version

Summary of OsREG529 (All List)

OrganismOryza sativa  
IDOsREG529  
SequenceCCCACGAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count556  

Entry Sequences (556 entries)

LocusGene modelSequenceDescription
Os01g0144100006-118-E08CCCACGAANONE 
AK058909CCCACGAASimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15). 
AK068113CCCACGAANONE 
AK104051CCCACGAANONE 
J065163E12CCCACGAANONE 
Os01g0180300AK120377TTCGTGGGLipoprotein, type 6 family protein. 
J013071N06TTCGTGGGNONE 
J023088F12TTCGTGGGNONE 
J100027H24TTCGTGGGNONE 
J100053K15TTCGTGGGNONE 
J100082M15TTCGTGGGNONE 
Os01g0281100AK109672TTCGTGGGTCCCACConserved hypothetical protein. 
J065013K07TTCGTGGGTCCCACNONE 
J065040E15TTCGTGGGTCCCACNONE 
J065127F12TTCGTGGGTCCCACNONE 
J075155K23TTCGTGGGTCCCACNONE 
Os01g0581300AK066182TTCGTGGGGCCCSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TTCGTGGGGCCCNONE 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0640800AK065688AGCCCACGAAConserved hypothetical protein 48 family protein. 
J013042L10AGCCCACGAANONE 
J013121H08AGCCCACGAANONE 
Os01g0763600AK061563CCCACGAANONE 
AK066596CCCACGAAGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15CCCACGAANONE 
J065016A16CCCACGAANONE 
J065039L06CCCACGAANONE 
J090001E03CCCACGAANONE 
J090012J18CCCACGAANONE 
J090085E15CCCACGAANONE 
Os01g0772500AK109736CTCCCCCACGAAGlycosyl transferase, family 14 protein. 
Os01g0878700012-037-H03TTCGTGGGNONE 
012-069-A11TTCGTGGGNONE 
AK065286TTCGTGGGNONE 
AK119529TTCGTGGGNONE 
AK121636TTCGTGGGAmino acid/polyamine transporter II family protein. 
J013002M14TTCGTGGGNONE 
J023060E02TTCGTGGGNONE 
J033130F17TTCGTGGGNONE 
J043022O10TTCGTGGGNONE 
J053046B11TTCGTGGGNONE 
J065099E21TTCGTGGGNONE 
J065132E13TTCGTGGGNONE 
J100055N18TTCGTGGGNONE 
Os01g0934500AK073211GAGGCCCACGAAConserved hypothetical protein. 
Os02g0138600AK071778GCCCACGAAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GCCCACGAANONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0195500AK066481GCCCACGAANONE 
AK121049GCCCACGAAProtein of unknown function DUF1680 family protein. 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0290500AK065628CCCACGAASimilar to Ubiquitin. 
J013027K22CCCACGAANONE 
J023027B07CCCACGAANONE 
J023077P07CCCACGAANONE 
J023106G17CCCACGAANONE 
J033034O13CCCACGAANONE 
J033044M18CCCACGAANONE 
J033103D02CCCACGAANONE 
J090009D03CCCACGAANONE 
Os02g0301100006-029-F04CCCCCACGAANONE 
012-005-F07CCCCCACGAANONE 
013-093-H10CCCCCACGAANONE 
015-042-B01CCCCCACGAANONE 
016-017-F09CCCCCACGAANONE 
016-079-B07CCCCCACGAANONE 
016-079-G03CCCCCACGAANONE 
016-087-F11CCCCCACGAANONE 
AK071676CCCCCACGAANONE 
AK100174CCCCCACGAAMtN3 and saliva related transmembrane protein family protein. 
AK104411CCCCCACGAANONE 
AK104467CCCCCACGAANONE 
J023069G02CCCCCACGAANONE 
J023108F17CCCCCACGAANONE 
J033042B04CCCCCACGAANONE 
J033128D06CCCCCACGAANONE 
J033138I12CCCCCACGAANONE 
J053064K16CCCCCACGAANONE 
J065088A12CCCCCACGAANONE 
J065102L08CCCCCACGAANONE 
J065104L14CCCCCACGAANONE 
J065117M20CCCCCACGAANONE 
J065117N14CCCCCACGAANONE 
J065120H23CCCCCACGAANONE 
J065135F06CCCCCACGAANONE 
J065138J17CCCCCACGAANONE 
J065138P06CCCCCACGAANONE 
J065156G16CCCCCACGAANONE 
J065163M20CCCCCACGAANONE 
J065176A14CCCCCACGAANONE 
J065182C02CCCCCACGAANONE 
J065200C05CCCCCACGAANONE 
J065213J22CCCCCACGAANONE 
J065217D24CCCCCACGAANONE 
J075009H03CCCCCACGAANONE 
J075020D10CCCCCACGAANONE 
J075026L24CCCCCACGAANONE 
J075028L01CCCCCACGAANONE 
J075057O09CCCCCACGAANONE 
J075089A20CCCCCACGAANONE 
J075094J15CCCCCACGAANONE 
J075103B11CCCCCACGAANONE 
J075143L13CCCCCACGAANONE 
J075153K15CCCCCACGAANONE 
J075161P22CCCCCACGAANONE 
J075166J06CCCCCACGAANONE 
J075177G06CCCCCACGAANONE 
J075198N06CCCCCACGAANONE 
Os02g0564400J100058K21CCCACGAASimilar to CLP protease regulatory subunit CLPX precursor. 
J100065N04CCCACGAANONE 
Os02g0586400006-066-D08CCCACGAANONE 
006-073-A01CCCACGAANONE 
J065088B17CCCACGAANONE 
J075065L07CCCACGAANONE 
J100017B20CCCACGAANONE 
J100025B03CCCACGAANONE 
Os02g0601000AK111034GCCCACGAAConserved hypothetical protein. 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0641800AK066504CCCACGAASimilar to RNA helicase (Fragment). 
AK072124CCCACGAANONE 
Os02g0681100AK100584GAAGCCCACGAAProtein of unknown function DUF604 family protein. 
J023106A15GAAGCCCACGAANONE 
Os02g0707900AK064638TTCGTGGGCNONE 
Os02g0719100AK069715GCCCCCACGAASimilar to Fimbrin/plastin-like (Fragment). 
Os02g0720900004-005-E09CCCACGAANONE 
004-013-D01CCCACGAANONE 
006-120-B01CCCACGAANONE 
AK061307CCCACGAANONE 
AK061628CCCACGAANONE 
AK099781CCCACGAAPeptidase A1, pepsin family protein. 
J013095M09CCCACGAANONE 
J100053O10CCCACGAANONE 
Os02g0740300AK067833TTCGTGGGCAAA ATPase domain containing protein. 
Os02g0795900012-075-B04GAGGCCCACGAANONE 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21GAGGCCCACGAANONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0183200AK106987GCCCACGAAConserved hypothetical protein. 
J065001J11GCCCACGAANONE 
J065013J06GCCCACGAANONE 
J065025E10GCCCACGAANONE 
J065039L04GCCCACGAANONE 
J065041H08GCCCACGAANONE 
J065046C23GCCCACGAANONE 
J065049D09GCCCACGAANONE 
J065057M12GCCCACGAANONE 
J065083P08GCCCACGAANONE 
J065096G10GCCCACGAANONE 
J065132D06GCCCACGAANONE 
J065139F18GCCCACGAANONE 
J065159E02GCCCACGAANONE 
J075161E24GCCCACGAANONE 
J075182J22GCCCACGAANONE 
J100053C12GCCCACGAANONE 
J100085D04GCCCACGAANONE 
Os03g0197400AK071413CCCACGAASimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905CCCACGAANONE 
J053023D18CCCACGAANONE 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0345100AK065579TTCGTGGGRad9 family protein. 
J100033H02TTCGTGGGNONE 
Os03g0566500AK070576GCCCACGAALupus La protein family protein. 
Os03g0586800003-114-H11TTCGTGGGCCTANONE 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TTCGTGGGCCTANONE 
J090004H06TTCGTGGGCCTANONE 
J090022N15TTCGTGGGCCTANONE 
J100035E05TTCGTGGGCCTANONE 
J100041L05TTCGTGGGCCTANONE 
J100041M18TTCGTGGGCCTANONE 
J100057P04TTCGTGGGCCTANONE 
J100089H06TTCGTGGGCCTANONE 
J100090C23TTCGTGGGCCTANONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0708800009-180-H07GCCCACGAANONE 
014-021-A05GCCCACGAANONE 
AK063141GCCCACGAANONE 
AK063654GCCCACGAAHypothetical protein. 
AK121625GCCCACGAANONE 
J065041G22GCCCACGAANONE 
J065063P10GCCCACGAANONE 
J065158O11GCCCACGAANONE 
Os03g0725300011-085-E09TAGGCCCACGAANONE 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
AK073636TAGGCCCACGAANONE 
J033050L15TAGGCCCACGAANONE 
J053082G03TAGGCCCACGAANONE 
Os03g0739700003-104-A04TTCGTGGGCTTTNONE 
AK062272TTCGTGGGCTTTUncharacterized protein UPF0114 family protein. 
Os03g0753100AB003324CCCACGAANONE 
AK100227CCCACGAATranscription factor, MADS-box domain containing protein. 
AY551917CCCACGAANONE 
AY551922CCCACGAANONE 
AY551926CCCACGAANONE 
J023012N20CCCACGAANONE 
J023048E14CCCACGAANONE 
Os03g0772800009-023-E05AAAGCCCACGAANONE 
009-059-F12AAAGCCCACGAANONE 
009-114-B08AAAGCCCACGAANONE 
009-115-G09AAAGCCCACGAANONE 
009-151-D08AAAGCCCACGAANONE 
009-158-A10AAAGCCCACGAANONE 
009-191-H02AAAGCCCACGAANONE 
009-192-E05AAAGCCCACGAANONE 
009-197-F11AAAGCCCACGAANONE 
AK059576AAAGCCCACGAANONE 
AK121608AAAGCCCACGAACytochrome c oxidase, subunit VIa family protein. 
J023087H20AAAGCCCACGAANONE 
J023105P14AAAGCCCACGAANONE 
J033026P15AAAGCCCACGAANONE 
J033042K10AAAGCCCACGAANONE 
J033133C09AAAGCCCACGAANONE 
J065123K13AAAGCCCACGAANONE 
J075190D03AAAGCCCACGAANONE 
J080310M14AAAGCCCACGAANONE 
J080317L14AAAGCCCACGAANONE 
J100067J19AAAGCCCACGAANONE 
J100079H21AAAGCCCACGAANONE 
Os03g0795800AK102207CCCACGAAProtein of unknown function UPF0005 family protein. 
J023014M02CCCACGAANONE 
J023026E12CCCACGAANONE 
J023036I07CCCACGAANONE 
J023079M08CCCACGAANONE 
J023129D24CCCACGAANONE 
J033087H03CCCACGAANONE 
J033115G02CCCACGAANONE 
J033122G06CCCACGAANONE 
J033150J15CCCACGAANONE 
J065064L16CCCACGAANONE 
J065065H20CCCACGAANONE 
J065096I18CCCACGAANONE 
J065114A10CCCACGAANONE 
J065164G10CCCACGAANONE 
J065178L20CCCACGAANONE 
J075071D20CCCACGAANONE 
Os03g0833700011-060-A10GAGGCCCACGAANONE 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os04g0110500AK073722GCCCACGAANONE 
AK103144GCCCACGAAProtein prenyltransferase domain containing protein. 
Os04g0312100AK120695CCCACGAAProtein of unknown function DUF860, plant family protein. 
Os04g0330200009-029-B01CCCACGAANONE 
009-127-D02CCCACGAANONE 
AK062413CCCACGAAJacalin-related lectin domain containing protein. 
Os04g0390500AK066575ACAGCCCACGAANONE 
AK099908ACAGCCCACGAANONE 
AK100148ACAGCCCACGAANONE 
Os04g0430200AK070740GCCCACGAAPhosphatidylinositol-specific phospholipase C, X region domain containing protein. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0552400AK069623TTCGTGGGCTGGSimilar to ZPT2-13. 
J023023M18TTCGTGGGCTGGNONE 
J023063H11TTCGTGGGCTGGNONE 
Os04g0635700009-079-G03TTCGTGGGNONE 
009-079-G03TTCGTGGGNONE 
AK062025TTCGTGGGRibbon-helix-helix domain containing protein. 
AK062025TTCGTGGGRibbon-helix-helix domain containing protein. 
AK098916TTCGTGGGNONE 
AK098916TTCGTGGGNONE 
J013002J07TTCGTGGGNONE 
J013002J07TTCGTGGGNONE 
J013109L20TTCGTGGGNONE 
J013109L20TTCGTGGGNONE 
J023055C07TTCGTGGGNONE 
J023055C07TTCGTGGGNONE 
J065036K04TTCGTGGGNONE 
J065036K04TTCGTGGGNONE 
J065164G12TTCGTGGGNONE 
J065164G12TTCGTGGGNONE 
Os04g0643100014-026-F09CCCACGAANONE 
AK067501CCCACGAASimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK106989CCCACGAANONE 
J013110H12CCCACGAANONE 
J090089E23CCCACGAANONE 
J100033G14CCCACGAANONE 
J100033L15CCCACGAANONE 
J100041J24CCCACGAANONE 
J100041M14CCCACGAANONE 
J100057A03CCCACGAANONE 
J100059C11CCCACGAANONE 
J100072B15CCCACGAANONE 
J100073N24CCCACGAANONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os04g0672100AK121689GCAGCCCACGAASimilar to Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kinase). 
J033057E18GCAGCCCACGAANONE 
J033071C20GCAGCCCACGAANONE 
J033107C06GCAGCCCACGAANONE 
J090033H05GCAGCCCACGAANONE 
J090036E04GCAGCCCACGAANONE 
J090082J15GCAGCCCACGAANONE 
Os05g0143800016-024-C02CCCACGAANONE 
AK106538CCCACGAAGH3 auxin-responsive promoter family protein. 
J043020B18CCCACGAANONE 
J100025E03CCCACGAANONE 
Os05g0187100012-066-F01CCCACGAANONE 
AK067988CCCACGAASimilar to Hexokinase. 
Os05g0237400AK072256CCCACGAANONE 
AK107045CCCACGAASimilar to Viroid symptom modulation protein. 
Os05g0364300009-036-C07TTCGTGGGCTGTNONE 
AK062440TTCGTGGGCTGTConserved hypothetical protein. 
Os05g0397300009-051-E02TTCGTGGGGCCCACGANONE 
009-060-E03TTCGTGGGGCCCACGANONE 
009-075-B01TTCGTGGGGCCCACGANONE 
009-082-B11TTCGTGGGGCCCACGANONE 
009-136-D05TTCGTGGGGCCCACGANONE 
AK062621TTCGTGGGGCCCACGANONE 
AK066003TTCGTGGGGCCCACGANONE 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
J023066C05TTCGTGGGGCCCACGANONE 
Os05g0413400AK060336TTCGTGGGACGGAACGSimilar to Isopentenyl diphosphate isomerase 1. 
AK099027TTCGTGGGACGGAACGNONE 
Os05g0490800J065037L19CCCACGAANONE 
Os05g0506000AF031609CCCACGAANONE 
AK062012CCCACGAANONE 
AK098900CCCACGAANONE 
AK122090CCCACGAASimilar to MS5-like protein (Fragment). 
J013002B13CCCACGAANONE 
J023149G13CCCACGAANONE 
J033123O20CCCACGAANONE 
J080315O17CCCACGAANONE 
Os06g0233000009-177-C07GGCCCCACGAANONE 
AK063118GGCCCCACGAAConserved hypothetical protein. 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os07g0124600AK073437CCCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24CCCCCACGAANONE 
J033136G07CCCCCACGAANONE 
J065092I12CCCCCACGAANONE 
J065132F04CCCCCACGAANONE 
J065143I11CCCCCACGAANONE 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAGGCCCACGAANONE 
J033117P16AAGGCCCACGAANONE 
Os07g0240400009-080-C04GCGGGCCCCACGAANONE 
AK062643GCGGGCCCCACGAAConserved hypothetical protein. 
Os07g0256200AK072904CCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23CCCACGAANONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0466200AK100328CCCACGAAConserved hypothetical protein. 
AK102749CCCACGAANONE 
J023002D04CCCACGAANONE 
J023080A02CCCACGAANONE 
J090069O19CCCACGAANONE 
Os07g0613300AK067398CCCACGAANONE 
AK099895CCCACGAANONE 
AK106898CCCACGAASimilar to PAUSED. 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0695100AB189039TTCGTGGGNONE 
AB189042TTCGTGGGNONE 
AK059514TTCGTGGGNONE 
AK066112TTCGTGGGCheY-like domain containing protein. 
J013051N02TTCGTGGGNONE 
J013127M02TTCGTGGGNONE 
J023007I05TTCGTGGGNONE 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0178500AK107865GCCCACGAAConserved hypothetical protein. 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
J013033H06TTCGTGGGCCGTTTNONE 
J075006G17TTCGTGGGCCGTTTNONE 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
AK065126GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
AK099206GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013001P06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013033N17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013070L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013104J15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013159L20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J033068M20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065039M22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065057C23GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065069O15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065080A01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065081F08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065117F05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065212F12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075015K06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075062J08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075063O17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075072G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098H11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098J11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098P09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075133G18GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075137G02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075169K02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080007M21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080009M17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080011J02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080012I10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080021K10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080023P13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080024C08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080025P11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080027B13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080032P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080033G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041F17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041N19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080042C20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080046J24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080047L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080049O11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080051E15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080052F01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054A08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080057G21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080059L15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080063H12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080070M24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080071D24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080077O19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078E08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078N12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080081I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080082A17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087A09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087F22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080088I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080090F19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091H16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091N06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080092H08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080097H19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302C09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080303L01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080304D07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080305G03GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080306B12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080307G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080315A14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080318H14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100029P15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100042C22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100063F24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100087P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100088A12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
Os08g0533700AK073691TTCGTGGGGGATConserved hypothetical protein. 
J033060E01TTCGTGGGGGATNONE 
J033111N06TTCGTGGGGGATNONE 
J053025N12TTCGTGGGGGATNONE 
J053080P18TTCGTGGGGGATNONE 
J053098H09TTCGTGGGGGATNONE 
J090076L19TTCGTGGGGGATNONE 
J100056A18TTCGTGGGGGATNONE 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0293900AGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0458400AK070055AGTTGGGCAGCCCACGAAConserved hypothetical protein. 
AK120321AGTTGGGCAGCCCACGAANONE 
J065064N11AGTTGGGCAGCCCACGAANONE 
J065083J06AGTTGGGCAGCCCACGAANONE 
J065121D24AGTTGGGCAGCCCACGAANONE 
J065156I22AGTTGGGCAGCCCACGAANONE 
J065163J24AGTTGGGCAGCCCACGAANONE 
J075001I02AGTTGGGCAGCCCACGAANONE 
J090088O06AGTTGGGCAGCCCACGAANONE 
Os09g0521700014-005-C08TTCGTGGGNONE 
AK063628TTCGTGGGSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507TTCGTGGGNONE 
Os09g0541900AK059017TTCGTGGGNONE 
J023024G17TTCGTGGGNONE 
J023133M02TTCGTGGGNONE 
J023145D07TTCGTGGGNONE 
J065162G13TTCGTGGGNONE 
J065165D20TTCGTGGGNONE 
J090024M05TTCGTGGGNONE 
J090045I02TTCGTGGGNONE 
J100055K23TTCGTGGGNONE 
J100082A13TTCGTGGGNONE 
Os09g0554000J065123C23AGCCCACGAASimilar to Mitochondrial phosphate transporter. 
Os11g0116300AK059463TTCGTGGGChalcone-flavanone isomerase family protein. 
J013123B20TTCGTGGGNONE 
J023013C07TTCGTGGGNONE 
J023043O08TTCGTGGGNONE 
J023050O19TTCGTGGGNONE 
J023074E18TTCGTGGGNONE 
J023084C24TTCGTGGGNONE 
J065076N12TTCGTGGGNONE 
Os11g0179000009-082-E10CCCACGAANONE 
AK062657CCCACGAAPlant disease resistance response protein family protein. 
Os11g0297300AK070171TTCGTGGGSimilar to Beta-D-xylosidase. 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0557900009-196-H11CCCACGAANONE 
AK063232CCCACGAAARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os12g0194400Os12g0194400CCCACGAAConserved hypothetical protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0221600009-043-F11TTCGTGGGNONE 
009-118-F02TTCGTGGGNONE 
AK062469TTCGTGGGHypothetical protein. 
Os12g0266000J075093G23TTCGTGGGCCCACACNONE 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0565800AK072828GGGCCCCACGAAZinc finger, TTF-type domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.