version

Summary of OsREG531 (All List)

OrganismOryza sativa  
IDOsREG531  
SequenceCCCACGGG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
ACGGGC  function unknown  
PLACE Motif 
Total Entry Count920  

Entry Sequences (920 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07CCCACGGGNONE 
AK063774CCCACGGGTranslocon-associated beta family protein. 
AK099081CCCACGGGNONE 
AK099360CCCACGGGNONE 
J013096O20CCCACGGGNONE 
J023002P14CCCACGGGNONE 
J033046F10CCCACGGGNONE 
J033084K08CCCACGGGNONE 
J065011H22CCCACGGGNONE 
J090017O18CCCACGGGNONE 
J090047F15CCCACGGGNONE 
J090049G20CCCACGGGNONE 
Os01g0134200AK059156CCCACGGGNONE 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0175100AK071289GCCCACGGGKv1.4 voltage-gated K+ channel family protein. 
J023088B10GCCCACGGGNONE 
J065122H15GCCCACGGGNONE 
J065140B19GCCCACGGGNONE 
J100031E12GCCCACGGGNONE 
J100068J03GCCCACGGGNONE 
J100083E12GCCCACGGGNONE 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK111284CCCGTGGGCCCACCCNONE 
Os01g0244400J075054J20GCCCACGGGProtein of unknown function DUF1618 domain containing protein. 
J075101O11GCCCACGGGNONE 
J075123K08GCCCACGGGNONE 
Os01g0286600AB057749GCCCACGGGSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0327400AK068063CCCACGGGSimilar to Peroxidase (Fragment). 
AK099241CCCACGGGNONE 
J013129I12CCCACGGGNONE 
J033114B18CCCACGGGNONE 
J065025P08CCCACGGGNONE 
J100042P06CCCACGGGNONE 
J100067A20CCCACGGGNONE 
Os01g0564300AK064825CCCGTGGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os01g0571300016-074-C10GCTTTCCCCCCGTGGGNONE 
AK064271GCTTTCCCCCCGTGGGSimilar to Heat shock transcription factor 31 (Fragment). 
Os01g0582400AK069484CCCACGGGSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12CCCACGGGNONE 
J023036F15CCCACGGGNONE 
J023095O16CCCACGGGNONE 
J033102M15CCCACGGGNONE 
J043013I06CCCACGGGNONE 
J065083M21CCCACGGGNONE 
J065176A17CCCACGGGNONE 
Os01g0684800AK073525GCCCACGGGProtein prenyltransferase domain containing protein. 
Os01g0714600006-072-F05CCCGTGGGNONE 
AK059855CCCGTGGGConserved hypothetical protein. 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
J013131M12GGGGCCCACGGGNONE 
J023027B15GGGGCCCACGGGNONE 
J023059I06GGGGCCCACGGGNONE 
J023095L05GGGGCCCACGGGNONE 
J033033E20GGGGCCCACGGGNONE 
J033105F24GGGGCCCACGGGNONE 
J033148N05GGGGCCCACGGGNONE 
J065060H14GGGGCCCACGGGNONE 
J090093E17GGGGCCCACGGGNONE 
Os01g0821800015-005-A04CCCGTGGGCTNONE 
AK073951CCCGTGGGCTNONE 
AK103171CCCGTGGGCTNONE 
AK119168CCCGTGGGCTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22CCCGTGGGCTNONE 
J033098N09CCCGTGGGCTNONE 
J033121G11CCCGTGGGCTNONE 
J090030L03CCCGTGGGCTNONE 
Os01g0848900AK065438CCCGTGGGConserved hypothetical protein. 
J013025A05CCCGTGGGNONE 
J053026J20CCCGTGGGNONE 
J053027B19CCCGTGGGNONE 
J053033A12CCCGTGGGNONE 
J053039K16CCCGTGGGNONE 
J053039K17CCCGTGGGNONE 
J053051N18CCCGTGGGNONE 
J053053B06CCCGTGGGNONE 
J053060A12CCCGTGGGNONE 
J053074L18CCCGTGGGNONE 
J053083E22CCCGTGGGNONE 
J053086P22CCCGTGGGNONE 
J053095G12CCCGTGGGNONE 
J100018E11CCCGTGGGNONE 
Os01g0863300014-030-D08CCCCCACGGGNONE 
AK111571CCCCCACGGGSimilar to MCB2 protein. 
J013071A13CCCCCACGGGNONE 
J075060E09CCCCCACGGGNONE 
J075138C14CCCCCACGGGNONE 
J075150M17CCCCCACGGGNONE 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK072312GTGGCCCACGGGNONE 
AK103428GTGGCCCACGGGNONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0301400AK121646CCCACGGGThioredoxin-like fold domain containing protein. 
J033028E10CCCACGGGNONE 
J033058J23CCCACGGGNONE 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0634900006-032-G12AGCCGTTGGCCCGTGGGNONE 
006-033-E09AGCCGTTGGCCCGTGGGNONE 
006-117-F10AGCCGTTGGCCCGTGGGNONE 
006-118-E01AGCCGTTGGCCCGTGGGNONE 
013-056-G08AGCCGTTGGCCCGTGGGNONE 
AK059769AGCCGTTGGCCCGTGGGNONE 
AK068583AGCCGTTGGCCCGTGGGNONE 
AK072855AGCCGTTGGCCCGTGGGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGCCGTTGGCCCGTGGGNONE 
J023138P05AGCCGTTGGCCCGTGGGNONE 
J023143J07AGCCGTTGGCCCGTGGGNONE 
J033022O09AGCCGTTGGCCCGTGGGNONE 
J033111L02AGCCGTTGGCCCGTGGGNONE 
J033135O03AGCCGTTGGCCCGTGGGNONE 
J065005K19AGCCGTTGGCCCGTGGGNONE 
J065044C17AGCCGTTGGCCCGTGGGNONE 
J065116K09AGCCGTTGGCCCGTGGGNONE 
J065119O21AGCCGTTGGCCCGTGGGNONE 
J075014L05AGCCGTTGGCCCGTGGGNONE 
J075109H16AGCCGTTGGCCCGTGGGNONE 
J075117D04AGCCGTTGGCCCGTGGGNONE 
Os02g0672700AK059611CCCGTGGGDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179CCCGTGGGNONE 
J023098L23CCCGTGGGNONE 
J065042J21CCCGTGGGNONE 
J065187L09CCCGTGGGNONE 
J065190O10CCCGTGGGNONE 
J080041G14CCCGTGGGNONE 
J080078K08CCCGTGGGNONE 
J080089D20CCCGTGGGNONE 
J080094D04CCCGTGGGNONE 
Os02g0744000AK064898AGCCCACGGGConserved hypothetical protein. 
AK104827AGCCCACGGGNONE 
J013000L12AGCCCACGGGNONE 
J013156N02AGCCCACGGGNONE 
J065001H14AGCCCACGGGNONE 
J065038D18AGCCCACGGGNONE 
J065039I18AGCCCACGGGNONE 
J065047C13AGCCCACGGGNONE 
J065053J09AGCCCACGGGNONE 
J065064G03AGCCCACGGGNONE 
J065066M05AGCCCACGGGNONE 
J065068O10AGCCCACGGGNONE 
J065090H22AGCCCACGGGNONE 
J065113L19AGCCCACGGGNONE 
J065121M02AGCCCACGGGNONE 
J065122K23AGCCCACGGGNONE 
J065138C12AGCCCACGGGNONE 
J065153E14AGCCCACGGGNONE 
J065156N12AGCCCACGGGNONE 
J065158L20AGCCCACGGGNONE 
J065166I06AGCCCACGGGNONE 
J065174L15AGCCCACGGGNONE 
J065175N03AGCCCACGGGNONE 
J090092C23AGCCCACGGGNONE 
Os02g0771500006-096-D12CCCGTGGGACCCACNONE 
009-011-G02CCCGTGGGACCCACNONE 
AK062335CCCGTGGGACCCACNONE 
AK106018CCCGTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os03g0125800AK100164CCCACGGGNONE 
AK102496CCCACGGGProtein of unknown function DUF21 domain containing protein. 
Os03g0161000AK121425CCCCCACGGGTTTCGGCCNONE 
J023135K12CCCCCACGGGTTTCGGCCNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0199500J065099N05CCCGTGGGNONE 
J065152P14CCCGTGGGConserved hypothetical protein. 
J080009C14CCCGTGGGNONE 
J080011K01CCCGTGGGNONE 
J080015H12CCCGTGGGNONE 
J080022K05CCCGTGGGNONE 
J080034G01CCCGTGGGNONE 
J080038I04CCCGTGGGNONE 
J080039F20CCCGTGGGNONE 
J080042J22CCCGTGGGNONE 
J080042N23CCCGTGGGNONE 
J080043E07CCCGTGGGNONE 
J080050A12CCCGTGGGNONE 
J080050C11CCCGTGGGNONE 
J080052B01CCCGTGGGNONE 
J080052H22CCCGTGGGNONE 
J080060E02CCCGTGGGNONE 
J080063K24CCCGTGGGNONE 
J080067I07CCCGTGGGNONE 
J080081H22CCCGTGGGNONE 
J080085J10CCCGTGGGNONE 
J080089E20CCCGTGGGNONE 
J080092N04CCCGTGGGNONE 
J080093B01CCCGTGGGNONE 
J080093N04CCCGTGGGNONE 
J080097B03CCCGTGGGNONE 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0219200011-045-E01CCCGTGGGCNONE 
AK073785CCCGTGGGCSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CCCGTGGGCNONE 
J043009H23CCCGTGGGCNONE 
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE 
015-065-B06CCCACGGGCCCACCTNONE 
AK100399CCCACGGGCCCACCTNONE 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
J023086N09CCCACGGGCCCACCTNONE 
J100032P14CCCACGGGCCCACCTNONE 
Os03g0261800AK060717CCCCCACGGGNONE 
AK121181CCCCCACGGGConserved hypothetical protein. 
J023084D19CCCCCACGGGNONE 
J065127D11CCCCCACGGGNONE 
J065179G15CCCCCACGGGNONE 
J090050I07CCCCCACGGGNONE 
Os03g0275700AK111329CCCGTGGGConserved hypothetical protein. 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0298900006-028-C11CCCGTGGGACCCACNONE 
AK060996CCCGTGGGACCCACHypothetical protein. 
Os03g0336200AK059473CCCGTGGGCNONE 
AK070466CCCGTGGGCTranscription factor RF2b. 
AY466471CCCGTGGGCNONE 
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CCCGTGGGCCCCACNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0616300AK066372CCCACGGGSimilar to DNA polymerase kappa (EC 2.7.7.7) (DINB protein) (DINP). Splice isoform 4. 
AK102930CCCACGGGNONE 
J013064K08CCCACGGGNONE 
J013102J23CCCACGGGNONE 
J033114G19CCCACGGGNONE 
J075037A20CCCACGGGNONE 
J075131B16CCCACGGGNONE 
Os03g0701700011-034-E06CCCGTGGGCCACNONE 
AF013979CCCGTGGGCCACNONE 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK067813CCCGTGGGCCACNONE 
J013002C04CCCGTGGGCCACNONE 
J013035M07CCCGTGGGCCACNONE 
J013049B10CCCGTGGGCCACNONE 
J013065F11CCCGTGGGCCACNONE 
J013072K18CCCGTGGGCCACNONE 
J013073P08CCCGTGGGCCACNONE 
J013098F08CCCGTGGGCCACNONE 
J013154M13CCCGTGGGCCACNONE 
J023001H02CCCGTGGGCCACNONE 
J023003D16CCCGTGGGCCACNONE 
J023014P17CCCGTGGGCCACNONE 
J023036A22CCCGTGGGCCACNONE 
J023038N01CCCGTGGGCCACNONE 
J023042E11CCCGTGGGCCACNONE 
J023058O05CCCGTGGGCCACNONE 
J023084D05CCCGTGGGCCACNONE 
J023088O17CCCGTGGGCCACNONE 
J023138O11CCCGTGGGCCACNONE 
J023147A10CCCGTGGGCCACNONE 
J033029G18CCCGTGGGCCACNONE 
J033031N13CCCGTGGGCCACNONE 
J033090D09CCCGTGGGCCACNONE 
J033091I06CCCGTGGGCCACNONE 
J033096B20CCCGTGGGCCACNONE 
J033101A19CCCGTGGGCCACNONE 
J033135D03CCCGTGGGCCACNONE 
J043001L13CCCGTGGGCCACNONE 
J043020A13CCCGTGGGCCACNONE 
J053071K24CCCGTGGGCCACNONE 
J053092L14CCCGTGGGCCACNONE 
J053099F19CCCGTGGGCCACNONE 
J065009P22CCCGTGGGCCACNONE 
J065046A22CCCGTGGGCCACNONE 
J065099K22CCCGTGGGCCACNONE 
J065112O22CCCGTGGGCCACNONE 
J065119K11CCCGTGGGCCACNONE 
J065212B11CCCGTGGGCCACNONE 
J090022A11CCCGTGGGCCACNONE 
J090054F15CCCGTGGGCCACNONE 
J090076B20CCCGTGGGCCACNONE 
J090099M22CCCGTGGGCCACNONE 
J100032L01CCCGTGGGCCACNONE 
J100065H13CCCGTGGGCCACNONE 
Os03g0702000011-023-H12CCCACGGGNONE 
AK105398CCCACGGGNONE 
AK119905CCCACGGGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK121682CCCACGGGNONE 
J033070B15CCCACGGGNONE 
J033117B11CCCACGGGNONE 
Os03g0736300AK104929GGGACCCGTGGGGCNONE 
Os03g0737600014-094-E01CTCCCCCACGGGNONE 
AB038234CTCCCCCACGGGNONE 
AK101854CTCCCCCACGGGCyclin H-1. 
AK105468CTCCCCCACGGGNONE 
J033069N12CTCCCCCACGGGNONE 
J043017A22CTCCCCCACGGGNONE 
J065154A20CTCCCCCACGGGNONE 
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0854500012-067-H08CCCACGGGCCCCNONE 
AK100430CCCACGGGCCCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118CCCACGGGCCCCNONE 
AY344485CCCACGGGCCCCNONE 
J023088F14CCCACGGGCCCCNONE 
J100041G01CCCACGGGCCCCNONE 
J100046N19CCCACGGGCCCCNONE 
J100052O08CCCACGGGCCCCNONE 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0378200AK103076GGTCCCACGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGTCCCACGGGNONE 
J065065F15GGTCCCACGGGNONE 
J090080I24GGTCCCACGGGNONE 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
Os04g0504800AK064269CCCACGGGNONE 
AK067210CCCACGGGSimilar to Poly(A)-binding protein. 
Os04g0562000006-096-A05GCAGCCCACGGGNONE 
006-105-B08GCAGCCCACGGGNONE 
AK060894GCAGCCCACGGGNONE 
AK072630GCAGCCCACGGGZinc finger, DHHC-type domain containing protein. 
AK104521GCAGCCCACGGGNONE 
J023038A11GCAGCCCACGGGNONE 
J023130P03GCAGCCCACGGGNONE 
J090006F10GCAGCCCACGGGNONE 
J090007M22GCAGCCCACGGGNONE 
Os04g0579200AK100603GCCCCACGGGZinc finger, RING-type domain containing protein. 
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein. 
AK103942CCCACGGGGCCCACACNONE 
Os05g0121400AK099528CCCGTGGGNONE 
AK099528GCCCACGGGNONE 
Os05g0143800016-024-C02CCCGTGGGNONE 
AK106538CCCGTGGGGH3 auxin-responsive promoter family protein. 
J043020B18CCCGTGGGNONE 
J100025E03CCCGTGGGNONE 
Os05g0187100012-066-F01CCCGTGGGCNONE 
AK067988CCCGTGGGCSimilar to Hexokinase. 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0242600016-092-A07CCCGTGGGGCCCGCNONE 
AK107430CCCGTGGGGCCCGCPrefoldin domain containing protein. 
J065218C11CCCGTGGGGCCCGCNONE 
Os05g0295100AK100239CCCGTGGGGGCCCGProtein of unknown function DUF1253 family protein. 
AK100239GCCCCACGGGProtein of unknown function DUF1253 family protein. 
AK108559CCCGTGGGGGCCCGNONE 
AK108559GCCCCACGGGNONE 
Os05g0339300AK109898CCCACGGGConserved hypothetical protein. 
J065068I16CCCACGGGNONE 
J065194L19CCCACGGGNONE 
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE 
AK061141CCCGTGGGCCCCACCNONE 
AK070900CCCGTGGGCCCCACCNONE 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
J023098C13CCCGTGGGCCCCACCNONE 
J033032J06CCCGTGGGCCCCACCNONE 
J065014A09CCCGTGGGCCCCACCNONE 
J065121L01CCCGTGGGCCCCACCNONE 
J065130K19CCCGTGGGCCCCACCNONE 
J065208B21CCCGTGGGCCCCACCNONE 
J075080G14CCCGTGGGCCCCACCNONE 
J075135L01CCCGTGGGCCCCACCNONE 
J075180J15CCCGTGGGCCCCACCNONE 
Os05g0382600AK068231CCCGTGGGAnnexin family protein. 
J013147O19CCCGTGGGNONE 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK065288CCCGTGGGCCATNONE 
J013002M22CCCGTGGGCCATNONE 
Os05g0586600AB096011CCCGTGGGPlastid sigma factor SIG5. 
AB096071CCCGTGGGNONE 
AK105697CCCGTGGGNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0135340J065061D17CCCGTGGGNONE 
J065159A10CCCGTGGGConserved hypothetical protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0338900016-067-B02CCCGTGGGNONE 
AK100837CCCGTGGGNucleotidyl transferase domain containing protein. 
J013058L01CCCGTGGGNONE 
J013135N01CCCGTGGGNONE 
J023123E15CCCGTGGGNONE 
J033051J01CCCGTGGGNONE 
J090002O21CCCGTGGGNONE 
J090013F06CCCGTGGGNONE 
J090056F16CCCGTGGGNONE 
J090081G13CCCGTGGGNONE 
J090090P21CCCGTGGGNONE 
J100039F05CCCGTGGGNONE 
J100059J03CCCGTGGGNONE 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
Os06g0589500AK073322CCCGTGGGCCCCConserved hypothetical protein. 
J033030G15CCCGTGGGCCCCNONE 
J033148N18CCCGTGGGCCCCNONE 
Os06g0717600AK061850CCCACGGGNONE 
AK067113CCCACGGGZinc finger, RING-type domain containing protein. 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
006-038-C11TGCGGGCCCACCCACGGGNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02TGCGGGCCCACCCACGGGNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK070524TGCGGGCCCACCCACGGGRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK121382TGCGGGCCCACCCACGGGNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19TGCGGGCCCACCCACGGGNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02TGCGGGCCCACCCACGGGNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02TGCGGGCCCACCCACGGGNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08TGCGGGCCCACCCACGGGNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21TGCGGGCCCACCCACGGGNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01TGCGGGCCCACCCACGGGNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13TGCGGGCCCACCCACGGGNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14TGCGGGCCCACCCACGGGNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11TGCGGGCCCACCCACGGGNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17TGCGGGCCCACCCACGGGNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17TGCGGGCCCACCCACGGGNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20TGCGGGCCCACCCACGGGNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04TGCGGGCCCACCCACGGGNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15TGCGGGCCCACCCACGGGNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04TGCGGGCCCACCCACGGGNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09TGCGGGCCCACCCACGGGNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12TGCGGGCCCACCCACGGGNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21TGCGGGCCCACCCACGGGNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07TGCGGGCCCACCCACGGGNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16TGCGGGCCCACCCACGGGNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14TGCGGGCCCACCCACGGGNONE 
Os07g0184800AK059544CCCGTGGGCSimilar to Variant of histone H1. 
AK099050CCCGTGGGCNONE 
AK102642CCCGTGGGCNONE 
AK106132CCCGTGGGCNONE 
J023037O08CCCGTGGGCNONE 
J023050M02CCCGTGGGCNONE 
J023087A10CCCGTGGGCNONE 
J033027D14CCCGTGGGCNONE 
J033028N17CCCGTGGGCNONE 
J033043P10CCCGTGGGCNONE 
J033051D07CCCGTGGGCNONE 
J033073M07CCCGTGGGCNONE 
J033075H01CCCGTGGGCNONE 
J033084E04CCCGTGGGCNONE 
J033096D10CCCGTGGGCNONE 
J033100F04CCCGTGGGCNONE 
J033114B06CCCGTGGGCNONE 
J033117C10CCCGTGGGCNONE 
J033140B21CCCGTGGGCNONE 
J043034J07CCCGTGGGCNONE 
J065006F04CCCGTGGGCNONE 
J065130H16CCCGTGGGCNONE 
J075020G13CCCGTGGGCNONE 
J075108M17CCCGTGGGCNONE 
J080018A06CCCGTGGGCNONE 
J080037J11CCCGTGGGCNONE 
J080048F15CCCGTGGGCNONE 
J080057D16CCCGTGGGCNONE 
J080069A10CCCGTGGGCNONE 
J080086L09CCCGTGGGCNONE 
J080088A17CCCGTGGGCNONE 
J100046F24CCCGTGGGCNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0187300AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12CCCGTGGGCCGGANONE 
J033117P16CCCGTGGGCCGGANONE 
Os07g0205700AK120553CCCACGGGSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CCCACGGGNONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0422100013-054-G11GCCCACGGGNONE 
AK063592GCCCACGGGNONE 
J065165K10GCCCACGGGNONE 
J075021B01GCCCACGGGNONE 
J075087H22GCCCACGGGNONE 
J075118C10GCCCACGGGNONE 
J075134N03GCCCACGGGNONE 
J075151F23GCCCACGGGNONE 
U57639GCCCACGGGAWPM-19-like family protein. 
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein. 
Os07g0456700AK100891GCCCACGGGSimilar to (1,4)-beta-xylan endohydrolase (EC 3.2.1.8). 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0596600AK067238CCCGTGGGCCCCACCSimilar to Cdc2MsC protein. 
Os07g0605200AF091458CCCGTGGGCCCCACCGGGCCNONE 
AF139665CCCGTGGGCCCCACCGGGCCNONE 
AJ011675CCCGTGGGCCCCACCGGGCCNONE 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15CCCGTGGGCCCCACCGGGCCNONE 
J090034M06CCCGTGGGCCCCACCGGGCCNONE 
J090079L24CCCGTGGGCCCCACCGGGCCNONE 
Os07g0628500AK059560CCCGTGGGCNONE 
AK070963CCCGTGGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337CCCGTGGGCNONE 
J023068N18CCCGTGGGCNONE 
J023088M08CCCGTGGGCNONE 
J033072H21CCCGTGGGCNONE 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0690300012-048-A07GCCGGGCCCACGGGNONE 
AK099674GCCGGGCCCACGGGChromatin SPT2 family protein. 
J013028F12GCCGGGCCCACGGGNONE 
J013069F21GCCGGGCCCACGGGNONE 
J013104E17GCCGGGCCCACGGGNONE 
J013153M16GCCGGGCCCACGGGNONE 
J023012L09GCCGGGCCCACGGGNONE 
J023069A08GCCGGGCCCACGGGNONE 
J023132L23GCCGGGCCCACGGGNONE 
J033120P19GCCGGGCCCACGGGNONE 
J065173J03GCCGGGCCCACGGGNONE 
J075008H06GCCGGGCCCACGGGNONE 
J075043J15GCCGGGCCCACGGGNONE 
J075147I12GCCGGGCCCACGGGNONE 
J090041G07GCCGGGCCCACGGGNONE 
Os08g0113600006-048-G08CCCACGGGTCCCNONE 
AK061571CCCACGGGTCCCConserved hypothetical protein. 
Os08g0121900AK101512CCCGTGGGACCCACCTGTCProtein of unknown function DUF23 family protein. 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0490100009-038-D02CCCGTGGGCCCCNONE 
J065152E11CCCGTGGGCCCCSimilar to PBF protein. 
J090050K03CCCGTGGGCCCCNONE 
J090053L01CCCGTGGGCCCCNONE 
Os08g0493900AK101284CCCGGCCCACCCACGGGNONE 
AK111820CCCGGCCCACCCACGGGWD40-like domain containing protein. 
Os08g0560900AK120366GCCCACGGGNONE 
Os09g0344700J080011F14CCCACGGGNONE 
J080011G13CCCACGGGNONE 
J080016C06CCCACGGGNONE 
J080034K13CCCACGGGNONE 
J080043N08CCCACGGGNONE 
J080068E01CCCACGGGConserved hypothetical protein. 
J080068L12CCCACGGGNONE 
J080071N01CCCACGGGNONE 
J080075D11CCCACGGGNONE 
J080076D14CCCACGGGNONE 
J080093L23CCCACGGGNONE 
J080093N22CCCACGGGNONE 
Os09g0424600AK073882GCCCACGGGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0432900006-021-H10CCCGTGGGNONE 
006-054-E04CCCGTGGGNONE 
006-065-G01CCCGTGGGNONE 
009-191-C12CCCGTGGGNONE 
AK060938CCCGTGGGNONE 
AK106115CCCGTGGGGlycosyl transferase, family 31 protein. 
Os09g0438000AK109935GCCCACGGGNONE 
AK120739GCCCACGGGSimilar to RbohAOsp (Fragment). 
Os09g0450200AK068872AGCCCACGGGConserved hypothetical protein. 
J065013B14AGCCCACGGGNONE 
J065034F17AGCCCACGGGNONE 
J065039K11AGCCCACGGGNONE 
J065093N22AGCCCACGGGNONE 
J075034N13AGCCCACGGGNONE 
J075110O14AGCCCACGGGNONE 
J075122H04AGCCCACGGGNONE 
J075147B13AGCCCACGGGNONE 
J075149A02AGCCCACGGGNONE 
J075195L14AGCCCACGGGNONE 
Os09g0459900009-190-G09CCCACGGGNONE 
AK063208CCCACGGGCyclin-dependent kinase inhibitor family protein. 
AK111010CCCACGGGNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0486500006-062-H11CCCGTGGGNONE 
009-049-A11CCCGTGGGNONE 
009-070-D06CCCGTGGGNONE 
009-089-A10CCCGTGGGNONE 
009-107-D06CCCGTGGGNONE 
009-133-F02CCCGTGGGNONE 
009-142-A05CCCGTGGGNONE 
009-175-G07CCCGTGGGNONE 
013-044-C05CCCGTGGGNONE 
014-044-D10CCCGTGGGNONE 
AF140722CCCGTGGGNONE 
AK061067CCCGTGGGNONE 
AK070140CCCGTGGGNONE 
AK106128CCCGTGGGMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793CCCGTGGGNONE 
J023042G11CCCGTGGGNONE 
J053043H07CCCGTGGGNONE 
J053046N13CCCGTGGGNONE 
J053091K15CCCGTGGGNONE 
J053094I21CCCGTGGGNONE 
J053094N04CCCGTGGGNONE 
J053100D12CCCGTGGGNONE 
J053101K11CCCGTGGGNONE 
J065079H06CCCGTGGGNONE 
J100028D11CCCGTGGGNONE 
J100033A20CCCGTGGGNONE 
J100033F15CCCGTGGGNONE 
Os09g0528000AK072633GACAGGTGGGCCCCGTGGGNONE 
AK100918GACAGGTGGGCCCCGTGGGKinesin, motor region domain containing protein. 
Os09g0531200AK064107GCCCACGGGRNA recognition motif 2 domain containing protein. 
Os09g0558200016-083-C09CCCACGGGNONE 
AK068834CCCACGGGNONE 
AK103673CCCACGGGHomeodomain-like containing protein. 
J013159M18CCCACGGGNONE 
J065022I04CCCACGGGNONE 
J065089B19CCCACGGGNONE 
Os11g0219400AK069850CCCGTGGGCTGGAnkyrin repeat containing protein. 
AK099123CCCGTGGGCTGGNONE 
J023143G18CCCGTGGGCTGGNONE 
Os11g0247300AK105080GCCCCACGGGNONE 
Os11g0421800015-041-B05CCCGTGGGCCCCCACACNONE 
AK106317CCCGTGGGCCCCCACACConserved hypothetical protein. 
Os11g0461300006-094-F10CCCGTGGGCNONE 
AK061200CCCGTGGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os12g0118800011-036-G12CCCGTGGGNONE 
012-061-G07CCCGTGGGNONE 
012-091-B08CCCGTGGGNONE 
015-009-H09CCCGTGGGNONE 
016-011-C01CCCGTGGGNONE 
AK063302CCCGTGGGAnkyrin repeat containing protein. 
J013038D16CCCGTGGGNONE 
J013045F18CCCGTGGGNONE 
J023060C11CCCGTGGGNONE 
J065036C05CCCGTGGGNONE 
J065091H16CCCGTGGGNONE 
J065094G12CCCGTGGGNONE 
J065096C03CCCGTGGGNONE 
J065112M13CCCGTGGGNONE 
J065116D02CCCGTGGGNONE 
J065182B11CCCGTGGGNONE 
J100022K06CCCGTGGGNONE 
J100040P12CCCGTGGGNONE 
Os12g0241000AK068925CCCGTGGGCCGGGIojap-related protein family protein. 
J023001D05CCCGTGGGCCGGGNONE 
J065042C19CCCGTGGGCCGGGNONE 
J065081G23CCCGTGGGCCGGGNONE 
J065105M09CCCGTGGGCCGGGNONE 
J065163P20CCCGTGGGCCGGGNONE 
J065182L22CCCGTGGGCCGGGNONE 
Os12g0244500AK102026CCCGTGGGCConserved hypothetical protein. 
J023014D06CCCGTGGGCNONE 
J023060C12CCCGTGGGCNONE 
J033080M18CCCGTGGGCNONE 
J090017I22CCCGTGGGCNONE 
J090023D21CCCGTGGGCNONE 
J090036J05CCCGTGGGCNONE 
J090053M19CCCGTGGGCNONE 
Os12g0299700AK071145CCCGTGGGConserved hypothetical protein. 
J023082N05CCCGTGGGNONE 
Os12g0460800J023003J21CCCGTGGGTCCCACCNONE 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0554400AK072345CCCGTGGGTetratricopeptide-like helical domain containing protein. 
Os12g0557800AK121691CCAGCCCACGGGProtein prenyltransferase domain containing protein. 
J013095M03CCAGCCCACGGGNONE 
J033071H11CCAGCCCACGGGNONE 
J065101B02CCAGCCCACGGGNONE 
Os12g0601400009-057-A09GGGGCCCACGGGNONE 
AK073361GGGGCCCACGGGSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J065037G12GGGGCCCACGGGNONE 
J065099K06GGGGCCCACGGGNONE 
J065156F11GGGGCCCACGGGNONE 
J100025G04GGGGCCCACGGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.