version

Summary of OsREG530 (All List)

OrganismOryza sativa  
IDOsREG530  
SequenceCCCACGCG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2509  

Entry Sequences (2509 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-030-A03GGGTGGGCCCACGCGTNONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-054-E02CGCGTGGGCCCGGANONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-036-E04CGCGTGGGCCCGGANONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-100-A07CGCGTGGGCCCGGANONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-077-H02CGCGTGGGCCCGGANONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-072-D02CGCGTGGGCCCGGANONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-088-H03CGCGTGGGCCCGGANONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
AK062063CGCGTGGGCCCGGANONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK102277GGGTGGGCCCACGCGTNONE 
AK119645CGCGTGGGCCCGGANONE 
AK119645GGGTGGGCCCACGCGTNONE 
AY341828CGCGTGGGCCCGGANONE 
AY341828GGGTGGGCCCACGCGTNONE 
J013036O08CGCGTGGGCCCGGANONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013037M17CGCGTGGGCCCGGANONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039L20CGCGTGGGCCCGGANONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013047B20CGCGTGGGCCCGGANONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013048E23CGCGTGGGCCCGGANONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051F12CGCGTGGGCCCGGANONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013056B05CGCGTGGGCCCGGANONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013057N24CGCGTGGGCCCGGANONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013064D21CGCGTGGGCCCGGANONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013065G24CGCGTGGGCCCGGANONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L24CGCGTGGGCCCGGANONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092M16CGCGTGGGCCCGGANONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013096K06CGCGTGGGCCCGGANONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013111F10CGCGTGGGCCCGGANONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120P07CGCGTGGGCCCGGANONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122H23CGCGTGGGCCCGGANONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126L17CGCGTGGGCCCGGANONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013129C15CGCGTGGGCCCGGANONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A06CGCGTGGGCCCGGANONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013153F01CGCGTGGGCCCGGANONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013156O06CGCGTGGGCCCGGANONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013162D05CGCGTGGGCCCGGANONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J023008N04CGCGTGGGCCCGGANONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023010D06CGCGTGGGCCCGGANONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023011I23CGCGTGGGCCCGGANONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023023I15CGCGTGGGCCCGGANONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023025C08CGCGTGGGCCCGGANONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023029H02CGCGTGGGCCCGGANONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023033C18CGCGTGGGCCCGGANONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023037D21CGCGTGGGCCCGGANONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023049F17CGCGTGGGCCCGGANONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023052B15CGCGTGGGCCCGGANONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023061D03CGCGTGGGCCCGGANONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023062M01CGCGTGGGCCCGGANONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023089D24CGCGTGGGCCCGGANONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109M21CGCGTGGGCCCGGANONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023120N04CGCGTGGGCCCGGANONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023122A04CGCGTGGGCCCGGANONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023134F23CGCGTGGGCCCGGANONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023149E20CGCGTGGGCCCGGANONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022C04CGCGTGGGCCCGGANONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033024K06CGCGTGGGCCCGGANONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033026F23CGCGTGGGCCCGGANONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033029J19CGCGTGGGCCCGGANONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033040H20CGCGTGGGCCCGGANONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033042P21CGCGTGGGCCCGGANONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033043F14CGCGTGGGCCCGGANONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033044G11CGCGTGGGCCCGGANONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052P03CGCGTGGGCCCGGANONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033079B20CGCGTGGGCCCGGANONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033089D21CGCGTGGGCCCGGANONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033094P04CGCGTGGGCCCGGANONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033103N02CGCGTGGGCCCGGANONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033110J19CGCGTGGGCCCGGANONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033114E17CGCGTGGGCCCGGANONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033115K04CGCGTGGGCCCGGANONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033119I06CGCGTGGGCCCGGANONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033121L10CGCGTGGGCCCGGANONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033123H14CGCGTGGGCCCGGANONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033136H10CGCGTGGGCCCGGANONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033139L07CGCGTGGGCCCGGANONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033143G23CGCGTGGGCCCGGANONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J043021F16CGCGTGGGCCCGGANONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J080304G01CGCGTGGGCCCGGANONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080305H24CGCGTGGGCCCGGANONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080309B11CGCGTGGGCCCGGANONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080315N09CGCGTGGGCCCGGANONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080319J20CGCGTGGGCCCGGANONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J090014D01CGCGTGGGCCCGGANONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090067F08CGCGTGGGCCCGGANONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090079P18CGCGTGGGCCCGGANONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090082K13CGCGTGGGCCCGGANONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090093K17CGCGTGGGCCCGGANONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090099G18CGCGTGGGCCCGGANONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J100022K14CGCGTGGGCCCGGANONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100052G17CGCGTGGGCCCGGANONE 
J100052G17GGGTGGGCCCACGCGTNONE 
Os01g0174600AK107662GCCCACGCGZinc finger, CCCH-type domain containing protein. 
Os01g0180300AK120377CGCGTGGGGGLipoprotein, type 6 family protein. 
J013071N06CGCGTGGGGGNONE 
J023088F12CGCGTGGGGGNONE 
J100027H24CGCGTGGGGGNONE 
J100053K15CGCGTGGGGGNONE 
J100082M15CGCGTGGGGGNONE 
Os01g0184800AK073377CCCACGCGPhosducin family protein. 
AK102544CCCACGCGNONE 
J023047L21CCCACGCGNONE 
J023135I09CCCACGCGNONE 
J033028G17CCCACGCGNONE 
J065164L07CCCACGCGNONE 
J065193F22CCCACGCGNONE 
J075035I10CCCACGCGNONE 
J075168H15CCCACGCGNONE 
Os01g0186900013-032-B12CGCGTGGGCCCCNONE 
013-069-C11CGCGTGGGCCCCNONE 
AK105323CGCGTGGGCCCCNONE 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK106168CGCGTGGGCCCCNONE 
J065023I10CGCGTGGGCCCCNONE 
J065182I03CGCGTGGGCCCCNONE 
J075116O22CGCGTGGGCCCCNONE 
J090082G13CGCGTGGGCCCCNONE 
J100060H12CGCGTGGGCCCCNONE 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0235700AK064943CGCGTGGGSimilar to BHLH transcription factor (Fragment). 
AK121013CGCGTGGGNONE 
J023007F05CGCGTGGGNONE 
J023044J06CGCGTGGGNONE 
J023047A22CGCGTGGGNONE 
J023047M20CGCGTGGGNONE 
J023058B22CGCGTGGGNONE 
J023126K20CGCGTGGGNONE 
J023145K20CGCGTGGGNONE 
J090039P10CGCGTGGGNONE 
Os01g0262700AK100901CGCGTGGGGCConserved hypothetical protein. 
AK119928CGCGTGGGGCNONE 
J033057O20CGCGTGGGGCNONE 
J065093J01CGCGTGGGGCNONE 
J075164F23CGCGTGGGGCNONE 
J100025E08CGCGTGGGGCNONE 
J100029L03CGCGTGGGGCNONE 
J100079F02CGCGTGGGGCNONE 
Os01g0332200J075075C23CCCACGCGConserved hypothetical protein. 
Os01g0391100AK108533CGCGTGGGACCCACCTGNONE 
AK121200CGCGTGGGACCCACCTGSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11CGCGTGGGACCCACCTGNONE 
J023087I02CGCGTGGGACCCACCTGNONE 
J065099C01CGCGTGGGACCCACCTGNONE 
Os01g0558700Os01g0558700CCCACGCGGCCACACGCACGCGConserved hypothetical protein. 
Os01g0631800AK069421CGCGTGGGCConserved hypothetical protein. 
J065017G23CGCGTGGGCNONE 
J065198M01CGCGTGGGCNONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0635400AK102655CCCACGCGSimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
AK111923CCCACGCGNONE 
Os01g0651100AK119380CCCACGCGCCCATCGCCCACCACProtein prenyltransferase domain containing protein. 
Os01g0672400AK060901CCCACGCGNONE 
AK061329CCCACGCGDrought induced 19 family protein. 
AK101922CCCACGCGNONE 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
J065039K13AAGGCCCACGCGNONE 
J065042K22AAGGCCCACGCGNONE 
J080016E23AAGGCCCACGCGNONE 
J080064E22AAGGCCCACGCGNONE 
Os01g0698300AK100582CCCACGCGCCCAGCCGCCCACGCZinc finger, BED-type predicted domain containing protein. 
J023105O09CCCACGCGCCCAGCCGCCCACGCNONE 
J023119F15CCCACGCGCCCAGCCGCCCACGCNONE 
J075007N19CCCACGCGCCCAGCCGCCCACGCNONE 
J075010F10CCCACGCGCCCAGCCGCCCACGCNONE 
J075032M22CCCACGCGCCCAGCCGCCCACGCNONE 
J075038E01CCCACGCGCCCAGCCGCCCACGCNONE 
J075064J17CCCACGCGCCCAGCCGCCCACGCNONE 
J075109L20CCCACGCGCCCAGCCGCCCACGCNONE 
J075131O16CCCACGCGCCCAGCCGCCCACGCNONE 
J075176A17CCCACGCGCCCAGCCGCCCACGCNONE 
J075178N11CCCACGCGCCCAGCCGCCCACGCNONE 
J075181N15CCCACGCGCCCAGCCGCCCACGCNONE 
J090060I06CCCACGCGCCCAGCCGCCCACGCNONE 
J090097O21CCCACGCGCCCAGCCGCCCACGCNONE 
Os01g0705800AK106968GCCCCACGCGConserved hypothetical protein. 
Os01g0706400AK065826CCCACGCGNONE 
AK066981CCCACGCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK068355CCCACGCGNONE 
J013036F01CCCACGCGNONE 
J013049K18CCCACGCGNONE 
J013092D23CCCACGCGNONE 
J013100B17CCCACGCGNONE 
J033096D22CCCACGCGNONE 
J033108P15CCCACGCGNONE 
J033119E24CCCACGCGNONE 
J075169P09CCCACGCGNONE 
Os01g0716800AK101741CCCACGCGEndonuclease/exonuclease/phosphatase domain containing protein. 
AK101771CCCACGCGNONE 
Os01g0720700J033124M22GCCCACGCGTCCNONE 
J065006G21GCCCACGCGTCCNONE 
J065025M24GCCCACGCGTCCNONE 
J065041J02GCCCACGCGTCCNONE 
J065044B14GCCCACGCGTCCNONE 
J065061J06GCCCACGCGTCCNONE 
J065116L21GCCCACGCGTCCNONE 
J075030F18GCCCACGCGTCCNONE 
J075034K17GCCCACGCGTCCNONE 
J075063I02GCCCACGCGTCCNONE 
J075110D21GCCCACGCGTCCSimilar to Serine acetyltransferase. 
J075188L15GCCCACGCGTCCNONE 
J075197B17GCCCACGCGTCCNONE 
Os01g0727100AK068181CCCACACGCCCACGCGGlycosyl transferase, family 8 protein. 
AK105758CCCACACGCCCACGCGNONE 
J013126C21CCCACACGCCCACGCGNONE 
J023049F24CCCACACGCCCACGCGNONE 
J033140G15CCCACACGCCCACGCGNONE 
Os01g0761100AK122112CCCACGCGTTesmin/TSO1-like, CXC domain containing protein. 
Os01g0766200AK069471CCCACGCGZinc finger, RING-type domain containing protein. 
AK070278CCCACGCGNONE 
J013074F08CCCACGCGNONE 
J023023M16CCCACGCGNONE 
J023049F08CCCACGCGNONE 
J065061D21CCCACGCGNONE 
J100083B13CCCACGCGNONE 
Os01g0780900J033069J11CGCGTGGGNONE 
J065054P18CGCGTGGGNONE 
J065163O05CGCGTGGGNONE 
J065165B05CGCGTGGGNONE 
J075097O22CGCGTGGGNONE 
J080029E07CGCGTGGGNONE 
J080093M08CGCGTGGGNONE 
J100025J07CGCGTGGGNONE 
J100029N22CGCGTGGGNONE 
J100041C23CGCGTGGGConserved hypothetical protein. 
J100041M22CGCGTGGGNONE 
J100058D11CGCGTGGGNONE 
J100064E15CGCGTGGGNONE 
J100066M09CGCGTGGGNONE 
J100067H14CGCGTGGGNONE 
Os01g0785900AK071014CCCACGCGZinc finger, C2H2-type domain containing protein. 
AK104311CCCACGCGNONE 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0812600Os01g0812600CCCACGCGNSF attachment protein family protein. 
Os01g0816700AK100654CCCACGCGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0825800AK102220CCCACGCGAmino acid/polyamine transporter II family protein. 
Os01g0835700AK109941CGCGTGGGCCT domain containing protein. 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0867600AK102226CCCACGCGSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0885600AK059523GCCCCCACGCGTEsterase/lipase/thioesterase domain containing protein. 
J065013G01GCCCCCACGCGTNONE 
J065063D03GCCCCCACGCGTNONE 
J065143H01GCCCCCACGCGTNONE 
J065146F08GCCCCCACGCGTNONE 
J065153D14GCCCCCACGCGTNONE 
J065170E02GCCCCCACGCGTNONE 
J065175M22GCCCCCACGCGTNONE 
J065186E13GCCCCCACGCGTNONE 
J075023J16GCCCCCACGCGTNONE 
J075176J06GCCCCCACGCGTNONE 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TAGGCCCACGCGNONE 
J090056H03TAGGCCCACGCGNONE 
J090058L14TAGGCCCACGCGNONE 
J090058P16TAGGCCCACGCGNONE 
J090076C19TAGGCCCACGCGNONE 
J100086P14TAGGCCCACGCGNONE 
Os02g0119700AK108777CCCACGCGProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0125300006-047-E06GCCCCCACGCGCGGGTNONE 
006-088-F09GCCCCCACGCGCGGGTNONE 
006-106-F10GCCCCCACGCGCGGGTNONE 
AB025926GCCCCCACGCGCGGGTNONE 
AK061564GCCCCCACGCGCGGGTNONE 
AK061953GCCCCCACGCGCGGGTNONE 
AK101060GCCCCCACGCGCGGGTBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21GCCCCCACGCGCGGGTNONE 
J023097A08GCCCCCACGCGCGGGTNONE 
J023133F03GCCCCCACGCGCGGGTNONE 
J033022C21GCCCCCACGCGCGGGTNONE 
J033073C21GCCCCCACGCGCGGGTNONE 
J033116O09GCCCCCACGCGCGGGTNONE 
J033120E01GCCCCCACGCGCGGGTNONE 
J065088M19GCCCCCACGCGCGGGTNONE 
J065135O04GCCCCCACGCGCGGGTNONE 
J080304J03GCCCCCACGCGCGGGTNONE 
J090001K14GCCCCCACGCGCGGGTNONE 
J090038D04GCCCCCACGCGCGGGTNONE 
J090045G09GCCCCCACGCGCGGGTNONE 
J090076E12GCCCCCACGCGCGGGTNONE 
J090077D21GCCCCCACGCGCGGGTNONE 
J100018J19GCCCCCACGCGCGGGTNONE 
J100029M12GCCCCCACGCGCGGGTNONE 
J100049D07GCCCCCACGCGCGGGTNONE 
J100067G21GCCCCCACGCGCGGGTNONE 
J100090D05GCCCCCACGCGCGGGTNONE 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0193900AK069578CGCGTGGGGGAGConserved hypothetical protein. 
AK104014CGCGTGGGGGAGNONE 
J080308C08CGCGTGGGGGAGNONE 
J090043C09CGCGTGGGGGAGNONE 
Os02g0234300003-129-C12CGCGTGGGCNONE 
AK062592CGCGTGGGCU box domain containing protein. 
Os02g0266200AK099647TAGGCCCACGCGNONE 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0288200AK073147CCCGGCCCCACGCGTNONE 
AK102886CCCGGCCCCACGCGTConserved hypothetical protein. 
Os02g0462800AK110587CCCCCACGCGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CCCCCACGCGNONE 
Os02g0471500AK120615CCCACGCGNONE 
AK120927CCCACGCGProtein phosphatase 2C-like domain containing protein. 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0574600AK059246CCCACGCGConserved hypothetical protein. 
Os02g0595800Os02g0595800CCCACGCGSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0638650J090094O16CGCGTGGGTCCCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os02g0646200009-031-C03CCCACGCGNONE 
AK071507CCCACGCGZinc finger, B-box domain containing protein. 
J023090D24CCCACGCGNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0653800J023002B17CCCACGCGNONE 
J033067E03CCCACGCGSimilar to GTP-binding protein. 
J033105M04CCCACGCGNONE 
J053039E15CCCACGCGNONE 
J065026L07CCCACGCGNONE 
J065038B03CCCACGCGNONE 
J065087J15CCCACGCGNONE 
J065121B22CCCACGCGNONE 
J065128N12CCCACGCGNONE 
J065189E19CCCACGCGNONE 
J100058B03CCCACGCGNONE 
Os02g0668500006-056-A05GCCCACGCGTCCNONE 
AK060958GCCCACGCGTCCNONE 
AK071867GCCCACGCGTCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15GCCCACGCGTCCNONE 
J065013J03GCCCACGCGTCCNONE 
J065021P16GCCCACGCGTCCNONE 
J065044B07GCCCACGCGTCCNONE 
J065059E23GCCCACGCGTCCNONE 
J065087N20GCCCACGCGTCCNONE 
J065185I04GCCCACGCGTCCNONE 
J065190G19GCCCACGCGTCCNONE 
J065199C15GCCCACGCGTCCNONE 
J065213L12GCCCACGCGTCCNONE 
J080305C01GCCCACGCGTCCNONE 
J080308C07GCCCACGCGTCCNONE 
J080310F02GCCCACGCGTCCNONE 
Os02g0669100012-068-E10GCCCCACGCGNONE 
016-075-F09GCCCCACGCGNONE 
AB011367GCCCCACGCGNONE 
AK070197GCCCCACGCGNONE 
AY587109GCCCCACGCGDehydrin family protein. 
AY786415GCCCCACGCGNONE 
J023042N13GCCCCACGCGNONE 
J023128F01GCCCCACGCGNONE 
J065002K05GCCCCACGCGNONE 
J090057I09GCCCCACGCGNONE 
J090067J23GCCCCACGCGNONE 
J090071B04GCCCCACGCGNONE 
J100018L23GCCCCACGCGNONE 
J100036A11GCCCCACGCGNONE 
J100063L18GCCCCACGCGNONE 
J100071G02GCCCCACGCGNONE 
J100084P19GCCCCACGCGNONE 
Os02g0670400009-189-H11CCCACGCGTCGCNONE 
AB079636CCCACGCGTCGCSimilar to HMGc1 protein. 
J090001B08CCCACGCGTCGCNONE 
Os02g0681200006-024-F11CCCACGCGNONE 
006-051-H06CCCACGCGNONE 
006-062-F08CCCACGCGNONE 
009-172-G01CCCACGCGNONE 
AK071853CCCACGCGZinc finger, RING-type domain containing protein. 
AK099314CCCACGCGNONE 
AK104122CCCACGCGNONE 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0730300AK098897ACCCCCCACGCGTCCNONE 
AK111629ACCCCCCACGCGTCCSimilar to Potassium transporter HAK3p (Fragment). 
Os02g0780500AK072784CCCACGCGNONE 
AK121143CCCACGCGConserved hypothetical protein. 
J023075M13CCCACGCGNONE 
J023077P14CCCACGCGNONE 
J023123C16CCCACGCGNONE 
J023142P06CCCACGCGNONE 
Os02g0788800AK066747GCCCACGCGCCCCCACAmino acid/polyamine transporter II family protein. 
Os02g0826200AK070787CGCGTGGGdTDP-4-dehydrorhamnose reductase family protein. 
J075022D14CGCGTGGGNONE 
Os03g0114100AK108265CCCACGCGConserved hypothetical protein. 
Os03g0116800012-097-D10CCCACGCGACGCGACNONE 
016-024-H10CCCACGCGACGCGACNONE 
AK066955CCCACGCGACGCGACConserved hypothetical protein. 
AK068678CCCACGCGACGCGACNONE 
AK104839CCCACGCGACGCGACNONE 
J013033G16CCCACGCGACGCGACNONE 
J013091C10CCCACGCGACGCGACNONE 
J013158H22CCCACGCGACGCGACNONE 
J023106K11CCCACGCGACGCGACNONE 
J065051O15CCCACGCGACGCGACNONE 
J065129G22CCCACGCGACGCGACNONE 
J075001K02CCCACGCGACGCGACNONE 
J075011O03CCCACGCGACGCGACNONE 
J075024K04CCCACGCGACGCGACNONE 
J075026E07CCCACGCGACGCGACNONE 
J075037O14CCCACGCGACGCGACNONE 
J075071D17CCCACGCGACGCGACNONE 
J075084M05CCCACGCGACGCGACNONE 
J075114B06CCCACGCGACGCGACNONE 
J075128C23CCCACGCGACGCGACNONE 
J075153A13CCCACGCGACGCGACNONE 
J075158A15CCCACGCGACGCGACNONE 
J075165P09CCCACGCGACGCGACNONE 
J075167M21CCCACGCGACGCGACNONE 
J075170F11CCCACGCGACGCGACNONE 
J075186F12CCCACGCGACGCGACNONE 
J075186L13CCCACGCGACGCGACNONE 
J075189A01CCCACGCGACGCGACNONE 
J075192D19CCCACGCGACGCGACNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0126800J075039C05CCCACGCGNONE 
J075172P07CCCACGCGNONE 
J075176L13CCCACGCGNONE 
J075180L10CCCACGCGNONE 
J090019H18CCCACGCGNONE 
J090024P22CCCACGCGNONE 
Os03g0127600AK103695CCCCCACGCGSMAD/FHA domain containing protein. 
J033136J18CCCCCACGCGNONE 
J075046D02CCCCCACGCGNONE 
J075093K04CCCCCACGCGNONE 
J075116M01CCCCCACGCGNONE 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0148400AK072852CCCACGCGProtein of unknown function DUF740 family protein. 
J023138H13CCCACGCGNONE 
Os03g0151800AK064955CGCGTGGGCCACNONE 
AK098874CGCGTGGGCCACNONE 
AK098980CGCGTGGGCCACNONE 
AK099712CGCGTGGGCCACNONE 
AK099889CGCGTGGGCCACNONE 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGCGTGGGCCACNONE 
J013001D04CGCGTGGGCCACNONE 
J013121O12CGCGTGGGCCACNONE 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0228900J065037A17GCCCCCACGCGNONE 
J065053L23GCCCCCACGCGNONE 
J065061G13GCCCCCACGCGNONE 
J065100L21GCCCCCACGCGNONE 
J065101C08GCCCCCACGCGNONE 
J065112B13GCCCCCACGCGHypothetical protein. 
J065114G11GCCCCCACGCGNONE 
J065122L03GCCCCCACGCGNONE 
J065127B04GCCCCCACGCGNONE 
Os03g0248000AK070612GCCCACGCGNONE 
AK071419GCCCACGCGNONE 
AK100304GCCCACGCGAutophagy protein Apg9 family protein. 
Os03g0299900AK069075CGCGTGGGCTGCSimilar to Plastid aminotransferase (Fragment). 
AY338235CGCGTGGGCTGCNONE 
J053077F07CGCGTGGGCTGCNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0320500AK108145CCCACGCGVQ domain containing protein. 
J065122I01CCCACGCGNONE 
J100057H12CCCACGCGNONE 
J100078A15CCCACGCGNONE 
Os03g0397400AB112772CCCACGCGTNONE 
AK069928CCCACGCGTSimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CCCACGCGTNONE 
J023036P06CCCACGCGTNONE 
J023145E24CCCACGCGTNONE 
J033142I11CCCACGCGTNONE 
J043003A10CCCACGCGTNONE 
J075023H21CCCACGCGTNONE 
J075145O10CCCACGCGTNONE 
J075149A03CCCACGCGTNONE 
J090099B09CCCACGCGTNONE 
J100017L14CCCACGCGTNONE 
J100050K18CCCACGCGTNONE 
J100063P16CCCACGCGTNONE 
Os03g0439500006-053-C08CGCGTGGGNONE 
006-053-G06CGCGTGGGNONE 
AK060946CGCGTGGGNONE 
AK067507CGCGTGGG2OG-Fe(II) oxygenase domain containing protein. 
AK067647CGCGTGGGNONE 
AK104779CGCGTGGGNONE 
AK119216CGCGTGGGNONE 
J013037D13CGCGTGGGNONE 
J013044J24CGCGTGGGNONE 
J013049J23CGCGTGGGNONE 
J013073I05CGCGTGGGNONE 
J013108E02CGCGTGGGNONE 
J013109I01CGCGTGGGNONE 
J013111O20CGCGTGGGNONE 
J023003J22CGCGTGGGNONE 
J023056E11CGCGTGGGNONE 
J023056P12CGCGTGGGNONE 
J023073J17CGCGTGGGNONE 
J023081D02CGCGTGGGNONE 
J023129B20CGCGTGGGNONE 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0588700Os03g0588700GCAGCCCACGCGConserved hypothetical protein. 
Os03g0643100AK106587GCCCACGCGTGCGHomeodomain-like containing protein. 
Os03g0650400016-019-C03ACGCGTGGGNONE 
AK064367ACGCGTGGGNONE 
AK101644ACGCGTGGGConserved hypothetical protein. 
J033055N07ACGCGTGGGNONE 
J075172F12ACGCGTGGGNONE 
J090026P03ACGCGTGGGNONE 
J090031K19ACGCGTGGGNONE 
Os03g0669100014-007-F05CGCGTGGGNONE 
014-090-H05CGCGTGGGNONE 
AK063633CGCGTGGGSimilar to Deoxyuridine 5'-triphosphate nucleotidohydrolase (EC 3.6.1.23) (dUTPase) (dUTP pyrophosphatase) (P18). 
AK063742CGCGTGGGNONE 
J065030M17CGCGTGGGNONE 
J065132J05CGCGTGGGNONE 
J065176B11CGCGTGGGNONE 
J065201F08CGCGTGGGNONE 
Os03g0670200011-069-G05CGCGTGGGCGAGGNONE 
AK069553CGCGTGGGCGAGGSimilar to YJR013Wp (Fragment). 
J023020O11CGCGTGGGCGAGGNONE 
J023114J22CGCGTGGGCGAGGNONE 
J100084F17CGCGTGGGCGAGGNONE 
J100087A11CGCGTGGGCGAGGNONE 
Os03g0670700009-028-B03GGACGGCCGCGTGGGNONE 
009-036-H12GGACGGCCGCGTGGGNONE 
009-053-H05GGACGGCCGCGTGGGNONE 
009-126-B02GGACGGCCGCGTGGGNONE 
009-135-D07GGACGGCCGCGTGGGNONE 
009-148-A03GGACGGCCGCGTGGGNONE 
009-148-A12GGACGGCCGCGTGGGNONE 
009-152-B02GGACGGCCGCGTGGGNONE 
009-153-B06GGACGGCCGCGTGGGNONE 
009-166-G05GGACGGCCGCGTGGGNONE 
009-181-A09GGACGGCCGCGTGGGNONE 
011-061-D07GGACGGCCGCGTGGGNONE 
012-043-C04GGACGGCCGCGTGGGNONE 
013-001-A02GGACGGCCGCGTGGGNONE 
013-004-F05GGACGGCCGCGTGGGNONE 
013-008-C08GGACGGCCGCGTGGGNONE 
013-015-B09GGACGGCCGCGTGGGNONE 
013-016-G05GGACGGCCGCGTGGGNONE 
013-023-A06GGACGGCCGCGTGGGNONE 
013-023-B06GGACGGCCGCGTGGGNONE 
013-032-F09GGACGGCCGCGTGGGNONE 
013-059-C07GGACGGCCGCGTGGGNONE 
013-071-E09GGACGGCCGCGTGGGNONE 
013-073-D06GGACGGCCGCGTGGGNONE 
013-077-C02GGACGGCCGCGTGGGNONE 
013-078-B12GGACGGCCGCGTGGGNONE 
013-093-A01GGACGGCCGCGTGGGNONE 
014-002-B12GGACGGCCGCGTGGGNONE 
014-003-E08GGACGGCCGCGTGGGNONE 
014-004-D06GGACGGCCGCGTGGGNONE 
014-007-C11GGACGGCCGCGTGGGNONE 
014-007-G10GGACGGCCGCGTGGGNONE 
014-019-C04GGACGGCCGCGTGGGNONE 
014-021-F05GGACGGCCGCGTGGGNONE 
014-024-G06GGACGGCCGCGTGGGNONE 
014-027-C07GGACGGCCGCGTGGGNONE 
014-027-D03GGACGGCCGCGTGGGNONE 
014-029-E07GGACGGCCGCGTGGGNONE 
014-031-B04GGACGGCCGCGTGGGNONE 
014-033-B05GGACGGCCGCGTGGGNONE 
014-033-C03GGACGGCCGCGTGGGNONE 
014-033-C12GGACGGCCGCGTGGGNONE 
014-036-F01GGACGGCCGCGTGGGNONE 
014-037-C04GGACGGCCGCGTGGGNONE 
014-040-H02GGACGGCCGCGTGGGNONE 
014-045-H04GGACGGCCGCGTGGGNONE 
014-045-H06GGACGGCCGCGTGGGNONE 
014-052-A08GGACGGCCGCGTGGGNONE 
014-076-G01GGACGGCCGCGTGGGNONE 
014-083-F04GGACGGCCGCGTGGGNONE 
014-086-E01GGACGGCCGCGTGGGNONE 
014-091-D02GGACGGCCGCGTGGGNONE 
014-091-F05GGACGGCCGCGTGGGNONE 
014-093-E10GGACGGCCGCGTGGGNONE 
014-100-C10GGACGGCCGCGTGGGNONE 
015-011-H02GGACGGCCGCGTGGGNONE 
015-073-B03GGACGGCCGCGTGGGNONE 
AF010579GGACGGCCGCGTGGGNONE 
AK059164GGACGGCCGCGTGGGSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GGACGGCCGCGTGGGNONE 
AK119238GGACGGCCGCGTGGGNONE 
AK119242GGACGGCCGCGTGGGNONE 
J023037K17GGACGGCCGCGTGGGNONE 
J033136F11GGACGGCCGCGTGGGNONE 
J065008C13GGACGGCCGCGTGGGNONE 
J065032K18GGACGGCCGCGTGGGNONE 
J065043N10GGACGGCCGCGTGGGNONE 
J065045E06GGACGGCCGCGTGGGNONE 
J065046P21GGACGGCCGCGTGGGNONE 
J065048J17GGACGGCCGCGTGGGNONE 
J065053I23GGACGGCCGCGTGGGNONE 
J065053P03GGACGGCCGCGTGGGNONE 
J065054C13GGACGGCCGCGTGGGNONE 
J065058I17GGACGGCCGCGTGGGNONE 
J065061I12GGACGGCCGCGTGGGNONE 
J065062E09GGACGGCCGCGTGGGNONE 
J065063P04GGACGGCCGCGTGGGNONE 
J065068J07GGACGGCCGCGTGGGNONE 
J065076D02GGACGGCCGCGTGGGNONE 
J065083O07GGACGGCCGCGTGGGNONE 
J065090J02GGACGGCCGCGTGGGNONE 
J065093N08GGACGGCCGCGTGGGNONE 
J065097F02GGACGGCCGCGTGGGNONE 
J065112H17GGACGGCCGCGTGGGNONE 
J065121B01GGACGGCCGCGTGGGNONE 
J065124F12GGACGGCCGCGTGGGNONE 
J065130L03GGACGGCCGCGTGGGNONE 
J065131K05GGACGGCCGCGTGGGNONE 
J065132C06GGACGGCCGCGTGGGNONE 
J065135J18GGACGGCCGCGTGGGNONE 
J065138J22GGACGGCCGCGTGGGNONE 
J065140G21GGACGGCCGCGTGGGNONE 
J065161B19GGACGGCCGCGTGGGNONE 
J065162F22GGACGGCCGCGTGGGNONE 
J065162M09GGACGGCCGCGTGGGNONE 
J065163D03GGACGGCCGCGTGGGNONE 
J065163O21GGACGGCCGCGTGGGNONE 
J065165H11GGACGGCCGCGTGGGNONE 
J065165O16GGACGGCCGCGTGGGNONE 
J065167N06GGACGGCCGCGTGGGNONE 
J065168I08GGACGGCCGCGTGGGNONE 
J065170A14GGACGGCCGCGTGGGNONE 
J065170L03GGACGGCCGCGTGGGNONE 
J065171C08GGACGGCCGCGTGGGNONE 
J065173G11GGACGGCCGCGTGGGNONE 
J065173M09GGACGGCCGCGTGGGNONE 
J065176P07GGACGGCCGCGTGGGNONE 
J065178K24GGACGGCCGCGTGGGNONE 
J065185O12GGACGGCCGCGTGGGNONE 
J065191E02GGACGGCCGCGTGGGNONE 
J065204H10GGACGGCCGCGTGGGNONE 
J075033C23GGACGGCCGCGTGGGNONE 
J075041M21GGACGGCCGCGTGGGNONE 
J075043F13GGACGGCCGCGTGGGNONE 
J075044D02GGACGGCCGCGTGGGNONE 
J075044J15GGACGGCCGCGTGGGNONE 
J075048L07GGACGGCCGCGTGGGNONE 
J075054G12GGACGGCCGCGTGGGNONE 
J075055J10GGACGGCCGCGTGGGNONE 
J075059F09GGACGGCCGCGTGGGNONE 
J075066M23GGACGGCCGCGTGGGNONE 
J075071O09GGACGGCCGCGTGGGNONE 
J075085G23GGACGGCCGCGTGGGNONE 
J075086B21GGACGGCCGCGTGGGNONE 
J075087L18GGACGGCCGCGTGGGNONE 
J075087L21GGACGGCCGCGTGGGNONE 
J075087N14GGACGGCCGCGTGGGNONE 
J075088O13GGACGGCCGCGTGGGNONE 
J075089B06GGACGGCCGCGTGGGNONE 
J075089E20GGACGGCCGCGTGGGNONE 
J075090J01GGACGGCCGCGTGGGNONE 
J075090L05GGACGGCCGCGTGGGNONE 
J075091G05GGACGGCCGCGTGGGNONE 
J075091N06GGACGGCCGCGTGGGNONE 
J075093G08GGACGGCCGCGTGGGNONE 
J075094C13GGACGGCCGCGTGGGNONE 
J075095K01GGACGGCCGCGTGGGNONE 
J075096C02GGACGGCCGCGTGGGNONE 
J075097L16GGACGGCCGCGTGGGNONE 
J075097O10GGACGGCCGCGTGGGNONE 
J075098H24GGACGGCCGCGTGGGNONE 
J075099H02GGACGGCCGCGTGGGNONE 
J075099J11GGACGGCCGCGTGGGNONE 
J075099L08GGACGGCCGCGTGGGNONE 
J075109I11GGACGGCCGCGTGGGNONE 
J075114F03GGACGGCCGCGTGGGNONE 
J075121G07GGACGGCCGCGTGGGNONE 
J075122D23GGACGGCCGCGTGGGNONE 
J075132O07GGACGGCCGCGTGGGNONE 
J075141L21GGACGGCCGCGTGGGNONE 
J075142I08GGACGGCCGCGTGGGNONE 
J075145A06GGACGGCCGCGTGGGNONE 
J075147J15GGACGGCCGCGTGGGNONE 
J075150B09GGACGGCCGCGTGGGNONE 
J075151E07GGACGGCCGCGTGGGNONE 
J075161M16GGACGGCCGCGTGGGNONE 
J075190I16GGACGGCCGCGTGGGNONE 
J075192L05GGACGGCCGCGTGGGNONE 
J075192O03GGACGGCCGCGTGGGNONE 
J075192O08GGACGGCCGCGTGGGNONE 
J075193L12GGACGGCCGCGTGGGNONE 
J080001M24GGACGGCCGCGTGGGNONE 
J080004E20GGACGGCCGCGTGGGNONE 
J080005K15GGACGGCCGCGTGGGNONE 
J080005L05GGACGGCCGCGTGGGNONE 
J080014P20GGACGGCCGCGTGGGNONE 
J080029D12GGACGGCCGCGTGGGNONE 
J080030H09GGACGGCCGCGTGGGNONE 
J080039G05GGACGGCCGCGTGGGNONE 
J080040E18GGACGGCCGCGTGGGNONE 
J080041B02GGACGGCCGCGTGGGNONE 
J080041E06GGACGGCCGCGTGGGNONE 
J080041G05GGACGGCCGCGTGGGNONE 
J080041G24GGACGGCCGCGTGGGNONE 
J080041H07GGACGGCCGCGTGGGNONE 
J080041K03GGACGGCCGCGTGGGNONE 
J080047G01GGACGGCCGCGTGGGNONE 
J080052E07GGACGGCCGCGTGGGNONE 
J080053B15GGACGGCCGCGTGGGNONE 
J080053N01GGACGGCCGCGTGGGNONE 
J080054I01GGACGGCCGCGTGGGNONE 
J080054N02GGACGGCCGCGTGGGNONE 
J080063P03GGACGGCCGCGTGGGNONE 
J080064E13GGACGGCCGCGTGGGNONE 
J080064G13GGACGGCCGCGTGGGNONE 
J080065F02GGACGGCCGCGTGGGNONE 
J080065G03GGACGGCCGCGTGGGNONE 
J080065K17GGACGGCCGCGTGGGNONE 
J080067D06GGACGGCCGCGTGGGNONE 
J080067H23GGACGGCCGCGTGGGNONE 
J080067M15GGACGGCCGCGTGGGNONE 
J080068B20GGACGGCCGCGTGGGNONE 
J080068G24GGACGGCCGCGTGGGNONE 
J080072K19GGACGGCCGCGTGGGNONE 
J080076I24GGACGGCCGCGTGGGNONE 
J080092F05GGACGGCCGCGTGGGNONE 
J080092K14GGACGGCCGCGTGGGNONE 
J080092N22GGACGGCCGCGTGGGNONE 
J080093K02GGACGGCCGCGTGGGNONE 
J080094C08GGACGGCCGCGTGGGNONE 
J080094E09GGACGGCCGCGTGGGNONE 
J080094E20GGACGGCCGCGTGGGNONE 
J080094G08GGACGGCCGCGTGGGNONE 
J080094H18GGACGGCCGCGTGGGNONE 
J080094P22GGACGGCCGCGTGGGNONE 
J080095J23GGACGGCCGCGTGGGNONE 
J080096F14GGACGGCCGCGTGGGNONE 
J080097A21GGACGGCCGCGTGGGNONE 
J080097I07GGACGGCCGCGTGGGNONE 
J080097J02GGACGGCCGCGTGGGNONE 
J080097K01GGACGGCCGCGTGGGNONE 
J080097K03GGACGGCCGCGTGGGNONE 
J080305H18GGACGGCCGCGTGGGNONE 
J080306G01GGACGGCCGCGTGGGNONE 
J080306O08GGACGGCCGCGTGGGNONE 
J080311I01GGACGGCCGCGTGGGNONE 
J080315N24GGACGGCCGCGTGGGNONE 
J090003K21GGACGGCCGCGTGGGNONE 
J090008C20GGACGGCCGCGTGGGNONE 
J090008K19GGACGGCCGCGTGGGNONE 
J090008P13GGACGGCCGCGTGGGNONE 
J090015H22GGACGGCCGCGTGGGNONE 
J090016M01GGACGGCCGCGTGGGNONE 
J090018E13GGACGGCCGCGTGGGNONE 
J090018G03GGACGGCCGCGTGGGNONE 
J090018L17GGACGGCCGCGTGGGNONE 
J090019H11GGACGGCCGCGTGGGNONE 
J090021B19GGACGGCCGCGTGGGNONE 
J090021K02GGACGGCCGCGTGGGNONE 
J090023H15GGACGGCCGCGTGGGNONE 
J090034E03GGACGGCCGCGTGGGNONE 
J090045D16GGACGGCCGCGTGGGNONE 
J090045I06GGACGGCCGCGTGGGNONE 
J090047L09GGACGGCCGCGTGGGNONE 
J090048B05GGACGGCCGCGTGGGNONE 
J090048D11GGACGGCCGCGTGGGNONE 
J090048N11GGACGGCCGCGTGGGNONE 
J090050F20GGACGGCCGCGTGGGNONE 
J090052M20GGACGGCCGCGTGGGNONE 
J090083H03GGACGGCCGCGTGGGNONE 
J090084C12GGACGGCCGCGTGGGNONE 
J090095B05GGACGGCCGCGTGGGNONE 
J090095M18GGACGGCCGCGTGGGNONE 
J100024I22GGACGGCCGCGTGGGNONE 
J100024J12GGACGGCCGCGTGGGNONE 
J100024J22GGACGGCCGCGTGGGNONE 
J100025F07GGACGGCCGCGTGGGNONE 
J100026B13GGACGGCCGCGTGGGNONE 
J100027N03GGACGGCCGCGTGGGNONE 
J100029F14GGACGGCCGCGTGGGNONE 
J100029L20GGACGGCCGCGTGGGNONE 
J100032C22GGACGGCCGCGTGGGNONE 
J100032I08GGACGGCCGCGTGGGNONE 
J100032O05GGACGGCCGCGTGGGNONE 
J100033J24GGACGGCCGCGTGGGNONE 
J100033L12GGACGGCCGCGTGGGNONE 
J100034K06GGACGGCCGCGTGGGNONE 
J100037D09GGACGGCCGCGTGGGNONE 
J100038H02GGACGGCCGCGTGGGNONE 
J100039A12GGACGGCCGCGTGGGNONE 
J100039N12GGACGGCCGCGTGGGNONE 
J100039O21GGACGGCCGCGTGGGNONE 
J100040K05GGACGGCCGCGTGGGNONE 
J100042A02GGACGGCCGCGTGGGNONE 
J100042A17GGACGGCCGCGTGGGNONE 
J100043C15GGACGGCCGCGTGGGNONE 
J100044A17GGACGGCCGCGTGGGNONE 
J100044E18GGACGGCCGCGTGGGNONE 
J100044I11GGACGGCCGCGTGGGNONE 
J100044J15GGACGGCCGCGTGGGNONE 
J100045E23GGACGGCCGCGTGGGNONE 
J100049B18GGACGGCCGCGTGGGNONE 
J100050G04GGACGGCCGCGTGGGNONE 
J100051D06GGACGGCCGCGTGGGNONE 
J100051H20GGACGGCCGCGTGGGNONE 
J100052J01GGACGGCCGCGTGGGNONE 
J100052K07GGACGGCCGCGTGGGNONE 
J100055I01GGACGGCCGCGTGGGNONE 
J100057D02GGACGGCCGCGTGGGNONE 
J100059G14GGACGGCCGCGTGGGNONE 
J100059G21GGACGGCCGCGTGGGNONE 
J100059H03GGACGGCCGCGTGGGNONE 
J100059H15GGACGGCCGCGTGGGNONE 
J100063E13GGACGGCCGCGTGGGNONE 
J100063M02GGACGGCCGCGTGGGNONE 
J100064B17GGACGGCCGCGTGGGNONE 
J100064F11GGACGGCCGCGTGGGNONE 
J100066G12GGACGGCCGCGTGGGNONE 
J100066H09GGACGGCCGCGTGGGNONE 
J100068B12GGACGGCCGCGTGGGNONE 
J100068L16GGACGGCCGCGTGGGNONE 
J100068M23GGACGGCCGCGTGGGNONE 
J100069A02GGACGGCCGCGTGGGNONE 
J100069D07GGACGGCCGCGTGGGNONE 
J100069M13GGACGGCCGCGTGGGNONE 
J100070C07GGACGGCCGCGTGGGNONE 
J100070J11GGACGGCCGCGTGGGNONE 
J100070L20GGACGGCCGCGTGGGNONE 
J100071H10GGACGGCCGCGTGGGNONE 
J100072L14GGACGGCCGCGTGGGNONE 
J100072N12GGACGGCCGCGTGGGNONE 
J100073A21GGACGGCCGCGTGGGNONE 
J100074K17GGACGGCCGCGTGGGNONE 
J100074M04GGACGGCCGCGTGGGNONE 
J100075F11GGACGGCCGCGTGGGNONE 
J100076E23GGACGGCCGCGTGGGNONE 
J100076G03GGACGGCCGCGTGGGNONE 
J100077K01GGACGGCCGCGTGGGNONE 
J100077N23GGACGGCCGCGTGGGNONE 
J100079H17GGACGGCCGCGTGGGNONE 
J100081N01GGACGGCCGCGTGGGNONE 
J100082E04GGACGGCCGCGTGGGNONE 
J100082K11GGACGGCCGCGTGGGNONE 
J100085H23GGACGGCCGCGTGGGNONE 
J100086O18GGACGGCCGCGTGGGNONE 
J100087F21GGACGGCCGCGTGGGNONE 
J100088E02GGACGGCCGCGTGGGNONE 
J100088F08GGACGGCCGCGTGGGNONE 
J100088G24GGACGGCCGCGTGGGNONE 
J100088K20GGACGGCCGCGTGGGNONE 
J100089B19GGACGGCCGCGTGGGNONE 
J100089K22GGACGGCCGCGTGGGNONE 
J100089N22GGACGGCCGCGTGGGNONE 
J100089O17GGACGGCCGCGTGGGNONE 
J100090N05GGACGGCCGCGTGGGNONE 
Os03g0709300AK100153CCCACGCGSimilar to Chemocyanin precursor (Basic blue protein) (Plantacyanin). 
J065192M19CCCACGCGNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0734500AK108001CCCACGCGConserved hypothetical protein. 
J080013F05CCCACGCGNONE 
J080030B16CCCACGCGNONE 
J080074G16CCCACGCGNONE 
J100062F08CCCACGCGNONE 
Os03g0735000AK069296GTGGGTCCCACGCGSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment). 
Os03g0751100AK102404GCCCACGCGSimilar to Isp4 protein-like. 
Os03g0764600AK105625CCCACGCGHomeodomain-like containing protein. 
Os03g0784400AK103474GGACGCGTGGGProtein of unknown function DUF1692 domain containing protein. 
J023135I15GGACGCGTGGGNONE 
J033130D12GGACGCGTGGGNONE 
J043035E20GGACGCGTGGGNONE 
J065206K15GGACGCGTGGGNONE 
J075053J20GGACGCGTGGGNONE 
J075129B11GGACGCGTGGGNONE 
J090003E22GGACGCGTGGGNONE 
J100023E23GGACGCGTGGGNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0799000013-010-A07TGTGGGGCGCGTGGGNONE 
013-081-H02TGTGGGGCGCGTGGGNONE 
AK067840TGTGGGGCGCGTGGGSimilar to Histone H1. 
AK099211TGTGGGGCGCGTGGGNONE 
J065066F23TGTGGGGCGCGTGGGNONE 
J065138O20TGTGGGGCGCGTGGGNONE 
J065163G22TGTGGGGCGCGTGGGNONE 
J065211J01TGTGGGGCGCGTGGGNONE 
J080027D02TGTGGGGCGCGTGGGNONE 
J080029E20TGTGGGGCGCGTGGGNONE 
J080045D03TGTGGGGCGCGTGGGNONE 
J080060G13TGTGGGGCGCGTGGGNONE 
J080067E14TGTGGGGCGCGTGGGNONE 
J080067J04TGTGGGGCGCGTGGGNONE 
J080067J21TGTGGGGCGCGTGGGNONE 
J080068L09TGTGGGGCGCGTGGGNONE 
J080077E15TGTGGGGCGCGTGGGNONE 
J080078B03TGTGGGGCGCGTGGGNONE 
J080086H09TGTGGGGCGCGTGGGNONE 
J090095G02TGTGGGGCGCGTGGGNONE 
J100058H04TGTGGGGCGCGTGGGNONE 
Os03g0839900AK067347CCCACGCGUspA domain containing protein. 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os04g0128700AK107172ACGCGTGGGThioredoxin-like fold domain containing protein. 
J065102M16ACGCGTGGGNONE 
J065124K01ACGCGTGGGNONE 
J065129I12ACGCGTGGGNONE 
J065192C08ACGCGTGGGNONE 
Os04g0170500AK103323CCCACGCGHypothetical protein. 
Os04g0319800J065187N03GCCCCACGCGTSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2). 
J065187N03GGTCCCACGCGSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2). 
Os04g0428500AK109932CGCGTGGGCTGTCGGACGGConserved hypothetical protein. 
Os04g0434400014-079-B10GCCCACGCGTNONE 
AK063725GCCCACGCGTConserved hypothetical protein. 
Os04g0476400J033082D17CGCGTGGGNONE 
Os04g0500700AK072528CCTCGCCCCACGCGGCCCCCACCCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK119237CCTCGCCCCACGCGGCCCCCACCCGNONE 
Os04g0506300AK063591CCCACGCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08CCCACGCGNONE 
Os04g0535200012-036-D08CCCCCACGCGNONE 
AK060585CCCCCACGCGNONE 
AK101505CCCCCACGCGNONE 
AK119767CCCCCACGCGPeptidase A1, pepsin family protein. 
J033044F04CCCCCACGCGNONE 
J065167K19CCCCCACGCGNONE 
J075017H22CCCCCACGCGNONE 
J075180E03CCCCCACGCGNONE 
J080025H04CCCCCACGCGNONE 
J080026P04CCCCCACGCGNONE 
J080029A01CCCCCACGCGNONE 
J080034L18CCCCCACGCGNONE 
J080038J07CCCCCACGCGNONE 
J080053L24CCCCCACGCGNONE 
J080071P08CCCCCACGCGNONE 
J080093F09CCCCCACGCGNONE 
Os04g0551800016-049-G12CGCGTGGGNONE 
AK121568CGCGTGGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CGCGTGGGNONE 
J013111B11CGCGTGGGNONE 
J013121H23CGCGTGGGNONE 
J023012A17CGCGTGGGNONE 
J023092M05CGCGTGGGNONE 
J033026P14CGCGTGGGNONE 
J033033C10CGCGTGGGNONE 
J033033M10CGCGTGGGNONE 
J033035C24CGCGTGGGNONE 
J033052E19CGCGTGGGNONE 
J033140K19CGCGTGGGNONE 
J065036F18CGCGTGGGNONE 
J065067L12CGCGTGGGNONE 
J065095G09CGCGTGGGNONE 
J065115B08CGCGTGGGNONE 
J065218E24CGCGTGGGNONE 
J090002N13CGCGTGGGNONE 
J090008B12CGCGTGGGNONE 
J090016F24CGCGTGGGNONE 
J090019H14CGCGTGGGNONE 
J090020G20CGCGTGGGNONE 
J090029L18CGCGTGGGNONE 
J090057C23CGCGTGGGNONE 
J090073H23CGCGTGGGNONE 
J090081C16CGCGTGGGNONE 
J090081E21CGCGTGGGNONE 
J090084L14CGCGTGGGNONE 
J090086M01CGCGTGGGNONE 
J090089E16CGCGTGGGNONE 
J100031P12CGCGTGGGNONE 
J100090N23CGCGTGGGNONE 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0602800AK100925CGCGTGGGGCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0631200013-003-B06ACGCGTGGGTCCCNONE 
AK059277ACGCGTGGGTCCCSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331ACGCGTGGGTCCCNONE 
J033024P08ACGCGTGGGTCCCNONE 
J033041G02ACGCGTGGGTCCCNONE 
J053075H12ACGCGTGGGTCCCNONE 
J065016B13ACGCGTGGGTCCCNONE 
J090075B22ACGCGTGGGTCCCNONE 
J100084K17ACGCGTGGGTCCCNONE 
Os04g0639100009-158-D03CGCGTGGGCCTCNONE 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
J075045D14CGCGTGGGCCTCNONE 
J075047L16CGCGTGGGCCTCNONE 
J075048D20CGCGTGGGCCTCNONE 
J075056E20CGCGTGGGCCTCNONE 
J075074E14CGCGTGGGCCTCNONE 
J075108F16CGCGTGGGCCTCNONE 
J075143L19CGCGTGGGCCTCNONE 
J075146L07CGCGTGGGCCTCNONE 
J075158I04CGCGTGGGCCTCNONE 
J075172B20CGCGTGGGCCTCNONE 
J090061M08CGCGTGGGCCTCNONE 
Os04g0653100014-075-B07CCCACGCGNONE 
016-077-E05CCCACGCGNONE 
AK067094CCCACGCGProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420CCCACGCGNONE 
J013098P05CCCACGCGNONE 
J075001K22CCCACGCGNONE 
J075198O04CCCACGCGNONE 
Os04g0659400AK070174ACGCGTGGGENT domain containing protein. 
Os04g0678200006-037-E05GGGGCCCACGCGTNONE 
006-059-G04GGGGCCCACGCGTNONE 
006-097-A11GGGGCCCACGCGTNONE 
006-098-D11GGGGCCCACGCGTNONE 
009-154-H11GGGGCCCACGCGTNONE 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
J013064K07GGGGCCCACGCGTNONE 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
J013108D21GCGGCCCACGCGNONE 
J023041E19GCGGCCCACGCGNONE 
J065006M21GCGGCCCACGCGNONE 
J065060B21GCGGCCCACGCGNONE 
J065086K07GCGGCCCACGCGNONE 
J065121N03GCGGCCCACGCGNONE 
J065201M22GCGGCCCACGCGNONE 
J075004H05GCGGCCCACGCGNONE 
J075005G06GCGGCCCACGCGNONE 
J075032N07GCGGCCCACGCGNONE 
J075055M01GCGGCCCACGCGNONE 
J075057A20GCGGCCCACGCGNONE 
J075078L23GCGGCCCACGCGNONE 
J075137G04GCGGCCCACGCGNONE 
J090026N09GCGGCCCACGCGNONE 
J090044L05GCGGCCCACGCGNONE 
Os05g0102500009-183-E08GGTCCCACGCGTNONE 
AK063894GGTCCCACGCGTNONE 
AK073341GGTCCCACGCGTConserved hypothetical protein. 
J023022C11GGTCCCACGCGTNONE 
J065095B14GGTCCCACGCGTNONE 
J065130O12GGTCCCACGCGTNONE 
J065142P07GGTCCCACGCGTNONE 
J065155L18GGTCCCACGCGTNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0116000AK058320CCCACGCGTNONE 
AK121775CCCACGCGT11-S plant seed storage protein family protein. 
J023003L12CCCACGCGTNONE 
J023025C18CCCACGCGTNONE 
J023074E20CCCACGCGTNONE 
J023128H09CCCACGCGTNONE 
J033092N18CCCACGCGTNONE 
J065009J09CCCACGCGTNONE 
J090073L21CCCACGCGTNONE 
Os05g0119300004-011-B09GCTGGGCCCCACGCGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AY348312GCTGGGCCCCACGCGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
J033031D02CCCACGCGTGGGCCCTNONE 
J065078F10CCCACGCGTGGGCCCTNONE 
J065151J16CCCACGCGTGGGCCCTNONE 
J065151K04CCCACGCGTGGGCCCTNONE 
J090057E18CCCACGCGTGGGCCCTNONE 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
Os05g0170000003-129-C04CCCACGCGNONE 
AK100216CCCACGCGProtein of unknown function DUF266, plant family protein. 
AK103412CCCACGCGNONE 
J023045H21CCCACGCGNONE 
J033128G01CCCACGCGNONE 
J065017O10CCCACGCGNONE 
J065032H11CCCACGCGNONE 
J065120G09CCCACGCGNONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0291700AK073234CATCCCCCACGCGTNONE 
AK099865CATCCCCCACGCGTConserved hypothetical protein. 
AK108453CATCCCCCACGCGTNONE 
Os05g0319700AK107192GGCCCCACGCGSimilar to Protein kinase-like protein (Fragment). 
Os05g0322900006-057-H12CGCGTGGGCCGCNONE 
014-051-A08CGCGTGGGCCGCNONE 
AK063697CGCGTGGGCCGCNONE 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
AK103959CGCGTGGGCCGCNONE 
AY870611CGCGTGGGCCGCNONE 
J100068H13CGCGTGGGCCGCNONE 
Os05g0323900006-105-F01CCCACGCGTCCNONE 
009-161-D06CCCACGCGTCCNONE 
AK070528CCCACGCGTCCManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030CCCACGCGTCCNONE 
AK104160CCCACGCGTCCNONE 
AK119904CCCACGCGTCCNONE 
J023060D13CCCACGCGTCCNONE 
J033057E10CCCACGCGTCCNONE 
J043034F19CCCACGCGTCCNONE 
J053099K12CCCACGCGTCCNONE 
J065022N03CCCACGCGTCCNONE 
J065035G13CCCACGCGTCCNONE 
J065059M24CCCACGCGTCCNONE 
J065059N23CCCACGCGTCCNONE 
J065073I02CCCACGCGTCCNONE 
J065095L15CCCACGCGTCCNONE 
J065104I24CCCACGCGTCCNONE 
J065104J24CCCACGCGTCCNONE 
J065112L13CCCACGCGTCCNONE 
J065114J24CCCACGCGTCCNONE 
J065120J16CCCACGCGTCCNONE 
J065141I09CCCACGCGTCCNONE 
J065165E17CCCACGCGTCCNONE 
J065170C14CCCACGCGTCCNONE 
J065182I05CCCACGCGTCCNONE 
J065191K20CCCACGCGTCCNONE 
J065205L14CCCACGCGTCCNONE 
J075017M10CCCACGCGTCCNONE 
J075019O04CCCACGCGTCCNONE 
J075019O15CCCACGCGTCCNONE 
J075032E07CCCACGCGTCCNONE 
J075042D13CCCACGCGTCCNONE 
J075054J07CCCACGCGTCCNONE 
J075089O11CCCACGCGTCCNONE 
J075104G09CCCACGCGTCCNONE 
J075150N03CCCACGCGTCCNONE 
J075187A09CCCACGCGTCCNONE 
J075187D04CCCACGCGTCCNONE 
J090006G06CCCACGCGTCCNONE 
J090045C09CCCACGCGTCCNONE 
J090083D13CCCACGCGTCCNONE 
J090084B13CCCACGCGTCCNONE 
J100021H22CCCACGCGTCCNONE 
J100034A15CCCACGCGTCCNONE 
J100041N15CCCACGCGTCCNONE 
J100042D05CCCACGCGTCCNONE 
J100042D08CCCACGCGTCCNONE 
J100059P21CCCACGCGTCCNONE 
L19436CCCACGCGTCCNONE 
L34038CCCACGCGTCCNONE 
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0413200006-067-C03CGCGTGGGACCGTCCGATCNONE 
006-080-C03CGCGTGGGACCGTCCGATCNONE 
006-095-G10CGCGTGGGACCGTCCGATCNONE 
006-115-G11CGCGTGGGACCGTCCGATCNONE 
013-040-E05CGCGTGGGACCGTCCGATCNONE 
AB104732CGCGTGGGACCGTCCGATCNONE 
AK122099CGCGTGGGACCGTCCGATCBeta-tubulin. 
J033087H20CGCGTGGGACCGTCCGATCNONE 
J033117C18CGCGTGGGACCGTCCGATCNONE 
J033125G10CGCGTGGGACCGTCCGATCNONE 
Os05g0461300AK111917CCCCCACGCGSimilar to RAB8C. 
AK111946CCCCCACGCGNONE 
AK111972CCCCCACGCGNONE 
AK112021CCCCCACGCGNONE 
J033135H16CCCCCACGCGNONE 
J043036O11CCCCCACGCGNONE 
Os05g0463800AB095439ACCCCCCACGCGNONE 
AK100811ACCCCCCACGCGSimilar to CCAAT-binding transcription factor-like protein (Fragment). 
AY224530ACCCCCCACGCGNONE 
J023075E18ACCCCCCACGCGNONE 
J023121O11ACCCCCCACGCGNONE 
Os05g0503300011-013-H12CGCGTGGGCNONE 
012-072-B03CGCGTGGGCNONE 
AK073969CGCGTGGGCSimilar to Sulfite reductase (Fragment). 
AK100773CGCGTGGGCNONE 
AK103289CGCGTGGGCNONE 
J013045K07CGCGTGGGCNONE 
J033075F01CGCGTGGGCNONE 
J033125N07CGCGTGGGCNONE 
J033130G12CGCGTGGGCNONE 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0571800009-157-G07GCCCACGCGNONE 
AK063033GCCCACGCGConserved hypothetical protein. 
Os05g0576300015-055-B11GCCCACGCGNONE 
AK106354GCCCACGCGZinc finger, CCCH-type domain containing protein. 
Os05g0595200AK070317CGCGTGGGAllergen V5/Tpx-1 related family protein. 
AK100748CGCGTGGGNONE 
J023052A08CGCGTGGGNONE 
J023118J22CGCGTGGGNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0140400AK059116CCCACGCGNONE 
AK102692CCCACGCGSimilar to HAHB-6 (Fragment). 
AY554033CCCACGCGNONE 
J033103D12CCCACGCGNONE 
Os06g0152200AB001886GCCCACGCGTCCNONE 
AK072231GCCCACGCGTCCZinc-finger protein R2931. 
AK104083GCCCACGCGTCCNONE 
J065077H19GCCCACGCGTCCNONE 
J065208H22GCCCACGCGTCCNONE 
J100032H08GCCCACGCGTCCNONE 
Os06g0168600AK068858ACGCGTGGGGGSimilar to Ribonucleotide reductase. 
Os06g0225200005-009-B07CCCACGCGNONE 
AK067095CCCACGCGMitochodrial transcription termination factor-related family protein. 
AK104692CCCACGCGNONE 
J013096A05CCCACGCGNONE 
J090092C03CCCACGCGNONE 
Os06g0246600AK107692CCAGGCCCCACGCGTSimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3). 
Os06g0265000AK100247CCCACGCGTCTCSimilar to Asparagine synthetase. 
D83378CCCACGCGTCTCNONE 
J013033O15CCCACGCGTCTCNONE 
J013037K20CCCACGCGTCTCNONE 
J013058I07CCCACGCGTCTCNONE 
J033125M21CCCACGCGTCTCNONE 
J033142B02CCCACGCGTCTCNONE 
J043030E23CCCACGCGTCTCNONE 
J043034K11CCCACGCGTCTCNONE 
J053050B10CCCACGCGTCTCNONE 
J053061I09CCCACGCGTCTCNONE 
J053068F17CCCACGCGTCTCNONE 
J053074G11CCCACGCGTCTCNONE 
J053095N11CCCACGCGTCTCNONE 
J090028M17CCCACGCGTCTCNONE 
J090031O08CCCACGCGTCTCNONE 
J090094C22CCCACGCGTCTCNONE 
J100045M24CCCACGCGTCTCNONE 
J100055P03CCCACGCGTCTCNONE 
J100073O10CCCACGCGTCTCNONE 
J100081K21CCCACGCGTCTCNONE 
U55873CCCACGCGTCTCNONE 
Os06g0286351AK121119GGCCCCACGCGTArmadillo-like helical domain containing protein. 
Os06g0326400AK065052GCCCCACGCGNONE 
AK121116GCCCCACGCGPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23GCCCCACGCGNONE 
J013129K13GCCCCACGCGNONE 
J023010F22GCCCCACGCGNONE 
J023120K19GCCCCACGCGNONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0590301J033139K16CGCGTGGGGGCNONE 
J065011M13CGCGTGGGGGCNONE 
J065027D20CGCGTGGGGGCNONE 
J065039O05CGCGTGGGGGCGlucose/ribitol dehydrogenase family protein. 
J065051O10CGCGTGGGGGCNONE 
J065128I21CGCGTGGGGGCNONE 
J065163P10CGCGTGGGGGCNONE 
J065169H02CGCGTGGGGGCNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0665500015-073-H04GGACCCACGCGNONE 
AK073262GGACCCACGCGAmidase, hydantoinase/carbamoylase family protein. 
J023095H01GGACCCACGCGNONE 
J023150C12GGACCCACGCGNONE 
J033026H23GGACCCACGCGNONE 
J033136A22GGACCCACGCGNONE 
J043021O11GGACCCACGCGNONE 
J065054C02GGACCCACGCGNONE 
J065117N17GGACCCACGCGNONE 
J075020B19GGACCCACGCGNONE 
J075021C15GGACCCACGCGNONE 
J075030E13GGACCCACGCGNONE 
J075046B01GGACCCACGCGNONE 
J075052L03GGACCCACGCGNONE 
J075071L10GGACCCACGCGNONE 
J075083L22GGACCCACGCGNONE 
J075108H22GGACCCACGCGNONE 
J075112G22GGACCCACGCGNONE 
J075112I23GGACCCACGCGNONE 
J075115C09GGACCCACGCGNONE 
J075118B03GGACCCACGCGNONE 
J075123H10GGACCCACGCGNONE 
J075123J08GGACCCACGCGNONE 
J075124J05GGACCCACGCGNONE 
J075125O04GGACCCACGCGNONE 
J075143D17GGACCCACGCGNONE 
J075157I06GGACCCACGCGNONE 
J090031B18GGACCCACGCGNONE 
J100030M07GGACCCACGCGNONE 
J100037E19GGACCCACGCGNONE 
J100087H18GGACCCACGCGNONE 
Os06g0677600009-200-F02CGCGTGGGTCCNONE 
AK063252CGCGTGGGTCCLike-Sm ribonucleoprotein, core family protein. 
J075028G10CGCGTGGGTCCNONE 
J075189D08CGCGTGGGTCCNONE 
J090045C02CGCGTGGGTCCNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0139400AB096864CGCGTGGGCCCCACTCCNONE 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK099140CGCGTGGGCCCCACTCCNONE 
AK099183CGCGTGGGCCCCACTCCNONE 
J013033B01CGCGTGGGCCCCACTCCNONE 
J013157B14CGCGTGGGCCCCACTCCNONE 
J023052E04CGCGTGGGCCCCACTCCNONE 
J023086K05CGCGTGGGCCCCACTCCNONE 
J023099C15CGCGTGGGCCCCACTCCNONE 
J033025C08CGCGTGGGCCCCACTCCNONE 
J033072I24CGCGTGGGCCCCACTCCNONE 
J043020I04CGCGTGGGCCCCACTCCNONE 
J090039I21CGCGTGGGCCCCACTCCNONE 
J090078P20CGCGTGGGCCCCACTCCNONE 
J090084C18CGCGTGGGCCCCACTCCNONE 
J100024F07CGCGTGGGCCCCACTCCNONE 
J100054D22CGCGTGGGCCCCACTCCNONE 
J100062O08CGCGTGGGCCCCACTCCNONE 
Os07g0223100006-044-G07CCCACGCGTCCCACCNONE 
006-071-E10CCCACGCGTCCCACCNONE 
006-077-A04CCCACGCGTCCCACCNONE 
009-162-H05CCCACGCGTCCCACCNONE 
J023050M10CCCACGCGTCCCACCNONE 
J023055F05CCCACGCGTCCCACCNONE 
J023060I11CCCACGCGTCCCACCNONE 
J023101M01CCCACGCGTCCCACCNONE 
J065059J21CCCACGCGTCCCACCNONE 
J065087I18CCCACGCGTCCCACCNONE 
J065113L17CCCACGCGTCCCACCNONE 
J065123E19CCCACGCGTCCCACCNONE 
J065137O04CCCACGCGTCCCACCNONE 
J065217M03CCCACGCGTCCCACCNONE 
J090012O14CCCACGCGTCCCACCNONE 
J090014C13CCCACGCGTCCCACCNONE 
J090060C24CCCACGCGTCCCACCNONE 
J100037H14CCCACGCGTCCCACCNONE 
J100060E10CCCACGCGTCCCACCNONE 
J100067L04CCCACGCGTCCCACCNONE 
J100075G09CCCACGCGTCCCACCNONE 
J100077C15CCCACGCGTCCCACCNONE 
Os07g0258400AK121534ACCCGCGCGCCCACGCGNONE 
L41217ACCCGCGCGCCCACGCGNONE 
S81897ACCCGCGCGCCCACGCGOsNramp1 (Integral membrane protein). 
Os07g0408500AK103596CTCGGCCCCACGCGSimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0438800AK060412CCCACGCGNONE 
AK100065CCCACGCGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCACGCGNONE 
AY224478CCCACGCGNONE 
J013160O05CCCACGCGNONE 
J023030C05CCCACGCGNONE 
J033025O04CCCACGCGNONE 
J033121P15CCCACGCGNONE 
J043034I23CCCACGCGNONE 
J065022N01CCCACGCGNONE 
J065022N02CCCACGCGNONE 
J065023M01CCCACGCGNONE 
J065101G13CCCACGCGNONE 
J075058P13CCCACGCGNONE 
J075186K10CCCACGCGNONE 
J075199F17CCCACGCGNONE 
Os07g0496200AK064866CCCACGCGNONE 
AK065801CCCACGCGSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0502200006-027-C06ACGCGTGGGNONE 
012-007-C05ACGCGTGGGNONE 
AK120682ACGCGTGGGMulti antimicrobial extrusion protein MatE family protein. 
J053045G13ACGCGTGGGNONE 
J053064I18ACGCGTGGGNONE 
J053091G24ACGCGTGGGNONE 
J065016E10ACGCGTGGGNONE 
J065021B18ACGCGTGGGNONE 
J065022A17ACGCGTGGGNONE 
J065059D18ACGCGTGGGNONE 
J065063N19ACGCGTGGGNONE 
J065065O10ACGCGTGGGNONE 
J065196F12ACGCGTGGGNONE 
J065208I01ACGCGTGGGNONE 
J065218G15ACGCGTGGGNONE 
J100040G01ACGCGTGGGNONE 
J100060M03ACGCGTGGGNONE 
J100061P09ACGCGTGGGNONE 
J100065P05ACGCGTGGGNONE 
Os07g0507300015-011-B09CCCACGCGNONE 
AK102538CCCACGCGSimilar to GCK-like kinase MIK. 
AK106514CCCACGCGNONE 
J033033M12CCCACGCGNONE 
J033044C06CCCACGCGNONE 
J033129B15CCCACGCGNONE 
Os07g0568900009-083-H02CGCGTGGGNONE 
AK062660CGCGTGGGConserved hypothetical protein. 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGGCCCACGCGNONE 
AK104756CACGGCCCACGCGNONE 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
Os07g0598500AK073214ACGCGTGGGTCCCACProtein prenyltransferase domain containing protein. 
J065192M24ACGCGTGGGTCCCACNONE 
J100039G03ACGCGTGGGTCCCACNONE 
Os07g0603100AK101352CGCGTGGGGCCCACCANuclear transport factor 2 domain containing protein. 
J023077E09CGCGTGGGGCCCACCANONE 
J023081N15CGCGTGGGGCCCACCANONE 
J033022N22CGCGTGGGGCCCACCANONE 
J033024M18CGCGTGGGGCCCACCANONE 
J033034P09CGCGTGGGGCCCACCANONE 
J033046A06CGCGTGGGGCCCACCANONE 
J033051K01CGCGTGGGGCCCACCANONE 
J033081P09CGCGTGGGGCCCACCANONE 
J033091B17CGCGTGGGGCCCACCANONE 
J033092K23CGCGTGGGGCCCACCANONE 
J033132J09CGCGTGGGGCCCACCANONE 
J033144A14CGCGTGGGGCCCACCANONE 
J033145A14CGCGTGGGGCCCACCANONE 
J043021B20CGCGTGGGGCCCACCANONE 
J053024D23CGCGTGGGGCCCACCANONE 
J065212J10CGCGTGGGGCCCACCANONE 
J090055M05CGCGTGGGGCCCACCANONE 
J090065E14CGCGTGGGGCCCACCANONE 
J090092J06CGCGTGGGGCCCACCANONE 
Os07g0608400AK109447GGTGGGCCCCACGCGSimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0628500AK059560GCCCACCCCACGCGNONE 
AK070963GCCCACCCCACGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337GCCCACCCCACGCGNONE 
J023068N18GCCCACCCCACGCGNONE 
J023088M08GCCCACCCCACGCGNONE 
J033072H21GCCCACCCCACGCGNONE 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
006-050-D12TCCGGCCCCACGCGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
009-124-B10TCCGGCCCCACGCGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK061123TCCGGCCCCACGCGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK066432TCCGGCCCCACGCGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
AK104664TCCGGCCCCACGCGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013064M13TCCGGCCCCACGCGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J013122O12TCCGGCCCCACGCGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033044A16TCCGGCCCCACGCGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J033144D14TCCGGCCCCACGCGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
J090078P13TCCGGCCCCACGCGNONE 
Os07g0673400009-130-B03GCCCACGCGNONE 
014-016-A11GCCCACGCGNONE 
AF491815GCCCACGCGNONE 
AK064061GCCCACGCGUniversal stress protein (Usp) family protein. 
AK073356GCCCACGCGNONE 
AY224503GCCCACGCGNONE 
J033028K22GCCCACGCGNONE 
J065010E10GCCCACGCGNONE 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0127600AK058365CCCACGCGTGCTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CCCACGCGTGCTGGGCCCCNONE 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10CCCACGCGTGCTGGGCCCCNONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17CCCACGCGTGCTGGGCCCCNONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10CCCACGCGTGCTGGGCCCCNONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
Os08g0127700012-086-F03GGGGCCCAGCACGCGTGGGNONE 
012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350GGGGCCCAGCACGCGTGGGNONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242GGGGCCCAGCACGCGTGGGNONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK121348GGGGCCCAGCACGCGTGGGConserved hypothetical protein. 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
J033027J18GGGGCCCAGCACGCGTGGGNONE 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22GGGGCCCAGCACGCGTGGGNONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17GGGGCCCAGCACGCGTGGGNONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02GGGGCCCAGCACGCGTGGGNONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04GGGGCCCAGCACGCGTGGGNONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14GGGGCCCAGCACGCGTGGGNONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12GGGGCCCAGCACGCGTGGGNONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
Os08g0135900AK072535CCCCCGCGTGGGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0192800AK059490CCCACGCGNONE 
AK101678CCCACGCGNONE 
AK120613CCCACGCGBromodomain containing protein. 
J080039B22CCCACGCGNONE 
J080039I23CCCACGCGNONE 
J080074D19CCCACGCGNONE 
J080086N13CCCACGCGNONE 
Os08g0267900AK107040CCCACTCCCCACGCGConserved hypothetical protein. 
Os08g0347200AK058279CCCACGCGTGGHypothetical protein. 
J100058J16CCCACGCGTGGNONE 
Os08g0397900006-033-G02AGAGTGGGCCCCACGCGNONE 
009-131-F03AGAGTGGGCCCCACGCGNONE 
AK060114AGAGTGGGCCCCACGCGNONE 
AK098973AGAGTGGGCCCCACGCGNONE 
AK109817AGAGTGGGCCCCACGCGConserved hypothetical protein. 
J013089E18AGAGTGGGCCCCACGCGNONE 
J100081N17AGAGTGGGCCCCACGCGNONE 
Os08g0450200AK072779ACGCGTGGGSimilar to Pectin methylesterase (Fragment). 
J023077K13ACGCGTGGGNONE 
Os08g0457600AB095096GCCCACGCGNONE 
AK065020GCCCACGCGSimilar to RSH2. 
AK099624GCCCACGCGNONE 
J013001F20GCCCACGCGNONE 
J013075L22GCCCACGCGNONE 
J023001L02GCCCACGCGNONE 
J023075M07GCCCACGCGNONE 
J033125H13GCCCACGCGNONE 
Os08g0474000009-121-F01CGCGTGGGGGATNONE 
009-124-B06CGCGTGGGGGATNONE 
AK062882CGCGTGGGGGATSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0532300009-122-A05GTCCGTCCCACGCGNONE 
009-129-H05GTCCGTCCCACGCGNONE 
AB011262GTCCGTCCCACGCGNONE 
AK065141GTCCGTCCCACGCGNONE 
AK119730GTCCGTCCCACGCGSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14GTCCGTCCCACGCGNONE 
J013042K23GTCCGTCCCACGCGNONE 
J023057J08GTCCGTCCCACGCGNONE 
J023057N10GTCCGTCCCACGCGNONE 
J023113C21GTCCGTCCCACGCGNONE 
J053054E03GTCCGTCCCACGCGNONE 
J053062B07GTCCGTCCCACGCGNONE 
J053075O17GTCCGTCCCACGCGNONE 
J053075P09GTCCGTCCCACGCGNONE 
J065024H05GTCCGTCCCACGCGNONE 
J065049F22GTCCGTCCCACGCGNONE 
J065063L03GTCCGTCCCACGCGNONE 
J065102O07GTCCGTCCCACGCGNONE 
J065104M12GTCCGTCCCACGCGNONE 
J065119E04GTCCGTCCCACGCGNONE 
J065153E10GTCCGTCCCACGCGNONE 
J065168M24GTCCGTCCCACGCGNONE 
J065173I10GTCCGTCCCACGCGNONE 
J065181L04GTCCGTCCCACGCGNONE 
J065184I18GTCCGTCCCACGCGNONE 
J065203M15GTCCGTCCCACGCGNONE 
J075004C21GTCCGTCCCACGCGNONE 
J075047B11GTCCGTCCCACGCGNONE 
J075055F18GTCCGTCCCACGCGNONE 
J075065G09GTCCGTCCCACGCGNONE 
J075094O14GTCCGTCCCACGCGNONE 
J075143C22GTCCGTCCCACGCGNONE 
J075153K18GTCCGTCCCACGCGNONE 
J075164N10GTCCGTCCCACGCGNONE 
J075197C11GTCCGTCCCACGCGNONE 
J080001A01GTCCGTCCCACGCGNONE 
J080003B11GTCCGTCCCACGCGNONE 
J080006G17GTCCGTCCCACGCGNONE 
J080007J06GTCCGTCCCACGCGNONE 
J080010H12GTCCGTCCCACGCGNONE 
J080014I01GTCCGTCCCACGCGNONE 
J080015C16GTCCGTCCCACGCGNONE 
J080016P19GTCCGTCCCACGCGNONE 
J080020G24GTCCGTCCCACGCGNONE 
J080021E12GTCCGTCCCACGCGNONE 
J080023I11GTCCGTCCCACGCGNONE 
J080024H24GTCCGTCCCACGCGNONE 
J080025G18GTCCGTCCCACGCGNONE 
J080028H08GTCCGTCCCACGCGNONE 
J080030G08GTCCGTCCCACGCGNONE 
J080031H20GTCCGTCCCACGCGNONE 
J080034C20GTCCGTCCCACGCGNONE 
J080040H13GTCCGTCCCACGCGNONE 
J080044M04GTCCGTCCCACGCGNONE 
J080047D02GTCCGTCCCACGCGNONE 
J080049D17GTCCGTCCCACGCGNONE 
J080049J17GTCCGTCCCACGCGNONE 
J080050A05GTCCGTCCCACGCGNONE 
J080051C11GTCCGTCCCACGCGNONE 
J080051K06GTCCGTCCCACGCGNONE 
J080053A07GTCCGTCCCACGCGNONE 
J080053I08GTCCGTCCCACGCGNONE 
J080056L12GTCCGTCCCACGCGNONE 
J080061I19GTCCGTCCCACGCGNONE 
J080075G09GTCCGTCCCACGCGNONE 
J080078C23GTCCGTCCCACGCGNONE 
J080080I21GTCCGTCCCACGCGNONE 
J080084F04GTCCGTCCCACGCGNONE 
J080085K16GTCCGTCCCACGCGNONE 
J080097A12GTCCGTCCCACGCGNONE 
J080097N01GTCCGTCCCACGCGNONE 
J090027L10GTCCGTCCCACGCGNONE 
J100034N17GTCCGTCCCACGCGNONE 
Os08g0544800009-168-G01GTGTGGGGCCCACGCGNONE 
011-046-D09GTGTGGGGCCCACGCGNONE 
012-003-C08GTGTGGGGCCCACGCGNONE 
012-042-B06GTGTGGGGCCCACGCGNONE 
013-035-H12GTGTGGGGCCCACGCGNONE 
013-072-A10GTGTGGGGCCCACGCGNONE 
014-010-B11GTGTGGGGCCCACGCGNONE 
014-097-E06GTGTGGGGCCCACGCGNONE 
015-003-E12GTGTGGGGCCCACGCGNONE 
015-040-B04GTGTGGGGCCCACGCGNONE 
AK060536GTGTGGGGCCCACGCGNONE 
AK102666GTGTGGGGCCCACGCGNONE 
AK119660GTGTGGGGCCCACGCGPCF2. 
D87261GTGTGGGGCCCACGCGNONE 
J090049N23GTGTGGGGCCCACGCGNONE 
J090084G06GTGTGGGGCCCACGCGNONE 
Os08g0557600AB026731CGCGTGGGCNONE 
AK102459CGCGTGGGCSimilar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase). 
J023088J22CGCGTGGGCNONE 
J033094C01CGCGTGGGCNONE 
J033125C20CGCGTGGGCNONE 
J065039E01CGCGTGGGCNONE 
J065212L01CGCGTGGGCNONE 
J075076D03CGCGTGGGCNONE 
J090019L14CGCGTGGGCNONE 
J090053K23CGCGTGGGCNONE 
Os09g0323000AK121426CGCGTGGGCCCCACTCCACCTGTCSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0342000AK111440GCCCACGCGCyclin-like F-box domain containing protein. 
Os09g0346500004-015-F05GCCCCACGCGCGAGNONE 
005-018-A05GCCCCACGCGCGAGNONE 
006-021-B03GCCCCACGCGCGAGNONE 
006-021-D10GCCCCACGCGCGAGNONE 
006-021-E07GCCCCACGCGCGAGNONE 
006-021-F03GCCCCACGCGCGAGNONE 
006-022-A06GCCCCACGCGCGAGNONE 
006-022-B07GCCCCACGCGCGAGNONE 
006-022-C02GCCCCACGCGCGAGNONE 
006-023-E02GCCCCACGCGCGAGNONE 
006-023-G08GCCCCACGCGCGAGNONE 
006-023-H05GCCCCACGCGCGAGNONE 
006-024-B09GCCCCACGCGCGAGNONE 
006-024-E02GCCCCACGCGCGAGNONE 
006-025-F01GCCCCACGCGCGAGNONE 
006-025-G12GCCCCACGCGCGAGNONE 
006-026-D02GCCCCACGCGCGAGNONE 
006-026-D05GCCCCACGCGCGAGNONE 
006-028-C05GCCCCACGCGCGAGNONE 
006-028-E07GCCCCACGCGCGAGNONE 
006-028-F05GCCCCACGCGCGAGNONE 
006-028-F07GCCCCACGCGCGAGNONE 
006-028-F08GCCCCACGCGCGAGNONE 
006-028-G09GCCCCACGCGCGAGNONE 
006-029-B04GCCCCACGCGCGAGNONE 
006-029-C10GCCCCACGCGCGAGNONE 
006-030-H03GCCCCACGCGCGAGNONE 
006-031-F04GCCCCACGCGCGAGNONE 
006-031-G11GCCCCACGCGCGAGNONE 
006-032-D07GCCCCACGCGCGAGNONE 
006-032-G02GCCCCACGCGCGAGNONE 
006-032-H02GCCCCACGCGCGAGNONE 
006-032-H10GCCCCACGCGCGAGNONE 
006-033-A05GCCCCACGCGCGAGNONE 
006-033-C04GCCCCACGCGCGAGNONE 
006-033-D02GCCCCACGCGCGAGNONE 
006-034-C05GCCCCACGCGCGAGNONE 
006-034-D01GCCCCACGCGCGAGNONE 
006-034-H10GCCCCACGCGCGAGNONE 
006-035-A10GCCCCACGCGCGAGNONE 
006-035-B10GCCCCACGCGCGAGNONE 
006-035-D05GCCCCACGCGCGAGNONE 
006-036-B07GCCCCACGCGCGAGNONE 
006-036-F04GCCCCACGCGCGAGNONE 
006-036-H02GCCCCACGCGCGAGNONE 
006-036-H05GCCCCACGCGCGAGNONE 
006-036-H06GCCCCACGCGCGAGNONE 
006-037-C10GCCCCACGCGCGAGNONE 
006-037-F03GCCCCACGCGCGAGNONE 
006-038-B05GCCCCACGCGCGAGNONE 
006-038-E03GCCCCACGCGCGAGNONE 
006-038-E06GCCCCACGCGCGAGNONE 
006-039-B07GCCCCACGCGCGAGNONE 
006-039-D03GCCCCACGCGCGAGNONE 
006-039-F05GCCCCACGCGCGAGNONE 
006-041-A10GCCCCACGCGCGAGNONE 
006-041-B07GCCCCACGCGCGAGNONE 
006-042-B05GCCCCACGCGCGAGNONE 
006-042-C04GCCCCACGCGCGAGNONE 
006-042-D12GCCCCACGCGCGAGNONE 
006-043-C11GCCCCACGCGCGAGNONE 
006-043-E04GCCCCACGCGCGAGNONE 
006-044-E09GCCCCACGCGCGAGNONE 
006-045-B01GCCCCACGCGCGAGNONE 
006-045-G02GCCCCACGCGCGAGNONE 
006-046-A01GCCCCACGCGCGAGNONE 
006-046-C07GCCCCACGCGCGAGNONE 
006-046-G02GCCCCACGCGCGAGNONE 
006-047-B02GCCCCACGCGCGAGNONE 
006-047-C01GCCCCACGCGCGAGNONE 
006-047-D05GCCCCACGCGCGAGNONE 
006-047-F09GCCCCACGCGCGAGNONE 
006-049-E05GCCCCACGCGCGAGNONE 
006-049-E09GCCCCACGCGCGAGNONE 
006-050-A01GCCCCACGCGCGAGNONE 
006-050-A12GCCCCACGCGCGAGNONE 
006-050-C05GCCCCACGCGCGAGNONE 
006-050-C06GCCCCACGCGCGAGNONE 
006-050-G06GCCCCACGCGCGAGNONE 
006-050-G10GCCCCACGCGCGAGNONE 
006-050-H02GCCCCACGCGCGAGNONE 
006-051-A02GCCCCACGCGCGAGNONE 
006-051-B09GCCCCACGCGCGAGNONE 
006-051-C02GCCCCACGCGCGAGNONE 
006-051-H01GCCCCACGCGCGAGNONE 
006-052-B12GCCCCACGCGCGAGNONE 
006-052-D08GCCCCACGCGCGAGNONE 
006-052-E08GCCCCACGCGCGAGNONE 
006-052-F05GCCCCACGCGCGAGNONE 
006-052-F11GCCCCACGCGCGAGNONE 
006-052-G08GCCCCACGCGCGAGNONE 
006-052-G11GCCCCACGCGCGAGNONE 
006-052-H07GCCCCACGCGCGAGNONE 
006-053-A08GCCCCACGCGCGAGNONE 
006-053-B06GCCCCACGCGCGAGNONE 
006-054-H08GCCCCACGCGCGAGNONE 
006-055-B08GCCCCACGCGCGAGNONE 
006-055-E03GCCCCACGCGCGAGNONE 
006-055-H08GCCCCACGCGCGAGNONE 
006-056-A10GCCCCACGCGCGAGNONE 
006-056-C10GCCCCACGCGCGAGNONE 
006-056-E04GCCCCACGCGCGAGNONE 
006-057-A10GCCCCACGCGCGAGNONE 
006-058-A02GCCCCACGCGCGAGNONE 
006-058-D11GCCCCACGCGCGAGNONE 
006-058-F01GCCCCACGCGCGAGNONE 
006-058-H03GCCCCACGCGCGAGNONE 
006-058-H10GCCCCACGCGCGAGNONE 
006-059-B04GCCCCACGCGCGAGNONE 
006-059-F04GCCCCACGCGCGAGNONE 
006-060-A06GCCCCACGCGCGAGNONE 
006-060-B07GCCCCACGCGCGAGNONE 
006-060-D03GCCCCACGCGCGAGNONE 
006-062-B09GCCCCACGCGCGAGNONE 
006-062-C02GCCCCACGCGCGAGNONE 
006-062-D01GCCCCACGCGCGAGNONE 
006-062-E01GCCCCACGCGCGAGNONE 
006-062-F03GCCCCACGCGCGAGNONE 
006-062-H02GCCCCACGCGCGAGNONE 
006-063-C03GCCCCACGCGCGAGNONE 
006-063-G02GCCCCACGCGCGAGNONE 
006-063-H10GCCCCACGCGCGAGNONE 
006-064-H01GCCCCACGCGCGAGNONE 
006-067-F08GCCCCACGCGCGAGNONE 
006-068-G11GCCCCACGCGCGAGNONE 
006-071-B06GCCCCACGCGCGAGNONE 
006-071-G08GCCCCACGCGCGAGNONE 
006-071-H10GCCCCACGCGCGAGNONE 
006-072-H11GCCCCACGCGCGAGNONE 
006-073-C12GCCCCACGCGCGAGNONE 
006-073-E07GCCCCACGCGCGAGNONE 
006-073-H09GCCCCACGCGCGAGNONE 
006-074-C03GCCCCACGCGCGAGNONE 
006-074-F03GCCCCACGCGCGAGNONE 
006-074-G02GCCCCACGCGCGAGNONE 
006-074-H12GCCCCACGCGCGAGNONE 
006-075-C06GCCCCACGCGCGAGNONE 
006-075-G07GCCCCACGCGCGAGNONE 
006-075-G08GCCCCACGCGCGAGNONE 
006-075-G09GCCCCACGCGCGAGNONE 
006-075-H09GCCCCACGCGCGAGNONE 
006-076-C02GCCCCACGCGCGAGNONE 
006-076-E12GCCCCACGCGCGAGNONE 
006-076-G04GCCCCACGCGCGAGNONE 
006-076-G06GCCCCACGCGCGAGNONE 
006-076-G11GCCCCACGCGCGAGNONE 
006-077-D09GCCCCACGCGCGAGNONE 
006-077-E08GCCCCACGCGCGAGNONE 
006-079-B10GCCCCACGCGCGAGNONE 
006-079-F11GCCCCACGCGCGAGNONE 
006-079-H04GCCCCACGCGCGAGNONE 
006-079-H11GCCCCACGCGCGAGNONE 
006-080-D06GCCCCACGCGCGAGNONE 
006-080-E10GCCCCACGCGCGAGNONE 
006-080-F09GCCCCACGCGCGAGNONE 
006-080-G04GCCCCACGCGCGAGNONE 
006-081-C05GCCCCACGCGCGAGNONE 
006-081-D08GCCCCACGCGCGAGNONE 
006-081-E09GCCCCACGCGCGAGNONE 
006-081-F07GCCCCACGCGCGAGNONE 
006-081-H11GCCCCACGCGCGAGNONE 
006-082-E05GCCCCACGCGCGAGNONE 
006-083-E12GCCCCACGCGCGAGNONE 
006-083-F12GCCCCACGCGCGAGNONE 
006-084-A10GCCCCACGCGCGAGNONE 
006-084-B07GCCCCACGCGCGAGNONE 
006-084-E05GCCCCACGCGCGAGNONE 
006-084-F07GCCCCACGCGCGAGNONE 
006-085-C01GCCCCACGCGCGAGNONE 
006-085-D08GCCCCACGCGCGAGNONE 
006-085-G07GCCCCACGCGCGAGNONE 
006-085-G11GCCCCACGCGCGAGNONE 
006-086-A01GCCCCACGCGCGAGNONE 
006-086-B09GCCCCACGCGCGAGNONE 
006-086-E05GCCCCACGCGCGAGNONE 
006-086-F11GCCCCACGCGCGAGNONE 
006-086-F12GCCCCACGCGCGAGNONE 
006-086-G03GCCCCACGCGCGAGNONE 
006-087-C01GCCCCACGCGCGAGNONE 
006-087-D09GCCCCACGCGCGAGNONE 
006-087-E02GCCCCACGCGCGAGNONE 
006-087-F07GCCCCACGCGCGAGNONE 
006-088-A05GCCCCACGCGCGAGNONE 
006-088-F02GCCCCACGCGCGAGNONE 
006-089-F08GCCCCACGCGCGAGNONE 
006-090-G11GCCCCACGCGCGAGNONE 
006-091-H10GCCCCACGCGCGAGNONE 
006-092-B09GCCCCACGCGCGAGNONE 
006-092-E09GCCCCACGCGCGAGNONE 
006-093-B01GCCCCACGCGCGAGNONE 
006-093-C09GCCCCACGCGCGAGNONE 
006-093-G08GCCCCACGCGCGAGNONE 
006-094-G06GCCCCACGCGCGAGNONE 
006-095-A11GCCCCACGCGCGAGNONE 
006-095-D06GCCCCACGCGCGAGNONE 
006-095-F06GCCCCACGCGCGAGNONE 
006-096-E05GCCCCACGCGCGAGNONE 
006-096-H05GCCCCACGCGCGAGNONE 
006-097-A04GCCCCACGCGCGAGNONE 
006-097-H01GCCCCACGCGCGAGNONE 
006-098-B10GCCCCACGCGCGAGNONE 
006-098-F01GCCCCACGCGCGAGNONE 
006-098-G08GCCCCACGCGCGAGNONE 
006-098-H08GCCCCACGCGCGAGNONE 
006-099-E01GCCCCACGCGCGAGNONE 
006-100-C11GCCCCACGCGCGAGNONE 
006-100-F03GCCCCACGCGCGAGNONE 
006-101-B03GCCCCACGCGCGAGNONE 
006-101-B06GCCCCACGCGCGAGNONE 
006-101-B09GCCCCACGCGCGAGNONE 
006-101-G02GCCCCACGCGCGAGNONE 
006-101-H03GCCCCACGCGCGAGNONE 
006-102-A03GCCCCACGCGCGAGNONE 
006-102-E11GCCCCACGCGCGAGNONE 
006-102-H01GCCCCACGCGCGAGNONE 
006-102-H03GCCCCACGCGCGAGNONE 
006-103-C04GCCCCACGCGCGAGNONE 
006-103-H06GCCCCACGCGCGAGNONE 
006-104-A03GCCCCACGCGCGAGNONE 
006-104-F11GCCCCACGCGCGAGNONE 
006-105-H05GCCCCACGCGCGAGNONE 
006-105-H07GCCCCACGCGCGAGNONE 
006-106-B12GCCCCACGCGCGAGNONE 
006-106-D04GCCCCACGCGCGAGNONE 
006-107-A08GCCCCACGCGCGAGNONE 
006-107-C03GCCCCACGCGCGAGNONE 
006-107-G02GCCCCACGCGCGAGNONE 
006-108-B06GCCCCACGCGCGAGNONE 
006-109-B02GCCCCACGCGCGAGNONE 
006-109-D08GCCCCACGCGCGAGNONE 
006-109-F11GCCCCACGCGCGAGNONE 
006-109-G08GCCCCACGCGCGAGNONE 
006-110-G12GCCCCACGCGCGAGNONE 
006-110-H07GCCCCACGCGCGAGNONE 
006-111-A01GCCCCACGCGCGAGNONE 
006-111-A11GCCCCACGCGCGAGNONE 
006-111-D01GCCCCACGCGCGAGNONE 
006-111-H10GCCCCACGCGCGAGNONE 
006-111-H11GCCCCACGCGCGAGNONE 
006-112-A03GCCCCACGCGCGAGNONE 
006-112-B02GCCCCACGCGCGAGNONE 
006-112-B10GCCCCACGCGCGAGNONE 
006-112-E12GCCCCACGCGCGAGNONE 
006-112-F06GCCCCACGCGCGAGNONE 
006-112-H10GCCCCACGCGCGAGNONE 
006-113-A10GCCCCACGCGCGAGNONE 
006-113-C07GCCCCACGCGCGAGNONE 
006-114-A04GCCCCACGCGCGAGNONE 
006-114-B10GCCCCACGCGCGAGNONE 
006-114-C04GCCCCACGCGCGAGNONE 
006-114-D03GCCCCACGCGCGAGNONE 
006-114-D07GCCCCACGCGCGAGNONE 
006-114-G11GCCCCACGCGCGAGNONE 
006-115-C01GCCCCACGCGCGAGNONE 
006-116-A12GCCCCACGCGCGAGNONE 
006-116-F09GCCCCACGCGCGAGNONE 
006-116-H01GCCCCACGCGCGAGNONE 
006-117-B04GCCCCACGCGCGAGNONE 
006-117-B08GCCCCACGCGCGAGNONE 
006-117-E07GCCCCACGCGCGAGNONE 
006-117-E11GCCCCACGCGCGAGNONE 
006-117-H04GCCCCACGCGCGAGNONE 
006-117-H11GCCCCACGCGCGAGNONE 
006-118-A12GCCCCACGCGCGAGNONE 
006-118-C01GCCCCACGCGCGAGNONE 
006-119-A12GCCCCACGCGCGAGNONE 
006-119-C11GCCCCACGCGCGAGNONE 
006-119-F06GCCCCACGCGCGAGNONE 
009-038-E07GCCCCACGCGCGAGNONE 
009-053-G07GCCCCACGCGCGAGNONE 
009-088-D05GCCCCACGCGCGAGNONE 
009-109-G12GCCCCACGCGCGAGNONE 
009-124-H09GCCCCACGCGCGAGNONE 
009-134-F04GCCCCACGCGCGAGNONE 
009-149-G07GCCCCACGCGCGAGNONE 
009-181-D07GCCCCACGCGCGAGNONE 
009-191-D03GCCCCACGCGCGAGNONE 
AK058305GCCCCACGCGCGAGNONE 
AK060851GCCCCACGCGCGAGSimilar to Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP). 
AK104281GCCCCACGCGCGAGNONE 
AK104288GCCCCACGCGCGAGNONE 
AK104350GCCCCACGCGCGAGNONE 
D00641GCCCCACGCGCGAGNONE 
J013091G20GCCCCACGCGCGAGNONE 
J013129G18GCCCCACGCGCGAGNONE 
J013158J17GCCCCACGCGCGAGNONE 
J023013M23GCCCCACGCGCGAGNONE 
J023062B14GCCCCACGCGCGAGNONE 
J023105C20GCCCCACGCGCGAGNONE 
J023113G18GCCCCACGCGCGAGNONE 
J065060F20GCCCCACGCGCGAGNONE 
J065132G17GCCCCACGCGCGAGNONE 
J065163A19GCCCCACGCGCGAGNONE 
J075001K18GCCCCACGCGCGAGNONE 
J075047E10GCCCCACGCGCGAGNONE 
J075050E09GCCCCACGCGCGAGNONE 
J075058J15GCCCCACGCGCGAGNONE 
J075086B22GCCCCACGCGCGAGNONE 
J075086E16GCCCCACGCGCGAGNONE 
J075092C16GCCCCACGCGCGAGNONE 
J075130A10GCCCCACGCGCGAGNONE 
J075140F10GCCCCACGCGCGAGNONE 
J075161K06GCCCCACGCGCGAGNONE 
J075176J22GCCCCACGCGCGAGNONE 
J075177I20GCCCCACGCGCGAGNONE 
J075179H01GCCCCACGCGCGAGNONE 
J080003C15GCCCCACGCGCGAGNONE 
J080005N03GCCCCACGCGCGAGNONE 
J080011I16GCCCCACGCGCGAGNONE 
J080014C08GCCCCACGCGCGAGNONE 
J080017L17GCCCCACGCGCGAGNONE 
J080018K10GCCCCACGCGCGAGNONE 
J080022J03GCCCCACGCGCGAGNONE 
J080024I10GCCCCACGCGCGAGNONE 
J080026F17GCCCCACGCGCGAGNONE 
J080029G15GCCCCACGCGCGAGNONE 
J080032H11GCCCCACGCGCGAGNONE 
J080034C09GCCCCACGCGCGAGNONE 
J080035B22GCCCCACGCGCGAGNONE 
J080037H20GCCCCACGCGCGAGNONE 
J080039J16GCCCCACGCGCGAGNONE 
J080042J20GCCCCACGCGCGAGNONE 
J080044F03GCCCCACGCGCGAGNONE 
J080044F23GCCCCACGCGCGAGNONE 
J080045H08GCCCCACGCGCGAGNONE 
J080048H13GCCCCACGCGCGAGNONE 
J080062K23GCCCCACGCGCGAGNONE 
J080063G19GCCCCACGCGCGAGNONE 
J080068M05GCCCCACGCGCGAGNONE 
J080069L18GCCCCACGCGCGAGNONE 
J080071P09GCCCCACGCGCGAGNONE 
J080074E21GCCCCACGCGCGAGNONE 
J080075A14GCCCCACGCGCGAGNONE 
J080075C06GCCCCACGCGCGAGNONE 
J080085D10GCCCCACGCGCGAGNONE 
J080085E07GCCCCACGCGCGAGNONE 
J080086E17GCCCCACGCGCGAGNONE 
J080089F09GCCCCACGCGCGAGNONE 
J080089O19GCCCCACGCGCGAGNONE 
J080096A04GCCCCACGCGCGAGNONE 
J080301D10GCCCCACGCGCGAGNONE 
J080301E15GCCCCACGCGCGAGNONE 
J080306C23GCCCCACGCGCGAGNONE 
J080307L24GCCCCACGCGCGAGNONE 
J080308G21GCCCCACGCGCGAGNONE 
J080315H03GCCCCACGCGCGAGNONE 
J090014I10GCCCCACGCGCGAGNONE 
J090018H12GCCCCACGCGCGAGNONE 
J090031J20GCCCCACGCGCGAGNONE 
J090055A05GCCCCACGCGCGAGNONE 
J090062H23GCCCCACGCGCGAGNONE 
J090071K20GCCCCACGCGCGAGNONE 
J090099G11GCCCCACGCGCGAGNONE 
J100045E10GCCCCACGCGCGAGNONE 
J100046E18GCCCCACGCGCGAGNONE 
J100052B19GCCCCACGCGCGAGNONE 
J100053A01GCCCCACGCGCGAGNONE 
J100079P18GCCCCACGCGCGAGNONE 
Os09g0371200J100027I16GCCCACGCGTMajor facilitator superfamily MFS_1 protein. 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0420300AK120582GCCCACGCGDNA glycosylase family protein. 
Os09g0445600AK107839GCCCCACGCGTConserved hypothetical protein. 
Os09g0458200AK108675CGCGTGGGCConserved hypothetical protein. 
Os09g0476100AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0525900006-115-E04CCCACGCGNONE 
AK059988CCCACGCGRhomboid-like protein family protein. 
AK071290CCCACGCGNONE 
J013153K05CCCACGCGNONE 
J023087M04CCCACGCGNONE 
J065165B13CCCACGCGNONE 
J075013G15CCCACGCGNONE 
J075028A09CCCACGCGNONE 
J075031I06CCCACGCGNONE 
J075051C21CCCACGCGNONE 
J075114H22CCCACGCGNONE 
J075129A19CCCACGCGNONE 
J075129M12CCCACGCGNONE 
J075166N24CCCACGCGNONE 
J075167M23CCCACGCGNONE 
J075168D10CCCACGCGNONE 
Os09g0532000AK105810CCCACGCGNONE 
AY850134CCCACGCGConserved hypothetical protein. 
J065022C05CCCACGCGNONE 
J065054B06CCCACGCGNONE 
J065072C03CCCACGCGNONE 
J065121O09CCCACGCGNONE 
J065163P22CCCACGCGNONE 
J065192G01CCCACGCGNONE 
J065194H12CCCACGCGNONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
003-104-E05CACACACCCCCACGCGNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03CACACACCCCCACGCGNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK067774CACACACCCCCACGCGNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
AK100449CACACACCCCCACGCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J013048F07CACACACCCCCACGCGNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023026E11CACACACCCCCACGCGNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023028B20CACACACCCCCACGCGNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023050P11CACACACCCCCACGCGNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023052K08CACACACCCCCACGCGNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023075J03CACACACCCCCACGCGNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023078E15CACACACCCCCACGCGNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023090P12CACACACCCCCACGCGNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023120E01CACACACCCCCACGCGNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01CACACACCCCCACGCGNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033027K23CACACACCCCCACGCGNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058A09CACACACCCCCACGCGNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033058C12CACACACCCCCACGCGNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J033125A04CACACACCCCCACGCGNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J043040L01CACACACCCCCACGCGNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053061D06CACACACCCCCACGCGNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J053096N13CACACACCCCCACGCGNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J065193H10CACACACCCCCACGCGNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J090075L17CACACACCCCCACGCGNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
J100050D10CACACACCCCCACGCGNONE 
Os09g0535000AK058712CGCGTGGGCSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CGCGTGGGCNONE 
AK069832CGCGTGGGCNONE 
J100065D20CGCGTGGGCNONE 
Os09g0559900AK111842CACGGCCCCACGCGProtein kinase-like domain containing protein. 
Os11g0137500AK070070CGCGTGGGCTGATranscription factor TFIIE, alpha subunit family protein. 
Os11g0163500AK101154CGCGTGGGGGCHomeodomain-like containing protein. 
Os11g0166800AK070928CGCGTGGGGCRNA polymerase II transcription factor SIII subunit A family protein. 
Os11g0170400AK066519CCCACGCGTGGConserved hypothetical protein. 
J013039A08CCCACGCGTGGNONE 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os12g0108201013-071-B01CCCACGCGTGGNONE 
J013060C24CCCACGCGTGGNONE 
J023026L08CCCACGCGTGGHypothetical protein. 
Os12g0116000AK102691CGCGTGGGNONE 
J023087D16CGCGTGGGNONE 
J033099O13CGCGTGGGNONE 
Os12g0122450Os12g0122450CCCACGCGTNONE 
Os12g0137100AK059278GCCCACGCGAnnexin, type VII family protein. 
Os12g0285600AK069104CTGGCCCACGCGOxysterol-binding protein family protein. 
Os12g0511300015-003-D12CCCACGCGNONE 
AK064077CCCACGCGNONE 
AK109892CCCACGCGNONE 
AK121419CCCACGCGConserved hypothetical protein. 
J065020L21CCCACGCGNONE 
J065033D11CCCACGCGNONE 
J065038K03CCCACGCGNONE 
J065043A18CCCACGCGNONE 
J065056F02CCCACGCGNONE 
J065071M10CCCACGCGNONE 
J065158M05CCCACGCGNONE 
J065161E23CCCACGCGNONE 
J065202O07CCCACGCGNONE 
J065208N21CCCACGCGNONE 
J100069C18CCCACGCGNONE 
J100088H18CCCACGCGNONE 
J100090B10CCCACGCGNONE 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0581700AK111563CCCACGCGConserved hypothetical protein. 
J023011D12CCCACGCGNONE 
J065176G05CCCACGCGNONE 
J065192E06CCCACGCGNONE 
J100075L05CCCACGCGNONE 
Os12g0592900AK064058CGCGTGGGCCCCNONE 
AK120039CGCGTGGGCCCCHypothetical protein. 
J065081M07CGCGTGGGCCCCNONE 
J065105G17CGCGTGGGCCCCNONE 
J075017E06CGCGTGGGCCCCNONE 
J075040M14CGCGTGGGCCCCNONE 
J075052I18CGCGTGGGCCCCNONE 
J075055J23CGCGTGGGCCCCNONE 
J075057L03CGCGTGGGCCCCNONE 
J075099C10CGCGTGGGCCCCNONE 
J075104C21CGCGTGGGCCCCNONE 
J075172L12CGCGTGGGCCCCNONE 
J075179D22CGCGTGGGCCCCNONE 
J075182G07CGCGTGGGCCCCNONE 
J075194N11CGCGTGGGCCCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.