version

Summary of OsREG527 (All List)

OrganismOryza sativa  
IDOsREG527  
SequenceCCCACCAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3481  

Entry Sequences (3481 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0104000AK072087CCCACCACNONE 
AK103808CCCACCACC-type lectin domain containing protein. 
Os01g0104100AK072797GTGGTGGGZinc finger, RING-type domain containing protein. 
AK104280GTGGTGGGNONE 
Os01g0139700J065118K13GCCCACCACConserved hypothetical protein. 
Os01g0172200AK100326CCCACCACCACCTGTCGCGTCWW/Rsp5/WWP domain containing protein. 
Os01g0172400AK065102ACGCGTGGTGGGNONE 
AK100365ACGCGTGGTGGGNONE 
AK119523ACGCGTGGTGGGNONE 
D73411ACGCGTGGTGGGPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03ACGCGTGGTGGGNONE 
J013052B12ACGCGTGGTGGGNONE 
J013071F15ACGCGTGGTGGGNONE 
J013108F19ACGCGTGGTGGGNONE 
J023025E17ACGCGTGGTGGGNONE 
J023083O10ACGCGTGGTGGGNONE 
J023084M17ACGCGTGGTGGGNONE 
J023100D16ACGCGTGGTGGGNONE 
J023107O10ACGCGTGGTGGGNONE 
J023119F08ACGCGTGGTGGGNONE 
J033035B07ACGCGTGGTGGGNONE 
J033052C18ACGCGTGGTGGGNONE 
J033092H11ACGCGTGGTGGGNONE 
J033096D02ACGCGTGGTGGGNONE 
J033117A16ACGCGTGGTGGGNONE 
J043010E08ACGCGTGGTGGGNONE 
J043013C12ACGCGTGGTGGGNONE 
J065001M15ACGCGTGGTGGGNONE 
J065021O11ACGCGTGGTGGGNONE 
J065089O20ACGCGTGGTGGGNONE 
J065117N05ACGCGTGGTGGGNONE 
J065129L11ACGCGTGGTGGGNONE 
J065170F18ACGCGTGGTGGGNONE 
J090066E11ACGCGTGGTGGGNONE 
J090076N24ACGCGTGGTGGGNONE 
J090093G21ACGCGTGGTGGGNONE 
J100041H17ACGCGTGGTGGGNONE 
J100050D07ACGCGTGGTGGGNONE 
J100063A06ACGCGTGGTGGGNONE 
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein. 
J013071N06GTGGGTCCCACCACNONE 
J023088F12GTGGGTCCCACCACNONE 
J100027H24GTGGGTCCCACCACNONE 
J100053K15GTGGGTCCCACCACNONE 
J100082M15GTGGGTCCCACCACNONE 
Os01g0188400AK072842CCCACCACNONE 
AK121770CCCACCACNONE 
D16499CCCACCACNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23CCCACCACNONE 
J100060J17CCCACCACNONE 
Os01g0198100AK119908CCCACCACConserved hypothetical protein. 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0231000AK066156CCCACCACSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
AK072001CCCACCACNONE 
AK104654CCCACCACNONE 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0303300J053035N19CCCACCACNONE 
J075042F02CCCACCACNONE 
J075068E10CCCACCACNONE 
J075116E19CCCACCACNONE 
J075131C10CCCACCACNONE 
J075145J11CCCACCACNONE 
J075157P20CCCACCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12CCCACCACNONE 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0342900011-017-G10CCCACCACNONE 
AK063921CCCACCACSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
J033050H23CCCACCACNONE 
J065097A19CCCACCACNONE 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0346700AK071793CCCACCACConserved hypothetical protein. 
J023114F06CCCACCACNONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0384800009-073-F04AGCCCACCACNONE 
009-073-F04CCCACCACNONE 
009-149-E07AGCCCACCACNONE 
009-149-E07CCCACCACNONE 
AK119688AGCCCACCACConserved hypothetical protein. 
AK119688CCCACCACConserved hypothetical protein. 
AK120910AGCCCACCACNONE 
AK120910CCCACCACNONE 
J013033N16AGCCCACCACNONE 
J013033N16CCCACCACNONE 
J023034B07AGCCCACCACNONE 
J023034B07CCCACCACNONE 
J023034J16AGCCCACCACNONE 
J023034J16CCCACCACNONE 
J065105O09AGCCCACCACNONE 
J065105O09CCCACCACNONE 
J065194F07AGCCCACCACNONE 
J065194F07CCCACCACNONE 
J075070L22AGCCCACCACNONE 
J075070L22CCCACCACNONE 
J075128L01AGCCCACCACNONE 
J075128L01CCCACCACNONE 
J075164C09AGCCCACCACNONE 
J075164C09CCCACCACNONE 
J100028M15AGCCCACCACNONE 
J100028M15CCCACCACNONE 
J100042M14AGCCCACCACNONE 
J100042M14CCCACCACNONE 
J100063D20AGCCCACCACNONE 
J100063D20CCCACCACNONE 
J100066A19AGCCCACCACNONE 
J100066A19CCCACCACNONE 
J100079K09AGCCCACCACNONE 
J100079K09CCCACCACNONE 
J100079K17AGCCCACCACNONE 
J100079K17CCCACCACNONE 
Os01g0388000AK069778GTGGTGGGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
Os01g0501800006-021-B07AGCCCACCACNONE 
006-021-E12AGCCCACCACNONE 
006-022-B08AGCCCACCACNONE 
006-022-C09AGCCCACCACNONE 
006-022-C12AGCCCACCACNONE 
006-022-F10AGCCCACCACNONE 
006-023-A09AGCCCACCACNONE 
006-023-D02AGCCCACCACNONE 
006-023-E06AGCCCACCACNONE 
006-023-E11AGCCCACCACNONE 
006-025-A01AGCCCACCACNONE 
006-025-B07AGCCCACCACNONE 
006-025-F04AGCCCACCACNONE 
006-025-F11AGCCCACCACNONE 
006-027-F05AGCCCACCACNONE 
006-028-C02AGCCCACCACNONE 
006-029-B01AGCCCACCACNONE 
006-029-D09AGCCCACCACNONE 
006-029-G02AGCCCACCACNONE 
006-029-H08AGCCCACCACNONE 
006-030-A02AGCCCACCACNONE 
006-030-B05AGCCCACCACNONE 
006-031-A01AGCCCACCACNONE 
006-032-E09AGCCCACCACNONE 
006-032-G10AGCCCACCACNONE 
006-032-H11AGCCCACCACNONE 
006-033-B08AGCCCACCACNONE 
006-033-E11AGCCCACCACNONE 
006-034-H01AGCCCACCACNONE 
006-035-B09AGCCCACCACNONE 
006-035-D08AGCCCACCACNONE 
006-036-F01AGCCCACCACNONE 
006-036-G01AGCCCACCACNONE 
006-037-E12AGCCCACCACNONE 
006-039-D07AGCCCACCACNONE 
006-040-A03AGCCCACCACNONE 
006-042-G11AGCCCACCACNONE 
006-044-F11AGCCCACCACNONE 
006-045-H04AGCCCACCACNONE 
006-046-A09AGCCCACCACNONE 
006-046-C12AGCCCACCACNONE 
006-046-F10AGCCCACCACNONE 
006-046-H08AGCCCACCACNONE 
006-047-G05AGCCCACCACNONE 
006-047-G06AGCCCACCACNONE 
006-048-C05AGCCCACCACNONE 
006-049-A07AGCCCACCACNONE 
006-049-E03AGCCCACCACNONE 
006-050-D08AGCCCACCACNONE 
006-050-E02AGCCCACCACNONE 
006-050-E07AGCCCACCACNONE 
006-050-F11AGCCCACCACNONE 
006-051-D04AGCCCACCACNONE 
006-051-G07AGCCCACCACNONE 
006-052-B06AGCCCACCACNONE 
006-052-B11AGCCCACCACNONE 
006-052-C06AGCCCACCACNONE 
006-053-G03AGCCCACCACNONE 
006-054-C01AGCCCACCACNONE 
006-054-D09AGCCCACCACNONE 
006-056-B11AGCCCACCACNONE 
006-056-C07AGCCCACCACNONE 
006-056-C12AGCCCACCACNONE 
006-057-C05AGCCCACCACNONE 
006-057-E08AGCCCACCACNONE 
006-058-F03AGCCCACCACNONE 
006-059-A03AGCCCACCACNONE 
006-059-C12AGCCCACCACNONE 
006-062-A06AGCCCACCACNONE 
006-062-H04AGCCCACCACNONE 
006-063-B08AGCCCACCACNONE 
006-063-B10AGCCCACCACNONE 
006-063-D11AGCCCACCACNONE 
006-063-H07AGCCCACCACNONE 
006-065-F08AGCCCACCACNONE 
006-067-F07AGCCCACCACNONE 
006-067-G04AGCCCACCACNONE 
006-067-G12AGCCCACCACNONE 
006-068-A12AGCCCACCACNONE 
006-068-E08AGCCCACCACNONE 
006-068-H01AGCCCACCACNONE 
006-069-C01AGCCCACCACNONE 
006-069-E08AGCCCACCACNONE 
006-070-D05AGCCCACCACNONE 
006-070-E10AGCCCACCACNONE 
006-071-A02AGCCCACCACNONE 
006-072-C01AGCCCACCACNONE 
006-073-B07AGCCCACCACNONE 
006-073-D02AGCCCACCACNONE 
006-073-F06AGCCCACCACNONE 
006-075-B10AGCCCACCACNONE 
006-075-C01AGCCCACCACNONE 
006-076-E10AGCCCACCACNONE 
006-076-H12AGCCCACCACNONE 
006-077-B10AGCCCACCACNONE 
006-077-F12AGCCCACCACNONE 
006-078-C04AGCCCACCACNONE 
006-078-C10AGCCCACCACNONE 
006-078-H11AGCCCACCACNONE 
006-079-A05AGCCCACCACNONE 
006-079-C01AGCCCACCACNONE 
006-079-E04AGCCCACCACNONE 
006-079-H06AGCCCACCACNONE 
006-080-G05AGCCCACCACNONE 
006-081-C07AGCCCACCACNONE 
006-081-H07AGCCCACCACNONE 
006-082-A09AGCCCACCACNONE 
006-082-D02AGCCCACCACNONE 
006-084-B11AGCCCACCACNONE 
006-085-G10AGCCCACCACNONE 
006-086-A05AGCCCACCACNONE 
006-086-B05AGCCCACCACNONE 
006-086-F09AGCCCACCACNONE 
006-088-B09AGCCCACCACNONE 
006-088-D02AGCCCACCACNONE 
006-088-D10AGCCCACCACNONE 
006-088-F05AGCCCACCACNONE 
006-089-C06AGCCCACCACNONE 
006-092-C07AGCCCACCACNONE 
006-092-C08AGCCCACCACNONE 
006-092-G09AGCCCACCACNONE 
006-093-D12AGCCCACCACNONE 
006-093-H10AGCCCACCACNONE 
006-094-E07AGCCCACCACNONE 
006-095-G01AGCCCACCACNONE 
006-096-A10AGCCCACCACNONE 
006-097-B06AGCCCACCACNONE 
006-097-H12AGCCCACCACNONE 
006-098-A08AGCCCACCACNONE 
006-098-A10AGCCCACCACNONE 
006-098-C10AGCCCACCACNONE 
006-098-D02AGCCCACCACNONE 
006-098-F10AGCCCACCACNONE 
006-099-B08AGCCCACCACNONE 
006-099-D02AGCCCACCACNONE 
006-099-D05AGCCCACCACNONE 
006-099-G10AGCCCACCACNONE 
006-100-G06AGCCCACCACNONE 
006-102-G09AGCCCACCACNONE 
006-104-F06AGCCCACCACNONE 
006-105-A12AGCCCACCACNONE 
006-105-D04AGCCCACCACNONE 
006-105-F05AGCCCACCACNONE 
006-106-B01AGCCCACCACNONE 
006-106-D05AGCCCACCACNONE 
006-107-B01AGCCCACCACNONE 
006-107-C02AGCCCACCACNONE 
006-107-E01AGCCCACCACNONE 
006-107-G03AGCCCACCACNONE 
006-108-D09AGCCCACCACNONE 
006-109-G01AGCCCACCACNONE 
006-109-H07AGCCCACCACNONE 
006-110-C04AGCCCACCACNONE 
006-111-B11AGCCCACCACNONE 
006-112-A02AGCCCACCACNONE 
006-112-E03AGCCCACCACNONE 
006-112-H04AGCCCACCACNONE 
006-113-B07AGCCCACCACNONE 
006-113-C08AGCCCACCACNONE 
006-114-C12AGCCCACCACNONE 
006-114-D06AGCCCACCACNONE 
006-115-B06AGCCCACCACNONE 
006-116-B01AGCCCACCACNONE 
006-116-C02AGCCCACCACNONE 
006-117-B05AGCCCACCACNONE 
006-117-C06AGCCCACCACNONE 
006-117-D10AGCCCACCACNONE 
006-118-D04AGCCCACCACNONE 
006-118-E12AGCCCACCACNONE 
006-119-A06AGCCCACCACNONE 
006-119-A09AGCCCACCACNONE 
006-119-D02AGCCCACCACNONE 
006-119-G07AGCCCACCACNONE 
006-120-B03AGCCCACCACNONE 
006-120-B07AGCCCACCACNONE 
006-120-C01AGCCCACCACNONE 
006-120-E04AGCCCACCACNONE 
006-120-F11AGCCCACCACNONE 
009-014-E11AGCCCACCACNONE 
009-079-C06AGCCCACCACNONE 
009-101-H06AGCCCACCACNONE 
009-113-F07AGCCCACCACNONE 
009-126-G04AGCCCACCACNONE 
009-138-F01AGCCCACCACNONE 
009-147-H02AGCCCACCACNONE 
009-198-B08AGCCCACCACNONE 
011-011-H03AGCCCACCACNONE 
013-053-A06AGCCCACCACNONE 
AK060886AGCCCACCACNONE 
AK067715AGCCCACCACSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK103920AGCCCACCACNONE 
AK103937AGCCCACCACNONE 
AK104080AGCCCACCACNONE 
AK104649AGCCCACCACNONE 
AK104760AGCCCACCACNONE 
AK119163AGCCCACCACNONE 
AK119188AGCCCACCACNONE 
AK119515AGCCCACCACNONE 
J013071M07AGCCCACCACNONE 
J013098E19AGCCCACCACNONE 
J013119C03AGCCCACCACNONE 
J013135O08AGCCCACCACNONE 
J023060H14AGCCCACCACNONE 
J023075M20AGCCCACCACNONE 
J023098P12AGCCCACCACNONE 
J053061C24AGCCCACCACNONE 
J053065C19AGCCCACCACNONE 
J053094K19AGCCCACCACNONE 
J075047M15AGCCCACCACNONE 
J075083H07AGCCCACCACNONE 
J075108K14AGCCCACCACNONE 
J075112B16AGCCCACCACNONE 
J075169L16AGCCCACCACNONE 
J075180P05AGCCCACCACNONE 
J075194D02AGCCCACCACNONE 
J080013D18AGCCCACCACNONE 
J080016G20AGCCCACCACNONE 
J080017E18AGCCCACCACNONE 
J080018J18AGCCCACCACNONE 
J080018N18AGCCCACCACNONE 
J080036G23AGCCCACCACNONE 
J080038O04AGCCCACCACNONE 
J080038P09AGCCCACCACNONE 
J080039N23AGCCCACCACNONE 
J080043F01AGCCCACCACNONE 
J080064J05AGCCCACCACNONE 
J080067C16AGCCCACCACNONE 
J080069B15AGCCCACCACNONE 
J080071H03AGCCCACCACNONE 
J080086L16AGCCCACCACNONE 
J080088H01AGCCCACCACNONE 
J080089B09AGCCCACCACNONE 
J080090K14AGCCCACCACNONE 
J080090N19AGCCCACCACNONE 
J080093H07AGCCCACCACNONE 
J080097B17AGCCCACCACNONE 
J080301J11AGCCCACCACNONE 
J080301K18AGCCCACCACNONE 
J080305K22AGCCCACCACNONE 
J090008D23AGCCCACCACNONE 
J090013H02AGCCCACCACNONE 
J090031N19AGCCCACCACNONE 
J090053G01AGCCCACCACNONE 
Os01g0514700AK069218CCCACCACProtein kinase domain containing protein. 
Os01g0541900AK069784GTGGTGGGProtein kinase-like domain containing protein. 
J013033M01GTGGTGGGNONE 
J013159H24GTGGTGGGNONE 
J023008E13GTGGTGGGNONE 
J023030I11GTGGTGGGNONE 
J065137G08GTGGTGGGNONE 
J065139H16GTGGTGGGNONE 
J065154K13GTGGTGGGNONE 
J075176C02GTGGTGGGNONE 
Os01g0588200006-052-E10GCCCACCACNONE 
AJ251563GCCCACCACNONE 
AK070745GCCCACCACVoltage-dependent anion channel. 
AK104055GCCCACCACNONE 
AK104419GCCCACCACNONE 
J023057A07GCCCACCACNONE 
J023068C08GCCCACCACNONE 
J023148E24GCCCACCACNONE 
J090045O22GCCCACCACNONE 
J090045P03GCCCACCACNONE 
J090050C18GCCCACCACNONE 
J100023F01GCCCACCACNONE 
J100051I18GCCCACCACNONE 
J100060P17GCCCACCACNONE 
Os01g0603300006-037-G03CCCACCACNONE 
006-087-B03CCCACCACNONE 
006-090-B11CCCACCACNONE 
AK061500CCCACCACNONE 
J013067O07CCCACCACNONE 
J023004H16CCCACCACNONE 
J033111O06CCCACCACNONE 
J033116J02CCCACCACNONE 
J033128P13CCCACCACNONE 
J065010E15CCCACCACNONE 
J065167E08CCCACCACNONE 
J065188B08CCCACCACNONE 
J080301L10CCCACCACNONE 
J080306F07CCCACCACNONE 
J080310B10CCCACCACNONE 
J080313O05CCCACCACNONE 
Os01g0618900AK099329GTGGTGGGACNONE 
Os01g0624700AK111416GCCCACCACSimilar to WRKY transcription factor 12. 
AY676924GCCCACCACNONE 
AY870601GCCCACCACNONE 
Os01g0651100AK119380CCCACGCGCCCATCGCCCACCACProtein prenyltransferase domain containing protein. 
Os01g0653700011-003-E09GTGGTGGGNONE 
AK073990GTGGTGGGCyclin-like F-box domain containing protein. 
AK120129GTGGTGGGNONE 
J033036F18GTGGTGGGNONE 
J033072D10GTGGTGGGNONE 
J033089B18GTGGTGGGNONE 
J033089J09GTGGTGGGNONE 
J033136J11GTGGTGGGNONE 
J065065E24GTGGTGGGNONE 
J090065L03GTGGTGGGNONE 
Os01g0667900013-097-A02CCCACCACNONE 
014-011-C01CCCACCACNONE 
AK105335CCCACCACGlutaredoxin-like, plant II family protein. 
J065156F10CCCACCACNONE 
J065163D22CCCACCACNONE 
J065197J04CCCACCACNONE 
J075122C02CCCACCACNONE 
J100047L16CCCACCACNONE 
Os01g0698300AK100582CCCACCACZinc finger, BED-type predicted domain containing protein. 
J023105O09CCCACCACNONE 
J023119F15CCCACCACNONE 
J075007N19CCCACCACNONE 
J075010F10CCCACCACNONE 
J075032M22CCCACCACNONE 
J075038E01CCCACCACNONE 
J075064J17CCCACCACNONE 
J075109L20CCCACCACNONE 
J075131O16CCCACCACNONE 
J075176A17CCCACCACNONE 
J075178N11CCCACCACNONE 
J075181N15CCCACCACNONE 
J090060I06CCCACCACNONE 
J090097O21CCCACCACNONE 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK109776ATGGCCCACCACNONE 
J080037E03ATGGCCCACCACNONE 
J080041H13ATGGCCCACCACNONE 
J080046B15ATGGCCCACCACNONE 
J080058K14ATGGCCCACCACNONE 
J080065E14ATGGCCCACCACNONE 
J080079C08ATGGCCCACCACNONE 
J080088J12ATGGCCCACCACNONE 
J080088M19ATGGCCCACCACNONE 
J100043G11ATGGCCCACCACNONE 
J100059M22ATGGCCCACCACNONE 
Os01g0707300AK059962AGCCCACCACNONE 
AK104463AGCCCACCACSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0722700AK069917CCCACCACSimilar to Hexokinase. 
Os01g0743200006-085-H08GTGGTGGGNONE 
AK073604GTGGTGGGNONE 
AK105996GTGGTGGGVirulence factor, pectin lyase fold family protein. 
AK109798GTGGTGGGNONE 
Os01g0747400AK102467GTGGTGGGProtein kinase-like domain containing protein. 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0766600AK061986GTCCCACCACNONE 
AK103570GTCCCACCACBSD domain containing protein. 
Os01g0770400006-112-B08GCCCACGCCCACCACNONE 
AK061253GCCCACGCCCACCACNONE 
AK061585GCCCACGCCCACCACCyclin-like F-box domain containing protein. 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0793200AK059040CCCACCACProtein prenyltransferase domain containing protein. 
Os01g0793900009-109-G11CCCACCACNONE 
009-109-G11CCCACCACNONE 
009-125-A10CCCACCACNONE 
009-125-A10CCCACCACNONE 
AK062811CCCACCACConserved hypothetical protein. 
AK062811CCCACCACConserved hypothetical protein. 
Os01g0799500AK109346CCCACCACDNA glycosylase family protein. 
Os01g0813400006-025-B06GTGGTGGGGCNONE 
006-030-C07GTGGTGGGGCNONE 
006-068-F06GTGGTGGGGCNONE 
006-096-E09GTGGTGGGGCNONE 
006-097-B11GTGGTGGGGCNONE 
006-104-H02GTGGTGGGGCNONE 
AK062251GTGGTGGGGCNONE 
AK065370GTGGTGGGGCSimilar to ADP-ribosylation factor 1. 
J013022G24GTGGTGGGGCNONE 
J013104C07GTGGTGGGGCNONE 
J023074M17GTGGTGGGGCNONE 
J043027C07GTGGTGGGGCNONE 
J065026K05GTGGTGGGGCNONE 
J065103I01GTGGTGGGGCNONE 
J090025M17GTGGTGGGGCNONE 
J100027L03GTGGTGGGGCNONE 
J100054I20GTGGTGGGGCNONE 
Os01g0823200AK066097CCCACCACCGCACConserved hypothetical protein. 
J013056K15CCCACCACCGCACNONE 
Os01g0826400AK107199GTGGTGGGWRKY transcription factor 24 (WRKY24). 
AY341849GTGGTGGGNONE 
AY676925GTGGTGGGNONE 
AY870608GTGGTGGGNONE 
Os01g0830500006-117-F06GTGGCCCACCACNONE 
AK061475GTGGCCCACCACNONE 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17GTGGCCCACCACNONE 
J065211O10GTGGCCCACCACNONE 
Os01g0834200AK069188GCCCACCACNONE 
AK100543GCCCACCACSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0835500AK100241GTCCCACCACSimilar to Respiratory burst oxidase protein. 
Os01g0848200AK069425CCCACCACSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230CCCACCACNONE 
Os01g0860500006-023-D08CCCACCACNONE 
006-031-E12CCCACCACNONE 
AB003195CCCACCACNONE 
AK058878CCCACCACSimilar to Hevamine A precursor [Includes: Chitinase (EC 3.2.1.14); Lysozyme (EC 3.2.1.17)]. 
AK099172CCCACCACNONE 
AK103976CCCACCACNONE 
AK104120CCCACCACNONE 
D55711CCCACCACNONE 
J023022H15CCCACCACNONE 
J023091F16CCCACCACNONE 
J023114L21CCCACCACNONE 
J023127L11CCCACCACNONE 
J065014H11CCCACCACNONE 
J065171A22CCCACCACNONE 
J065183H22CCCACCACNONE 
J100071D02CCCACCACNONE 
Os01g0862800AK071274CCCACCACNo apical meristem (NAM) protein domain containing protein. 
AK071274GTCCCACCACGCCACNo apical meristem (NAM) protein domain containing protein. 
Os01g0865600AK068033CCCACCACNONE 
AK099677CCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21CCCACCACNONE 
J090023C20CCCACCACNONE 
J090039J16CCCACCACNONE 
J090054K15CCCACCACNONE 
Os01g0885600AK059523CCCACCACEsterase/lipase/thioesterase domain containing protein. 
J065013G01CCCACCACNONE 
J065063D03CCCACCACNONE 
J065143H01CCCACCACNONE 
J065146F08CCCACCACNONE 
J065153D14CCCACCACNONE 
J065170E02CCCACCACNONE 
J065175M22CCCACCACNONE 
J065186E13CCCACCACNONE 
J075023J16CCCACCACNONE 
J075176J06CCCACCACNONE 
Os01g0900800009-086-C08CCCACCACNONE 
AK068254CCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713CCCACCACNONE 
J053025O10CCCACCACNONE 
J065063K24CCCACCACNONE 
J065167N21CCCACCACNONE 
J100060A20CCCACCACNONE 
J100079J03CCCACCACNONE 
J100087D11CCCACCACNONE 
J100089K10CCCACCACNONE 
Os01g0904500AK119437GTGGTGGGCTGGConserved hypothetical protein. 
J065022O22GTGGTGGGCTGGNONE 
J065102M14GTGGTGGGCTGGNONE 
J065192C12GTGGTGGGCTGGNONE 
Os01g0913100AK070387GGTCCCACCACProtein of unknown function DUF538 family protein. 
J100090K15GGTCCCACCACNONE 
Os01g0960500AK065423CCCACCACCopine domain containing protein. 
AK065423GTGGTGGGCCopine domain containing protein. 
J033099P18CCCACCACNONE 
J033099P18GTGGTGGGCNONE 
J043012D04CCCACCACNONE 
J043012D04GTGGTGGGCNONE 
J053060F17CCCACCACNONE 
J053060F17GTGGTGGGCNONE 
J090019J06CCCACCACNONE 
J090019J06GTGGTGGGCNONE 
Os01g0965500J075073G20AGCCCACCACNuclear protein SET domain containing protein. 
Os02g0115700AK061923GCCCACCACNONE 
AK061923GTGGTGGGNONE 
Os02g0115900AF006825CCCACCACNONE 
AK065743CCCACCACEndosperm lumenal binding protein. 
AK119653CCCACCACNONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0121100012-035-F06CCCACCACNONE 
013-031-H05CCCACCACNONE 
013-058-E11CCCACCACNONE 
014-010-D01CCCACCACNONE 
AK070711CCCACCACConserved hypothetical protein. 
AK119758CCCACCACNONE 
J013033G12CCCACCACNONE 
J023007M16CCCACCACNONE 
J023020K20CCCACCACNONE 
J023061H10CCCACCACNONE 
J033027H20CCCACCACNONE 
J033051E18CCCACCACNONE 
J090005F12CCCACCACNONE 
J090017A20CCCACCACNONE 
J090018G11CCCACCACNONE 
J090062C18CCCACCACNONE 
J100027N10CCCACCACNONE 
J100032L14CCCACCACNONE 
J100045C14CCCACCACNONE 
J100061M09CCCACCACNONE 
J100062K11CCCACCACNONE 
J100064H11CCCACCACNONE 
J100074H16CCCACCACNONE 
J100082N01CCCACCACNONE 
Os02g0128300AK101453GTGGTGGGENTH/VHS domain containing protein. 
J013033G07GTGGTGGGNONE 
Os02g0129800AK109213GTGGTGGGGCCConserved hypothetical protein. 
Os02g0137100015-082-A12CCCACCACNONE 
016-013-D11CCCACCACNONE 
AK073353CCCACCACConserved hypothetical protein 1589, plant family protein. 
J013026D20CCCACCACNONE 
J013111M05CCCACCACNONE 
J023099B09CCCACCACNONE 
J033025E21CCCACCACNONE 
J033082H04CCCACCACNONE 
J065110E11CCCACCACNONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0198200J075078L15CCCACCACNONE 
J075097G10CCCACCACNONE 
J075099N12CCCACCACNONE 
J075142K24CCCACCACNONE 
J075199K14CCCACCACNONE 
Os02g0315400009-126-G07GTGGTGGGNONE 
009-146-D02GTGGTGGGNONE 
AK071564GTGGTGGGConserved hypothetical protein. 
J023101C14GTGGTGGGNONE 
J065002G09GTGGTGGGNONE 
J065096M05GTGGTGGGNONE 
J065097O05GTGGTGGGNONE 
J065122H06GTGGTGGGNONE 
J065191C16GTGGTGGGNONE 
J075019N15GTGGTGGGNONE 
J075027F14GTGGTGGGNONE 
J075137F09GTGGTGGGNONE 
J090097G04GTGGTGGGNONE 
J090097K24GTGGTGGGNONE 
Os02g0317700006-023-C04CCCACCACNONE 
006-114-B02CCCACCACNONE 
AK060062CCCACCACNONE 
AK068024CCCACCACConserved hypothetical protein. 
AK111402CCCACCACNONE 
J013134E19CCCACCACNONE 
Os02g0324700006-086-H07CCCACCACNONE 
006-106-G09CCCACCACNONE 
AK060405CCCACCACConserved hypothetical protein. 
AK104437CCCACCACNONE 
Os02g0473000AK065460GTGGTGGGCGAGGRiboflavin biosynthesis protein RibD family protein. 
Os02g0491400AK073233CCCACCACSimilar to Peptidylprolyl isomerase. 
AK073233CCCACCACSimilar to Peptidylprolyl isomerase. 
J090046J15CCCACCACNONE 
J090046J15CCCACCACNONE 
Os02g0550900AK068291GTGGTGGGFAR1 domain containing protein. 
AK102807GTGGTGGGNONE 
AK106638GTGGTGGGNONE 
J013027H15GTGGTGGGNONE 
J013031L15GTGGTGGGNONE 
J013149F05GTGGTGGGNONE 
J033108J05GTGGTGGGNONE 
J065030H12GTGGTGGGNONE 
J065107B07GTGGTGGGNONE 
Os02g0555000015-020-G02AAAGCCCACCACNONE 
AK065270AAAGCCCACCACNONE 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
J013002L01AAAGCCCACCACNONE 
J023060A02AAAGCCCACCACNONE 
J023101O11AAAGCCCACCACNONE 
J023140A15AAAGCCCACCACNONE 
J033042H19AAAGCCCACCACNONE 
J033046C02AAAGCCCACCACNONE 
J033080N19AAAGCCCACCACNONE 
J065026I02AAAGCCCACCACNONE 
J065040C18AAAGCCCACCACNONE 
J090004I16AAAGCCCACCACNONE 
Os02g0556800AK060580CCCACCACNONE 
AK100187CCCACCACConserved hypothetical protein. 
J065162A21CCCACCACNONE 
J075093B20CCCACCACNONE 
J075097N04CCCACCACNONE 
Os02g0564400J100058K21CCCACCACSimilar to CLP protease regulatory subunit CLPX precursor. 
J100065N04CCCACCACNONE 
Os02g0574800AK108451GTGGTGGGGCConserved hypothetical protein. 
Os02g0574900AK073087AGCCCACCACCyclin-like F-box domain containing protein. 
J033023M04AGCCCACCACNONE 
J033117N08AGCCCACCACNONE 
J075008F16AGCCCACCACNONE 
J075075I19AGCCCACCACNONE 
J075079A06AGCCCACCACNONE 
J075086I07AGCCCACCACNONE 
J075088F13AGCCCACCACNONE 
J075093D04AGCCCACCACNONE 
J075163C10AGCCCACCACNONE 
Os02g0588700AK100801CCCACCACCAACConserved hypothetical protein. 
J100030D24CCCACCACCAACNONE 
J100031B19CCCACCACCAACNONE 
J100032M18CCCACCACCAACNONE 
J100035B04CCCACCACCAACNONE 
J100055G19CCCACCACCAACNONE 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0619600AK072178CCCACCACZinc finger, RING-type domain containing protein. 
Os02g0622400005-010-C04GTGGTGGGNONE 
AK061679GTGGTGGGConserved hypothetical protein. 
J013058H01GTGGTGGGNONE 
J013095D07GTGGTGGGNONE 
J023054G05GTGGTGGGNONE 
J023093A17GTGGTGGGNONE 
J023146P16GTGGTGGGNONE 
J033089D16GTGGTGGGNONE 
J033099G12GTGGTGGGNONE 
J033131N10GTGGTGGGNONE 
J053073J04GTGGTGGGNONE 
J053074P03GTGGTGGGNONE 
J053075M06GTGGTGGGNONE 
J053088K13GTGGTGGGNONE 
J090039F18GTGGTGGGNONE 
J090045M03GTGGTGGGNONE 
Os02g0634700AK071869GCCCCACCACNONE 
J013129B13GCCCCACCACNONE 
J013134D24GCCCCACCACNONE 
Os02g0634800003-004-F03GTGGTGGGNONE 
AK059694GTGGTGGGUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17GTGGTGGGNONE 
J053077G20GTGGTGGGNONE 
J075195F14GTGGTGGGNONE 
Os02g0634900006-032-G12CCCACCACNONE 
006-033-E09CCCACCACNONE 
006-117-F10CCCACCACNONE 
006-118-E01CCCACCACNONE 
013-056-G08CCCACCACNONE 
AK059769CCCACCACNONE 
AK068583CCCACCACNONE 
AK072855CCCACCACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210CCCACCACNONE 
J023138P05CCCACCACNONE 
J023143J07CCCACCACNONE 
J033022O09CCCACCACNONE 
J033111L02CCCACCACNONE 
J033135O03CCCACCACNONE 
J065005K19CCCACCACNONE 
J065044C17CCCACCACNONE 
J065116K09CCCACCACNONE 
J065119O21CCCACCACNONE 
J075014L05CCCACCACNONE 
J075109H16CCCACCACNONE 
J075117D04CCCACCACNONE 
Os02g0652100AK072906AGCCCACCACSimilar to WRKY transcription factor 34. 
J075187F06AGCCCACCACNONE 
Os02g0653000AK062922GCCCCCACCACConserved hypothetical protein. 
Os02g0658500012-083-D01GCCCCCACCACNONE 
016-061-E08GCCCCCACCACNONE 
AK099591GCCCCCACCACConserved hypothetical protein. 
AK107591GCCCCCACCACNONE 
J013043M11GCCCCCACCACNONE 
J100025J18GCCCCCACCACNONE 
J100059C10GCCCCCACCACNONE 
Os02g0697200015-013-B10ACAGCCCACCACNONE 
AK059475ACAGCCCACCACNONE 
AK102993ACAGCCCACCACConserved hypothetical protein. 
J033079I18ACAGCCCACCACNONE 
J033082A14ACAGCCCACCACNONE 
J065047H08ACAGCCCACCACNONE 
J065131M14ACAGCCCACCACNONE 
Os02g0717600J090003H19CCCACCACNONE 
J100090A12CCCACCACConserved hypothetical protein. 
Os02g0728600AK063054GTGGTGGGCSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04GTGGTGGGCNONE 
Os02g0741800AK073562GTGCGGTGGTGGGSimilar to Permease 1. 
J033048K09GTGCGGTGGTGGGNONE 
J065002G12GTGCGGTGGTGGGNONE 
J065174P12GTGCGGTGGTGGGNONE 
J065208H13GTGCGGTGGTGGGNONE 
J065218J01GTGCGGTGGTGGGNONE 
Os02g0744200AF247162CCCACCACNONE 
AF247162CCCACCACNONE 
AK073572CCCACCACAlpha-expansin OsEXPA5. 
AK073572CCCACCACAlpha-expansin OsEXPA5. 
AK107334CCCACCACNONE 
AK107334CCCACCACNONE 
J065006L24CCCACCACNONE 
J065006L24CCCACCACNONE 
J065184I10CCCACCACNONE 
J065184I10CCCACCACNONE 
J065205G12CCCACCACNONE 
J065205G12CCCACCACNONE 
J090051J23CCCACCACNONE 
J090051J23CCCACCACNONE 
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein. 
J023132N16CCCACCACGTGTCACTNONE 
J033069F17CCCACCACGTGTCACTNONE 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0783000AK105110GTGGTGGGSimilar to Pectin methylesterase 5 (Fragment). 
Os02g0792600J090091O08CTCCCCCACCACNONE 
Os02g0813600AK107210CCCACCACVery-long-chain 3-ketoacyl-CoA synthase family protein. 
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135CGGGCCCCACCACNONE 
U46758CGGGCCCCACCACNONE 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os03g0109400AK102378GTGGTGGGGGAGHomeobox domain containing protein. 
AK110678GTGGTGGGGGAGNONE 
AY425991GTGGTGGGGGAGNONE 
Os03g0116800012-097-D10GAAGCCCACCACNONE 
016-024-H10GAAGCCCACCACNONE 
AK066955GAAGCCCACCACConserved hypothetical protein. 
AK068678GAAGCCCACCACNONE 
AK104839GAAGCCCACCACNONE 
J013033G16GAAGCCCACCACNONE 
J013091C10GAAGCCCACCACNONE 
J013158H22GAAGCCCACCACNONE 
J023106K11GAAGCCCACCACNONE 
J065051O15GAAGCCCACCACNONE 
J065129G22GAAGCCCACCACNONE 
J075001K02GAAGCCCACCACNONE 
J075011O03GAAGCCCACCACNONE 
J075024K04GAAGCCCACCACNONE 
J075026E07GAAGCCCACCACNONE 
J075037O14GAAGCCCACCACNONE 
J075071D17GAAGCCCACCACNONE 
J075084M05GAAGCCCACCACNONE 
J075114B06GAAGCCCACCACNONE 
J075128C23GAAGCCCACCACNONE 
J075153A13GAAGCCCACCACNONE 
J075158A15GAAGCCCACCACNONE 
J075165P09GAAGCCCACCACNONE 
J075167M21GAAGCCCACCACNONE 
J075170F11GAAGCCCACCACNONE 
J075186F12GAAGCCCACCACNONE 
J075186L13GAAGCCCACCACNONE 
J075189A01GAAGCCCACCACNONE 
J075192D19GAAGCCCACCACNONE 
Os03g0123300003-131-G09GTCCCACCACNONE 
AK058595GTCCCACCACNONE 
J075056B01GTCCCACCACNONE 
Os03g0126800J075039C05GTGGTGGGNONE 
J075172P07GTGGTGGGNONE 
J075176L13GTGGTGGGNONE 
J075180L10GTGGTGGGNONE 
J090019H18GTGGTGGGNONE 
J090024P22GTGGTGGGNONE 
Os03g0128300AK064718CCCACCACConserved hypothetical protein. 
Os03g0131000AK109138CCCACCACSimilar to Avr9/Cf-9 induced kinase 1. 
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase. 
Os03g0136900AK067183GCCCACCACGCGTCTCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase). 
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0160200AK064836CCCACCACGCGTCCConserved hypothetical protein. 
AK071081CCCACCACGCGTCCNONE 
AK100712CCCACCACGCGTCCNONE 
AK104859CCCACCACGCGTCCNONE 
J013000F21CCCACCACGCGTCCNONE 
J013024G05CCCACCACGCGTCCNONE 
J013035E12CCCACCACGCGTCCNONE 
J013041A17CCCACCACGCGTCCNONE 
J013045D10CCCACCACGCGTCCNONE 
J013045F04CCCACCACGCGTCCNONE 
J013046F04CCCACCACGCGTCCNONE 
J013047F10CCCACCACGCGTCCNONE 
J013051E10CCCACCACGCGTCCNONE 
J013059J07CCCACCACGCGTCCNONE 
J013059O17CCCACCACGCGTCCNONE 
J013060A20CCCACCACGCGTCCNONE 
J013063J23CCCACCACGCGTCCNONE 
J013066D19CCCACCACGCGTCCNONE 
J013069O08CCCACCACGCGTCCNONE 
J013088K24CCCACCACGCGTCCNONE 
J013098G04CCCACCACGCGTCCNONE 
J013100I15CCCACCACGCGTCCNONE 
J013102E18CCCACCACGCGTCCNONE 
J013102O09CCCACCACGCGTCCNONE 
J013119M18CCCACCACGCGTCCNONE 
J013123I19CCCACCACGCGTCCNONE 
J013146H15CCCACCACGCGTCCNONE 
J013149A14CCCACCACGCGTCCNONE 
J023003A05CCCACCACGCGTCCNONE 
J023013O19CCCACCACGCGTCCNONE 
J023044M05CCCACCACGCGTCCNONE 
J023048O03CCCACCACGCGTCCNONE 
J023049L17CCCACCACGCGTCCNONE 
J023060D22CCCACCACGCGTCCNONE 
J023060F20CCCACCACGCGTCCNONE 
J023069G09CCCACCACGCGTCCNONE 
J023086E11CCCACCACGCGTCCNONE 
J023091I09CCCACCACGCGTCCNONE 
J023091M19CCCACCACGCGTCCNONE 
J023101D06CCCACCACGCGTCCNONE 
J023109B03CCCACCACGCGTCCNONE 
J023113B14CCCACCACGCGTCCNONE 
J023114B19CCCACCACGCGTCCNONE 
J023115H16CCCACCACGCGTCCNONE 
J023134F22CCCACCACGCGTCCNONE 
J023139I06CCCACCACGCGTCCNONE 
J023150C02CCCACCACGCGTCCNONE 
J033033A14CCCACCACGCGTCCNONE 
J033058O11CCCACCACGCGTCCNONE 
J033060H13CCCACCACGCGTCCNONE 
J033075P14CCCACCACGCGTCCNONE 
J033084O05CCCACCACGCGTCCNONE 
J033087G04CCCACCACGCGTCCNONE 
J033092E18CCCACCACGCGTCCNONE 
J033101G23CCCACCACGCGTCCNONE 
J033112I05CCCACCACGCGTCCNONE 
J033118E14CCCACCACGCGTCCNONE 
J033118P04CCCACCACGCGTCCNONE 
J033123C07CCCACCACGCGTCCNONE 
J043003C01CCCACCACGCGTCCNONE 
J043024B21CCCACCACGCGTCCNONE 
J043030N04CCCACCACGCGTCCNONE 
J043039J02CCCACCACGCGTCCNONE 
J043039N08CCCACCACGCGTCCNONE 
J075006N21CCCACCACGCGTCCNONE 
J075008A16CCCACCACGCGTCCNONE 
J075018J16CCCACCACGCGTCCNONE 
J075023G04CCCACCACGCGTCCNONE 
J075134F18CCCACCACGCGTCCNONE 
J075181B05CCCACCACGCGTCCNONE 
J090014O14CCCACCACGCGTCCNONE 
J090020H22CCCACCACGCGTCCNONE 
J090022G17CCCACCACGCGTCCNONE 
J090023J24CCCACCACGCGTCCNONE 
J090033H01CCCACCACGCGTCCNONE 
J090038A03CCCACCACGCGTCCNONE 
J090041O22CCCACCACGCGTCCNONE 
J090049E10CCCACCACGCGTCCNONE 
J090063E24CCCACCACGCGTCCNONE 
J090080N12CCCACCACGCGTCCNONE 
J100021G23CCCACCACGCGTCCNONE 
J100028P06CCCACCACGCGTCCNONE 
J100060L21CCCACCACGCGTCCNONE 
J100077D16CCCACCACGCGTCCNONE 
J100088I09CCCACCACGCGTCCNONE 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0175200J090059M15GTGGTGGGCNONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0181500003-108-B12CCCACCACNONE 
006-025-D12CCCACCACNONE 
006-034-D11CCCACCACNONE 
006-045-B04CCCACCACNONE 
006-087-C12CCCACCACNONE 
006-116-A09CCCACCACNONE 
006-119-H05CCCACCACNONE 
013-014-E04CCCACCACNONE 
014-039-H09CCCACCACNONE 
015-067-B05CCCACCACNONE 
AK060840CCCACCACNONE 
AK061335CCCACCACSimilar to Fiddlehead protein. 
AK099232CCCACCACNONE 
AK119228CCCACCACNONE 
J013030L02CCCACCACNONE 
J013151K04CCCACCACNONE 
J013170F20CCCACCACNONE 
J065063H18CCCACCACNONE 
J065219J11CCCACCACNONE 
J075090B17CCCACCACNONE 
J075125F15CCCACCACNONE 
J075140K11CCCACCACNONE 
J090073H24CCCACCACNONE 
Os03g0207400AK072292GCCCCACCACSimilar to Protein phosphatase 2C-like. 
Os03g0274800011-021-B02GCCCCCACCACNONE 
011-076-C11GCCCCCACCACNONE 
AK102905GCCCCCACCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
J033113F11GCCCCCACCACNONE 
J043009A15GCCCCCACCACNONE 
J090069A03GCCCCCACCACNONE 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0278500AK070850GTGGTGGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16GTGGTGGGNONE 
Os03g0279200009-097-C06CGGGCCCACCACNONE 
013-007-B07CGGGCCCACCACNONE 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
J033087I02CGGGCCCACCACNONE 
J065002G20CGGGCCCACCACNONE 
J065102M04CGGGCCCACCACNONE 
J065139A02CGGGCCCACCACNONE 
J075109D21CGGGCCCACCACNONE 
J075191L12CGGGCCCACCACNONE 
J090096C03CGGGCCCACCACNONE 
J100036C23CGGGCCCACCACNONE 
Os03g0302900011-005-H01CCCACCACNONE 
AK069222CCCACCACConserved hypothetical protein. 
J023014L15CCCACCACNONE 
J033023G12CCCACCACNONE 
J090008H16CCCACCACNONE 
Os03g0348900006-103-E01CCAAGCCCCCACCACNONE 
AK059950CCAAGCCCCCACCACZinc finger, CHY-type domain containing protein. 
AK073680CCAAGCCCCCACCACNONE 
J065058L22CCAAGCCCCCACCACNONE 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0379300006-039-F11CTGGCCCACCACNONE 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CTGGCCCACCACNONE 
J013159M16CTGGCCCACCACNONE 
J090067F01CTGGCCCACCACNONE 
J090083F21CTGGCCCACCACNONE 
J100040M08CTGGCCCACCACNONE 
J100048C03CTGGCCCACCACNONE 
J100056M07CTGGCCCACCACNONE 
J100062N22CTGGCCCACCACNONE 
J100086L07CTGGCCCACCACNONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0417800AK058813GTGGTGGGNONE 
Os03g0437600006-051-A10CCCACCACNONE 
006-059-D02CCCACCACNONE 
006-074-A04CCCACCACNONE 
006-089-G11CCCACCACNONE 
006-095-H02CCCACCACNONE 
006-118-B09CCCACCACNONE 
009-156-G04CCCACCACNONE 
015-015-G01CCCACCACNONE 
016-089-D06CCCACCACNONE 
AK061303CCCACCACNONE 
AK070773CCCACCACNONE 
AK073355CCCACCACSimilar to Hydrolase. 
AK104138CCCACCACNONE 
AK104400CCCACCACNONE 
J033030A08CCCACCACNONE 
J065056E01CCCACCACNONE 
J065061F16CCCACCACNONE 
J065075L21CCCACCACNONE 
J065102E09CCCACCACNONE 
J065175K12CCCACCACNONE 
J065197D14CCCACCACNONE 
J065199D08CCCACCACNONE 
J075029F13CCCACCACNONE 
J075042F07CCCACCACNONE 
J075056E23CCCACCACNONE 
J075077L02CCCACCACNONE 
J075086N01CCCACCACNONE 
J075095I08CCCACCACNONE 
J075099N21CCCACCACNONE 
J075099O09CCCACCACNONE 
J075109L06CCCACCACNONE 
J075114H11CCCACCACNONE 
J075120E09CCCACCACNONE 
J075137F08CCCACCACNONE 
J075154D10CCCACCACNONE 
J075158A18CCCACCACNONE 
J075197N10CCCACCACNONE 
Os03g0576900AK064861CCCACCACNONE 
J013000I01CCCACCACNONE 
J013169P21CCCACCACNONE 
J023001P03CCCACCACNONE 
J023009M10CCCACCACNONE 
J023025G11CCCACCACNONE 
J033046B19CCCACCACNONE 
J033149I10CCCACCACNONE 
J090081C04CCCACCACNONE 
Os03g0611200AK065587CCCACCCGCCCACCACAldo/keto reductase family protein. 
Os03g0623100014-072-D06GCCCACCACNONE 
014-072-G11GCCCACCACNONE 
AK063716GCCCACCACConserved hypothetical protein. 
J065136O20GCCCACCACNONE 
J075030G11GCCCACCACNONE 
J075034O21GCCCACCACNONE 
J075051D07GCCCACCACNONE 
J075066M05GCCCACCACNONE 
J075095G15GCCCACCACNONE 
Os03g0625900AK101109ACCCCCCACCACWD40-like domain containing protein. 
Os03g0626100AK119864GTGGTGGGZinc finger, RING-type domain containing protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0656500AK121052CCCACCACSimilar to K-exchanger-like protein. 
J065195N11CCCACCACNONE 
J065197F16CCCACCACNONE 
J075022O03CCCACCACNONE 
J075056N16CCCACCACNONE 
J075139P11CCCACCACNONE 
Os03g0670700009-028-B03GTGGTGGGCCGCNONE 
009-036-H12GTGGTGGGCCGCNONE 
009-053-H05GTGGTGGGCCGCNONE 
009-126-B02GTGGTGGGCCGCNONE 
009-135-D07GTGGTGGGCCGCNONE 
009-148-A03GTGGTGGGCCGCNONE 
009-148-A12GTGGTGGGCCGCNONE 
009-152-B02GTGGTGGGCCGCNONE 
009-153-B06GTGGTGGGCCGCNONE 
009-166-G05GTGGTGGGCCGCNONE 
009-181-A09GTGGTGGGCCGCNONE 
011-061-D07GTGGTGGGCCGCNONE 
012-043-C04GTGGTGGGCCGCNONE 
013-001-A02GTGGTGGGCCGCNONE 
013-004-F05GTGGTGGGCCGCNONE 
013-008-C08GTGGTGGGCCGCNONE 
013-015-B09GTGGTGGGCCGCNONE 
013-016-G05GTGGTGGGCCGCNONE 
013-023-A06GTGGTGGGCCGCNONE 
013-023-B06GTGGTGGGCCGCNONE 
013-032-F09GTGGTGGGCCGCNONE 
013-059-C07GTGGTGGGCCGCNONE 
013-071-E09GTGGTGGGCCGCNONE 
013-073-D06GTGGTGGGCCGCNONE 
013-077-C02GTGGTGGGCCGCNONE 
013-078-B12GTGGTGGGCCGCNONE 
013-093-A01GTGGTGGGCCGCNONE 
014-002-B12GTGGTGGGCCGCNONE 
014-003-E08GTGGTGGGCCGCNONE 
014-004-D06GTGGTGGGCCGCNONE 
014-007-C11GTGGTGGGCCGCNONE 
014-007-G10GTGGTGGGCCGCNONE 
014-019-C04GTGGTGGGCCGCNONE 
014-021-F05GTGGTGGGCCGCNONE 
014-024-G06GTGGTGGGCCGCNONE 
014-027-C07GTGGTGGGCCGCNONE 
014-027-D03GTGGTGGGCCGCNONE 
014-029-E07GTGGTGGGCCGCNONE 
014-031-B04GTGGTGGGCCGCNONE 
014-033-B05GTGGTGGGCCGCNONE 
014-033-C03GTGGTGGGCCGCNONE 
014-033-C12GTGGTGGGCCGCNONE 
014-036-F01GTGGTGGGCCGCNONE 
014-037-C04GTGGTGGGCCGCNONE 
014-040-H02GTGGTGGGCCGCNONE 
014-045-H04GTGGTGGGCCGCNONE 
014-045-H06GTGGTGGGCCGCNONE 
014-052-A08GTGGTGGGCCGCNONE 
014-076-G01GTGGTGGGCCGCNONE 
014-083-F04GTGGTGGGCCGCNONE 
014-086-E01GTGGTGGGCCGCNONE 
014-091-D02GTGGTGGGCCGCNONE 
014-091-F05GTGGTGGGCCGCNONE 
014-093-E10GTGGTGGGCCGCNONE 
014-100-C10GTGGTGGGCCGCNONE 
015-011-H02GTGGTGGGCCGCNONE 
015-073-B03GTGGTGGGCCGCNONE 
AF010579GTGGTGGGCCGCNONE 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GTGGTGGGCCGCNONE 
AK119238GTGGTGGGCCGCNONE 
AK119242GTGGTGGGCCGCNONE 
J023037K17GTGGTGGGCCGCNONE 
J033136F11GTGGTGGGCCGCNONE 
J065008C13GTGGTGGGCCGCNONE 
J065032K18GTGGTGGGCCGCNONE 
J065043N10GTGGTGGGCCGCNONE 
J065045E06GTGGTGGGCCGCNONE 
J065046P21GTGGTGGGCCGCNONE 
J065048J17GTGGTGGGCCGCNONE 
J065053I23GTGGTGGGCCGCNONE 
J065053P03GTGGTGGGCCGCNONE 
J065054C13GTGGTGGGCCGCNONE 
J065058I17GTGGTGGGCCGCNONE 
J065061I12GTGGTGGGCCGCNONE 
J065062E09GTGGTGGGCCGCNONE 
J065063P04GTGGTGGGCCGCNONE 
J065068J07GTGGTGGGCCGCNONE 
J065076D02GTGGTGGGCCGCNONE 
J065083O07GTGGTGGGCCGCNONE 
J065090J02GTGGTGGGCCGCNONE 
J065093N08GTGGTGGGCCGCNONE 
J065097F02GTGGTGGGCCGCNONE 
J065112H17GTGGTGGGCCGCNONE 
J065121B01GTGGTGGGCCGCNONE 
J065124F12GTGGTGGGCCGCNONE 
J065130L03GTGGTGGGCCGCNONE 
J065131K05GTGGTGGGCCGCNONE 
J065132C06GTGGTGGGCCGCNONE 
J065135J18GTGGTGGGCCGCNONE 
J065138J22GTGGTGGGCCGCNONE 
J065140G21GTGGTGGGCCGCNONE 
J065161B19GTGGTGGGCCGCNONE 
J065162F22GTGGTGGGCCGCNONE 
J065162M09GTGGTGGGCCGCNONE 
J065163D03GTGGTGGGCCGCNONE 
J065163O21GTGGTGGGCCGCNONE 
J065165H11GTGGTGGGCCGCNONE 
J065165O16GTGGTGGGCCGCNONE 
J065167N06GTGGTGGGCCGCNONE 
J065168I08GTGGTGGGCCGCNONE 
J065170A14GTGGTGGGCCGCNONE 
J065170L03GTGGTGGGCCGCNONE 
J065171C08GTGGTGGGCCGCNONE 
J065173G11GTGGTGGGCCGCNONE 
J065173M09GTGGTGGGCCGCNONE 
J065176P07GTGGTGGGCCGCNONE 
J065178K24GTGGTGGGCCGCNONE 
J065185O12GTGGTGGGCCGCNONE 
J065191E02GTGGTGGGCCGCNONE 
J065204H10GTGGTGGGCCGCNONE 
J075033C23GTGGTGGGCCGCNONE 
J075041M21GTGGTGGGCCGCNONE 
J075043F13GTGGTGGGCCGCNONE 
J075044D02GTGGTGGGCCGCNONE 
J075044J15GTGGTGGGCCGCNONE 
J075048L07GTGGTGGGCCGCNONE 
J075054G12GTGGTGGGCCGCNONE 
J075055J10GTGGTGGGCCGCNONE 
J075059F09GTGGTGGGCCGCNONE 
J075066M23GTGGTGGGCCGCNONE 
J075071O09GTGGTGGGCCGCNONE 
J075085G23GTGGTGGGCCGCNONE 
J075086B21GTGGTGGGCCGCNONE 
J075087L18GTGGTGGGCCGCNONE 
J075087L21GTGGTGGGCCGCNONE 
J075087N14GTGGTGGGCCGCNONE 
J075088O13GTGGTGGGCCGCNONE 
J075089B06GTGGTGGGCCGCNONE 
J075089E20GTGGTGGGCCGCNONE 
J075090J01GTGGTGGGCCGCNONE 
J075090L05GTGGTGGGCCGCNONE 
J075091G05GTGGTGGGCCGCNONE 
J075091N06GTGGTGGGCCGCNONE 
J075093G08GTGGTGGGCCGCNONE 
J075094C13GTGGTGGGCCGCNONE 
J075095K01GTGGTGGGCCGCNONE 
J075096C02GTGGTGGGCCGCNONE 
J075097L16GTGGTGGGCCGCNONE 
J075097O10GTGGTGGGCCGCNONE 
J075098H24GTGGTGGGCCGCNONE 
J075099H02GTGGTGGGCCGCNONE 
J075099J11GTGGTGGGCCGCNONE 
J075099L08GTGGTGGGCCGCNONE 
J075109I11GTGGTGGGCCGCNONE 
J075114F03GTGGTGGGCCGCNONE 
J075121G07GTGGTGGGCCGCNONE 
J075122D23GTGGTGGGCCGCNONE 
J075132O07GTGGTGGGCCGCNONE 
J075141L21GTGGTGGGCCGCNONE 
J075142I08GTGGTGGGCCGCNONE 
J075145A06GTGGTGGGCCGCNONE 
J075147J15GTGGTGGGCCGCNONE 
J075150B09GTGGTGGGCCGCNONE 
J075151E07GTGGTGGGCCGCNONE 
J075161M16GTGGTGGGCCGCNONE 
J075190I16GTGGTGGGCCGCNONE 
J075192L05GTGGTGGGCCGCNONE 
J075192O03GTGGTGGGCCGCNONE 
J075192O08GTGGTGGGCCGCNONE 
J075193L12GTGGTGGGCCGCNONE 
J080001M24GTGGTGGGCCGCNONE 
J080004E20GTGGTGGGCCGCNONE 
J080005K15GTGGTGGGCCGCNONE 
J080005L05GTGGTGGGCCGCNONE 
J080014P20GTGGTGGGCCGCNONE 
J080029D12GTGGTGGGCCGCNONE 
J080030H09GTGGTGGGCCGCNONE 
J080039G05GTGGTGGGCCGCNONE 
J080040E18GTGGTGGGCCGCNONE 
J080041B02GTGGTGGGCCGCNONE 
J080041E06GTGGTGGGCCGCNONE 
J080041G05GTGGTGGGCCGCNONE 
J080041G24GTGGTGGGCCGCNONE 
J080041H07GTGGTGGGCCGCNONE 
J080041K03GTGGTGGGCCGCNONE 
J080047G01GTGGTGGGCCGCNONE 
J080052E07GTGGTGGGCCGCNONE 
J080053B15GTGGTGGGCCGCNONE 
J080053N01GTGGTGGGCCGCNONE 
J080054I01GTGGTGGGCCGCNONE 
J080054N02GTGGTGGGCCGCNONE 
J080063P03GTGGTGGGCCGCNONE 
J080064E13GTGGTGGGCCGCNONE 
J080064G13GTGGTGGGCCGCNONE 
J080065F02GTGGTGGGCCGCNONE 
J080065G03GTGGTGGGCCGCNONE 
J080065K17GTGGTGGGCCGCNONE 
J080067D06GTGGTGGGCCGCNONE 
J080067H23GTGGTGGGCCGCNONE 
J080067M15GTGGTGGGCCGCNONE 
J080068B20GTGGTGGGCCGCNONE 
J080068G24GTGGTGGGCCGCNONE 
J080072K19GTGGTGGGCCGCNONE 
J080076I24GTGGTGGGCCGCNONE 
J080092F05GTGGTGGGCCGCNONE 
J080092K14GTGGTGGGCCGCNONE 
J080092N22GTGGTGGGCCGCNONE 
J080093K02GTGGTGGGCCGCNONE 
J080094C08GTGGTGGGCCGCNONE 
J080094E09GTGGTGGGCCGCNONE 
J080094E20GTGGTGGGCCGCNONE 
J080094G08GTGGTGGGCCGCNONE 
J080094H18GTGGTGGGCCGCNONE 
J080094P22GTGGTGGGCCGCNONE 
J080095J23GTGGTGGGCCGCNONE 
J080096F14GTGGTGGGCCGCNONE 
J080097A21GTGGTGGGCCGCNONE 
J080097I07GTGGTGGGCCGCNONE 
J080097J02GTGGTGGGCCGCNONE 
J080097K01GTGGTGGGCCGCNONE 
J080097K03GTGGTGGGCCGCNONE 
J080305H18GTGGTGGGCCGCNONE 
J080306G01GTGGTGGGCCGCNONE 
J080306O08GTGGTGGGCCGCNONE 
J080311I01GTGGTGGGCCGCNONE 
J080315N24GTGGTGGGCCGCNONE 
J090003K21GTGGTGGGCCGCNONE 
J090008C20GTGGTGGGCCGCNONE 
J090008K19GTGGTGGGCCGCNONE 
J090008P13GTGGTGGGCCGCNONE 
J090015H22GTGGTGGGCCGCNONE 
J090016M01GTGGTGGGCCGCNONE 
J090018E13GTGGTGGGCCGCNONE 
J090018G03GTGGTGGGCCGCNONE 
J090018L17GTGGTGGGCCGCNONE 
J090019H11GTGGTGGGCCGCNONE 
J090021B19GTGGTGGGCCGCNONE 
J090021K02GTGGTGGGCCGCNONE 
J090023H15GTGGTGGGCCGCNONE 
J090034E03GTGGTGGGCCGCNONE 
J090045D16GTGGTGGGCCGCNONE 
J090045I06GTGGTGGGCCGCNONE 
J090047L09GTGGTGGGCCGCNONE 
J090048B05GTGGTGGGCCGCNONE 
J090048D11GTGGTGGGCCGCNONE 
J090048N11GTGGTGGGCCGCNONE 
J090050F20GTGGTGGGCCGCNONE 
J090052M20GTGGTGGGCCGCNONE 
J090083H03GTGGTGGGCCGCNONE 
J090084C12GTGGTGGGCCGCNONE 
J090095B05GTGGTGGGCCGCNONE 
J090095M18GTGGTGGGCCGCNONE 
J100024I22GTGGTGGGCCGCNONE 
J100024J12GTGGTGGGCCGCNONE 
J100024J22GTGGTGGGCCGCNONE 
J100025F07GTGGTGGGCCGCNONE 
J100026B13GTGGTGGGCCGCNONE 
J100027N03GTGGTGGGCCGCNONE 
J100029F14GTGGTGGGCCGCNONE 
J100029L20GTGGTGGGCCGCNONE 
J100032C22GTGGTGGGCCGCNONE 
J100032I08GTGGTGGGCCGCNONE 
J100032O05GTGGTGGGCCGCNONE 
J100033J24GTGGTGGGCCGCNONE 
J100033L12GTGGTGGGCCGCNONE 
J100034K06GTGGTGGGCCGCNONE 
J100037D09GTGGTGGGCCGCNONE 
J100038H02GTGGTGGGCCGCNONE 
J100039A12GTGGTGGGCCGCNONE 
J100039N12GTGGTGGGCCGCNONE 
J100039O21GTGGTGGGCCGCNONE 
J100040K05GTGGTGGGCCGCNONE 
J100042A02GTGGTGGGCCGCNONE 
J100042A17GTGGTGGGCCGCNONE 
J100043C15GTGGTGGGCCGCNONE 
J100044A17GTGGTGGGCCGCNONE 
J100044E18GTGGTGGGCCGCNONE 
J100044I11GTGGTGGGCCGCNONE 
J100044J15GTGGTGGGCCGCNONE 
J100045E23GTGGTGGGCCGCNONE 
J100049B18GTGGTGGGCCGCNONE 
J100050G04GTGGTGGGCCGCNONE 
J100051D06GTGGTGGGCCGCNONE 
J100051H20GTGGTGGGCCGCNONE 
J100052J01GTGGTGGGCCGCNONE 
J100052K07GTGGTGGGCCGCNONE 
J100055I01GTGGTGGGCCGCNONE 
J100057D02GTGGTGGGCCGCNONE 
J100059G14GTGGTGGGCCGCNONE 
J100059G21GTGGTGGGCCGCNONE 
J100059H03GTGGTGGGCCGCNONE 
J100059H15GTGGTGGGCCGCNONE 
J100063E13GTGGTGGGCCGCNONE 
J100063M02GTGGTGGGCCGCNONE 
J100064B17GTGGTGGGCCGCNONE 
J100064F11GTGGTGGGCCGCNONE 
J100066G12GTGGTGGGCCGCNONE 
J100066H09GTGGTGGGCCGCNONE 
J100068B12GTGGTGGGCCGCNONE 
J100068L16GTGGTGGGCCGCNONE 
J100068M23GTGGTGGGCCGCNONE 
J100069A02GTGGTGGGCCGCNONE 
J100069D07GTGGTGGGCCGCNONE 
J100069M13GTGGTGGGCCGCNONE 
J100070C07GTGGTGGGCCGCNONE 
J100070J11GTGGTGGGCCGCNONE 
J100070L20GTGGTGGGCCGCNONE 
J100071H10GTGGTGGGCCGCNONE 
J100072L14GTGGTGGGCCGCNONE 
J100072N12GTGGTGGGCCGCNONE 
J100073A21GTGGTGGGCCGCNONE 
J100074K17GTGGTGGGCCGCNONE 
J100074M04GTGGTGGGCCGCNONE 
J100075F11GTGGTGGGCCGCNONE 
J100076E23GTGGTGGGCCGCNONE 
J100076G03GTGGTGGGCCGCNONE 
J100077K01GTGGTGGGCCGCNONE 
J100077N23GTGGTGGGCCGCNONE 
J100079H17GTGGTGGGCCGCNONE 
J100081N01GTGGTGGGCCGCNONE 
J100082E04GTGGTGGGCCGCNONE 
J100082K11GTGGTGGGCCGCNONE 
J100085H23GTGGTGGGCCGCNONE 
J100086O18GTGGTGGGCCGCNONE 
J100087F21GTGGTGGGCCGCNONE 
J100088E02GTGGTGGGCCGCNONE 
J100088F08GTGGTGGGCCGCNONE 
J100088G24GTGGTGGGCCGCNONE 
J100088K20GTGGTGGGCCGCNONE 
J100089B19GTGGTGGGCCGCNONE 
J100089K22GTGGTGGGCCGCNONE 
J100089N22GTGGTGGGCCGCNONE 
J100089O17GTGGTGGGCCGCNONE 
J100090N05GTGGTGGGCCGCNONE 
Os03g0708800009-180-H07CCCACCACNONE 
014-021-A05CCCACCACNONE 
AK063141CCCACCACNONE 
AK063654CCCACCACHypothetical protein. 
AK121625CCCACCACNONE 
J065041G22CCCACCACNONE 
J065063P10CCCACCACNONE 
J065158O11CCCACCACNONE 
Os03g0711400AK100286CCCACCACSimilar to Coatomer alpha subunit. 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0713100J013039M09GGTCCCACCACNONE 
J023007K01GGTCCCACCACNONE 
J023073H01GGTCCCACCACNONE 
J023087M20GGTCCCACCACNONE 
J023142E01GGTCCCACCACNONE 
J033048E03GGTCCCACCACNONE 
J033048F03GGTCCCACCACSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGTCCCACCACNONE 
J033074M20GGTCCCACCACNONE 
J033084M11GGTCCCACCACNONE 
J033091I23GGTCCCACCACNONE 
J033100C08GGTCCCACCACNONE 
J033123K19GGTCCCACCACNONE 
J090006P21GGTCCCACCACNONE 
J090045O16GGTCCCACCACNONE 
J100087M13GGTCCCACCACNONE 
Os03g0719100AK065127GTGGTGGGCTDNA-binding SAP domain containing protein. 
J013001P07GTGGTGGGCTNONE 
J065102J01GTGGTGGGCTNONE 
J065205K05GTGGTGGGCTNONE 
Os03g0722000AK069866GTGGTGGGGCNONE 
Os03g0741500AK110867GTGGTGGGSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
Os03g0747300006-120-B12GTGGTGGGNONE 
AK060347GTGGTGGGNONE 
AK071214GTGGTGGGProtein of unknown function DUF124 family protein. 
J023082F22GTGGTGGGNONE 
J043034I22GTGGTGGGNONE 
J053037D23GTGGTGGGNONE 
J053043C01GTGGTGGGNONE 
J053083D14GTGGTGGGNONE 
J053100J21GTGGTGGGNONE 
J065008H11GTGGTGGGNONE 
J065024G19GTGGTGGGNONE 
J065030G05GTGGTGGGNONE 
J065073N07GTGGTGGGNONE 
J065101N18GTGGTGGGNONE 
J065129O04GTGGTGGGNONE 
J065152M14GTGGTGGGNONE 
J065161L08GTGGTGGGNONE 
J065191G23GTGGTGGGNONE 
J090008A11GTGGTGGGNONE 
J090047J20GTGGTGGGNONE 
J090047J23GTGGTGGGNONE 
J090064C23GTGGTGGGNONE 
J090087H06GTGGTGGGNONE 
J100027M11GTGGTGGGNONE 
J100081M15GTGGTGGGNONE 
J100084C22GTGGTGGGNONE 
J100086C11GTGGTGGGNONE 
Os03g0764200Os03g0764200CCCACCACGTGTNONE 
Os03g0773600AK103310GGTGTGTGGTGGGKinesin, motor region domain containing protein. 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0784500AK109744GGTGGGCCCCACCACNONE 
Os03g0793500AK103407GCCCGGCCCCACCACNONE 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
Os03g0815100006-022-A04CCCACCACNONE 
006-032-F09CCCACCACNONE 
012-044-F04CCCACCACNONE 
012-051-A11CCCACCACNONE 
014-094-A11CCCACCACNONE 
016-048-F09CCCACCACNONE 
AK067690CCCACCACSimilar to OsNAC6 protein. 
AK099245CCCACCACNONE 
AK104551CCCACCACNONE 
AK104712CCCACCACNONE 
AY596808CCCACCACNONE 
J013023I21CCCACCACNONE 
J013027O21CCCACCACNONE 
J013027P22CCCACCACNONE 
J013039E09CCCACCACNONE 
J013070D18CCCACCACNONE 
J013120D02CCCACCACNONE 
J013124K09CCCACCACNONE 
J023010G16CCCACCACNONE 
J023012B04CCCACCACNONE 
J023012O20CCCACCACNONE 
J023019D19CCCACCACNONE 
J023045H15CCCACCACNONE 
J023049M06CCCACCACNONE 
J023052G12CCCACCACNONE 
J023052L12CCCACCACNONE 
J023056N15CCCACCACNONE 
J023082P03CCCACCACNONE 
J023130J01CCCACCACNONE 
J023136J03CCCACCACNONE 
J033032A20CCCACCACNONE 
J033048C16CCCACCACNONE 
J033081C19CCCACCACNONE 
J033086J21CCCACCACNONE 
J033139O19CCCACCACNONE 
J043013G20CCCACCACNONE 
J043040J11CCCACCACNONE 
J065010G15CCCACCACNONE 
J065020E20CCCACCACNONE 
J065039K24CCCACCACNONE 
J065056M11CCCACCACNONE 
J065065I09CCCACCACNONE 
J065103L22CCCACCACNONE 
J065117P20CCCACCACNONE 
J065167C22CCCACCACNONE 
J065168L06CCCACCACNONE 
J065182A21CCCACCACNONE 
J065191E11CCCACCACNONE 
J065215E01CCCACCACNONE 
J090015D12CCCACCACNONE 
J090024E16CCCACCACNONE 
J090077P07CCCACCACNONE 
J100024A01CCCACCACNONE 
J100029O14CCCACCACNONE 
J100036E17CCCACCACNONE 
J100059P22CCCACCACNONE 
J100067K06CCCACCACNONE 
J100080A22CCCACCACNONE 
J100086A03CCCACCACNONE 
Os03g0822400013-072-A06CCCACCACNONE 
014-009-H06CCCACCACNONE 
014-025-G05CCCACCACNONE 
014-033-G02CCCACCACNONE 
014-038-G06CCCACCACNONE 
014-047-H10CCCACCACNONE 
014-054-H04CCCACCACNONE 
014-055-F05CCCACCACNONE 
014-075-E04CCCACCACNONE 
014-084-B02CCCACCACNONE 
014-087-F10CCCACCACNONE 
014-098-D02CCCACCACNONE 
014-099-B04CCCACCACNONE 
014-100-H10CCCACCACNONE 
AK070075CCCACCACConserved hypothetical protein. 
AK102425CCCACCACNONE 
J065134M15CCCACCACNONE 
J090053B16CCCACCACNONE 
Os03g0825300AK072216AAAGCCCACCACNONE 
AK102693AAAGCCCACCACNONE 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
BT014687AAAGCCCACCACNONE 
Os03g0830600AK107563CCCACCACPectinesterase inhibitor domain containing protein. 
Os03g0853600J033082A21CCCACCACConserved hypothetical protein. 
Os04g0218900AK071049CCCACCACTRAF-like domain containing protein. 
J023004C03CCCACCACNONE 
J023060C17CCCACCACNONE 
J023077B16CCCACCACNONE 
J023106C15CCCACCACNONE 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment). 
Os04g0293600AK063003GTGGTGGGCHypothetical protein. 
Os04g0407900AK064758CCCACCACSimilar to Cytochrom P450-like protein. 
Os04g0412100AK108223CCCACCACConserved hypothetical protein. 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
J065172M13GTGGTGGGCTTTNONE 
J100026H21GTGGTGGGCTTTNONE 
J100032D22GTGGTGGGCTTTNONE 
Os04g0434800011-033-F12GCGGCCCACCACNONE 
011-049-F07GCGGCCCACCACNONE 
AB114855GCGGCCCACCACNONE 
AK063934GCGGCCCACCACNONE 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC 1.11.1.11) (Fragment). 
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09GCCCCCACCACGTCGCGCGCNONE 
J023003G16GCCCCCACCACGTCGCGCGCNONE 
J023006F16GCCCCCACCACGTCGCGCGCNONE 
J023008D10GCCCCCACCACGTCGCGCGCNONE 
J023010A01GCCCCCACCACGTCGCGCGCNONE 
J023012M16GCCCCCACCACGTCGCGCGCNONE 
J023023H17GCCCCCACCACGTCGCGCGCNONE 
J023029B12GCCCCCACCACGTCGCGCGCNONE 
J023030F09GCCCCCACCACGTCGCGCGCNONE 
J023034K03GCCCCCACCACGTCGCGCGCNONE 
J023045A16GCCCCCACCACGTCGCGCGCNONE 
J023048I04GCCCCCACCACGTCGCGCGCNONE 
J023056C09GCCCCCACCACGTCGCGCGCNONE 
J023056F05GCCCCCACCACGTCGCGCGCNONE 
J023058B21GCCCCCACCACGTCGCGCGCNONE 
J023058N06GCCCCCACCACGTCGCGCGCNONE 
J023059F03GCCCCCACCACGTCGCGCGCNONE 
J023059M19GCCCCCACCACGTCGCGCGCNONE 
J023060P05GCCCCCACCACGTCGCGCGCNONE 
J023062D07GCCCCCACCACGTCGCGCGCNONE 
J023063F16GCCCCCACCACGTCGCGCGCNONE 
J023068K15GCCCCCACCACGTCGCGCGCNONE 
J023069L04GCCCCCACCACGTCGCGCGCNONE 
J023075I24GCCCCCACCACGTCGCGCGCNONE 
J023086H01GCCCCCACCACGTCGCGCGCNONE 
J023086I24GCCCCCACCACGTCGCGCGCNONE 
J023091M08GCCCCCACCACGTCGCGCGCNONE 
J023095A07GCCCCCACCACGTCGCGCGCNONE 
J023110K06GCCCCCACCACGTCGCGCGCNONE 
J023113D07GCCCCCACCACGTCGCGCGCNONE 
J023126J05GCCCCCACCACGTCGCGCGCNONE 
J023140F04GCCCCCACCACGTCGCGCGCNONE 
J023141N19GCCCCCACCACGTCGCGCGCNONE 
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0462500006-073-E08GTGGTGGGGCCGTGNONE 
AK062065GTGGTGGGGCCGTGNONE 
AK071311GTGGTGGGGCCGTGSimilar to 14-3-3-like protein GF14-6. 
AK071822GTGGTGGGGCCGTGNONE 
AK099243GTGGTGGGGCCGTGNONE 
AK101938GTGGTGGGGCCGTGNONE 
J013056F02GTGGTGGGGCCGTGNONE 
J023020E08GTGGTGGGGCCGTGNONE 
J023085B16GTGGTGGGGCCGTGNONE 
J023117D08GTGGTGGGGCCGTGNONE 
J023133K12GTGGTGGGGCCGTGNONE 
J033025G04GTGGTGGGGCCGTGNONE 
J033052A15GTGGTGGGGCCGTGNONE 
J033074G16GTGGTGGGGCCGTGNONE 
J033090A16GTGGTGGGGCCGTGNONE 
J033122A07GTGGTGGGGCCGTGNONE 
J033133G09GTGGTGGGGCCGTGNONE 
J065002F16GTGGTGGGGCCGTGNONE 
J065030M09GTGGTGGGGCCGTGNONE 
J065056B11GTGGTGGGGCCGTGNONE 
J065115I10GTGGTGGGGCCGTGNONE 
J065120O09GTGGTGGGGCCGTGNONE 
J065124G21GTGGTGGGGCCGTGNONE 
J075031C14GTGGTGGGGCCGTGNONE 
J075040H07GTGGTGGGGCCGTGNONE 
J075047F04GTGGTGGGGCCGTGNONE 
J075065F14GTGGTGGGGCCGTGNONE 
J075066G20GTGGTGGGGCCGTGNONE 
J075105D01GTGGTGGGGCCGTGNONE 
J075147B04GTGGTGGGGCCGTGNONE 
J075149A12GTGGTGGGGCCGTGNONE 
J075172D07GTGGTGGGGCCGTGNONE 
J075190J11GTGGTGGGGCCGTGNONE 
J090038H18GTGGTGGGGCCGTGNONE 
J090087G05GTGGTGGGGCCGTGNONE 
J100025A10GTGGTGGGGCCGTGNONE 
J100025O10GTGGTGGGGCCGTGNONE 
J100027D02GTGGTGGGGCCGTGNONE 
J100027P06GTGGTGGGGCCGTGNONE 
J100032K04GTGGTGGGGCCGTGNONE 
J100056D21GTGGTGGGGCCGTGNONE 
J100060J08GTGGTGGGGCCGTGNONE 
J100063N19GTGGTGGGGCCGTGNONE 
J100064C14GTGGTGGGGCCGTGNONE 
J100064K18GTGGTGGGGCCGTGNONE 
J100070L21GTGGTGGGGCCGTGNONE 
J100072M17GTGGTGGGGCCGTGNONE 
J100074F21GTGGTGGGGCCGTGNONE 
J100087E05GTGGTGGGGCCGTGNONE 
U65956GTGGTGGGGCCGTGNONE 
Os04g0472300AK070339GCCCACCACGlycerophosphoryl diester phosphodiesterase family protein. 
Os04g0477500AK063950CGCACCGCCCACCACNONE 
AK067372CGCACCGCCCACCACGlycosyl transferase, family 17 protein. 
AK100897CGCACCGCCCACCACNONE 
J013106K01CGCACCGCCCACCACNONE 
J043012L06CGCACCGCCCACCACNONE 
J065025M07CGCACCGCCCACCACNONE 
J065025M08CGCACCGCCCACCACNONE 
Os04g0501200AK069193CCCACCACConserved hypothetical protein. 
J023004E10CCCACCACNONE 
J065021F15CCCACCACNONE 
J065158G12CCCACCACNONE 
J100031G05CCCACCACNONE 
J100036K01CCCACCACNONE 
J100048A02CCCACCACNONE 
J100086H02CCCACCACNONE 
Os04g0512300AK071791CCCACCACArp2/3 complex, 34kDa subunit p34-Arc family protein. 
J023012N15CCCACCACNONE 
J023114E05CCCACCACNONE 
J075035B21CCCACCACNONE 
J075173E11CCCACCACNONE 
J075199P08CCCACCACNONE 
Os04g0513400012-070-C07GTGGTGGGCNONE 
AK066850GTGGTGGGCNONE 
AK068772GTGGTGGGCSimilar to Beta-glucosidase. 
J065054D24GTGGTGGGCNONE 
J065072G04GTGGTGGGCNONE 
J065190D11GTGGTGGGCNONE 
Os04g0529100AK107680CCCACCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0533300004-013-E11CCCACCACNONE 
009-003-C01CCCACCACNONE 
009-136-B07CCCACCACNONE 
016-046-G12CCCACCACNONE 
AJ441302CCCACCACNONE 
AK061351CCCACCACNONE 
AK065139CCCACCACNONE 
AK103947CCCACCACNONE 
AK104678CCCACCACNONE 
AK106182CCCACCACSimilar to Remorin (pp34). 
J013002A11CCCACCACNONE 
J013097J21CCCACCACNONE 
J023013C20CCCACCACNONE 
J023041G02CCCACCACNONE 
J023087M07CCCACCACNONE 
J100041N12CCCACCACNONE 
J100058J08CCCACCACNONE 
J100089A01CCCACCACNONE 
Os04g0549300AK063296GCCCACCACGGCCSimilar to GA protein (Fragment). 
J065073I11GCCCACCACGGCCNONE 
J065172C13GCCCACCACGGCCNONE 
J090004B10GCCCACCACGGCCNONE 
J090039N18GCCCACCACGGCCNONE 
J090088F09GCCCACCACGGCCNONE 
Os04g0555000AK100757CCCACCACGRAS transcription factor domain containing protein. 
J023002M24CCCACCACNONE 
J023118P13CCCACCACNONE 
J065166A22CCCACCACNONE 
J065192H19CCCACCACNONE 
Os04g0564700AK111806GTGGTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0565900AK109094CCCACCACHelix-loop-helix DNA-binding domain containing protein. 
J065103P12CCCACCACNONE 
J065205A12CCCACCACNONE 
J100074K13CCCACCACNONE 
Os04g0579200AK100603CCCACCACZinc finger, RING-type domain containing protein. 
AK100603GCCCACCACZinc finger, RING-type domain containing protein. 
Os04g0600200AB004864GGCCCCACCACNONE 
AB007452GGCCCCACCACNONE 
AK064040GGCCCCACCACSimilar to Alternative oxidase 1a (Fragment). 
Os04g0602800AK100925GTGGTGGGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0613200AK109490CCCACCACCAACVirulence factor, pectin lyase fold family protein. 
Os04g0623400AK100249ATCCCCCACCACNONE 
AK110887ATCCCCCACCACExonuclease domain containing protein. 
J023060F18ATCCCCCACCACNONE 
J023108E02ATCCCCCACCACNONE 
J065203O14ATCCCCCACCACNONE 
Os04g0636900009-009-D04GCCCACCACNONE 
009-010-G07GCCCACCACNONE 
009-048-H10GCCCACCACNONE 
013-066-B10GCCCACCACNONE 
014-093-G08GCCCACCACNONE 
015-025-C07GCCCACCACNONE 
J013058C15GCCCACCACNONE 
J013058E15GCCCACCACNONE 
J013072N16GCCCACCACNONE 
J013102O16GCCCACCACNONE 
J090069E22GCCCACCACNONE 
J100030G19GCCCACCACNONE 
J100050F15GCCCACCACNONE 
J100050L20GCCCACCACNONE 
J100054F18GCCCACCACNONE 
J100083P05GCCCACCACNONE 
Os04g0645100AK100454CCCACCACNONE 
J075047L12CCCACCACNONE 
J075095P06CCCACCACNONE 
J090024C03CCCACCACNONE 
J090054E23CCCACCACNONE 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACCACCCACACGCCACACGCCCAAAANONE 
Os05g0115100015-002-G01TGGGACCCACCACNONE 
016-075-D04TGGGACCCACCACNONE 
AK106226TGGGACCCACCACProtein of unknown function DUF1635 family protein. 
AK110672TGGGACCCACCACNONE 
J075034O20TGGGACCCACCACNONE 
Os05g0116500AK102231CCCACCACConserved hypothetical protein. 
AK102231GGGACCCACCACConserved hypothetical protein. 
J033088A05CCCACCACNONE 
J033088A05GGGACCCACCACNONE 
Os05g0140100003-106-D03CCCACCACNONE 
AJ495784CCCACCACNONE 
AK099636CCCACCACNONE 
AK104345CCCACCACNONE 
AK111821CCCACCACMyb, DNA-binding domain containing protein. 
J013059L07CCCACCACNONE 
J065073K19CCCACCACNONE 
J065098F13CCCACCACNONE 
J065104A20CCCACCACNONE 
J065138N24CCCACCACNONE 
J065180J07CCCACCACNONE 
Os05g0143300AK072841CCACCAACCCCACCACNONE 
AK099030CCACCAACCCCACCACConserved hypothetical protein. 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0186300AK070360CCCACCACSimilar to NADP-malic enzyme. 
AK099249CCCACCACNONE 
AY435404CCCACCACNONE 
J023006D11CCCACCACNONE 
J023059P07CCCACCACNONE 
Os05g0186900AK111403GCCCACCACCACCTGTConserved hypothetical protein. 
Os05g0194900AK071798GTGGTGGGCSimilar to Pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein (Pyrophosphate-dependent phosphofructo-1-kinase-like protein). 
J023112B14GTGGTGGGCNONE 
Os05g0209000AK111487AGCCCACCACConserved hypothetical protein. 
J075017G20AGCCCACCACNONE 
J075025B12AGCCCACCACNONE 
J075112L13AGCCCACCACNONE 
J075115B08AGCCCACCACNONE 
J075121P06AGCCCACCACNONE 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0223300AK069616CCCACCACCAACSimilar to RNA-binding protein. 
J080093O15CCCACCACCAACNONE 
J090061N02CCCACCACCAACNONE 
Os05g0243200009-073-F12GCCCACCACNONE 
AK061317GCCCACCACSimilar to Ribosomal protein L13. 
J065120F21GCCCACCACNONE 
J065185K05GCCCACCACNONE 
Os05g0272900AK107093GTGGTGGGB-cell receptor-associated 31-like family protein. 
J065214G16GTGGTGGGNONE 
J100022C20GTGGTGGGNONE 
J100040B08GTGGTGGGNONE 
J100088C21GTGGTGGGNONE 
Os05g0273800AK060563CCCACCACSimilar to Soluble epoxide hydrolase. 
Os05g0280200006-058-E11CCCACCACNONE 
006-097-A12CCCACCACNONE 
006-115-G07CCCACCACNONE 
AK120316CCCACCACNONE 
D13152CCCACCACSimilar to Ras-related protein Rab11A. 
J013055N09CCCACCACNONE 
J023063N16CCCACCACNONE 
J023093L24CCCACCACNONE 
J033115M09CCCACCACNONE 
J065011C10CCCACCACNONE 
J065017O22CCCACCACNONE 
J065209P15CCCACCACNONE 
J100019P06CCCACCACNONE 
Os05g0330700009-032-H01ACAGCCCACCACNONE 
AK062425ACAGCCCACCACConserved hypothetical protein. 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
J075100E12ACCGGGCCCCACCCCACCACNONE 
J090024D03ACCGGGCCCCACCCCACCACNONE 
J100027C02ACCGGGCCCCACCCCACCACNONE 
J100053P05ACCGGGCCCCACCCCACCACNONE 
J100055P22ACCGGGCCCCACCCCACCACNONE 
Os05g0358000006-083-G07GTCCCACCACNONE 
AK061141GTCCCACCACNONE 
AK070900GTCCCACCACNONE 
AK101263GTCCCACCACDrought induced 19 family protein. 
J023098C13GTCCCACCACNONE 
J033032J06GTCCCACCACNONE 
J065014A09GTCCCACCACNONE 
J065121L01GTCCCACCACNONE 
J065130K19GTCCCACCACNONE 
J065208B21GTCCCACCACNONE 
J075080G14GTCCCACCACNONE 
J075135L01GTCCCACCACNONE 
J075180J15GTCCCACCACNONE 
Os05g0369900015-049-C07GTGGTGGGNONE 
AK064110GTGGTGGGConserved hypothetical protein. 
Os05g0370700AK108862GCAGCCCACCACAlpha/beta hydrolase family protein. 
Os05g0391500AK119412ACCCCCCACCACSimilar to Endo-beta-mannosidase. 
Os05g0392700AK058728CCCACCACNONE 
AK058728GCCCACCACNONE 
AK073425CCCACCACNONE 
AK073425GCCCACCACNONE 
AK104407CCCACCACMitochondrial substrate carrier family protein. 
AK104407GCCCACCACMitochondrial substrate carrier family protein. 
Os05g0406100AK070068GGGGCCCACCACNONE 
J023041D03GGGGCCCACCACNONE 
Os05g0410800AK108312GCCCCACCACTGF-beta receptor, type I/II extracellular region family protein. 
Os05g0429700AK069203TCGTGGGCCCCACCACNONE 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0429900AK066834GCGGGCCCACCACNONE 
AK099108GCGGGCCCACCACNONE 
AK104053GCGGGCCCACCACNONE 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
J090031E22GCGGGCCCACCACNONE 
Os05g0430200J090095K16CAAGCCCACCACNONE 
Os05g0438500006-102-F01CCCACCACCACCAACNONE 
AK059951CCCACCACCACCAACSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0458100006-084-A05ATGGCCCACCACNONE 
009-091-H05ATGGCCCACCACNONE 
AJ557547ATGGCCCACCACNONE 
AK059467ATGGCCCACCACNONE 
AK061127ATGGCCCACCACNONE 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06ATGGCCCACCACNONE 
J033057B20ATGGCCCACCACNONE 
J033087A05ATGGCCCACCACNONE 
J043009C05ATGGCCCACCACNONE 
J090009E10ATGGCCCACCACNONE 
Os05g0474700AK109305GTGGTGGGConserved hypothetical protein. 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
009-036-D05GTGGTGGGCCTCNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK062441GTGGTGGGCCTCCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080003C10GTGGTGGGCCTCNONE 
J080046G11GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCTCNONE 
Os05g0524400AK063963CCCACCACNONE 
AK072857CCCACCACPhosphofructokinase family protein. 
Os05g0566800AK065748CCCACCACCold acclimation protein COR413-TM1. 
AY181210CCCACCACNONE 
Os05g0579300AK111350CATCCCCCACCACZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
AK111350CCCACCACZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os05g0581700AK108181CCCACCACConserved hypothetical protein. 
Os05g0592500AK071878GTGGTGGGCNONE 
AK099566GTGGTGGGCSIT4 phosphatase-associated protein family protein. 
J013021B11GTGGTGGGCNONE 
J013034M16GTGGTGGGCNONE 
J013039A13GTGGTGGGCNONE 
J013055O15GTGGTGGGCNONE 
J013067K22GTGGTGGGCNONE 
J013100G17GTGGTGGGCNONE 
J013104E08GTGGTGGGCNONE 
J023025L16GTGGTGGGCNONE 
J023086C08GTGGTGGGCNONE 
J023086E13GTGGTGGGCNONE 
J033044J02GTGGTGGGCNONE 
J033055J15GTGGTGGGCNONE 
J033123L19GTGGTGGGCNONE 
Os06g0104400011-027-A07CCCACCACNONE 
013-010-H04CCCACCACNONE 
013-053-G04CCCACCACNONE 
013-079-E08CCCACCACNONE 
014-093-A05CCCACCACNONE 
015-007-E08CCCACCACNONE 
015-038-C04CCCACCACNONE 
015-077-H03CCCACCACNONE 
016-019-B06CCCACCACNONE 
016-094-F09CCCACCACNONE 
AK060638CCCACCACIQ calmodulin-binding region domain containing protein. 
AK103829CCCACCACNONE 
J043001H14CCCACCACNONE 
J053099G05CCCACCACNONE 
J065085L08CCCACCACNONE 
J065104P17CCCACCACNONE 
J065121N22CCCACCACNONE 
J065208O13CCCACCACNONE 
J075030D04CCCACCACNONE 
J075076C04CCCACCACNONE 
J075087K02CCCACCACNONE 
J090090D16CCCACCACNONE 
Os06g0135000J075008J15GTGGTGGGNONE 
J075166F23GTGGTGGGNONE 
J075185F03GTGGTGGGNONE 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0154200AK107102CCCACCACNONE 
Os06g0171700AK103771GCGCGGGTGGTGGGGCTTGGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GCGCGGGTGGTGGGGCTTGGNONE 
Os06g0179000AK065263CCCACCACGlycoside hydrolase family 79, N-terminal protein. 
J013002K06CCCACCACNONE 
J013043F11CCCACCACNONE 
J013065A15CCCACCACNONE 
J013095F02CCCACCACNONE 
J013106C19CCCACCACNONE 
J023002K18CCCACCACNONE 
J023083B04CCCACCACNONE 
J023095B05CCCACCACNONE 
J023149P04CCCACCACNONE 
J090053F18CCCACCACNONE 
J090063L23CCCACCACNONE 
J100024I02CCCACCACNONE 
J100033E01CCCACCACNONE 
J100070J22CCCACCACNONE 
Os06g0179800AK065817GGTCCCACCACNONE 
AK121252GGTCCCACCACLeucine rich repeat, N-terminal domain containing protein. 
Os06g0192000AK106844GTGGTGGGConserved hypothetical protein. 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0202300AK063905GTGGTGGGConserved hypothetical protein. 
Os06g0207000AK067115CCCACCACFumble domain containing protein. 
J013095O17CCCACCACNONE 
J023034A17CCCACCACNONE 
J065022F15CCCACCACNONE 
J100061I01CCCACCACNONE 
J100087H05CCCACCACNONE 
Os06g0359400J065023L12GTGGTGGGNONE 
J065028L17GTGGTGGGNONE 
J065089L20GTGGTGGGNONE 
J065168N11GTGGTGGGConserved hypothetical protein. 
J065187B07GTGGTGGGNONE 
J100057A10GTGGTGGGNONE 
Os06g0495800J100069N08GCCCACCACProtein of unknown function DUF617, plant family protein. 
Os06g0506600009-119-E12AGCCCACCACNONE 
J023086A18AGCCCACCACNONE 
J033036I02AGCCCACCACNONE 
J033125C16AGCCCACCACNONE 
J065013I11AGCCCACCACNONE 
J065026O21AGCCCACCACNONE 
J065060H10AGCCCACCACNONE 
J065067A15AGCCCACCACNONE 
J065068F07AGCCCACCACNONE 
J065085N06AGCCCACCACNONE 
J065108N10AGCCCACCACNONE 
J065161O11AGCCCACCACNONE 
J065185J15AGCCCACCACNONE 
J065191H18AGCCCACCACNONE 
J065199J09AGCCCACCACNONE 
J075005G03AGCCCACCACNONE 
J075018C16AGCCCACCACNONE 
J075061K20AGCCCACCACNONE 
J075069J06AGCCCACCACNONE 
J075075H19AGCCCACCACNONE 
J075076D20AGCCCACCACNONE 
J075078D16AGCCCACCACNONE 
J075100J19AGCCCACCACNONE 
J075110M11AGCCCACCACNONE 
J075157N05AGCCCACCACNONE 
J075171F20AGCCCACCACNONE 
J075177G08AGCCCACCACNONE 
J075179G08AGCCCACCACNONE 
Os06g0603000AK068856CCCACCACNONE 
AK104955CCCACCACSimilar to Heme oxygenase 1 (Fragment). 
Os06g0609600AK072533CCCACCACEF-Hand type domain containing protein. 
AK099872CCCACCACNONE 
BT014680CCCACCACNONE 
J023008M02CCCACCACNONE 
J023127M12CCCACCACNONE 
J065049L24CCCACCACNONE 
J065102K24CCCACCACNONE 
J065205O14CCCACCACNONE 
J075127F01CCCACCACNONE 
J080033F07CCCACCACNONE 
Os06g0617800AK065878CCCACCACNONE 
AK066802CCCACCACNONE 
AK067505CCCACCACRibose-phosphate pyrophosphokinase 2 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 2). Splice isoform 1. 
AK067686CCCACCACNONE 
AK068485CCCACCACNONE 
J013047O13CCCACCACNONE 
J013075O08CCCACCACNONE 
J013109E14CCCACCACNONE 
J013151A20CCCACCACNONE 
J023052D19CCCACCACNONE 
J065043M07CCCACCACNONE 
J065051E07CCCACCACNONE 
J065068L05CCCACCACNONE 
J065217K21CCCACCACNONE 
J075009O13CCCACCACNONE 
J075086O08CCCACCACNONE 
J075108E03CCCACCACNONE 
J075117A11CCCACCACNONE 
J075117F09CCCACCACNONE 
J075121B09CCCACCACNONE 
J075121J09CCCACCACNONE 
J075147M13CCCACCACNONE 
J075169N13CCCACCACNONE 
J075171H08CCCACCACNONE 
J075175B22CCCACCACNONE 
J075176B16CCCACCACNONE 
J075177L20CCCACCACNONE 
J075181O14CCCACCACNONE 
J090079F03CCCACCACNONE 
J090093I23CCCACCACNONE 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0636700AK058562GGCCCCACCACLipolytic enzyme, G-D-S-L family protein. 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0647400AK068457GTGGTGGGCTSimilar to Lysosomal Pro-X carboxypeptidase. 
AK103281GTGGTGGGCTNONE 
J013151A14GTGGTGGGCTNONE 
Os06g0666400AK108002GGGGCCCACCCACCACVQ domain containing protein. 
J065043C22GGGGCCCACCCACCACNONE 
J065120O19GGGGCCCACCCACCACNONE 
J075197D23GGGGCCCACCCACCACNONE 
J100030E22GGGGCCCACCCACCACNONE 
J100031I22GGGGCCCACCCACCACNONE 
J100072I12GGGGCCCACCCACCACNONE 
Os06g0667400AK065424GTGGTGGGConserved hypothetical protein. 
AK065424GTGGTGGGConserved hypothetical protein. 
AK065580GTGGTGGGNONE 
AK065580GTGGTGGGNONE 
Os06g0683400009-047-C07GAAGCCCACCACNONE 
009-060-B06GAAGCCCACCACNONE 
013-057-F12GAAGCCCACCACNONE 
AK111852GAAGCCCACCACNONE 
AK111897GAAGCCCACCACNONE 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GAAGCCCACCACNONE 
J065187J11GAAGCCCACCACNONE 
J065197L08GAAGCCCACCACNONE 
J100045K14GAAGCCCACCACNONE 
J100074M08GAAGCCCACCACNONE 
J100088H21GAAGCCCACCACNONE 
Os06g0683900011-042-B09CCCACCACACACCNONE 
011-042-F07CCCACCACACACCNONE 
015-047-H05CCCACCACACACCNONE 
016-011-D06CCCACCACACACCNONE 
AK063941CCCACCACACACCConserved hypothetical protein. 
AK102096CCCACCACACACCNONE 
J090059F01CCCACCACACACCNONE 
Os06g0704700AK120907CCCCCGCGCCCCACCACNmrA-like family protein. 
AY224493CCCCCGCGCCCCACCACNONE 
Os06g0707200006-022-G09CCCACCACNONE 
AK059411CCCACCACNONE 
AK071568CCCACCACProtein of unknown function DUF563 family protein. 
J065101E21CCCACCACNONE 
Os06g0710900AK073326CTGGCCCACCACConserved hypothetical protein. 
Os06g0711600016-047-G09GAAGCCCACCACNONE 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
AK102831GAAGCCCACCACNONE 
J013072P18GAAGCCCACCACNONE 
J023049G01GAAGCCCACCACNONE 
J023088I01GAAGCCCACCACNONE 
J033023I22GAAGCCCACCACNONE 
J033106I12GAAGCCCACCACNONE 
J033109G07GAAGCCCACCACNONE 
J065030F22GAAGCCCACCACNONE 
J065132H19GAAGCCCACCACNONE 
J080301D07GAAGCCCACCACNONE 
J080305C09GAAGCCCACCACNONE 
J080312C03GAAGCCCACCACNONE 
J080313I15GAAGCCCACCACNONE 
J080315B09GAAGCCCACCACNONE 
J090056N21GAAGCCCACCACNONE 
J100027B07GAAGCCCACCACNONE 
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
AK069538TGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
J023020A02CGGGTCCCACCACNONE 
J023020A02TGGGTCCCACCACNONE 
J023039H03CGGGTCCCACCACNONE 
J023039H03TGGGTCCCACCACNONE 
J100042E23CGGGTCCCACCACNONE 
J100042E23TGGGTCCCACCACNONE 
J100069N01CGGGTCCCACCACNONE 
J100069N01TGGGTCCCACCACNONE 
J100089L13CGGGTCCCACCACNONE 
J100089L13TGGGTCCCACCACNONE 
Os06g0716800014-028-E06GTGGTGGGNONE 
014-028-E06TGGTGGGCCCACCACNONE 
016-046-F04GTGGTGGGNONE 
016-046-F04TGGTGGGCCCACCACNONE 
AK071639GTGGTGGGEukaryotic transcription factor, DNA-binding domain containing protein. 
AK071639TGGTGGGCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
AK103968GTGGTGGGNONE 
AK103968TGGTGGGCCCACCACNONE 
J023099K10GTGGTGGGNONE 
J023099K10TGGTGGGCCCACCACNONE 
J065036H06GTGGTGGGNONE 
J065036H06TGGTGGGCCCACCACNONE 
J065049K01GTGGTGGGNONE 
J065049K01TGGTGGGCCCACCACNONE 
J065060N02GTGGTGGGNONE 
J065060N02TGGTGGGCCCACCACNONE 
J065204C12GTGGTGGGNONE 
J065204C12TGGTGGGCCCACCACNONE 
J065213P15GTGGTGGGNONE 
J065213P15TGGTGGGCCCACCACNONE 
J080001K17GTGGTGGGNONE 
J080001K17TGGTGGGCCCACCACNONE 
J080006L04GTGGTGGGNONE 
J080006L04TGGTGGGCCCACCACNONE 
J080008A10GTGGTGGGNONE 
J080008A10TGGTGGGCCCACCACNONE 
J080008E16GTGGTGGGNONE 
J080008E16TGGTGGGCCCACCACNONE 
J080010L22GTGGTGGGNONE 
J080010L22TGGTGGGCCCACCACNONE 
J080011N22GTGGTGGGNONE 
J080011N22TGGTGGGCCCACCACNONE 
J080014K12GTGGTGGGNONE 
J080014K12TGGTGGGCCCACCACNONE 
J080018F08GTGGTGGGNONE 
J080018F08TGGTGGGCCCACCACNONE 
J080018N02GTGGTGGGNONE 
J080018N02TGGTGGGCCCACCACNONE 
J080021N10GTGGTGGGNONE 
J080021N10TGGTGGGCCCACCACNONE 
J080029B02GTGGTGGGNONE 
J080029B02TGGTGGGCCCACCACNONE 
J080030D07GTGGTGGGNONE 
J080030D07TGGTGGGCCCACCACNONE 
J080032A16GTGGTGGGNONE 
J080032A16TGGTGGGCCCACCACNONE 
J080034M13GTGGTGGGNONE 
J080034M13TGGTGGGCCCACCACNONE 
J080038F06GTGGTGGGNONE 
J080038F06TGGTGGGCCCACCACNONE 
J080039K15GTGGTGGGNONE 
J080039K15TGGTGGGCCCACCACNONE 
J080042M20GTGGTGGGNONE 
J080042M20TGGTGGGCCCACCACNONE 
J080048N14GTGGTGGGNONE 
J080048N14TGGTGGGCCCACCACNONE 
J080050F23GTGGTGGGNONE 
J080050F23TGGTGGGCCCACCACNONE 
J080051C22GTGGTGGGNONE 
J080051C22TGGTGGGCCCACCACNONE 
J080053B19GTGGTGGGNONE 
J080053B19TGGTGGGCCCACCACNONE 
J080056J19GTGGTGGGNONE 
J080056J19TGGTGGGCCCACCACNONE 
J080056K05GTGGTGGGNONE 
J080056K05TGGTGGGCCCACCACNONE 
J080060C09GTGGTGGGNONE 
J080060C09TGGTGGGCCCACCACNONE 
J080060K21GTGGTGGGNONE 
J080060K21TGGTGGGCCCACCACNONE 
J080065J17GTGGTGGGNONE 
J080065J17TGGTGGGCCCACCACNONE 
J080067A16GTGGTGGGNONE 
J080067A16TGGTGGGCCCACCACNONE 
J080075I03GTGGTGGGNONE 
J080075I03TGGTGGGCCCACCACNONE 
J080076D21GTGGTGGGNONE 
J080076D21TGGTGGGCCCACCACNONE 
J080078G16GTGGTGGGNONE 
J080078G16TGGTGGGCCCACCACNONE 
J080085K15GTGGTGGGNONE 
J080085K15TGGTGGGCCCACCACNONE 
J080089C14GTGGTGGGNONE 
J080089C14TGGTGGGCCCACCACNONE 
J080091N22GTGGTGGGNONE 
J080091N22TGGTGGGCCCACCACNONE 
J080094N12GTGGTGGGNONE 
J080094N12TGGTGGGCCCACCACNONE 
J090032N05GTGGTGGGNONE 
J090032N05TGGTGGGCCCACCACNONE 
Os06g0717800006-038-C09GTGGTGGGNONE 
AK062157GTGGTGGGNONE 
Os06g0731700J065089G16GTGGTGGGACNONE 
J065157E16GTGGTGGGACNONE 
Os07g0100200006-022-D06GTGGTGGGCNONE 
011-025-B06GTGGTGGGCNONE 
012-069-A07GTGGTGGGCNONE 
AK060986GTGGTGGGCNONE 
AK073305GTGGTGGGCSimilar to PDX1-like protein 4. 
J023055C05GTGGTGGGCNONE 
J033024J11GTGGTGGGCNONE 
J065045F14GTGGTGGGCNONE 
J075097C22GTGGTGGGCNONE 
Os07g0171100AF272978TCCGGGCCCACCACNONE 
AK062132TCCGGGCCCACCACNONE 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
J013068C23TCCGGGCCCACCACNONE 
Os07g0176600AK066812CCCACCACNONE 
AK067073CCCACCACSimilar to Kinase-like protein. 
Os07g0185700012-040-A11CAAGCCCACCACNONE 
AK070572CAAGCCCACCACConserved hypothetical protein. 
J065116D10CAAGCCCACCACNONE 
J065122F20CAAGCCCACCACNONE 
Os07g0191000AK071379CCCACCACInositol monophosphatase family protein. 
AK103440CCCACCACNONE 
Os07g0198300006-052-H02CCCACCACNONE 
009-097-B09CCCACCACNONE 
009-116-E02CCCACCACNONE 
009-186-A12CCCACCACNONE 
AK060951CCCACCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830CCCACCACNONE 
J023117F24CCCACCACNONE 
J065073D24CCCACCACNONE 
J065116O11CCCACCACNONE 
J065122C11CCCACCACNONE 
Os07g0217600AK065971GTGGTGGGCCytochrome P450 family protein. 
Os07g0229200AK058412GTGGTGGGGGCCyclin-like F-box domain containing protein. 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0486500AK063998CCCACCACRho GTPase activation protein domain containing protein. 
AK068175CCCACCACNONE 
J013130L24CCCACCACNONE 
J013156J03CCCACCACNONE 
J033031L21CCCACCACNONE 
J043001A20CCCACCACNONE 
J043007B17CCCACCACNONE 
J043017M19CCCACCACNONE 
J043024H09CCCACCACNONE 
J043030B12CCCACCACNONE 
J065177C18CCCACCACNONE 
J075004K10CCCACCACNONE 
J075004K12CCCACCACNONE 
J075088G07CCCACCACNONE 
J075107M02CCCACCACNONE 
J075126G01CCCACCACNONE 
J075185J08CCCACCACNONE 
J100034E04CCCACCACNONE 
J100038G12CCCACCACNONE 
Os07g0495000015-070-F12GTGGTGGGGGAGNONE 
AK060721GTGGTGGGGGAGNONE 
AK073883GTGGTGGGGGAGCupin, RmlC-type domain containing protein. 
AK119204GTGGTGGGGGAGNONE 
J033071H20GTGGTGGGGGAGNONE 
J090079B04GTGGTGGGGGAGNONE 
Os07g0499800AK120716ACCCCCCACCACZinc finger, RING-type domain containing protein. 
AK120716CCCACCACZinc finger, RING-type domain containing protein. 
Os07g0541900AK109699GTGGTGGGGCCSimilar to KI domain interacting kinase 1. 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0584500003-129-F05CCCACCACNONE 
006-119-H08CCCACCACNONE 
011-022-G03CCCACCACNONE 
AK067725CCCACCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109CCCACCACNONE 
J013055C05CCCACCACNONE 
J013062F12CCCACCACNONE 
J013069J22CCCACCACNONE 
J013114I11CCCACCACNONE 
J023072P12CCCACCACNONE 
Os07g0588800015-027-E02CCCACCACNONE 
AK070635CCCACCACNONE 
AK103183CCCACCACConserved hypothetical protein. 
J023058H18CCCACCACNONE 
Os07g0594400J065137M02CCCACCACConserved hypothetical protein. 
J065218E03CCCACCACNONE 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0606600AK111621GCCCCACCACNONE 
AK112118GCCCCACCACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22GCCCCACCACNONE 
Os07g0607800012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0622200AB122058CCCACCACNONE 
AK069968CCCACCACNONE 
AK105687CCCACCACSimilar to M-160-u1_1 (Fragment). 
J075095A10CCCACCACNONE 
Os07g0623600AK063642GTGGTGGGTGGGGGCGCGGGTGCGGTGConserved hypothetical protein. 
Os07g0624600AK109902GTGGTGGGCCATSimilar to Trehalose-6-phosphate phosphatase. 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0633800AK103878GTGGTGGGACConserved hypothetical protein. 
J033025K08GTGGTGGGACNONE 
J033026N04GTGGTGGGACNONE 
J090062M09GTGGTGGGACNONE 
J090087F04GTGGTGGGACNONE 
Os07g0661400006-083-E05CCCGGCCCCACCACCCCACCCGNONE 
006-084-B12CCCGGCCCCACCACCCCACCCGNONE 
006-096-B03CCCGGCCCCACCACCCCACCCGNONE 
009-013-C12CCCGGCCCCACCACCCCACCCGNONE 
009-017-C10CCCGGCCCCACCACCCCACCCGNONE 
009-027-A02CCCGGCCCCACCACCCCACCCGNONE 
009-035-A06CCCGGCCCCACCACCCCACCCGNONE 
009-047-H11CCCGGCCCCACCACCCCACCCGNONE 
009-050-B11CCCGGCCCCACCACCCCACCCGNONE 
009-051-C02CCCGGCCCCACCACCCCACCCGNONE 
009-089-G06CCCGGCCCCACCACCCCACCCGNONE 
009-091-C05CCCGGCCCCACCACCCCACCCGNONE 
009-095-B11CCCGGCCCCACCACCCCACCCGNONE 
009-151-C01CCCGGCCCCACCACCCCACCCGNONE 
009-154-F06CCCGGCCCCACCACCCCACCCGNONE 
009-169-F02CCCGGCCCCACCACCCCACCCGNONE 
009-171-G01CCCGGCCCCACCACCCCACCCGNONE 
009-179-F07CCCGGCCCCACCACCCCACCCGNONE 
013-018-H06CCCGGCCCCACCACCCCACCCGNONE 
013-024-E05CCCGGCCCCACCACCCCACCCGNONE 
013-038-F09CCCGGCCCCACCACCCCACCCGNONE 
013-099-F06CCCGGCCCCACCACCCCACCCGNONE 
014-042-E09CCCGGCCCCACCACCCCACCCGNONE 
014-086-C02CCCGGCCCCACCACCCCACCCGNONE 
014-093-B08CCCGGCCCCACCACCCCACCCGNONE 
015-039-G11CCCGGCCCCACCACCCCACCCGNONE 
016-036-E05CCCGGCCCCACCACCCCACCCGNONE 
AK068814CCCGGCCCCACCACCCCACCCGNONE 
AK102682CCCGGCCCCACCACCCCACCCGNONE 
AK105973CCCGGCCCCACCACCCCACCCGNONE 
AK107202CCCGGCCCCACCACCCCACCCGConserved hypothetical protein. 
J053035N21CCCGGCCCCACCACCCCACCCGNONE 
J053099D11CCCGGCCCCACCACCCCACCCGNONE 
J065023B18CCCGGCCCCACCACCCCACCCGNONE 
J065031M15CCCGGCCCCACCACCCCACCCGNONE 
J065035G23CCCGGCCCCACCACCCCACCCGNONE 
J065060M18CCCGGCCCCACCACCCCACCCGNONE 
J065073J18CCCGGCCCCACCACCCCACCCGNONE 
J065103E20CCCGGCCCCACCACCCCACCCGNONE 
J065105N19CCCGGCCCCACCACCCCACCCGNONE 
J065137A08CCCGGCCCCACCACCCCACCCGNONE 
J065152K09CCCGGCCCCACCACCCCACCCGNONE 
J065156M12CCCGGCCCCACCACCCCACCCGNONE 
J065162G23CCCGGCCCCACCACCCCACCCGNONE 
J065162L13CCCGGCCCCACCACCCCACCCGNONE 
J065163H16CCCGGCCCCACCACCCCACCCGNONE 
J065165E06CCCGGCCCCACCACCCCACCCGNONE 
J065171J04CCCGGCCCCACCACCCCACCCGNONE 
J065180L23CCCGGCCCCACCACCCCACCCGNONE 
J065183K23CCCGGCCCCACCACCCCACCCGNONE 
J065186H13CCCGGCCCCACCACCCCACCCGNONE 
J065195D10CCCGGCCCCACCACCCCACCCGNONE 
J065209G11CCCGGCCCCACCACCCCACCCGNONE 
J075006J08CCCGGCCCCACCACCCCACCCGNONE 
J075112O07CCCGGCCCCACCACCCCACCCGNONE 
J080301H14CCCGGCCCCACCACCCCACCCGNONE 
J100058C17CCCGGCCCCACCACCCCACCCGNONE 
J100077I23CCCGGCCCCACCACCCCACCCGNONE 
J100080I24CCCGGCCCCACCACCCCACCCGNONE 
Os07g0672500AK067432CCCACCACSMAD/FHA domain containing protein. 
AK119940CCCACCACNONE 
Os07g0680300009-195-E06CCCACCACNONE 
AK063800CCCACCACSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19CCCACCACNONE 
J075066A20CCCACCACNONE 
J075088I17CCCACCACNONE 
J075147M19CCCACCACNONE 
J075153L02CCCACCACNONE 
J080013A21CCCACCACNONE 
J080051B13CCCACCACNONE 
J080077I24CCCACCACNONE 
J080302B14CCCACCACNONE 
J080309D22CCCACCACNONE 
J100083B16CCCACCACNONE 
Os07g0691200AK068807GCCCACCACNONE 
AK072158GCCCACCACNONE 
J013001D13GCCCACCACNONE 
J013022D09GCCCACCACNONE 
J013028C24GCCCACCACNONE 
J013032M14GCCCACCACNONE 
J023097E13GCCCACCACNONE 
J065095A22GCCCACCACNONE 
Os08g0112800009-113-D03GTGGTGGGCCCTNONE 
AK121176GTGGTGGGCCCTRickettsia 17 kDa surface antigen family protein. 
J023083C18GTGGTGGGCCCTNONE 
J033074M10GTGGTGGGCCCTNONE 
J033097G10GTGGTGGGCCCTNONE 
J065090F05GTGGTGGGCCCTNONE 
J090001J03GTGGTGGGCCCTNONE 
J090044F23GTGGTGGGCCCTNONE 
J090078H09GTGGTGGGCCCTNONE 
J100088G23GTGGTGGGCCCTNONE 
Os08g0120500AK067413GTGGTGGGNONE 
J013100H24GTGGTGGGNONE 
Os08g0126500AK110941TGGGACCCACCACProtein of unknown function DUF295 family protein. 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
Os08g0127700012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
Os08g0128200AK120428GTGGGTCCCACCACConserved hypothetical protein. 
Os08g0141300AK058337GTGGTGGGCCCCACCNONE 
AK067917GTGGTGGGCCCCACCMajor sperm protein domain containing protein. 
J100039I03GTGGTGGGCCCCACCNONE 
Os08g0157900012-025-H08CCCACCACGTCTCNONE 
012-069-E02CCCACCACGTCTCNONE 
012-074-H11CCCACCACGTCTCNONE 
AK065294CCCACCACGTCTCSimilar to NAM protein. 
J013002N10CCCACCACGTCTCNONE 
J013042J10CCCACCACGTCTCNONE 
J023060K03CCCACCACGTCTCNONE 
J023145N12CCCACCACGTCTCNONE 
J033040L20CCCACCACGTCTCNONE 
J033044L13CCCACCACGTCTCNONE 
J033057C19CCCACCACGTCTCNONE 
J033107E01CCCACCACGTCTCNONE 
J033123M07CCCACCACGTCTCNONE 
J033136I18CCCACCACGTCTCNONE 
J065051P18CCCACCACGTCTCNONE 
J065055L08CCCACCACGTCTCNONE 
J065196D15CCCACCACGTCTCNONE 
Os08g0176900AK107028GCCCCCACCACSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK109294GCCCCCACCACNONE 
Os08g0178800009-155-D05GGCCGTGGTGGTGGGGGAGNONE 
AK063025GGCCGTGGTGGTGGGGGAGHypothetical protein. 
Os08g0260600AK108529GTGGTGGGCD9/CD37/CD63 antigen family protein. 
Os08g0261100009-083-E09CCCACCACNONE 
AK068711CCCACCACProtein of unknown function DUF1218 family protein. 
J013160C06CCCACCACNONE 
J053033I11CCCACCACNONE 
J065022B20CCCACCACNONE 
J080022A03CCCACCACNONE 
J100034M10CCCACCACNONE 
Os08g0276100006-086-B08CCCACCACNONE 
AK068157CCCACCACNONE 
AK104325CCCACCACNONE 
AK105984CCCACCACConserved hypothetical protein. 
J013134G12CCCACCACNONE 
J013160J03CCCACCACNONE 
J065128E08CCCACCACNONE 
J065170A10CCCACCACNONE 
Os08g0346400003-103-D08CCCACCACNONE 
009-135-G12CCCACCACNONE 
AK059644CCCACCACNONE 
AK062928CCCACCACNONE 
AK103873CCCACCACSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11CCCACCACNONE 
J065137E08CCCACCACNONE 
J065194M22CCCACCACNONE 
J075083O16CCCACCACNONE 
Os08g0387500AK105106GTGGTGGGCCCCACCCGSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0430000AK120950CCCACCACConserved hypothetical protein. 
Os08g0431100AK069476GTGGTGGGGCBromo adjacent region domain containing protein. 
J043026K24GTGGTGGGGCNONE 
Os08g0435900003-113-D09CCCACCACNONE 
003-131-A04CCCACCACNONE 
006-021-D09CCCACCACNONE 
006-023-F09CCCACCACNONE 
006-024-H07CCCACCACNONE 
006-025-F06CCCACCACNONE 
006-025-H01CCCACCACNONE 
006-025-H10CCCACCACNONE 
006-026-A07CCCACCACNONE 
006-026-E01CCCACCACNONE 
006-026-F04CCCACCACNONE 
006-027-A01CCCACCACNONE 
006-029-H01CCCACCACNONE 
006-030-D02CCCACCACNONE 
006-032-C03CCCACCACNONE 
006-034-C02CCCACCACNONE 
006-035-H10CCCACCACNONE 
006-039-C01CCCACCACNONE 
006-039-H08CCCACCACNONE 
006-040-D09CCCACCACNONE 
006-040-F05CCCACCACNONE 
006-044-D04CCCACCACNONE 
006-044-F09CCCACCACNONE 
006-044-G05CCCACCACNONE 
006-045-C06CCCACCACNONE 
006-046-B04CCCACCACNONE 
006-047-D03CCCACCACNONE 
006-048-C10CCCACCACNONE 
006-048-D10CCCACCACNONE 
006-050-H01CCCACCACNONE 
006-051-D12CCCACCACNONE 
006-053-B05CCCACCACNONE 
006-054-B12CCCACCACNONE 
006-054-E05CCCACCACNONE 
006-054-H06CCCACCACNONE 
006-056-H02CCCACCACNONE 
006-059-A07CCCACCACNONE 
006-059-G02CCCACCACNONE 
006-059-G12CCCACCACNONE 
006-061-F01CCCACCACNONE 
006-061-H10CCCACCACNONE 
006-063-B02CCCACCACNONE 
006-064-H12CCCACCACNONE 
006-068-D06CCCACCACNONE 
006-071-H08CCCACCACNONE 
006-072-E10CCCACCACNONE 
006-074-C06CCCACCACNONE 
006-074-D12CCCACCACNONE 
006-076-H06CCCACCACNONE 
006-077-E04CCCACCACNONE 
006-081-H01CCCACCACNONE 
006-082-E11CCCACCACNONE 
006-083-G10CCCACCACNONE 
006-084-B05CCCACCACNONE 
006-085-C06CCCACCACNONE 
006-088-C04CCCACCACNONE 
006-088-F11CCCACCACNONE 
006-088-H11CCCACCACNONE 
006-090-F06CCCACCACNONE 
006-091-B01CCCACCACNONE 
006-091-C10CCCACCACNONE 
006-091-G11CCCACCACNONE 
006-092-A11CCCACCACNONE 
006-092-F10CCCACCACNONE 
006-093-D01CCCACCACNONE 
006-093-E11CCCACCACNONE 
006-095-F09CCCACCACNONE 
006-096-B05CCCACCACNONE 
006-096-B06CCCACCACNONE 
006-096-B11CCCACCACNONE 
006-099-E04CCCACCACNONE 
006-100-A01CCCACCACNONE 
006-100-E04CCCACCACNONE 
006-104-B09CCCACCACNONE 
006-106-A09CCCACCACNONE 
006-107-C07CCCACCACNONE 
006-107-H03CCCACCACNONE 
006-109-B12CCCACCACNONE 
006-109-F10CCCACCACNONE 
006-110-C10CCCACCACNONE 
006-110-E09CCCACCACNONE 
006-114-H07CCCACCACNONE 
006-115-A06CCCACCACNONE 
006-115-A12CCCACCACNONE 
006-115-C10CCCACCACNONE 
006-115-D10CCCACCACNONE 
006-116-D02CCCACCACNONE 
006-117-C11CCCACCACNONE 
006-119-H09CCCACCACNONE 
009-008-B04CCCACCACNONE 
009-021-A04CCCACCACNONE 
009-026-H09CCCACCACNONE 
009-027-D10CCCACCACNONE 
009-030-B11CCCACCACNONE 
009-040-E08CCCACCACNONE 
009-049-E10CCCACCACNONE 
009-058-C12CCCACCACNONE 
009-061-G01CCCACCACNONE 
009-079-G09CCCACCACNONE 
009-081-F08CCCACCACNONE 
009-096-F04CCCACCACNONE 
009-103-D05CCCACCACNONE 
009-119-F08CCCACCACNONE 
009-123-B02CCCACCACNONE 
009-128-H11CCCACCACNONE 
009-131-B06CCCACCACNONE 
009-142-H06CCCACCACNONE 
009-156-C01CCCACCACNONE 
009-165-D02CCCACCACNONE 
009-168-G10CCCACCACNONE 
009-175-F03CCCACCACNONE 
009-178-E06CCCACCACNONE 
009-179-G04CCCACCACNONE 
009-181-C10CCCACCACNONE 
009-182-D09CCCACCACNONE 
009-183-D07CCCACCACNONE 
AF094775CCCACCACNONE 
AK060222CCCACCACSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK067712CCCACCACNONE 
AK067809CCCACCACNONE 
AK103921CCCACCACNONE 
AK104416CCCACCACNONE 
AK104499CCCACCACNONE 
AY445626CCCACCACNONE 
J013120H04CCCACCACNONE 
J013121A03CCCACCACNONE 
J013127D22CCCACCACNONE 
J023088A04CCCACCACNONE 
J023132O20CCCACCACNONE 
J053026I18CCCACCACNONE 
J053032G14CCCACCACNONE 
J053055E21CCCACCACNONE 
J053070F24CCCACCACNONE 
J065034E08CCCACCACNONE 
J065085O17CCCACCACNONE 
J065156H20CCCACCACNONE 
J065171C21CCCACCACNONE 
J065173A20CCCACCACNONE 
J065173C02CCCACCACNONE 
J065182N01CCCACCACNONE 
J075001K11CCCACCACNONE 
J075002K18CCCACCACNONE 
J075005P06CCCACCACNONE 
J075006P21CCCACCACNONE 
J075008G02CCCACCACNONE 
J075009D08CCCACCACNONE 
J075013D09CCCACCACNONE 
J075013D15CCCACCACNONE 
J075016F05CCCACCACNONE 
J075016F18CCCACCACNONE 
J075016K07CCCACCACNONE 
J075016M08CCCACCACNONE 
J075021G21CCCACCACNONE 
J075025G06CCCACCACNONE 
J075029M11CCCACCACNONE 
J075035E01CCCACCACNONE 
J075038M21CCCACCACNONE 
J075039G20CCCACCACNONE 
J075040K18CCCACCACNONE 
J075041G13CCCACCACNONE 
J075042O03CCCACCACNONE 
J075047C01CCCACCACNONE 
J075047M08CCCACCACNONE 
J075052L02CCCACCACNONE 
J075055E24CCCACCACNONE 
J075056F22CCCACCACNONE 
J075068B12CCCACCACNONE 
J075068D01CCCACCACNONE 
J075069H19CCCACCACNONE 
J075071J21CCCACCACNONE 
J075072O06CCCACCACNONE 
J075075J05CCCACCACNONE 
J075079E21CCCACCACNONE 
J075079H05CCCACCACNONE 
J075081L10CCCACCACNONE 
J075087D17CCCACCACNONE 
J075088B07CCCACCACNONE 
J075088D22CCCACCACNONE 
J075090E03CCCACCACNONE 
J075095L09CCCACCACNONE 
J075098G08CCCACCACNONE 
J075099M10CCCACCACNONE 
J075101D01CCCACCACNONE 
J075102H24CCCACCACNONE 
J075103A05CCCACCACNONE 
J075106A15CCCACCACNONE 
J075106L10CCCACCACNONE 
J075108H11CCCACCACNONE 
J075110D12CCCACCACNONE 
J075114A06CCCACCACNONE 
J075116G16CCCACCACNONE 
J075118B13CCCACCACNONE 
J075119C20CCCACCACNONE 
J075122F24CCCACCACNONE 
J075129D14CCCACCACNONE 
J075132L06CCCACCACNONE 
J075133E22CCCACCACNONE 
J075140L09CCCACCACNONE 
J075140L24CCCACCACNONE 
J075146J17CCCACCACNONE 
J075148A09CCCACCACNONE 
J075152D01CCCACCACNONE 
J075153L22CCCACCACNONE 
J075156B08CCCACCACNONE 
J075158D24CCCACCACNONE 
J075158H14CCCACCACNONE 
J075167M07CCCACCACNONE 
J075172F21CCCACCACNONE 
J075175J15CCCACCACNONE 
J075183C13CCCACCACNONE 
J075190A08CCCACCACNONE 
J075190E08CCCACCACNONE 
J075190H21CCCACCACNONE 
J075194C13CCCACCACNONE 
J075195E18CCCACCACNONE 
J075197H09CCCACCACNONE 
J075199J01CCCACCACNONE 
J080310L13CCCACCACNONE 
J080311F02CCCACCACNONE 
J080311H17CCCACCACNONE 
J080315M04CCCACCACNONE 
J080316A09CCCACCACNONE 
J080319D20CCCACCACNONE 
J080319L04CCCACCACNONE 
J090002C14CCCACCACNONE 
J090031P04CCCACCACNONE 
J090050E09CCCACCACNONE 
J100048H01CCCACCACNONE 
J100089C18CCCACCACNONE 
Os08g0447200AK067377GTGGTGGGCCAGSGT1 family protein. 
J013106M17GTGGTGGGCCAGNONE 
J033133D18GTGGTGGGCCAGNONE 
J033140B09GTGGTGGGCCAGNONE 
J100028I17GTGGTGGGCCAGNONE 
J100086C22GTGGTGGGCCAGNONE 
Os08g0471800AK105281GCCCACCACRemorin, C-terminal region domain containing protein. 
Os08g0474000009-121-F01CCCACCACNONE 
009-124-B06CCCACCACNONE 
AK062882CCCACCACSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0490100009-038-D02GTGGTGGGCCCCACANONE 
J065152E11GTGGTGGGCCCCACASimilar to PBF protein. 
J090050K03GTGGTGGGCCCCACANONE 
J090053L01GTGGTGGGCCCCACANONE 
Os08g0493900AK101284CCCGGCCCACCACNONE 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
Os08g0500200AK059046CCACTGACGTGGTGGGCCCCACCNONE 
AK064018CCACTGACGTGGTGGGCCCCACCConserved hypothetical protein. 
J075091E11CCACTGACGTGGTGGGCCCCACCNONE 
J090039E22CCACTGACGTGGTGGGCCCCACCNONE 
J100072K15CCACTGACGTGGTGGGCCCCACCNONE 
Os08g0512700AK060545GTGGTGGGGCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0526100011-072-E04GCCCACCACNONE 
AK100965GCCCACCACNAD-dependent epimerase/dehydratase family protein. 
J023142D13GCCCACCACNONE 
J033132L16GCCCACCACNONE 
J090006E20GCCCACCACNONE 
J100069L13GCCCACCACNONE 
Os08g0544800009-168-G01CGGGTCCCCACCACNONE 
011-046-D09CGGGTCCCCACCACNONE 
012-003-C08CGGGTCCCCACCACNONE 
012-042-B06CGGGTCCCCACCACNONE 
013-035-H12CGGGTCCCCACCACNONE 
013-072-A10CGGGTCCCCACCACNONE 
014-010-B11CGGGTCCCCACCACNONE 
014-097-E06CGGGTCCCCACCACNONE 
015-003-E12CGGGTCCCCACCACNONE 
015-040-B04CGGGTCCCCACCACNONE 
AK060536CGGGTCCCCACCACNONE 
AK102666CGGGTCCCCACCACNONE 
AK119660CGGGTCCCCACCACPCF2. 
D87261CGGGTCCCCACCACNONE 
J090049N23CGGGTCCCCACCACNONE 
J090084G06CGGGTCCCCACCACNONE 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
J013030C19CCCAGCCCACCACNONE 
J033029A20CCCAGCCCACCACNONE 
J033050L14CCCAGCCCACCACNONE 
J033058F03CCCAGCCCACCACNONE 
J033110K01CCCAGCCCACCACNONE 
J033123D21CCCAGCCCACCACNONE 
Os09g0133600006-034-E08CCCACCACNONE 
AK061477CCCACCACPAP fibrillin family protein. 
AK099394CCCACCACNONE 
AK104742CCCACCACNONE 
AY224474CCCACCACNONE 
Os09g0309500J100027L22GAGGCCCACCACConserved hypothetical protein. 
Os09g0322100AK107018TCAGCCCACCACConserved hypothetical protein. 
Os09g0324000AK107774CTCCCCCACCACSimilar to Oleosin. 
AK119722CTCCCCCACCACNONE 
J065205O11CTCCCCCACCACNONE 
J075150L22CTCCCCCACCACNONE 
Os09g0325700011-041-G03CCCACCACCTGTCNONE 
AK063334CCCACCACCTGTCSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CCCACCACCTGTCNONE 
Os09g0363900AK072899GTGGTGGGSimilar to HOTHEAD protein precursor (ADHESION OF CALYX EDGES protein). 
J013131E16GTGGTGGGNONE 
J023009K05GTGGTGGGNONE 
J023148B06GTGGTGGGNONE 
J043034N19GTGGTGGGNONE 
J065005I22GTGGTGGGNONE 
J065040G24GTGGTGGGNONE 
J090004P13GTGGTGGGNONE 
J090043P12GTGGTGGGNONE 
J090044P04GTGGTGGGNONE 
J090057N18GTGGTGGGNONE 
J090067D21GTGGTGGGNONE 
Os09g0370300AK108199AGCCCACCACSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0380400009-200-D01CCCACCACACTGACANONE 
AK063909CCCACCACACTGACANONE 
AK072517CCCACCACACTGACAConserved hypothetical protein. 
AK073073CCCACCACACTGACANONE 
J065205F20CCCACCACACTGACANONE 
J100036D22CCCACCACACTGACANONE 
J100047M01CCCACCACACTGACANONE 
J100071G04CCCACCACACTGACANONE 
Os09g0416700AK061283GTGGTGGGNONE 
AK101300GTGGTGGGVesicle transport v-SNARE family protein. 
J075138J18GTGGTGGGNONE 
Os09g0423500AK120024CCCACCACPeptidase A1, pepsin family protein. 
Os09g0444500AK059606GCCCCACCACConserved hypothetical protein. 
Os09g0445600AK107839CAGGTGGGGCCCACCACConserved hypothetical protein. 
Os09g0455200J065041I12CCCACCACWinged helix repressor DNA-binding domain containing protein. 
J065120N14CCCACCACNONE 
Os09g0457100Os09g0457100GCCCACCACCytochrome P450 family protein. 
Os09g0459900009-190-G09GCCCACCACACCGCACNONE 
AK063208GCCCACCACACCGCACCyclin-dependent kinase inhibitor family protein. 
AK111010GCCCACCACACCGCACNONE 
Os09g0461500006-107-E02AAAGCCCACCACNONE 
011-089-D02AAAGCCCACCACNONE 
AK063400AAAGCCCACCACNONE 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
J033090L22AAAGCCCACCACNONE 
J065031O14AAAGCCCACCACNONE 
J065083D22AAAGCCCACCACNONE 
J065182N14AAAGCCCACCACNONE 
J065190H22AAAGCCCACCACNONE 
J065219H11AAAGCCCACCACNONE 
J075007O22AAAGCCCACCACNONE 
J075025E09AAAGCCCACCACNONE 
J075041K24AAAGCCCACCACNONE 
J075046F11AAAGCCCACCACNONE 
J090032E12AAAGCCCACCACNONE 
Os09g0482740006-098-F12CCCACCACNONE 
AK061852CCCACCACProtein of unknown function DUF1664 family protein. 
J013032I17CCCACCACNONE 
J013119L22CCCACCACNONE 
J065114C06CCCACCACNONE 
J090059O06CCCACCACNONE 
J090062K09CCCACCACNONE 
J100031O03CCCACCACNONE 
J100038P06CCCACCACNONE 
J100051M18CCCACCACNONE 
J100075H20CCCACCACNONE 
J100077O11CCCACCACNONE 
Os09g0492700AK101104GTGGTGGGACCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
U95816GTGGTGGGACCNONE 
Os09g0497000AK099705GCCCCACCACMitochondrial substrate carrier family protein. 
Os09g0519200009-006-A07GTGGTGGGCNONE 
009-092-E11GTGGTGGGCNONE 
009-124-A12GTGGTGGGCNONE 
009-140-E10GTGGTGGGCNONE 
009-151-A11GTGGTGGGCNONE 
AK063004GTGGTGGGCConserved hypothetical protein. 
AK067759GTGGTGGGCNONE 
J080001K23GTGGTGGGCNONE 
J080005M03GTGGTGGGCNONE 
J080010I19GTGGTGGGCNONE 
J080016E11GTGGTGGGCNONE 
J080020C09GTGGTGGGCNONE 
J080021H12GTGGTGGGCNONE 
J080022D22GTGGTGGGCNONE 
J080022H06GTGGTGGGCNONE 
J080028M15GTGGTGGGCNONE 
J080032J10GTGGTGGGCNONE 
J080034F22GTGGTGGGCNONE 
J080040E05GTGGTGGGCNONE 
J080042G22GTGGTGGGCNONE 
J080042N10GTGGTGGGCNONE 
J080050H02GTGGTGGGCNONE 
J080053L12GTGGTGGGCNONE 
J080058G15GTGGTGGGCNONE 
J080062O15GTGGTGGGCNONE 
J080063B17GTGGTGGGCNONE 
J080066C10GTGGTGGGCNONE 
J080066M23GTGGTGGGCNONE 
J080067L18GTGGTGGGCNONE 
J080069F06GTGGTGGGCNONE 
J080069F08GTGGTGGGCNONE 
J080069P19GTGGTGGGCNONE 
J080077P18GTGGTGGGCNONE 
J080079E24GTGGTGGGCNONE 
J080079J12GTGGTGGGCNONE 
J080086C03GTGGTGGGCNONE 
J080089I24GTGGTGGGCNONE 
J080090I06GTGGTGGGCNONE 
J080096D06GTGGTGGGCNONE 
J080096N03GTGGTGGGCNONE 
Os09g0527700AK111128CCCACCACSimilar to Auxin-induced protein IAA4. 
J065124H12CCCACCACNONE 
J065181I07CCCACCACNONE 
J065207G14CCCACCACNONE 
Os09g0527900AK122172GCCCCACCACSimilar to Hd1-like protein. 
J033148H23GCCCCACCACNONE 
J080070L07GCCCCACCACNONE 
J090088G19GCCCCACCACNONE 
Os09g0528800AK070219GTGGTGGGGGCCGGGRabGAP/TBC domain containing protein. 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0542100AK105001GGTGGGCCCCACCGCCCACCACPeptidase A1, pepsin family protein. 
J023149B01GGTGGGCCCCACCGCCCACCACNONE 
J100043C13GGTGGGCCCCACCGCCCACCACNONE 
Os09g0542900AK073400CCCACCACConserved hypothetical protein. 
Os09g0547200016-021-H03ACTGGGCCCCGCCCACCACNONE 
AK073078ACTGGGCCCCGCCCACCACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984ACTGGGCCCCGCCCACCACNONE 
J065005L05ACTGGGCCCCGCCCACCACNONE 
J065039C06ACTGGGCCCCGCCCACCACNONE 
J065116H17ACTGGGCCCCGCCCACCACNONE 
J100046A17ACTGGGCCCCGCCCACCACNONE 
Os09g0558200016-083-C09CCCACCACNONE 
AK068834CCCACCACNONE 
AK103673CCCACCACHomeodomain-like containing protein. 
J013159M18CCCACCACNONE 
J065022I04CCCACCACNONE 
J065089B19CCCACCACNONE 
Os09g0571100AK106869CCCACCACVirulence factor, pectin lyase fold family protein. 
Os11g0126900012-037-D04CCCACCACNONE 
015-046-E12CCCACCACNONE 
015-069-A05CCCACCACNONE 
AK069257CCCACCACSimilar to NAC domain transcription factor. 
J023011O06CCCACCACNONE 
J065091E09CCCACCACNONE 
J075021C14CCCACCACNONE 
J075035D07CCCACCACNONE 
J075084B04CCCACCACNONE 
J075171O09CCCACCACNONE 
J075199M23CCCACCACNONE 
Os11g0209700012-068-H08CCACGGCCCCCACCACNONE 
015-016-B07CCACGGCCCCCACCACNONE 
AK068331CCACGGCCCCCACCACNONE 
Os11g0237700J100060P16GGATGGGCCCACCACConserved hypothetical protein. 
J100065I12GGATGGGCCCACCACNONE 
Os11g0306300006-102-D09GTGGTGGGCTGANONE 
AK109384GTGGTGGGCTGASimilar to Herbicide safener binding protein. 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
AK098929GACAGGTGGGCCCCACCACNONE 
J013026M18GACAGGTGGGCCCCACCACNONE 
J013050K16GACAGGTGGGCCCCACCACNONE 
J013156L24GACAGGTGGGCCCCACCACNONE 
J023022H22GACAGGTGGGCCCCACCACNONE 
J023065I09GACAGGTGGGCCCCACCACNONE 
J023084F23GACAGGTGGGCCCCACCACNONE 
J033111G01GACAGGTGGGCCCCACCACNONE 
J053026C09GACAGGTGGGCCCCACCACNONE 
J053027J02GACAGGTGGGCCCCACCACNONE 
J053061N23GACAGGTGGGCCCCACCACNONE 
J053086A13GACAGGTGGGCCCCACCACNONE 
J053094C15GACAGGTGGGCCCCACCACNONE 
J075094C03GACAGGTGGGCCCCACCACNONE 
J075150B17GACAGGTGGGCCCCACCACNONE 
J090097L07GACAGGTGGGCCCCACCACNONE 
J100025O15GACAGGTGGGCCCCACCACNONE 
J100077N15GACAGGTGGGCCCCACCACNONE 
Os11g0527000J065137N17GTGGTGGGCConserved hypothetical protein. 
Os11g0542100J065162B12GGGGCCCACCACZinc finger, RING-type domain containing protein. 
Os11g0543100AK108274CCCACCACConserved hypothetical protein. 
Os11g0547000AK100677GCGGGCCCCACCCCCACCACSimilar to FKF1. 
Os11g0602300AK103473ACAGCCCACCACSimilar to HVA22-like protein a (AtHVA22a). 
J033075N24ACAGCCCACCACNONE 
Os11g0606400AK066515GTGGTGGGDisease resistance protein family protein. 
AK120451GTGGTGGGNONE 
J013102N23GTGGTGGGNONE 
J065044L16GTGGTGGGNONE 
J065131E03GTGGTGGGNONE 
J065208M05GTGGTGGGNONE 
Os11g0606500AK065351CCCACCACDisease resistance protein family protein. 
Os11g0623700009-049-D06GCCCCACCACNONE 
AK063799GCCCCACCACConserved hypothetical protein. 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
AK072026GTGGTGGGCCCAGCCNONE 
Os12g0143150009-090-F09GCCCACCACUbiquitin domain containing protein. 
J013121D01GCCCACCACNONE 
J065129G09GCCCACCACNONE 
J080311D13GCCCACCACNONE 
J090014O10GCCCACCACNONE 
J090045E21GCCCACCACNONE 
J100047D12GCCCACCACNONE 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0151500AK058389GTGGGTCCCACCACSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GTGGGTCCCACCACNONE 
Os12g0224000AK060284GTGGTGGGSimilar to Diacylglycerol kinase 1 (EC 2.7.1.107) (Diglyceride kinase 1) (DGK 1) (DAG kinase 1). 
Os12g0226900AK060453GTGGTGGGCTSimilar to Allyl alcohol dehydrogenase. 
AK071631GTGGTGGGCTNONE 
AK104386GTGGTGGGCTNONE 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0235800AK071066AGCCCACCACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0460800J023003J21CCCACCACNONE 
Os12g0479400AK065254CACACACCCCCACACCCACCACCCCACACNONE 
AK067061CACACACCCCCACACCCACCACCCCACACSimilar to Auxin response factor 1. 
Os12g0488900AK068902GCCCACCACArmadillo-like helical domain containing protein. 
Os12g0527500AK109836GCGGCCCACCACCyclin-like F-box domain containing protein. 
Os12g0535900006-061-F02GTGGTGGGNONE 
AK109358GTGGTGGGNONE 
Os12g0541000J065083F23GTGGTGGGTCCLumazine-binding protein family protein. 
J100073N23GTGGTGGGTCCNONE 
Os12g0605900AK109696GCCCCACCACSimilar to Kinase like protein. 
Os12g0612400AK064919CCCACCACNONE 
AK120388CCCACCACSimilar to S-locus protein 5 (Fragment). 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0621900AK072851CCCACCACNONE 
AK102645CCCACCACNONE 
AK103987CCCACCACNONE 
Os12g0624000AK067726CCCACCACTTTGGGCTGGGNONE 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein. 
J013039E03CCCACCACTTTGGGCTGGGNONE 
J013040D22CCCACCACTTTGGGCTGGGNONE 
J013047K12CCCACCACTTTGGGCTGGGNONE 
J013056C04CCCACCACTTTGGGCTGGGNONE 
J013062K01CCCACCACTTTGGGCTGGGNONE 
J013108K09CCCACCACTTTGGGCTGGGNONE 
J013126I24CCCACCACTTTGGGCTGGGNONE 
J013128D18CCCACCACTTTGGGCTGGGNONE 
J013147D23CCCACCACTTTGGGCTGGGNONE 
J013154N13CCCACCACTTTGGGCTGGGNONE 
J023003C20CCCACCACTTTGGGCTGGGNONE 
J023003N19CCCACCACTTTGGGCTGGGNONE 
J023007B09CCCACCACTTTGGGCTGGGNONE 
J023008L12CCCACCACTTTGGGCTGGGNONE 
J023037O10CCCACCACTTTGGGCTGGGNONE 
J023044F11CCCACCACTTTGGGCTGGGNONE 
J023062H22CCCACCACTTTGGGCTGGGNONE 
J023064O07CCCACCACTTTGGGCTGGGNONE 
J023067D16CCCACCACTTTGGGCTGGGNONE 
J023082C19CCCACCACTTTGGGCTGGGNONE 
J023090A08CCCACCACTTTGGGCTGGGNONE 
J023102P21CCCACCACTTTGGGCTGGGNONE 
J023122G15CCCACCACTTTGGGCTGGGNONE 
J023123I24CCCACCACTTTGGGCTGGGNONE 
J023134N07CCCACCACTTTGGGCTGGGNONE 
J023140M21CCCACCACTTTGGGCTGGGNONE 
J033023G06CCCACCACTTTGGGCTGGGNONE 
J033025J02CCCACCACTTTGGGCTGGGNONE 
J033025L06CCCACCACTTTGGGCTGGGNONE 
J033026I21CCCACCACTTTGGGCTGGGNONE 
J033028G20CCCACCACTTTGGGCTGGGNONE 
J033028L03CCCACCACTTTGGGCTGGGNONE 
J033030P14CCCACCACTTTGGGCTGGGNONE 
J033031C02CCCACCACTTTGGGCTGGGNONE 
J033031I06CCCACCACTTTGGGCTGGGNONE 
J033037D21CCCACCACTTTGGGCTGGGNONE 
J033037M24CCCACCACTTTGGGCTGGGNONE 
J033040P06CCCACCACTTTGGGCTGGGNONE 
J033046J18CCCACCACTTTGGGCTGGGNONE 
J033048A14CCCACCACTTTGGGCTGGGNONE 
J033048B14CCCACCACTTTGGGCTGGGNONE 
J033051N03CCCACCACTTTGGGCTGGGNONE 
J033060A19CCCACCACTTTGGGCTGGGNONE 
J033060K19CCCACCACTTTGGGCTGGGNONE 
J033065O13CCCACCACTTTGGGCTGGGNONE 
J033067I23CCCACCACTTTGGGCTGGGNONE 
J033068N13CCCACCACTTTGGGCTGGGNONE 
J033070N02CCCACCACTTTGGGCTGGGNONE 
J033072K15CCCACCACTTTGGGCTGGGNONE 
J033073D09CCCACCACTTTGGGCTGGGNONE 
J033075H17CCCACCACTTTGGGCTGGGNONE 
J033076O22CCCACCACTTTGGGCTGGGNONE 
J033086K06CCCACCACTTTGGGCTGGGNONE 
J033086L03CCCACCACTTTGGGCTGGGNONE 
J033088J09CCCACCACTTTGGGCTGGGNONE 
J033091D17CCCACCACTTTGGGCTGGGNONE 
J033096B11CCCACCACTTTGGGCTGGGNONE 
J033099A05CCCACCACTTTGGGCTGGGNONE 
J033101B15CCCACCACTTTGGGCTGGGNONE 
J033101D20CCCACCACTTTGGGCTGGGNONE 
J033105D22CCCACCACTTTGGGCTGGGNONE 
J033106J20CCCACCACTTTGGGCTGGGNONE 
J033107J01CCCACCACTTTGGGCTGGGNONE 
J033111N08CCCACCACTTTGGGCTGGGNONE 
J033112B18CCCACCACTTTGGGCTGGGNONE 
J033113L04CCCACCACTTTGGGCTGGGNONE 
J033114F02CCCACCACTTTGGGCTGGGNONE 
J033118A22CCCACCACTTTGGGCTGGGNONE 
J033119J02CCCACCACTTTGGGCTGGGNONE 
J033120F22CCCACCACTTTGGGCTGGGNONE 
J033120O16CCCACCACTTTGGGCTGGGNONE 
J033127A12CCCACCACTTTGGGCTGGGNONE 
J033127J08CCCACCACTTTGGGCTGGGNONE 
J033127N13CCCACCACTTTGGGCTGGGNONE 
J033131N09CCCACCACTTTGGGCTGGGNONE 
J033135I05CCCACCACTTTGGGCTGGGNONE 
J033140D04CCCACCACTTTGGGCTGGGNONE 
J033142D04CCCACCACTTTGGGCTGGGNONE 
J033145B14CCCACCACTTTGGGCTGGGNONE 
J043007I15CCCACCACTTTGGGCTGGGNONE 
J043021N20CCCACCACTTTGGGCTGGGNONE 
J043037I05CCCACCACTTTGGGCTGGGNONE 
J065008P22CCCACCACTTTGGGCTGGGNONE 
J065038C05CCCACCACTTTGGGCTGGGNONE 
J065060A16CCCACCACTTTGGGCTGGGNONE 
J065111M10CCCACCACTTTGGGCTGGGNONE 
J065112L11CCCACCACTTTGGGCTGGGNONE 
J065114B07CCCACCACTTTGGGCTGGGNONE 
J065116M04CCCACCACTTTGGGCTGGGNONE 
J065152D15CCCACCACTTTGGGCTGGGNONE 
J065171C15CCCACCACTTTGGGCTGGGNONE 
J065173N07CCCACCACTTTGGGCTGGGNONE 
J065185N18CCCACCACTTTGGGCTGGGNONE 
J065187F09CCCACCACTTTGGGCTGGGNONE 
J065188L15CCCACCACTTTGGGCTGGGNONE 
J065190K15CCCACCACTTTGGGCTGGGNONE 
J065214C16CCCACCACTTTGGGCTGGGNONE 
J065215F05CCCACCACTTTGGGCTGGGNONE 
J075108J08CCCACCACTTTGGGCTGGGNONE 
J090002C16CCCACCACTTTGGGCTGGGNONE 
J090002K12CCCACCACTTTGGGCTGGGNONE 
J090003M10CCCACCACTTTGGGCTGGGNONE 
J090007J12CCCACCACTTTGGGCTGGGNONE 
J090010D06CCCACCACTTTGGGCTGGGNONE 
J090010F21CCCACCACTTTGGGCTGGGNONE 
J090014E20CCCACCACTTTGGGCTGGGNONE 
J090014J03CCCACCACTTTGGGCTGGGNONE 
J090017E15CCCACCACTTTGGGCTGGGNONE 
J090019J18CCCACCACTTTGGGCTGGGNONE 
J090021B21CCCACCACTTTGGGCTGGGNONE 
J090021H21CCCACCACTTTGGGCTGGGNONE 
J090021J12CCCACCACTTTGGGCTGGGNONE 
J090022K10CCCACCACTTTGGGCTGGGNONE 
J090024C24CCCACCACTTTGGGCTGGGNONE 
J090026D12CCCACCACTTTGGGCTGGGNONE 
J090034F08CCCACCACTTTGGGCTGGGNONE 
J090036H24CCCACCACTTTGGGCTGGGNONE