
Summary of OsREG527 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3481  

Entry Sequences (3481 entries)

LocusGene modelSequenceDescription
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK103808CCCACCACC-type lectin domain containing protein. 
Os01g0104100AK072797GTGGTGGGZinc finger, RING-type domain containing protein. 
Os01g0139700J065118K13GCCCACCACConserved hypothetical protein. 
Os01g0172200AK100326CCCACCACCACCTGTCGCGTCWW/Rsp5/WWP domain containing protein. 
D73411ACGCGTGGTGGGPhospholipase D alpha 1 precursor (EC (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein. 
D16499CCCACCACNADP-dependent malic enzyme, chloroplast precursor (EC (NADP-ME). 
Os01g0198100AK119908CCCACCACConserved hypothetical protein. 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0231000AK066156CCCACCACSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J075157P20CCCACCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK063921CCCACCACSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0346700AK071793CCCACCACConserved hypothetical protein. 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
AK119688AGCCCACCACConserved hypothetical protein. 
AK119688CCCACCACConserved hypothetical protein. 
Os01g0388000AK069778GTGGTGGGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
AK067715AGCCCACCACSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
Os01g0514700AK069218CCCACCACProtein kinase domain containing protein. 
Os01g0541900AK069784GTGGTGGGProtein kinase-like domain containing protein. 
AK070745GCCCACCACVoltage-dependent anion channel. 
Os01g0624700AK111416GCCCACCACSimilar to WRKY transcription factor 12. 
Os01g0651100AK119380CCCACGCGCCCATCGCCCACCACProtein prenyltransferase domain containing protein. 
AK073990GTGGTGGGCyclin-like F-box domain containing protein. 
AK105335CCCACCACGlutaredoxin-like, plant II family protein. 
Os01g0698300AK100582CCCACCACZinc finger, BED-type predicted domain containing protein. 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK104463AGCCCACCACSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0722700AK069917CCCACCACSimilar to Hexokinase. 
AK105996GTGGTGGGVirulence factor, pectin lyase fold family protein. 
Os01g0747400AK102467GTGGTGGGProtein kinase-like domain containing protein. 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
AK103570GTCCCACCACBSD domain containing protein. 
AK061585GCCCACGCCCACCACCyclin-like F-box domain containing protein. 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0793200AK059040CCCACCACProtein prenyltransferase domain containing protein. 
AK062811CCCACCACConserved hypothetical protein. 
AK062811CCCACCACConserved hypothetical protein. 
Os01g0799500AK109346CCCACCACDNA glycosylase family protein. 
AK065370GTGGTGGGGCSimilar to ADP-ribosylation factor 1. 
Os01g0823200AK066097CCCACCACCGCACConserved hypothetical protein. 
Os01g0826400AK107199GTGGTGGGWRKY transcription factor 24 (WRKY24). 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
AK100543GCCCACCACSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0835500AK100241GTCCCACCACSimilar to Respiratory burst oxidase protein. 
Os01g0848200AK069425CCCACCACSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK058878CCCACCACSimilar to Hevamine A precursor [Includes: Chitinase (EC; Lysozyme (EC]. 
Os01g0862800AK071274CCCACCACNo apical meristem (NAM) protein domain containing protein. 
AK071274GTCCCACCACGCCACNo apical meristem (NAM) protein domain containing protein. 
AK099677CCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0885600AK059523CCCACCACEsterase/lipase/thioesterase domain containing protein. 
AK068254CCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0904500AK119437GTGGTGGGCTGGConserved hypothetical protein. 
Os01g0913100AK070387GGTCCCACCACProtein of unknown function DUF538 family protein. 
Os01g0960500AK065423CCCACCACCopine domain containing protein. 
AK065423GTGGTGGGCCopine domain containing protein. 
Os01g0965500J075073G20AGCCCACCACNuclear protein SET domain containing protein. 
AK065743CCCACCACEndosperm lumenal binding protein. 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK070711CCCACCACConserved hypothetical protein. 
Os02g0128300AK101453GTGGTGGGENTH/VHS domain containing protein. 
Os02g0129800AK109213GTGGTGGGGCCConserved hypothetical protein. 
AK073353CCCACCACConserved hypothetical protein 1589, plant family protein. 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 
AK071564GTGGTGGGConserved hypothetical protein. 
AK068024CCCACCACConserved hypothetical protein. 
AK060405CCCACCACConserved hypothetical protein. 
Os02g0473000AK065460GTGGTGGGCGAGGRiboflavin biosynthesis protein RibD family protein. 
Os02g0491400AK073233CCCACCACSimilar to Peptidylprolyl isomerase. 
AK073233CCCACCACSimilar to Peptidylprolyl isomerase. 
Os02g0550900AK068291GTGGTGGGFAR1 domain containing protein. 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
AK100187CCCACCACConserved hypothetical protein. 
Os02g0564400J100058K21CCCACCACSimilar to CLP protease regulatory subunit CLPX precursor. 
Os02g0574800AK108451GTGGTGGGGCConserved hypothetical protein. 
Os02g0574900AK073087AGCCCACCACCyclin-like F-box domain containing protein. 
Os02g0588700AK100801CCCACCACCAACConserved hypothetical protein. 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
Os02g0619600AK072178CCCACCACZinc finger, RING-type domain containing protein. 
AK061679GTGGTGGGConserved hypothetical protein. 
AK059694GTGGTGGGUbiquitin-conjugating enzyme, E2 domain containing protein. 
AK072855CCCACCACProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
Os02g0652100AK072906AGCCCACCACSimilar to WRKY transcription factor 34. 
Os02g0653000AK062922GCCCCCACCACConserved hypothetical protein. 
AK099591GCCCCCACCACConserved hypothetical protein. 
AK102993ACAGCCCACCACConserved hypothetical protein. 
J100090A12CCCACCACConserved hypothetical protein. 
Os02g0728600AK063054GTGGTGGGCSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
Os02g0741800AK073562GTGCGGTGGTGGGSimilar to Permease 1. 
AK073572CCCACCACAlpha-expansin OsEXPA5. 
AK073572CCCACCACAlpha-expansin OsEXPA5. 
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
Os02g0783000AK105110GTGGTGGGSimilar to Pectin methylesterase 5 (Fragment). 
Os02g0813600AK107210CCCACCACVery-long-chain 3-ketoacyl-CoA synthase family protein. 
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein. 
Os03g0109400AK102378GTGGTGGGGGAGHomeobox domain containing protein. 
AK066955GAAGCCCACCACConserved hypothetical protein. 
Os03g0128300AK064718CCCACCACConserved hypothetical protein. 
Os03g0131000AK109138CCCACCACSimilar to Avr9/Cf-9 induced kinase 1. 
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase. 
Os03g0136900AK067183GCCCACCACGCGTCTCSimilar to Aconitate hydratase, cytoplasmic (EC (Citrate hydro-lyase) (Aconitase). 
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0160200AK064836CCCACCACGCGTCCConserved hypothetical protein. 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
AK061335CCCACCACSimilar to Fiddlehead protein. 
Os03g0207400AK072292GCCCCACCACSimilar to Protein phosphatase 2C-like. 
AK102905GCCCCCACCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0278500AK070850GTGGTGGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
AK069222CCCACCACConserved hypothetical protein. 
AK059950CCAAGCCCCCACCACZinc finger, CHY-type domain containing protein. 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
AK073355CCCACCACSimilar to Hydrolase. 
Os03g0611200AK065587CCCACCCGCCCACCACAldo/keto reductase family protein. 
AK063716GCCCACCACConserved hypothetical protein. 
Os03g0625900AK101109ACCCCCCACCACWD40-like domain containing protein. 
Os03g0626100AK119864GTGGTGGGZinc finger, RING-type domain containing protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0656500AK121052CCCACCACSimilar to K-exchanger-like protein. 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK063654CCCACCACHypothetical protein. 
Os03g0711400AK100286CCCACCACSimilar to Coatomer alpha subunit. 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
J033048F03GGTCCCACCACSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
Os03g0719100AK065127GTGGTGGGCTDNA-binding SAP domain containing protein. 
Os03g0741500AK110867GTGGTGGGSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
AK071214GTGGTGGGProtein of unknown function DUF124 family protein. 
Os03g0773600AK103310GGTGTGTGGTGGGKinesin, motor region domain containing protein. 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
AK067690CCCACCACSimilar to OsNAC6 protein. 
AK070075CCCACCACConserved hypothetical protein. 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
Os03g0830600AK107563CCCACCACPectinesterase inhibitor domain containing protein. 
Os03g0853600J033082A21CCCACCACConserved hypothetical protein. 
Os04g0218900AK071049CCCACCACTRAF-like domain containing protein. 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment). 
Os04g0293600AK063003GTGGTGGGCHypothetical protein. 
Os04g0407900AK064758CCCACCACSimilar to Cytochrom P450-like protein. 
Os04g0412100AK108223CCCACCACConserved hypothetical protein. 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC (Fragment). 
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC (GAD 2). 
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 
AK071311GTGGTGGGGCCGTGSimilar to 14-3-3-like protein GF14-6. 
Os04g0472300AK070339GCCCACCACGlycerophosphoryl diester phosphodiesterase family protein. 
AK067372CGCACCGCCCACCACGlycosyl transferase, family 17 protein. 
Os04g0501200AK069193CCCACCACConserved hypothetical protein. 
Os04g0512300AK071791CCCACCACArp2/3 complex, 34kDa subunit p34-Arc family protein. 
AK068772GTGGTGGGCSimilar to Beta-glucosidase. 
Os04g0529100AK107680CCCACCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK106182CCCACCACSimilar to Remorin (pp34). 
Os04g0549300AK063296GCCCACCACGGCCSimilar to GA protein (Fragment). 
Os04g0555000AK100757CCCACCACGRAS transcription factor domain containing protein. 
Os04g0564700AK111806GTGGTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0565900AK109094CCCACCACHelix-loop-helix DNA-binding domain containing protein. 
Os04g0579200AK100603CCCACCACZinc finger, RING-type domain containing protein. 
AK100603GCCCACCACZinc finger, RING-type domain containing protein. 
AK064040GGCCCCACCACSimilar to Alternative oxidase 1a (Fragment). 
Os04g0602800AK100925GTGGTGGGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0613200AK109490CCCACCACCAACVirulence factor, pectin lyase fold family protein. 
AK110887ATCCCCCACCACExonuclease domain containing protein. 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
AK106226TGGGACCCACCACProtein of unknown function DUF1635 family protein. 
Os05g0116500AK102231CCCACCACConserved hypothetical protein. 
AK102231GGGACCCACCACConserved hypothetical protein. 
AK111821CCCACCACMyb, DNA-binding domain containing protein. 
AK099030CCACCAACCCCACCACConserved hypothetical protein. 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0186300AK070360CCCACCACSimilar to NADP-malic enzyme. 
Os05g0186900AK111403GCCCACCACCACCTGTConserved hypothetical protein. 
Os05g0194900AK071798GTGGTGGGCSimilar to Pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein (Pyrophosphate-dependent phosphofructo-1-kinase-like protein). 
Os05g0209000AK111487AGCCCACCACConserved hypothetical protein. 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
Os05g0223300AK069616CCCACCACCAACSimilar to RNA-binding protein. 
AK061317GCCCACCACSimilar to Ribosomal protein L13. 
Os05g0272900AK107093GTGGTGGGB-cell receptor-associated 31-like family protein. 
Os05g0273800AK060563CCCACCACSimilar to Soluble epoxide hydrolase. 
D13152CCCACCACSimilar to Ras-related protein Rab11A. 
AK062425ACAGCCCACCACConserved hypothetical protein. 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
AK101263GTCCCACCACDrought induced 19 family protein. 
AK064110GTGGTGGGConserved hypothetical protein. 
Os05g0370700AK108862GCAGCCCACCACAlpha/beta hydrolase family protein. 
Os05g0391500AK119412ACCCCCCACCACSimilar to Endo-beta-mannosidase. 
AK104407CCCACCACMitochondrial substrate carrier family protein. 
AK104407GCCCACCACMitochondrial substrate carrier family protein. 
Os05g0410800AK108312GCCCCACCACTGF-beta receptor, type I/II extracellular region family protein. 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
AK059951CCCACCACCACCAACSimilar to Soluble inorganic pyrophosphatase (EC (Pyrophosphate phospho- hydrolase) (PPase). 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
Os05g0474700AK109305GTGGTGGGConserved hypothetical protein. 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK062441GTGGTGGGCCTCCT20 family protein. 
AK072857CCCACCACPhosphofructokinase family protein. 
Os05g0566800AK065748CCCACCACCold acclimation protein COR413-TM1. 
Os05g0579300AK111350CATCCCCCACCACZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
AK111350CCCACCACZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os05g0581700AK108181CCCACCACConserved hypothetical protein. 
AK099566GTGGTGGGCSIT4 phosphatase-associated protein family protein. 
AK060638CCCACCACIQ calmodulin-binding region domain containing protein. 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0171700AK103771GCGCGGGTGGTGGGGCTTGGCdk-activating kinase assembly factor (MAT1) family protein. 
Os06g0179000AK065263CCCACCACGlycoside hydrolase family 79, N-terminal protein. 
AK121252GGTCCCACCACLeucine rich repeat, N-terminal domain containing protein. 
Os06g0192000AK106844GTGGTGGGConserved hypothetical protein. 
Os06g0202300AK063905GTGGTGGGConserved hypothetical protein. 
Os06g0207000AK067115CCCACCACFumble domain containing protein. 
J065168N11GTGGTGGGConserved hypothetical protein. 
Os06g0495800J100069N08GCCCACCACProtein of unknown function DUF617, plant family protein. 
AK104955CCCACCACSimilar to Heme oxygenase 1 (Fragment). 
Os06g0609600AK072533CCCACCACEF-Hand type domain containing protein. 
AK067505CCCACCACRibose-phosphate pyrophosphokinase 2 (EC (Phosphoribosyl pyrophosphate synthetase 2). Splice isoform 1. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
Os06g0636700AK058562GGCCCCACCACLipolytic enzyme, G-D-S-L family protein. 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
Os06g0647400AK068457GTGGTGGGCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os06g0666400AK108002GGGGCCCACCCACCACVQ domain containing protein. 
Os06g0667400AK065424GTGGTGGGConserved hypothetical protein. 
AK065424GTGGTGGGConserved hypothetical protein. 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
AK063941CCCACCACACACCConserved hypothetical protein. 
Os06g0704700AK120907CCCCCGCGCCCCACCACNmrA-like family protein. 
AK071568CCCACCACProtein of unknown function DUF563 family protein. 
Os06g0710900AK073326CTGGCCCACCACConserved hypothetical protein. 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
AK069538TGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
AK071639GTGGTGGGEukaryotic transcription factor, DNA-binding domain containing protein. 
AK071639TGGTGGGCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
AK073305GTGGTGGGCSimilar to PDX1-like protein 4. 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
AK067073CCCACCACSimilar to Kinase-like protein. 
AK070572CAAGCCCACCACConserved hypothetical protein. 
Os07g0191000AK071379CCCACCACInositol monophosphatase family protein. 
AK060951CCCACCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
Os07g0217600AK065971GTGGTGGGCCytochrome P450 family protein. 
Os07g0229200AK058412GTGGTGGGGGCCyclin-like F-box domain containing protein. 
Os07g0486500AK063998CCCACCACRho GTPase activation protein domain containing protein. 
AK073883GTGGTGGGGGAGCupin, RmlC-type domain containing protein. 
Os07g0499800AK120716ACCCCCCACCACZinc finger, RING-type domain containing protein. 
AK120716CCCACCACZinc finger, RING-type domain containing protein. 
Os07g0541900AK109699GTGGTGGGGCCSimilar to KI domain interacting kinase 1. 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC (Fragment). 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
AK067725CCCACCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103183CCCACCACConserved hypothetical protein. 
Os07g0594400J065137M02CCCACCACConserved hypothetical protein. 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
AK112118GCCCCACCACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
AK105687CCCACCACSimilar to M-160-u1_1 (Fragment). 
Os07g0623600AK063642GTGGTGGGTGGGGGCGCGGGTGCGGTGConserved hypothetical protein. 
Os07g0624600AK109902GTGGTGGGCCATSimilar to Trehalose-6-phosphate phosphatase. 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0633800AK103878GTGGTGGGACConserved hypothetical protein. 
AK107202CCCGGCCCCACCACCCCACCCGConserved hypothetical protein. 
Os07g0672500AK067432CCCACCACSMAD/FHA domain containing protein. 
AK063800CCCACCACSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC (CR6). 
AK121176GTGGTGGGCCCTRickettsia 17 kDa surface antigen family protein. 
Os08g0126500AK110941TGGGACCCACCACProtein of unknown function DUF295 family protein. 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
Os08g0128200AK120428GTGGGTCCCACCACConserved hypothetical protein. 
AK067917GTGGTGGGCCCCACCMajor sperm protein domain containing protein. 
AK065294CCCACCACGTCTCSimilar to NAM protein. 
Os08g0176900AK107028GCCCCCACCACSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK063025GGCCGTGGTGGTGGGGGAGHypothetical protein. 
Os08g0260600AK108529GTGGTGGGCD9/CD37/CD63 antigen family protein. 
AK068711CCCACCACProtein of unknown function DUF1218 family protein. 
AK105984CCCACCACConserved hypothetical protein. 
AK103873CCCACCACSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
Os08g0387500AK105106GTGGTGGGCCCCACCCGSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
Os08g0430000AK120950CCCACCACConserved hypothetical protein. 
Os08g0431100AK069476GTGGTGGGGCBromo adjacent region domain containing protein. 
AK060222CCCACCACSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
Os08g0447200AK067377GTGGTGGGCCAGSGT1 family protein. 
Os08g0471800AK105281GCCCACCACRemorin, C-terminal region domain containing protein. 
AK062882CCCACCACSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J065152E11GTGGTGGGCCCCACASimilar to PBF protein. 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
AK064018CCACTGACGTGGTGGGCCCCACCConserved hypothetical protein. 
Os08g0512700AK060545GTGGTGGGGCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC (Fragment). 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
AK100965GCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
AK061477CCCACCACPAP fibrillin family protein. 
Os09g0309500J100027L22GAGGCCCACCACConserved hypothetical protein. 
Os09g0322100AK107018TCAGCCCACCACConserved hypothetical protein. 
Os09g0324000AK107774CTCCCCCACCACSimilar to Oleosin. 
AK063334CCCACCACCTGTCSimilar to Protein phpsphatase 2C (PP2C) (EC 
Os09g0363900AK072899GTGGTGGGSimilar to HOTHEAD protein precursor (ADHESION OF CALYX EDGES protein). 
Os09g0370300AK108199AGCCCACCACSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
AK072517CCCACCACACTGACAConserved hypothetical protein. 
AK101300GTGGTGGGVesicle transport v-SNARE family protein. 
Os09g0423500AK120024CCCACCACPeptidase A1, pepsin family protein. 
Os09g0444500AK059606GCCCCACCACConserved hypothetical protein. 
Os09g0445600AK107839CAGGTGGGGCCCACCACConserved hypothetical protein. 
Os09g0455200J065041I12CCCACCACWinged helix repressor DNA-binding domain containing protein. 
Os09g0457100Os09g0457100GCCCACCACCytochrome P450 family protein. 
AK063208GCCCACCACACCGCACCyclin-dependent kinase inhibitor family protein. 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
AK061852CCCACCACProtein of unknown function DUF1664 family protein. 
Os09g0492700AK101104GTGGTGGGACCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC (Fragment). 
Os09g0497000AK099705GCCCCACCACMitochondrial substrate carrier family protein. 
AK063004GTGGTGGGCConserved hypothetical protein. 
Os09g0527700AK111128CCCACCACSimilar to Auxin-induced protein IAA4. 
Os09g0527900AK122172GCCCCACCACSimilar to Hd1-like protein. 
Os09g0528800AK070219GTGGTGGGGGCCGGGRabGAP/TBC domain containing protein. 
Os09g0542100AK105001GGTGGGCCCCACCGCCCACCACPeptidase A1, pepsin family protein. 
Os09g0542900AK073400CCCACCACConserved hypothetical protein. 
AK073078ACTGGGCCCCGCCCACCACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK103673CCCACCACHomeodomain-like containing protein. 
Os09g0571100AK106869CCCACCACVirulence factor, pectin lyase fold family protein. 
AK069257CCCACCACSimilar to NAC domain transcription factor. 
Os11g0237700J100060P16GGATGGGCCCACCACConserved hypothetical protein. 
AK109384GTGGTGGGCTGASimilar to Herbicide safener binding protein. 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
Os11g0527000J065137N17GTGGTGGGCConserved hypothetical protein. 
Os11g0542100J065162B12GGGGCCCACCACZinc finger, RING-type domain containing protein. 
Os11g0543100AK108274CCCACCACConserved hypothetical protein. 
Os11g0547000AK100677GCGGGCCCCACCCCCACCACSimilar to FKF1. 
Os11g0602300AK103473ACAGCCCACCACSimilar to HVA22-like protein a (AtHVA22a). 
Os11g0606400AK066515GTGGTGGGDisease resistance protein family protein. 
Os11g0606500AK065351CCCACCACDisease resistance protein family protein. 
AK063799GCCCCACCACConserved hypothetical protein. 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
Os12g0143150009-090-F09GCCCACCACUbiquitin domain containing protein. 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
Os12g0151500AK058389GTGGGTCCCACCACSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
Os12g0224000AK060284GTGGTGGGSimilar to Diacylglycerol kinase 1 (EC (Diglyceride kinase 1) (DGK 1) (DAG kinase 1). 
Os12g0226900AK060453GTGGTGGGCTSimilar to Allyl alcohol dehydrogenase. 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0235800AK071066AGCCCACCACSimilar to Argininosuccinate synthase (Fragment). 
AK067061CACACACCCCCACACCCACCACCCCACACSimilar to Auxin response factor 1. 
Os12g0488900AK068902GCCCACCACArmadillo-like helical domain containing protein. 
Os12g0527500AK109836GCGGCCCACCACCyclin-like F-box domain containing protein. 
Os12g0541000J065083F23GTGGTGGGTCCLumazine-binding protein family protein. 
Os12g0605900AK109696GCCCCACCACSimilar to Kinase like protein. 
AK120388CCCACCACSimilar to S-locus protein 5 (Fragment). 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein.