCCCACACGConserved hypothetical protein. 
Os09g0455200J065041I12GCCCACACGWinged helix repressor DNA-binding domain containing protein. 
J065120N14GCCCACACGNONE 
Os09g0463700016-008-D06TTGGCCCACACGNONE 
AK060708TTGGCCCACACGSimilar to AHM1. 
J090013G05TTGGCCCACACGNONE 
Os09g0471900AK073815CGCGTCTCCAGCCCACACGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0553200003-101-F12CGTGTGGGCNONE 
003-125-E09CGTGTGGGCNONE 
011-031-H12CGTGTGGGCNONE 
012-033-A01CGTGTGGGCNONE 
015-046-H04CGTGTGGGCNONE 
015-056-F04CGTGTGGGCNONE 
016-029-H06CGTGTGGGCNONE 
016-080-D05CGTGTGGGCNONE 
AB062606CGTGTGGGCNONE 
AK065780CGTGTGGGCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGTGTGGGCNONE 
AK104344CGTGTGGGCNONE 
AK119197CGTGTGGGCNONE 
AK119232CGTGTGGGCNONE 
J013039M01CGTGTGGGCNONE 
J013043M01CGTGTGGGCNONE 
J013064F03CGTGTGGGCNONE 
J013066K19CGTGTGGGCNONE 
J013092G12CGTGTGGGCNONE 
J013123P09CGTGTGGGCNONE 
J013155F01CGTGTGGGCNONE 
J013158J12CGTGTGGGCNONE 
J013159H14CGTGTGGGCNONE 
J013169C10CGTGTGGGCNONE 
J013170L23CGTGTGGGCNONE 
J023010J18CGTGTGGGCNONE 
J023019E23CGTGTGGGCNONE 
J023045B14CGTGTGGGCNONE 
J023082K24CGTGTGGGCNONE 
J023086G04CGTGTGGGCNONE 
J023090N09CGTGTGGGCNONE 
J023113C08CGTGTGGGCNONE 
J023125H18CGTGTGGGCNONE 
J033034M08CGTGTGGGCNONE 
J033035K03CGTGTGGGCNONE 
J033039D15CGTGTGGGCNONE 
J033045P18CGTGTGGGCNONE 
J033058P08CGTGTGGGCNONE 
J033061D16CGTGTGGGCNONE 
J033070F14CGTGTGGGCNONE 
J033086F23CGTGTGGGCNONE 
J033095C05CGTGTGGGCNONE 
J033114H22CGTGTGGGCNONE 
J033133M20CGTGTGGGCNONE 
J043026G01CGTGTGGGCNONE 
J043037F17CGTGTGGGCNONE 
J065120K17CGTGTGGGCNONE 
J065123O07CGTGTGGGCNONE 
J080305H06CGTGTGGGCNONE 
J090001F11CGTGTGGGCNONE 
J090020C17CGTGTGGGCNONE 
J090043A19CGTGTGGGCNONE 
J090051J17CGTGTGGGCNONE 
J090068K06CGTGTGGGCNONE 
J090075P19CGTGTGGGCNONE 
J100036G10CGTGTGGGCNONE 
J100084F02CGTGTGGGCNONE 
Os11g0127700AK103742GGACCCACACGHypothetical protein. 
J090083M11GGACCCACACGNONE 
Os11g0157900AK108705CCCACACGConserved hypothetical protein. 
Os11g0166800AK070928CGTGTGGGRNA polymerase II transcription factor SIII subunit A family protein. 
Os11g0184900011-088-C07GCCCACACGNONE 
015-036-B03GCCCACACGNONE 
016-087-F07GCCCACACGNONE 
AB028184GCCCACACGNONE 
AK063399GCCCACACGSimilar to NAC-domain protein 5-7. 
AK064292GCCCACACGNONE 
AK102475GCCCACACGNONE 
J033094I01GCCCACACGNONE 
J090087J16GCCCACACGNONE 
Os11g0414000012-012-F01TCAGCCCACACGNONE 
AK071277TCAGCCCACACGeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCAGCCCACACGNONE 
J023083E17TCAGCCCACACGNONE 
J023128I07TCAGCCCACACGNONE 
J033098J04TCAGCCCACACGNONE 
J033135G10TCAGCCCACACGNONE 
J043007L23TCAGCCCACACGNONE 
J065011N07TCAGCCCACACGNONE 
J065016E01TCAGCCCACACGNONE 
J065162N12TCAGCCCACACGNONE 
J065164O22TCAGCCCACACGNONE 
J065173J06TCAGCCCACACGNONE 
J065200E24TCAGCCCACACGNONE 
J065203K20TCAGCCCACACGNONE 
J075033N16TCAGCCCACACGNONE 
J075047L06TCAGCCCACACGNONE 
J075064J24TCAGCCCACACGNONE 
J075100O07TCAGCCCACACGNONE 
J075121G11TCAGCCCACACGNONE 
J075134A13TCAGCCCACACGNONE 
J075190F20TCAGCCCACACGNONE 
J075190H08TCAGCCCACACGNONE 
J080033L04TCAGCCCACACGNONE 
J080045O09TCAGCCCACACGNONE 
J080064J07TCAGCCCACACGNONE 
J080066N22TCAGCCCACACGNONE 
J080075C09TCAGCCCACACGNONE 
J090002C08TCAGCCCACACGNONE 
J090058G21TCAGCCCACACGNONE 
J090074M07TCAGCCCACACGNONE 
J100090G06TCAGCCCACACGNONE 
Os12g0123900016-031-A06GGACCCACACGNONE 
AK061862GGACCCACACGHypothetical protein. 
J013031P10GGACCCACACGNONE 
J053034P22GGACCCACACGNONE 
J053046O16GGACCCACACGNONE 
J053048D20GGACCCACACGNONE 
J090031I07GGACCCACACGNONE 
J100025B02GGACCCACACGNONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0230600AK072568TGTGGGCCCCACCCACACGProtein of unknown function DUF1685 family protein. 
Os12g0242800AK107948CCCACACGTRAM, LAG1 and CLN8 homology domain containing protein. 
Os12g0460800J023003J21GCCCACACGCCACNONE 
Os12g0547500AK065586ACCCCCCACACGCalponin-like actin-binding domain containing protein. 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0621100AK070737GCCCCCACACGSimilar to Filamentous flower-like yabby protein (Fragment). 
AK104918GCCCCCACACGNONE 
J013057J22GCCCCCACACGNONE 
J023025C05GCCCCCACACGNONE 
J023060E23GCCCCCACACGNONE 
J090041I07GCCCCCACACGNONE 
Os12g0633900AK107507CCCACACGConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.