version

Summary of OsREG528 (All List)

OrganismOryza sativa  
IDOsREG528  
SequenceCCCACCCG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1643  

Entry Sequences (1643 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03GTGGCCCACCCGNONE 
006-049-C10GTGGCCCACCCGNONE 
006-054-E02GTGGCCCACCCGNONE 
011-035-H02GTGGCCCACCCGNONE 
011-036-E04GTGGCCCACCCGNONE 
012-047-C08GTGGCCCACCCGNONE 
012-079-F08GTGGCCCACCCGNONE 
012-097-C02GTGGCCCACCCGNONE 
012-100-A07GTGGCCCACCCGNONE 
013-015-H05GTGGCCCACCCGNONE 
013-047-A03GTGGCCCACCCGNONE 
013-051-B05GTGGCCCACCCGNONE 
013-061-G02GTGGCCCACCCGNONE 
013-077-H02GTGGCCCACCCGNONE 
015-005-D04GTGGCCCACCCGNONE 
015-064-B06GTGGCCCACCCGNONE 
015-072-D02GTGGCCCACCCGNONE 
016-073-E09GTGGCCCACCCGNONE 
016-088-H03GTGGCCCACCCGNONE 
AK062063GTGGCCCACCCGNONE 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GTGGCCCACCCGNONE 
AK119645GTGGCCCACCCGNONE 
AY341828GTGGCCCACCCGNONE 
J013036O08GTGGCCCACCCGNONE 
J013037M17GTGGCCCACCCGNONE 
J013039B11GTGGCCCACCCGNONE 
J013039L20GTGGCCCACCCGNONE 
J013047B20GTGGCCCACCCGNONE 
J013048E23GTGGCCCACCCGNONE 
J013051E12GTGGCCCACCCGNONE 
J013051F12GTGGCCCACCCGNONE 
J013056B05GTGGCCCACCCGNONE 
J013057N24GTGGCCCACCCGNONE 
J013064D21GTGGCCCACCCGNONE 
J013065G24GTGGCCCACCCGNONE 
J013075L13GTGGCCCACCCGNONE 
J013075L24GTGGCCCACCCGNONE 
J013092F04GTGGCCCACCCGNONE 
J013092F10GTGGCCCACCCGNONE 
J013092M16GTGGCCCACCCGNONE 
J013096K06GTGGCCCACCCGNONE 
J013111F10GTGGCCCACCCGNONE 
J013120B17GTGGCCCACCCGNONE 
J013120P07GTGGCCCACCCGNONE 
J013122F18GTGGCCCACCCGNONE 
J013122H23GTGGCCCACCCGNONE 
J013126I15GTGGCCCACCCGNONE 
J013126L17GTGGCCCACCCGNONE 
J013129C15GTGGCCCACCCGNONE 
J013146A04GTGGCCCACCCGNONE 
J013146A06GTGGCCCACCCGNONE 
J013153F01GTGGCCCACCCGNONE 
J013156O06GTGGCCCACCCGNONE 
J013162D05GTGGCCCACCCGNONE 
J023008N04GTGGCCCACCCGNONE 
J023010D06GTGGCCCACCCGNONE 
J023011I23GTGGCCCACCCGNONE 
J023023I15GTGGCCCACCCGNONE 
J023025C08GTGGCCCACCCGNONE 
J023029H02GTGGCCCACCCGNONE 
J023033C18GTGGCCCACCCGNONE 
J023037D21GTGGCCCACCCGNONE 
J023049F17GTGGCCCACCCGNONE 
J023052B15GTGGCCCACCCGNONE 
J023061D03GTGGCCCACCCGNONE 
J023062M01GTGGCCCACCCGNONE 
J023089D24GTGGCCCACCCGNONE 
J023109J20GTGGCCCACCCGNONE 
J023109M21GTGGCCCACCCGNONE 
J023120N04GTGGCCCACCCGNONE 
J023122A04GTGGCCCACCCGNONE 
J023134F23GTGGCCCACCCGNONE 
J023149E20GTGGCCCACCCGNONE 
J033022A12GTGGCCCACCCGNONE 
J033022C04GTGGCCCACCCGNONE 
J033024K06GTGGCCCACCCGNONE 
J033026F23GTGGCCCACCCGNONE 
J033029J19GTGGCCCACCCGNONE 
J033040H20GTGGCCCACCCGNONE 
J033042P21GTGGCCCACCCGNONE 
J033043F14GTGGCCCACCCGNONE 
J033044G11GTGGCCCACCCGNONE 
J033052L10GTGGCCCACCCGNONE 
J033052O03GTGGCCCACCCGNONE 
J033052P03GTGGCCCACCCGNONE 
J033079B20GTGGCCCACCCGNONE 
J033089D21GTGGCCCACCCGNONE 
J033094P04GTGGCCCACCCGNONE 
J033103N02GTGGCCCACCCGNONE 
J033110J19GTGGCCCACCCGNONE 
J033114E17GTGGCCCACCCGNONE 
J033115K04GTGGCCCACCCGNONE 
J033119I06GTGGCCCACCCGNONE 
J033121L10GTGGCCCACCCGNONE 
J033123H14GTGGCCCACCCGNONE 
J033136H10GTGGCCCACCCGNONE 
J033139L07GTGGCCCACCCGNONE 
J033143G23GTGGCCCACCCGNONE 
J043021F16GTGGCCCACCCGNONE 
J080304G01GTGGCCCACCCGNONE 
J080305H24GTGGCCCACCCGNONE 
J080309B11GTGGCCCACCCGNONE 
J080315N09GTGGCCCACCCGNONE 
J080319J20GTGGCCCACCCGNONE 
J090014D01GTGGCCCACCCGNONE 
J090067F08GTGGCCCACCCGNONE 
J090079P18GTGGCCCACCCGNONE 
J090082K13GTGGCCCACCCGNONE 
J090093K17GTGGCCCACCCGNONE 
J090099G18GTGGCCCACCCGNONE 
J100022K14GTGGCCCACCCGNONE 
J100052G17GTGGCCCACCCGNONE 
Os01g0139900AK121677CCCACCCGConserved hypothetical protein. 
J033069D19CCCACCCGNONE 
Os01g0146200J090080H03CCCACCCGConserved hypothetical protein. 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0244400J075054J20AGCCCACCCGCCCAAACProtein of unknown function DUF1618 domain containing protein. 
J075101O11AGCCCACCCGCCCAAACNONE 
J075123K08AGCCCACCCGCCCAAACNONE 
Os01g0295700AK070333CGGGTGGGSimilar to Protein phosphatase-2C. 
Os01g0305200009-022-C01GCTCAGCTGCCCACCCGNONE 
AK062385GCTCAGCTGCCCACCCGLg106-like family protein. 
J075005A20GCTCAGCTGCCCACCCGNONE 
J075028K05GCTCAGCTGCCCACCCGNONE 
J075060H07GCTCAGCTGCCCACCCGNONE 
J075090G07GCTCAGCTGCCCACCCGNONE 
J075117E20GCTCAGCTGCCCACCCGNONE 
J075153F17GCTCAGCTGCCCACCCGNONE 
J075179J10GCTCAGCTGCCCACCCGNONE 
J075183G15GCTCAGCTGCCCACCCGNONE 
Os01g0513400AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0589700J075063C11CCCACCCGNONE 
J075104N14CCCACCCGNONE 
J075120J05CCCACCCGNONE 
J075146O17CCCACCCGNONE 
J075149C20CCCACCCGNONE 
J090048E23CCCACCCGConserved hypothetical protein. 
J090089B22CCCACCCGNONE 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0606900AK065697CCCACCCGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0612600004-008-D07CCCACCCGNONE 
009-057-C09CCCACCCGNONE 
009-130-C01CCCACCCGNONE 
AK062906CCCACCCGNONE 
AK066561CCCACCCGProtein of unknown function DUF1644 family protein. 
J013065E14CCCACCCGNONE 
J013073D14CCCACCCGNONE 
J023014A21CCCACCCGNONE 
J023073M13CCCACCCGNONE 
J023079F02CCCACCCGNONE 
J023083B16CCCACCCGNONE 
J023090G19CCCACCCGNONE 
J023095F15CCCACCCGNONE 
J023119H11CCCACCCGNONE 
J033040B01CCCACCCGNONE 
J033044F13CCCACCCGNONE 
J033081E23CCCACCCGNONE 
J033121K07CCCACCCGNONE 
J033124D11CCCACCCGNONE 
J033131N22CCCACCCGNONE 
J065179E10CCCACCCGNONE 
J090020A13CCCACCCGNONE 
J090045K17CCCACCCGNONE 
J090047M24CCCACCCGNONE 
J090064G23CCCACCCGNONE 
J090084G08CCCACCCGNONE 
J090086F18CCCACCCGNONE 
J100032D09CCCACCCGNONE 
J100037O18CCCACCCGNONE 
J100042B03CCCACCCGNONE 
J100061D06CCCACCCGNONE 
J100061I03CCCACCCGNONE 
J100063B17CCCACCCGNONE 
Os01g0654500013-057-E05CCCACCCGNONE 
AF155333CCCACCCGNONE 
AK061752CCCACCCGSimilar to NADP-isocitrate dehydrogenase. 
D21069CCCACCCGNONE 
Os01g0672400AK060901GCCCCACCCGNONE 
AK061329GCCCCACCCGDrought induced 19 family protein. 
AK101922GCCCCACCCGNONE 
Os01g0683400AB110983CCCACCCGNONE 
AK102997CCCACCCGSimilar to Origin recognition complex 4. 
J033116E22CCCACCCGNONE 
J090087A03CCCACCCGNONE 
Os01g0695200015-090-F01CCCACCCGCGCNONE 
AK064145CCCACCCGCGCProtein of unknown function DUF266, plant family protein. 
J065163N10CCCACCCGCGCNONE 
J100051F21CCCACCCGCGCNONE 
Os01g0708700AK102451GGACCCACCCGIQ calmodulin-binding region domain containing protein. 
Os01g0723600AK109735GCCCACCCGRibose-phosphate pyrophosphokinase 3 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 3). 
Os01g0738400AK110661CCCACCCGSimilar to Zn-finger transcription factor. 
Os01g0748600AK104674CCCACCCGNONE 
Os01g0776700J065046N20CCCACCCGConserved hypothetical protein. 
J100086L02CCCACCCGNONE 
Os01g0814200AK070675CCCACCCGNONE 
AK073107CCCACCCGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19CCCACCCGNONE 
Os01g0818000AK069848GGTCCCACCCGNONE 
AK070194GGTCCCACCCGAuxin Efflux Carrier family protein. 
J023041H12GGTCCCACCCGNONE 
Os01g0830000012-056-G03GCCCACCCGCGCNONE 
015-092-H05GCCCACCCGCGCNONE 
AK121100GCCCACCCGCGCSimilar to Plastid sufB (Fragment). 
J023069G03GCCCACCCGCGCNONE 
J090047G13GCCCACCCGCGCNONE 
J090059K22GCCCACCCGCGCNONE 
Os01g0830100AK069755GCGCGGGTGGGCPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0841000009-005-A12GCCCACCCGNONE 
AK059601GCCCACCCGENTH/VHS domain containing protein. 
AK103342GCCCACCCGNONE 
J023022C02GCCCACCCGNONE 
J023030C09GCCCACCCGNONE 
J033075D24GCCCACCCGNONE 
J033123O16GCCCACCCGNONE 
J033126C16GCCCACCCGNONE 
J065120M23GCCCACCCGNONE 
J065190I23GCCCACCCGNONE 
J090090G01GCCCACCCGNONE 
Os01g0844900AK066659GGGACCCACCCGHomeodomain-like containing protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0869800006-029-F03CCCACCCGNONE 
006-067-H02CCCACCCGNONE 
006-084-A06CCCACCCGNONE 
AK058284CCCACCCGSimilar to Photosystem II subunit PsbS. 
AK071827CCCACCCGNONE 
AK104275CCCACCCGNONE 
J013049J07CCCACCCGNONE 
J033089F12CCCACCCGNONE 
J090094I11CCCACCCGNONE 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os02g0121100012-035-F06GGCCCCACCCGNONE 
013-031-H05GGCCCCACCCGNONE 
013-058-E11GGCCCCACCCGNONE 
014-010-D01GGCCCCACCCGNONE 
AK070711GGCCCCACCCGConserved hypothetical protein. 
AK119758GGCCCCACCCGNONE 
J013033G12GGCCCCACCCGNONE 
J023007M16GGCCCCACCCGNONE 
J023020K20GGCCCCACCCGNONE 
J023061H10GGCCCCACCCGNONE 
J033027H20GGCCCCACCCGNONE 
J033051E18GGCCCCACCCGNONE 
J090005F12GGCCCCACCCGNONE 
J090017A20GGCCCCACCCGNONE 
J090018G11GGCCCCACCCGNONE 
J090062C18GGCCCCACCCGNONE 
J100027N10GGCCCCACCCGNONE 
J100032L14GGCCCCACCCGNONE 
J100045C14GGCCCCACCCGNONE 
J100061M09GGCCCCACCCGNONE 
J100062K11GGCCCCACCCGNONE 
J100064H11GGCCCCACCCGNONE 
J100074H16GGCCCCACCCGNONE 
J100082N01GGCCCCACCCGNONE 
Os02g0141500AK099428CCCACCCGConserved hypothetical protein. 
J075161P05CCCACCCGNONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0153200AK111680CGGGTGGGNONE 
AY714495CGGGTGGGProtein kinase-like domain containing protein. 
J065136E09CGGGTGGGNONE 
Os02g0173100AK066680GCCCCACCCGNONE 
AK100596GCCCCACCCGSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10GCCCCACCCGNONE 
Os02g0266800AK070674CGGGTGGGCNONE 
L34551CGGGTGGGCTranscriptional activator protein. 
Os02g0302900AK110752CTCCCCCACCCGReticulon family protein. 
Os02g0445600009-183-B02CCCACCCGNONE 
AK063150CCCACCCGSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0465900006-021-E11CCCACCCGNONE 
006-033-A08CCCACCCGNONE 
006-040-B12CCCACCCGNONE 
006-051-D06CCCACCCGNONE 
006-059-G11CCCACCCGNONE 
006-066-B01CCCACCCGNONE 
006-067-H07CCCACCCGNONE 
006-073-G04CCCACCCGNONE 
006-074-C07CCCACCCGNONE 
006-084-C11CCCACCCGNONE 
006-095-B07CCCACCCGNONE 
006-100-A04CCCACCCGNONE 
012-034-E07CCCACCCGNONE 
012-036-E03CCCACCCGNONE 
012-040-C12CCCACCCGNONE 
013-080-E03CCCACCCGNONE 
015-053-G09CCCACCCGNONE 
AK071205CCCACCCGChaC-like protein family protein. 
AK104187CCCACCCGNONE 
AK104223CCCACCCGNONE 
AK104241CCCACCCGNONE 
AK104351CCCACCCGNONE 
AK104503CCCACCCGNONE 
AK104516CCCACCCGNONE 
AK119187CCCACCCGNONE 
J013045B01CCCACCCGNONE 
J013152E13CCCACCCGNONE 
J023045P04CCCACCCGNONE 
J023085D08CCCACCCGNONE 
J033072J17CCCACCCGNONE 
J033091M15CCCACCCGNONE 
J033112K18CCCACCCGNONE 
J033117D13CCCACCCGNONE 
J033132D10CCCACCCGNONE 
J065001A16CCCACCCGNONE 
J065001O09CCCACCCGNONE 
J065014D08CCCACCCGNONE 
J065014D10CCCACCCGNONE 
J065029N20CCCACCCGNONE 
J065033H15CCCACCCGNONE 
J065035F22CCCACCCGNONE 
J065055L07CCCACCCGNONE 
J065059C06CCCACCCGNONE 
J065071K08CCCACCCGNONE 
J065095C11CCCACCCGNONE 
J065104D05CCCACCCGNONE 
J065106O08CCCACCCGNONE 
J065109K19CCCACCCGNONE 
J065116M19CCCACCCGNONE 
J065120I08CCCACCCGNONE 
J065121E02CCCACCCGNONE 
J065130B04CCCACCCGNONE 
J065130J19CCCACCCGNONE 
J065152C11CCCACCCGNONE 
J065156A05CCCACCCGNONE 
J065158B09CCCACCCGNONE 
J065177K09CCCACCCGNONE 
J065189D08CCCACCCGNONE 
J065190F07CCCACCCGNONE 
J065192B08CCCACCCGNONE 
J065205K21CCCACCCGNONE 
J065212B04CCCACCCGNONE 
J065215N20CCCACCCGNONE 
J065219C13CCCACCCGNONE 
J075010F13CCCACCCGNONE 
J075019K23CCCACCCGNONE 
J075023D01CCCACCCGNONE 
J075027B08CCCACCCGNONE 
J075028M09CCCACCCGNONE 
J075033E06CCCACCCGNONE 
J075059M13CCCACCCGNONE 
J075060E22CCCACCCGNONE 
J075067M14CCCACCCGNONE 
J075068N13CCCACCCGNONE 
J075071N03CCCACCCGNONE 
J075077I07CCCACCCGNONE 
J075079B05CCCACCCGNONE 
J075089H20CCCACCCGNONE 
J075102N17CCCACCCGNONE 
J075111M15CCCACCCGNONE 
J075116A22CCCACCCGNONE 
J075118D14CCCACCCGNONE 
J075118I21CCCACCCGNONE 
J075120N07CCCACCCGNONE 
J075120P05CCCACCCGNONE 
J075136D24CCCACCCGNONE 
J075140E20CCCACCCGNONE 
J075140O14CCCACCCGNONE 
J075141L11CCCACCCGNONE 
J075149C24CCCACCCGNONE 
J075150G13CCCACCCGNONE 
J075153F09CCCACCCGNONE 
J075158M04CCCACCCGNONE 
J075168O20CCCACCCGNONE 
J075172A15CCCACCCGNONE 
J075183D08CCCACCCGNONE 
J075191B13CCCACCCGNONE 
J075195C07CCCACCCGNONE 
J080010N22CCCACCCGNONE 
J080016C04CCCACCCGNONE 
J080079O19CCCACCCGNONE 
J080086D17CCCACCCGNONE 
J080303I21CCCACCCGNONE 
J080306L05CCCACCCGNONE 
J080307D10CCCACCCGNONE 
J080307G04CCCACCCGNONE 
J080308K23CCCACCCGNONE 
J080312C13CCCACCCGNONE 
J080313O09CCCACCCGNONE 
J080315D04CCCACCCGNONE 
J080315E01CCCACCCGNONE 
J080316C06CCCACCCGNONE 
J080316N06CCCACCCGNONE 
J080317O06CCCACCCGNONE 
J080318C06CCCACCCGNONE 
J080318C18CCCACCCGNONE 
J080318J03CCCACCCGNONE 
J080319E07CCCACCCGNONE 
J090023P03CCCACCCGNONE 
J090084G14CCCACCCGNONE 
J090093J19CCCACCCGNONE 
J100030G01CCCACCCGNONE 
J100044I24CCCACCCGNONE 
J100048M18CCCACCCGNONE 
J100068K19CCCACCCGNONE 
Os02g0557200AK070026CCCACCCGSimilar to Auxin response factor 1. 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0608500AK071922GACGGCCCCACCCGNONE 
AK099756GACGGCCCCACCCGSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0627100AK068993CCCACCCGSimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5). 
D21290CCCACCCGNONE 
J023001A06CCCACCCGNONE 
J065156K20CCCACCCGNONE 
J065187O09CCCACCCGNONE 
J100036D20CCCACCCGNONE 
J100089I01CCCACCCGNONE 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0651500AK066333CGGGTGGGCTGGGNONE 
AK121865CGGGTGGGCTGGGHypothetical protein. 
J090038J11CGGGTGGGCTGGGNONE 
Os02g0693700AK103774CCCACCCGSimilar to P-glycoprotein ABCB5. 
AK106518CCCACCCGNONE 
Os02g0697700AK120209CGGGTGGGACCConserved hypothetical protein. 
J013038N05CGGGTGGGACCNONE 
J013170I01CGGGTGGGACCNONE 
J033144L08CGGGTGGGACCNONE 
J033145L08CGGGTGGGACCNONE 
J043004E24CGGGTGGGACCNONE 
J065032A08CGGGTGGGACCNONE 
J065166F03CGGGTGGGACCNONE 
J075174D13CGGGTGGGACCNONE 
J100019I19CGGGTGGGACCNONE 
J100073F13CGGGTGGGACCNONE 
Os02g0725300AK101487CGGGTGGGCellulose synthase family protein. 
AK107881CGGGTGGGNONE 
AK111344CGGGTGGGNONE 
J033042D19CGGGTGGGNONE 
Os02g0733300AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGTCCCACCCGNONE 
Os02g0744200AF247162GCCCCACCCGNONE 
AK073572GCCCCACCCGAlpha-expansin OsEXPA5. 
AK107334GCCCCACCCGNONE 
J065006L24GCCCCACCCGNONE 
J065184I10GCCCCACCCGNONE 
J065205G12GCCCCACCCGNONE 
J090051J23GCCCCACCCGNONE 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0778400AK103372CCCACCCGSimilar to UMP/CMP kinase a (EC 2.7.1.48). 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0138600Os03g0138600CGGGTGGGGCCProtein of unknown function DUF810 family protein. 
Os03g0143700AK066360GCCCCACCCGConserved hypothetical protein. 
J013066M09GCCCCACCCGNONE 
J023087N24GCCCCACCCGNONE 
Os03g0145900J013045K15CGCACGCGGGTGGGNONE 
J013051O08CGCACGCGGGTGGGNONE 
J065054C08CGCACGCGGGTGGGNONE 
J075053J16CGCACGCGGGTGGGNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0213600AK100407GGTGGGACCCACCCGConserved hypothetical protein. 
Os03g0222600J065048C01CCCACCCGNONE 
J065117L06CCCACCCGNONE 
J065183E14CCCACCCGNONE 
J075074N18CCCACCCGNONE 
J075197B12CCCACCCGNONE 
J090049N05CCCACCCGNONE 
J100029D23CCCACCCGNONE 
J100068E06CCCACCCGNONE 
Os03g0248000AK070612CCCACCCGNONE 
AK071419CCCACCCGNONE 
AK100304CCCACCCGAutophagy protein Apg9 family protein. 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CGGGTGGGCCCTNONE 
AK104877CGGGTGGGCCCTNONE 
J013026L10CGGGTGGGCCCTNONE 
J013055P12CGGGTGGGCCCTNONE 
J023091A14CGGGTGGGCCCTNONE 
J033034G07CGGGTGGGCCCTNONE 
J033048H19CGGGTGGGCCCTNONE 
J033128D07CGGGTGGGCCCTNONE 
J065060L24CGGGTGGGCCCTNONE 
J065176A19CGGGTGGGCCCTNONE 
J090018K08CGGGTGGGCCCTNONE 
J090023C03CGGGTGGGCCCTNONE 
Os03g0275500AK065232GCCCACCCGEpsin, N-terminal domain containing protein. 
J013002H14GCCCACCCGNONE 
J013047G17GCCCACCCGNONE 
J013050M23GCCCACCCGNONE 
J013066D16GCCCACCCGNONE 
J013088C16GCCCACCCGNONE 
J023026P14GCCCACCCGNONE 
J023031E04GCCCACCCGNONE 
J023045C06GCCCACCCGNONE 
J023086K13GCCCACCCGNONE 
J023119G16GCCCACCCGNONE 
J033079G11GCCCACCCGNONE 
J033090O21GCCCACCCGNONE 
J033103H08GCCCACCCGNONE 
J033103M23GCCCACCCGNONE 
J033106J17GCCCACCCGNONE 
J033141M15GCCCACCCGNONE 
J090029G22GCCCACCCGNONE 
J090032O20GCCCACCCGNONE 
J090034P11GCCCACCCGNONE 
J090087D18GCCCACCCGNONE 
J100078E18GCCCACCCGNONE 
J100081C12GCCCACCCGNONE 
Os03g0300300AK099693CGGGTGGGWD40-like domain containing protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE 
AK062803CGGGTGGGGCGTCGGATCHypothetical protein. 
AK070776CGGGTGGGGCGTCGGATCNONE 
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0340500012-007-F10CGGGTGGGNONE 
AK099406CGGGTGGGNONE 
AK102158CGGGTGGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CGGGTGGGNONE 
J013063E02CGGGTGGGNONE 
J013063I02CGGGTGGGNONE 
J013157O07CGGGTGGGNONE 
J023131N05CGGGTGGGNONE 
J033033P05CGGGTGGGNONE 
J033040N16CGGGTGGGNONE 
J033044M19CGGGTGGGNONE 
J033086F24CGGGTGGGNONE 
J033097H01CGGGTGGGNONE 
J033106C22CGGGTGGGNONE 
J033128M13CGGGTGGGNONE 
J033133I15CGGGTGGGNONE 
J043027A21CGGGTGGGNONE 
J090028A09CGGGTGGGNONE 
J090053D06CGGGTGGGNONE 
J090083O17CGGGTGGGNONE 
J090099H10CGGGTGGGNONE 
J100036M05CGGGTGGGNONE 
Os03g0373300AK107897CCCACCCGProtein of unknown function DUF1110 family protein. 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0405500AK104893CCCACCCGNONE 
Os03g0431100009-024-H08CCCACCCGNONE 
009-057-F10CCCACCCGNONE 
009-089-F05CCCACCCGNONE 
009-131-C05CCCACCCGNONE 
009-133-D11CCCACCCGNONE 
009-191-G08CCCACCCGNONE 
013-024-A03CCCACCCGNONE 
013-053-F10CCCACCCGNONE 
013-057-D04CCCACCCGNONE 
013-096-F08CCCACCCGNONE 
AK058643CCCACCCGXYPPX repeat containing protein. 
J013170C12CCCACCCGNONE 
J065013E12CCCACCCGNONE 
J065056D10CCCACCCGNONE 
J065116F03CCCACCCGNONE 
J065127J02CCCACCCGNONE 
J065210J02CCCACCCGNONE 
J075064D13CCCACCCGNONE 
J075145C05CCCACCCGNONE 
J075173H04CCCACCCGNONE 
J075197D19CCCACCCGNONE 
J075199E21CCCACCCGNONE 
J100025E11CCCACCCGNONE 
J100036J23CCCACCCGNONE 
J100042A07CCCACCCGNONE 
J100045J24CCCACCCGNONE 
J100046E08CCCACCCGNONE 
J100050E22CCCACCCGNONE 
J100070G12CCCACCCGNONE 
Os03g0439700AK065720GCCCACCCGProtein of unknown function DUF1230 family protein. 
J013041G12GCCCACCCGNONE 
J065030N09GCCCACCCGNONE 
J065084A03GCCCACCCGNONE 
J065167B14GCCCACCCGNONE 
J100025F06GCCCACCCGNONE 
J100032J16GCCCACCCGNONE 
J100040L01GCCCACCCGNONE 
J100074M13GCCCACCCGNONE 
Os03g0611200AK065587CCCACCCGCCCACCACAldo/keto reductase family protein. 
Os03g0633800AK073044GCCCCACCCGSimilar to IAA6 (Fragment). 
J065038L22GCCCCACCCGNONE 
J065185C13GCCCCACCCGNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0745000AK109590CCCACCCGNONE 
AY332465CCCACCCGNONE 
AY344486CCCACCCGNONE 
AY998118CCCACCCGWinged helix repressor DNA-binding domain containing protein. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os04g0117100009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0350000011-080-B03CGGGTGGGNONE 
AK063387CGGGTGGGNONE 
AK121263CGGGTGGGNONE 
Os04g0387600009-148-E01ATGGCCCACCCGNONE 
009-155-A11ATGGCCCACCCGNONE 
009-175-F04ATGGCCCACCCGNONE 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
J065035F12ATGGCCCACCCGNONE 
J065162C13ATGGCCCACCCGNONE 
J065169L19ATGGCCCACCCGNONE 
Os04g0412100AK108223CCCACCCGConserved hypothetical protein. 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462500006-073-E08CGGGTGGGNONE 
AK062065CGGGTGGGNONE 
AK071311CGGGTGGGSimilar to 14-3-3-like protein GF14-6. 
AK071822CGGGTGGGNONE 
AK099243CGGGTGGGNONE 
AK101938CGGGTGGGNONE 
J013056F02CGGGTGGGNONE 
J023020E08CGGGTGGGNONE 
J023085B16CGGGTGGGNONE 
J023117D08CGGGTGGGNONE 
J023133K12CGGGTGGGNONE 
J033025G04CGGGTGGGNONE 
J033052A15CGGGTGGGNONE 
J033074G16CGGGTGGGNONE 
J033090A16CGGGTGGGNONE 
J033122A07CGGGTGGGNONE 
J033133G09CGGGTGGGNONE 
J065002F16CGGGTGGGNONE 
J065030M09CGGGTGGGNONE 
J065056B11CGGGTGGGNONE 
J065115I10CGGGTGGGNONE 
J065120O09CGGGTGGGNONE 
J065124G21CGGGTGGGNONE 
J075031C14CGGGTGGGNONE 
J075040H07CGGGTGGGNONE 
J075047F04CGGGTGGGNONE 
J075065F14CGGGTGGGNONE 
J075066G20CGGGTGGGNONE 
J075105D01CGGGTGGGNONE 
J075147B04CGGGTGGGNONE 
J075149A12CGGGTGGGNONE 
J075172D07CGGGTGGGNONE 
J075190J11CGGGTGGGNONE 
J090038H18CGGGTGGGNONE 
J090087G05CGGGTGGGNONE 
J100025A10CGGGTGGGNONE 
J100025O10CGGGTGGGNONE 
J100027D02CGGGTGGGNONE 
J100027P06CGGGTGGGNONE 
J100032K04CGGGTGGGNONE 
J100056D21CGGGTGGGNONE 
J100060J08CGGGTGGGNONE 
J100063N19CGGGTGGGNONE 
J100064C14CGGGTGGGNONE 
J100064K18CGGGTGGGNONE 
J100070L21CGGGTGGGNONE 
J100072M17CGGGTGGGNONE 
J100074F21CGGGTGGGNONE 
J100087E05CGGGTGGGNONE 
U65956CGGGTGGGNONE 
Os04g0486500AK111976CCCACCCGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0489600003-130-E01CATCCCCCACCCGCGCNONE 
AK062301CATCCCCCACCCGCGCNONE 
AK068039CATCCCCCACCCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0500700AK072528CCTCGCCCCACGCGGCCCCCACCCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK072528CGGGTGGGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK104637CGGGTGGGNONE 
AK119237CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK119237CGGGTGGGNONE 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK099122GAGGCCCACCCGNONE 
Os04g0505700AK071138GCCCCCACCCGLeucine-rich repeat, cysteine-containing subtype containing protein. 
J023081C03GCCCCCACCCGNONE 
J033108O05GCCCCCACCCGNONE 
J100079D03GCCCCCACCCGNONE 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0509800AK072717GCGCGGGTGGGCConserved hypothetical protein. 
Os04g0513400012-070-C07CCCACCCGNONE 
AK066850CCCACCCGNONE 
AK068772CCCACCCGSimilar to Beta-glucosidase. 
J065054D24CCCACCCGNONE 
J065072G04CCCACCCGNONE 
J065190D11CCCACCCGNONE 
Os04g0586100009-190-F11CCCACCCGNONE 
AK063206CCCACCCGProtein of unknown function DUF581 family protein. 
Os04g0611800AY347876CCCACCCGNONE 
AY347877CCCACCCGTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
AY347878CCCACCCGNONE 
J065026D21CCCACCCGNONE 
J065065G04CCCACCCGNONE 
J065113B11CCCACCCGNONE 
J065139F13CCCACCCGNONE 
Os04g0649600009-019-A10GCCCAGTTGCCCACCCGCGCNONE 
009-059-G07GCCCAGTTGCCCACCCGCGCNONE 
009-068-D06GCCCAGTTGCCCACCCGCGCNONE 
AK105164GCCCAGTTGCCCACCCGCGCConserved hypothetical protein. 
J100056J15GCCCAGTTGCCCACCCGCGCNONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0111000AK073598CCCACCCGSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
003-016-C11GGGCCCCACCCGNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK066168GGGCCCCACCCGNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AK104336GGGCCCCACCCGSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
AY360145GGGCCCCACCCGNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013055J22GGGCCCCACCCGNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013057M24GGGCCCCACCCGNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013074N03GGGCCCCACCCGNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J013158A22GGGCCCCACCCGNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
J075118H09GGGCCCCACCCGNONE 
Os05g0164100AF456329CCCACCCGNONE 
AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AF456329CGGGTGGGGCCCACCCGNONE 
AK065086CCCACCCGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK072243CCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCACCCGNONE 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013132O12CCCACCCGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J023003N09CCCACCCGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
Os05g0386900AK071425GCTGGGCCCCACCCGNONE 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
J065182F20GCGGGCCCACCCGNONE 
Os05g0458100006-084-A05CCCACCCGNONE 
009-091-H05CCCACCCGNONE 
AJ557547CCCACCCGNONE 
AK059467CCCACCCGNONE 
AK061127CCCACCCGNONE 
AK101652CCCACCCGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06CCCACCCGNONE 
J033057B20CCCACCCGNONE 
J033087A05CCCACCCGNONE 
J043009C05CCCACCCGNONE 
J090009E10CCCACCCGNONE 
Os05g0478200J023113C02CCCACCCGNONE 
J023150G23CCCACCCGNONE 
J033101K13CCCACCCGNONE 
Os05g0486100AK119823CGGGTGGGProtein kinase-like domain containing protein. 
Os05g0490200016-097-B03CCCACCCGNONE 
AK101147CCCACCCGProtein of unknown function DUF1692 domain containing protein. 
AK105601CCCACCCGNONE 
J033026P06CCCACCCGNONE 
Os05g0491200AK068637CGGGTGGGSimilar to SNF1 kinase complex anchoring protein (Fragment). 
AK071229CGGGTGGGNONE 
Os05g0512400011-014-B07CGGGTGGGNONE 
011-014-B07GGCCCCACCCGNONE 
AK120770CGGGTGGGConserved hypothetical protein. 
AK120770GGCCCCACCCGConserved hypothetical protein. 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0566800AK065748GCCCACCCGCold acclimation protein COR413-TM1. 
AY181210GCCCACCCGNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0585900AK062575CGGGCCCACCCGMitochondrial substrate carrier family protein. 
AK098854CGGGCCCACCCGNONE 
J013000H16CGGGCCCACCCGNONE 
J033118D07CGGGCCCACCCGNONE 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0202900AK109607CCCACCCGProtein kinase-like domain containing protein. 
Os06g0286351AK121119CCCACCCGArmadillo-like helical domain containing protein. 
Os06g0334600AK064993CCCACCCGHypothetical protein. 
J013001D16CCCACCCGNONE 
J043009I09CCCACCCGNONE 
Os06g0352900AK121496CCCACCCGConserved hypothetical protein. 
J065141H07CCCACCCGNONE 
J065199A09CCCACCCGNONE 
J065213D13CCCACCCGNONE 
J100048A07CCCACCCGNONE 
J100058B02CCCACCCGNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0505700009-010-E06CCCACCCGNONE 
009-010-E06GCCCCCACCCGNONE 
AK121505CCCACCCGHypothetical protein. 
AK121505GCCCCCACCCGHypothetical protein. 
J033022N03CCCACCCGNONE 
J033022N03GCCCCCACCCGNONE 
Os06g0524900AK101846GCCCCACCCGDisease resistance protein family protein. 
AK121910GCCCCACCCGNONE 
J033069I17GCCCCACCCGNONE 
J033105O17GCCCCACCCGNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0553100J065130H10CGGGTGGGNONE 
J075102G23CGGGTGGGNONE 
J075147H23CGGGTGGGHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0558700AY785762CCCACCCGCGCSimilar to Poly(A) polymerase. 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0679500AK063283GCCCCACCCGSimilar to Avr9 elicitor response-like protein. 
AK108015GCCCCACCCGNONE 
Os06g0683600009-130-D10CCCACCCGNONE 
009-162-E11CCCACCCGNONE 
AK103599CCCACCCGConserved hypothetical protein. 
J033133F14CCCACCCGNONE 
J065041F11CCCACCCGNONE 
J065179G17CCCACCCGNONE 
Os07g0136300AK064609CGGGTGGGACCConserved hypothetical protein. 
Os07g0136500011-084-F06CGGGTGGGGCCConserved hypothetical protein. 
J065137B11CGGGTGGGGCCNONE 
J075015A10CGGGTGGGGCCNONE 
J075048L03CGGGTGGGGCCNONE 
J075051C17CGGGTGGGGCCNONE 
J075163H13CGGGTGGGGCCNONE 
Os07g0246200012-046-B07CTGGCCCACCCGCGCNONE 
012-046-B07GCCGGGCCCACCCGNONE 
AB021259CTGGCCCACCCGCGCNONE 
AB021259GCCGGGCCCACCCGNONE 
AK065341CTGGCCCACCCGCGCSimilar to Calreticulin (Fragment). 
AK065341GCCGGGCCCACCCGSimilar to Calreticulin (Fragment). 
AK099348CTGGCCCACCCGCGCNONE 
AK099348GCCGGGCCCACCCGNONE 
AK104328CTGGCCCACCCGCGCNONE 
AK104328GCCGGGCCCACCCGNONE 
AK104826CTGGCCCACCCGCGCNONE 
AK104826GCCGGGCCCACCCGNONE 
J013000E04CTGGCCCACCCGCGCNONE 
J013000E04GCCGGGCCCACCCGNONE 
J013093M19CTGGCCCACCCGCGCNONE 
J013093M19GCCGGGCCCACCCGNONE 
J013108J08CTGGCCCACCCGCGCNONE 
J013108J08GCCGGGCCCACCCGNONE 
J013118G03CTGGCCCACCCGCGCNONE 
J013118G03GCCGGGCCCACCCGNONE 
J013121I07CTGGCCCACCCGCGCNONE 
J013121I07GCCGGGCCCACCCGNONE 
J013153K07CTGGCCCACCCGCGCNONE 
J013153K07GCCGGGCCCACCCGNONE 
J023028N07CTGGCCCACCCGCGCNONE 
J023028N07GCCGGGCCCACCCGNONE 
J023034F12CTGGCCCACCCGCGCNONE 
J023034F12GCCGGGCCCACCCGNONE 
J023043J11CTGGCCCACCCGCGCNONE 
J023043J11GCCGGGCCCACCCGNONE 
J023087A03CTGGCCCACCCGCGCNONE 
J023087A03GCCGGGCCCACCCGNONE 
J023099N05CTGGCCCACCCGCGCNONE 
J023099N05GCCGGGCCCACCCGNONE 
J023105B02CTGGCCCACCCGCGCNONE 
J023105B02GCCGGGCCCACCCGNONE 
J023110H02CTGGCCCACCCGCGCNONE 
J023110H02GCCGGGCCCACCCGNONE 
J023112E15CTGGCCCACCCGCGCNONE 
J023112E15GCCGGGCCCACCCGNONE 
J023132C20CTGGCCCACCCGCGCNONE 
J023132C20GCCGGGCCCACCCGNONE 
J023134G12CTGGCCCACCCGCGCNONE 
J023134G12GCCGGGCCCACCCGNONE 
J023138O12CTGGCCCACCCGCGCNONE 
J023138O12GCCGGGCCCACCCGNONE 
J033031E05CTGGCCCACCCGCGCNONE 
J033031E05GCCGGGCCCACCCGNONE 
J033032C03CTGGCCCACCCGCGCNONE 
J033032C03GCCGGGCCCACCCGNONE 
J033039K10CTGGCCCACCCGCGCNONE 
J033039K10GCCGGGCCCACCCGNONE 
J033050P09CTGGCCCACCCGCGCNONE 
J033050P09GCCGGGCCCACCCGNONE 
J033074D03CTGGCCCACCCGCGCNONE 
J033074D03GCCGGGCCCACCCGNONE 
J033075G14CTGGCCCACCCGCGCNONE 
J033075G14GCCGGGCCCACCCGNONE 
J033075I23CTGGCCCACCCGCGCNONE 
J033075I23GCCGGGCCCACCCGNONE 
J033081H23CTGGCCCACCCGCGCNONE 
J033081H23GCCGGGCCCACCCGNONE 
J033087N08CTGGCCCACCCGCGCNONE 
J033087N08GCCGGGCCCACCCGNONE 
J033110B03CTGGCCCACCCGCGCNONE 
J033110B03GCCGGGCCCACCCGNONE 
J033148H22CTGGCCCACCCGCGCNONE 
J033148H22GCCGGGCCCACCCGNONE 
J043027F13CTGGCCCACCCGCGCNONE 
J043027F13GCCGGGCCCACCCGNONE 
J043031H01CTGGCCCACCCGCGCNONE 
J043031H01GCCGGGCCCACCCGNONE 
J080003O10CTGGCCCACCCGCGCNONE 
J080003O10GCCGGGCCCACCCGNONE 
J080022D10CTGGCCCACCCGCGCNONE 
J080022D10GCCGGGCCCACCCGNONE 
J080029I12CTGGCCCACCCGCGCNONE 
J080029I12GCCGGGCCCACCCGNONE 
J080034A09CTGGCCCACCCGCGCNONE 
J080034A09GCCGGGCCCACCCGNONE 
J080035H20CTGGCCCACCCGCGCNONE 
J080035H20GCCGGGCCCACCCGNONE 
J080049C10CTGGCCCACCCGCGCNONE 
J080049C10GCCGGGCCCACCCGNONE 
J080053G14CTGGCCCACCCGCGCNONE 
J080053G14GCCGGGCCCACCCGNONE 
J080055J22CTGGCCCACCCGCGCNONE 
J080055J22GCCGGGCCCACCCGNONE 
J080058J04CTGGCCCACCCGCGCNONE 
J080058J04GCCGGGCCCACCCGNONE 
J080069E14CTGGCCCACCCGCGCNONE 
J080069E14GCCGGGCCCACCCGNONE 
J080069M23CTGGCCCACCCGCGCNONE 
J080069M23GCCGGGCCCACCCGNONE 
J080072E19CTGGCCCACCCGCGCNONE 
J080072E19GCCGGGCCCACCCGNONE 
J080072I03CTGGCCCACCCGCGCNONE 
J080072I03GCCGGGCCCACCCGNONE 
J080075B13CTGGCCCACCCGCGCNONE 
J080075B13GCCGGGCCCACCCGNONE 
J080078I11CTGGCCCACCCGCGCNONE 
J080078I11GCCGGGCCCACCCGNONE 
J080081F16CTGGCCCACCCGCGCNONE 
J080081F16GCCGGGCCCACCCGNONE 
J080088O10CTGGCCCACCCGCGCNONE 
J080088O10GCCGGGCCCACCCGNONE 
J080089G18CTGGCCCACCCGCGCNONE 
J080089G18GCCGGGCCCACCCGNONE 
J090009C10CTGGCCCACCCGCGCNONE 
J090009C10GCCGGGCCCACCCGNONE 
J090022D23CTGGCCCACCCGCGCNONE 
J090022D23GCCGGGCCCACCCGNONE 
J090023A15CTGGCCCACCCGCGCNONE 
J090023A15GCCGGGCCCACCCGNONE 
J090024M10CTGGCCCACCCGCGCNONE 
J090024M10GCCGGGCCCACCCGNONE 
J090038F24CTGGCCCACCCGCGCNONE 
J090038F24GCCGGGCCCACCCGNONE 
J090039O13CTGGCCCACCCGCGCNONE 
J090039O13GCCGGGCCCACCCGNONE 
J090040N12CTGGCCCACCCGCGCNONE 
J090040N12GCCGGGCCCACCCGNONE 
J090054I18CTGGCCCACCCGCGCNONE 
J090054I18GCCGGGCCCACCCGNONE 
J090061C16CTGGCCCACCCGCGCNONE 
J090061C16GCCGGGCCCACCCGNONE 
J090063H23CTGGCCCACCCGCGCNONE 
J090063H23GCCGGGCCCACCCGNONE 
J090067F21CTGGCCCACCCGCGCNONE 
J090067F21GCCGGGCCCACCCGNONE 
J090075A01CTGGCCCACCCGCGCNONE 
J090075A01GCCGGGCCCACCCGNONE 
J090076K11CTGGCCCACCCGCGCNONE 
J090076K11GCCGGGCCCACCCGNONE 
J090078L11CTGGCCCACCCGCGCNONE 
J090078L11GCCGGGCCCACCCGNONE 
J090079P03CTGGCCCACCCGCGCNONE 
J090079P03GCCGGGCCCACCCGNONE 
J090087D23CTGGCCCACCCGCGCNONE 
J090087D23GCCGGGCCCACCCGNONE 
J090087G22CTGGCCCACCCGCGCNONE 
J090087G22GCCGGGCCCACCCGNONE 
J090089F03CTGGCCCACCCGCGCNONE 
J090089F03GCCGGGCCCACCCGNONE 
J090092A04CTGGCCCACCCGCGCNONE 
J090092A04GCCGGGCCCACCCGNONE 
J100024L17CTGGCCCACCCGCGCNONE 
J100024L17GCCGGGCCCACCCGNONE 
J100031P13CTGGCCCACCCGCGCNONE 
J100031P13GCCGGGCCCACCCGNONE 
J100032H05CTGGCCCACCCGCGCNONE 
J100032H05GCCGGGCCCACCCGNONE 
J100036P03CTGGCCCACCCGCGCNONE 
J100036P03GCCGGGCCCACCCGNONE 
J100038L07CTGGCCCACCCGCGCNONE 
J100038L07GCCGGGCCCACCCGNONE 
J100043I20CTGGCCCACCCGCGCNONE 
J100043I20GCCGGGCCCACCCGNONE 
J100069A21CTGGCCCACCCGCGCNONE 
J100069A21GCCGGGCCCACCCGNONE 
J100078G06CTGGCCCACCCGCGCNONE 
J100078G06GCCGGGCCCACCCGNONE 
J100081J24CTGGCCCACCCGCGCNONE 
J100081J24GCCGGGCCCACCCGNONE 
J100081N04CTGGCCCACCCGCGCNONE 
J100081N04GCCGGGCCCACCCGNONE 
J100084K16CTGGCCCACCCGCGCNONE 
J100084K16GCCGGGCCCACCCGNONE 
J100085O06CTGGCCCACCCGCGCNONE 
J100085O06GCCGGGCCCACCCGNONE 
J100088L13CTGGCCCACCCGCGCNONE 
J100088L13GCCGGGCCCACCCGNONE 
J100090O21CTGGCCCACCCGCGCNONE 
J100090O21GCCGGGCCCACCCGNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065002G18TCTCGGCCCACCCGNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0295000AK071844CGGGTGGGMitochondrial substrate carrier family protein. 
AK099295CGGGTGGGNONE 
Os07g0419500J065210A06ACCCCCCACCCGNONE 
J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0513200015-004-B02CGGGTGGGACNONE 
AK101410CGGGTGGGACNONE 
AK106227CGGGTGGGACNONE 
AK119451CGGGTGGGACProtein prenyltransferase domain containing protein. 
Os07g0531600015-098-E11GGGGCCCACCCGNONE 
AK067845GGGGCCCACCCGPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01GGGGCCCACCCGNONE 
J065008E15GGGGCCCACCCGNONE 
J065052K14GGGGCCCACCCGNONE 
J065052L13GGGGCCCACCCGNONE 
J065058M02GGGGCCCACCCGNONE 
J065069M10GGGGCCCACCCGNONE 
J065135A14GGGGCCCACCCGNONE 
J065168O18GGGGCCCACCCGNONE 
J075070D14GGGGCCCACCCGNONE 
J075169B16GGGGCCCACCCGNONE 
Os07g0545400009-136-E03CGGGTGGGGCCCACCNONE 
013-015-G08CGGGTGGGGCCCACCNONE 
AK059228CGGGTGGGGCCCACCNONE 
J065040D09CGGGTGGGGCCCACCNONE 
J065051C19CGGGTGGGGCCCACCNONE 
J065139B05CGGGTGGGGCCCACCNONE 
J065160E20CGGGTGGGGCCCACCNONE 
J065207I17CGGGTGGGGCCCACCNONE 
J080319M24CGGGTGGGGCCCACCNONE 
Os07g0563700AK121078CGGGTGGGGGATIKI3 family protein. 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
J013119M01TCGTGGGCCCCACCCGCGCNONE 
J013120B09TCGTGGGCCCCACCCGCGCNONE 
J013123G12TCGTGGGCCCCACCCGCGCNONE 
J023012C12TCGTGGGCCCCACCCGCGCNONE 
J023020G17TCGTGGGCCCCACCCGCGCNONE 
J023037E23TCGTGGGCCCCACCCGCGCNONE 
J033076I01TCGTGGGCCCCACCCGCGCNONE 
J033108A07TCGTGGGCCCCACCCGCGCNONE 
J033138J02TCGTGGGCCCCACCCGCGCNONE 
J075033L09TCGTGGGCCCCACCCGCGCNONE 
J075049E02TCGTGGGCCCCACCCGCGCNONE 
J075060N23TCGTGGGCCCCACCCGCGCNONE 
J075094H13TCGTGGGCCCCACCCGCGCNONE 
J075179L18TCGTGGGCCCCACCCGCGCNONE 
J080005P09TCGTGGGCCCCACCCGCGCNONE 
J080044J03TCGTGGGCCCCACCCGCGCNONE 
J080062G20TCGTGGGCCCCACCCGCGCNONE 
J080063L23TCGTGGGCCCCACCCGCGCNONE 
J080065B16TCGTGGGCCCCACCCGCGCNONE 
J080071K09TCGTGGGCCCCACCCGCGCNONE 
J080089C23TCGTGGGCCCCACCCGCGCNONE 
J090008P21TCGTGGGCCCCACCCGCGCNONE 
J090046B22TCGTGGGCCCCACCCGCGCNONE 
J090094C19TCGTGGGCCCCACCCGCGCNONE 
J090096B19TCGTGGGCCCCACCCGCGCNONE 
J100060G03TCGTGGGCCCCACCCGCGCNONE 
J100082D16TCGTGGGCCCCACCCGCGCNONE 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0637400AK067595CCCACCCGSimilar to Novel plant SNARE 12 (AtNPSN12). 
AY740016CCCACCCGNONE 
J013108F08CCCACCCGNONE 
J033071O11CCCACCCGNONE 
J090029K15CCCACCCGNONE 
J100039N22CCCACCCGNONE 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
Os07g0661400006-083-E05CCCGGCCCCACCACCCCACCCGNONE 
006-084-B12CCCGGCCCCACCACCCCACCCGNONE 
006-096-B03CCCGGCCCCACCACCCCACCCGNONE 
009-013-C12CCCGGCCCCACCACCCCACCCGNONE 
009-017-C10CCCGGCCCCACCACCCCACCCGNONE 
009-027-A02CCCGGCCCCACCACCCCACCCGNONE 
009-035-A06CCCGGCCCCACCACCCCACCCGNONE 
009-047-H11CCCGGCCCCACCACCCCACCCGNONE 
009-050-B11CCCGGCCCCACCACCCCACCCGNONE 
009-051-C02CCCGGCCCCACCACCCCACCCGNONE 
009-089-G06CCCGGCCCCACCACCCCACCCGNONE 
009-091-C05CCCGGCCCCACCACCCCACCCGNONE 
009-095-B11CCCGGCCCCACCACCCCACCCGNONE 
009-151-C01CCCGGCCCCACCACCCCACCCGNONE 
009-154-F06CCCGGCCCCACCACCCCACCCGNONE 
009-169-F02CCCGGCCCCACCACCCCACCCGNONE 
009-171-G01CCCGGCCCCACCACCCCACCCGNONE 
009-179-F07CCCGGCCCCACCACCCCACCCGNONE 
013-018-H06CCCGGCCCCACCACCCCACCCGNONE 
013-024-E05CCCGGCCCCACCACCCCACCCGNONE 
013-038-F09CCCGGCCCCACCACCCCACCCGNONE 
013-099-F06CCCGGCCCCACCACCCCACCCGNONE 
014-042-E09CCCGGCCCCACCACCCCACCCGNONE 
014-086-C02CCCGGCCCCACCACCCCACCCGNONE 
014-093-B08CCCGGCCCCACCACCCCACCCGNONE 
015-039-G11CCCGGCCCCACCACCCCACCCGNONE 
016-036-E05CCCGGCCCCACCACCCCACCCGNONE 
AK068814CCCGGCCCCACCACCCCACCCGNONE 
AK102682CCCGGCCCCACCACCCCACCCGNONE 
AK105973CCCGGCCCCACCACCCCACCCGNONE 
AK107202CCCGGCCCCACCACCCCACCCGConserved hypothetical protein. 
J053035N21CCCGGCCCCACCACCCCACCCGNONE 
J053099D11CCCGGCCCCACCACCCCACCCGNONE 
J065023B18CCCGGCCCCACCACCCCACCCGNONE 
J065031M15CCCGGCCCCACCACCCCACCCGNONE 
J065035G23CCCGGCCCCACCACCCCACCCGNONE 
J065060M18CCCGGCCCCACCACCCCACCCGNONE 
J065073J18CCCGGCCCCACCACCCCACCCGNONE 
J065103E20CCCGGCCCCACCACCCCACCCGNONE 
J065105N19CCCGGCCCCACCACCCCACCCGNONE 
J065137A08CCCGGCCCCACCACCCCACCCGNONE 
J065152K09CCCGGCCCCACCACCCCACCCGNONE 
J065156M12CCCGGCCCCACCACCCCACCCGNONE 
J065162G23CCCGGCCCCACCACCCCACCCGNONE 
J065162L13CCCGGCCCCACCACCCCACCCGNONE 
J065163H16CCCGGCCCCACCACCCCACCCGNONE 
J065165E06CCCGGCCCCACCACCCCACCCGNONE 
J065171J04CCCGGCCCCACCACCCCACCCGNONE 
J065180L23CCCGGCCCCACCACCCCACCCGNONE 
J065183K23CCCGGCCCCACCACCCCACCCGNONE 
J065186H13CCCGGCCCCACCACCCCACCCGNONE 
J065195D10CCCGGCCCCACCACCCCACCCGNONE 
J065209G11CCCGGCCCCACCACCCCACCCGNONE 
J075006J08CCCGGCCCCACCACCCCACCCGNONE 
J075112O07CCCGGCCCCACCACCCCACCCGNONE 
J080301H14CCCGGCCCCACCACCCCACCCGNONE 
J100058C17CCCGGCCCCACCACCCCACCCGNONE 
J100077I23CCCGGCCCCACCACCCCACCCGNONE 
J100080I24CCCGGCCCCACCACCCCACCCGNONE 
Os07g0673400009-130-B03CCCACCCGNONE 
014-016-A11CCCACCCGNONE 
AF491815CCCACCCGNONE 
AK064061CCCACCCGUniversal stress protein (Usp) family protein. 
AK073356CCCACCCGNONE 
AY224503CCCACCCGNONE 
J033028K22CCCACCCGNONE 
J065010E10CCCACCCGNONE 
Os07g0693800AK061531CGGGTGGGSimilar to Fatty acid desaturase (Fragment). 
AK098930CGGGTGGGNONE 
AY848920CGGGTGGGNONE 
Os08g0113600006-048-G08CCCACCCGNONE 
AK061571CCCACCCGConserved hypothetical protein. 
Os08g0155100AK069865CGGGTGGGGCCMajor sperm protein domain containing protein. 
AK104886CGGGTGGGGCCNONE 
J013089M01CGGGTGGGGCCNONE 
J023037M15CGGGTGGGGCCNONE 
J033068E03CGGGTGGGGCCNONE 
J090021P19CGGGTGGGGCCNONE 
Os08g0157900012-025-H08CCCACCCGNONE 
012-069-E02CCCACCCGNONE 
012-074-H11CCCACCCGNONE 
AK065294CCCACCCGSimilar to NAM protein. 
J013002N10CCCACCCGNONE 
J013042J10CCCACCCGNONE 
J023060K03CCCACCCGNONE 
J023145N12CCCACCCGNONE 
J033040L20CCCACCCGNONE 
J033044L13CCCACCCGNONE 
J033057C19CCCACCCGNONE 
J033107E01CCCACCCGNONE 
J033123M07CCCACCCGNONE 
J033136I18CCCACCCGNONE 
J065051P18CCCACCCGNONE 
J065055L08CCCACCCGNONE 
J065196D15CCCACCCGNONE 
Os08g0207500AB126089CGGGTGGGNONE 
AK105258CGGGTGGGSimilar to Zinc transporter ZIP1 (Fragment). 
Os08g0237000003-111-F01CCCACCCGNONE 
006-022-H07CCCACCCGNONE 
006-028-G01CCCACCCGNONE 
006-032-D10CCCACCCGNONE 
006-039-F08CCCACCCGNONE 
006-039-H01CCCACCCGNONE 
006-051-E01CCCACCCGNONE 
006-053-E11CCCACCCGNONE 
006-055-E09CCCACCCGNONE 
006-061-H02CCCACCCGNONE 
006-062-G07CCCACCCGNONE 
006-074-D07CCCACCCGNONE 
006-074-F11CCCACCCGNONE 
006-076-F03CCCACCCGNONE 
006-080-G01CCCACCCGNONE 
006-081-A03CCCACCCGNONE 
006-084-F05CCCACCCGNONE 
006-085-B08CCCACCCGNONE 
006-089-C03CCCACCCGNONE 
006-090-B12CCCACCCGNONE 
006-092-D04CCCACCCGNONE 
006-095-E05CCCACCCGNONE 
006-100-C12CCCACCCGNONE 
006-109-C03CCCACCCGNONE 
006-114-E09CCCACCCGNONE 
009-033-G02CCCACCCGNONE 
009-189-F09CCCACCCGNONE 
009-200-A08CCCACCCGNONE 
009-200-D07CCCACCCGNONE 
AB110604CCCACCCGXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654CCCACCCGNONE 
AK104451CCCACCCGNONE 
Os08g0299200009-120-G12AGCCCACCCGNONE 
J075096F13AGCCCACCCGAdenylate cyclase domain containing protein. 
Os08g0387500AK105106GTGGTGGGCCCCACCCGSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0504400014-015-C10CGGGTGGGCCGAGNONE 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CGGGTGGGCCGAGNONE 
J023006O19CGGGTGGGCCGAGNONE 
J033041C11CGGGTGGGCCGAGNONE 
Os08g0525000AK103220CCCACCCGRas GTPase family protein. 
J033122O18CCCACCCGNONE 
J065026M15CCCACCCGNONE 
J075007I01CCCACCCGNONE 
J075031E01CCCACCCGNONE 
J075043N14CCCACCCGNONE 
J075074O16CCCACCCGNONE 
J075092O04CCCACCCGNONE 
J075141D16CCCACCCGNONE 
J075172C22CCCACCCGNONE 
J075173A05CCCACCCGNONE 
Os08g0554900AK072840GCCCCCACCCGNonaspanin (TM9SF) family protein. 
AK099230GCCCCCACCCGNONE 
Os08g0557600AB026731CGGGTGGGNONE 
AK102459CGGGTGGGSimilar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase). 
J023088J22CGGGTGGGNONE 
J033094C01CGGGTGGGNONE 
J033125C20CGGGTGGGNONE 
J065039E01CGGGTGGGNONE 
J065212L01CGGGTGGGNONE 
J075076D03CGGGTGGGNONE 
J090019L14CGGGTGGGNONE 
J090053K23CGGGTGGGNONE 
Os08g0566900AK100851CCCACCCGMpv17/PMP22 family protein. 
J023075L09CCCACCCGNONE 
J023123J02CCCACCCGNONE 
J090048G12CCCACCCGNONE 
J100049C15CCCACCCGNONE 
Os09g0110400006-024-D01GGCCCCACCCGNONE 
006-054-H12GGCCCCACCCGNONE 
AK061402GGCCCCACCCGNONE 
AK068844GGCCCCACCCGSimilar to DNA-directed RNA polymerase II 36 kDa polypeptide A (EC 2.7.7.6) (RNA polymerase II subunit 3). 
AK103978GGCCCCACCCGNONE 
AK120034GGCCCCACCCGNONE 
AK121793GGCCCCACCCGNONE 
J023122O13GGCCCCACCCGNONE 
J033095G14GGCCCCACCCGNONE 
J043003I15GGCCCCACCCGNONE 
J065078D10GGCCCCACCCGNONE 
J065087J01GGCCCCACCCGNONE 
J065122J01GGCCCCACCCGNONE 
J065123N22GGCCCCACCCGNONE 
J065136F22GGCCCCACCCGNONE 
J065161L10GGCCCCACCCGNONE 
J065201L13GGCCCCACCCGNONE 
J075003B14GGCCCCACCCGNONE 
J075066H15GGCCCCACCCGNONE 
J075138D04GGCCCCACCCGNONE 
J075183B16GGCCCCACCCGNONE 
J090082J22GGCCCCACCCGNONE 
J100055D17GGCCCCACCCGNONE 
Os09g0309500J100027L22GGGTGGGCCCACCCGConserved hypothetical protein. 
Os09g0322000AK067346CCCACCCGSimilar to PaMst-1. 
J075056E09CCCACCCGNONE 
J100031I18CCCACCCGNONE 
J100032J07CCCACCCGNONE 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
009-192-H06CCCACCCGNONE 
009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
AK071395CCCACCCGConserved hypothetical protein. 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J013045J21CCCACCCGNONE 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J023095O09CCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
J065207K01CCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0386200J013002G14CCCACCCGNONE 
J065121C06CCCACCCGU box domain containing protein. 
J100039D18CCCACCCGNONE 
J100050A19CCCACCCGNONE 
J100075N18CCCACCCGNONE 
J100083E14CCCACCCGNONE 
J100085J24CCCACCCGNONE 
J100088B02CCCACCCGNONE 
J100090J11CCCACCCGNONE 
Os09g0434200AK062015CCCACCCGNONE 
AK103447CCCACCCGZinc finger, RING-type domain containing protein. 
Os09g0440300003-009-E04CCCACCCGNONE 
011-082-D08CCCACCCGNONE 
AF323586CCCACCCGNONE 
AK060757CCCACCCGNONE 
AK109168CCCACCCGNONE 
AK119560CCCACCCGSimilar to Aldehyde dehydrogenase family 7 member A1 (EC 1.2.1.3) (Antiquitin 1) (Matured fruit 60 kDa protein) (MF-60). 
AK120185CCCACCCGNONE 
J013034F13CCCACCCGNONE 
J013155H10CCCACCCGNONE 
J023044A13CCCACCCGNONE 
J033117D03CCCACCCGNONE 
J043024F16CCCACCCGNONE 
J065155C17CCCACCCGNONE 
J090059G03CCCACCCGNONE 
Os09g0453800AK119212GCCCACCCGNONE 
J023081A04GCCCACCCGNONE 
J065180G14GCCCACCCGNONE 
J100024A17GCCCACCCGNONE 
J100030A05GCCCACCCGNONE 
J100042I11GCCCACCCGNONE 
J100054N05GCCCACCCGNONE 
J100075G23GCCCACCCGNONE 
Os09g0453900AK107054CCCGGCCCACCCGNONE 
Os09g0455200J065041I12CCCACCCGWinged helix repressor DNA-binding domain containing protein. 
J065120N14CCCACCCGNONE 
Os09g0476100AK099938CCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0480600AK107853CCCACCCGHypothetical protein. 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0551600005-020-H08CCCACCCGNONE 
006-043-E02CCCACCCGNONE 
013-043-F03CCCACCCGNONE 
AK066658CCCACCCGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CCCACCCGNONE 
J065177J20CCCACCCGNONE 
J075041D06CCCACCCGNONE 
J075199H24CCCACCCGNONE 
J080001G07CCCACCCGNONE 
J080024A12CCCACCCGNONE 
J080025B15CCCACCCGNONE 
J090017G07CCCACCCGNONE 
J090050G23CCCACCCGNONE 
J090083G11CCCACCCGNONE 
Os11g0240600015-031-E04GGTCCCACCCGNONE 
016-077-E10GGTCCCACCCGNONE 
AK061589GGTCCCACCCGEsterase/lipase/thioesterase domain containing protein. 
AK120858GGTCCCACCCGNONE 
J075181M24GGTCCCACCCGNONE 
Os11g0473000AK060156CCCACCCGNONE 
AK065994CCCACCCGSimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759CCCACCCGNONE 
Os11g0530600AB000801CCCACCCGSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810CCCACCCGNONE 
D29697CCCACCCGNONE 
J013119K06CCCACCCGNONE 
J023001C21CCCACCCGNONE 
J023081C19CCCACCCGNONE 
J065026K21CCCACCCGNONE 
J065040A17CCCACCCGNONE 
J065043H01CCCACCCGNONE 
J065093P05CCCACCCGNONE 
J065104P15CCCACCCGNONE 
J065127C09CCCACCCGNONE 
J065140D08CCCACCCGNONE 
X89859CCCACCCGNONE 
Os11g0700900006-105-G12CCCACCCGNONE 
011-059-C05CCCACCCGNONE 
014-047-C08CCCACCCGNONE 
015-071-E10CCCACCCGNONE 
015-078-C07CCCACCCGNONE 
AB027421CCCACCCGNONE 
AB027422CCCACCCGNONE 
AB027423CCCACCCGNONE 
AK067962CCCACCCGConserved hypothetical protein. 
AK073757CCCACCCGNONE 
D55714CCCACCCGNONE 
J013092K24CCCACCCGNONE 
J013123G23CCCACCCGNONE 
J023060I09CCCACCCGNONE 
J033022P03CCCACCCGNONE 
J033024C16CCCACCCGNONE 
J033036A20CCCACCCGNONE 
J033061G03CCCACCCGNONE 
J033069C02CCCACCCGNONE 
J033086D10CCCACCCGNONE 
J033092I19CCCACCCGNONE 
J033093A11CCCACCCGNONE 
J033105L17CCCACCCGNONE 
J033116P18CCCACCCGNONE 
J033119N24CCCACCCGNONE 
J033122H07CCCACCCGNONE 
J043016K15CCCACCCGNONE 
J043026D04CCCACCCGNONE 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0285600AK069104AGTGGGCCCATCCCCCCACCCGOxysterol-binding protein family protein. 
Os12g0407300AK119778GCCCACCCGIntron maturase, type II family protein. 
Os12g0620400015-008-B10CCCACCCGNONE 
AK059006CCCACCCGNONE 
AK059973CCCACCCGNONE 
AK063843CCCACCCGMethyl-CpG binding domain containing protein. 
AK072503CCCACCCGNONE 
AK072934CCCACCCGNONE 
J023126H05CCCACCCGNONE 
J023131G11CCCACCCGNONE 
J023146E17CCCACCCGNONE 
J033064P08CCCACCCGNONE 
J033095L07CCCACCCGNONE 
J065101N06CCCACCCGNONE 
J065186F11CCCACCCGNONE 
J065215J15CCCACCCGNONE 
J080049H05CCCACCCGNONE 
J080059L05CCCACCCGNONE 
J080061M17CCCACCCGNONE 
J080063D16CCCACCCGNONE 
J090012D01CCCACCCGNONE 
J090023D20CCCACCCGNONE 
J090040A09CCCACCCGNONE 
J090044K08CCCACCCGNONE 
J100019H03CCCACCCGNONE 
J100054N04CCCACCCGNONE 
Os12g0621500AK111785GCGGGCCCACCCGSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.